Α Τ Υ Ο Τ Ο Ι Π Ι Λ Π Α Λ Σ Α ΙΑ Ι Ζ Α Ε Ζ ΤΑ Τ Ι

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Α Τ Υ Ο Τ Ο Ι Π Ι Λ Π Α Λ Σ Α ΙΑ Ι Ζ Α Ε Ζ ΤΑ Τ Ι"

Transcript

1 ΚΕΦΑΛΑΙΟ 2ο: Σελίδες ANTIΓΡΑΦΗ, ΕΚΦΡΑΣΗ & ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 1

2 O µηχανισµός µε τον οποίο το DNA αντιγράφεται χαρακτηρίζεται ηµισυντηρητικός Ο Watson και Crick φαντάστηκαν µια διπλή έλικα η οποία ξετυλίγεται και κάθε αλυσίδα λειτουργεί σαν καλούπι για την σύνθεση µιας νέας συµπληρωµατικής αλυσίδας ΤΟ DNA ΑΥΤΟ ΙΠΛΑΣΙΑΖΕΤΑΙ Τα δύο θυγατρικά µόρια που προκύπτουν είναι πανοµοιότυπα µε το µητρικό και το καθένα αποτελείται από µια παλιά και µια καινούρια αλυσίδα 2

3 ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΑ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Ο µηχανισµός της αντιγραφής έχει µελετηθεί πολύ περισσότερο στα προκαρυωτικά κύτταρα και κυρίως στην Escherichia coli Το DNA τους είναι πολύ µικρότερο και απλούστερα οργανωµένο από το DNA των ευκαρυωτικών κυττάρων Η αντιγραφή αρχίζει από καθορισµένα σηµεία που ονοµάζονται σηµεία έναρξης της αντιγραφής Το βακτηριακό DNA που είναι κυκλικό έχει µόνο µία θέση έναρξης της αντιγραφής Στο σηµείο έναρξης ξετυλίγεται η διπλή έλικα δηµιουργώντας µια «θηλιά» που αυξάνεται και προς τις δύο κατευθύνσεις Η διαδικασία ολοκληρώνεται σε λιγότερο από 30 min σε ευνοϊκές συνθήκες 3

4 ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΑ ΕΥΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Το DNA κάθε χρωµοσώµατος είναι ένα µακρύ γραµµικό δίκλωνο µόριο Έχει πολυάριθµες θέσεις έναρξης της αντιγραφής Στα σηµεία έναρξης ξετυλίγεται η διπλή έλικα δηµιουργώντας «θηλιές» που αυξάνονται και προς τις δύο κατευθύνσεις Έτσι αντιγράφεται ταυτόχρονα από εκατοντάδες σηµεία σε όλο το µήκος του και στη συνέχεια τα τµήµατα που δηµιουργούνται ενώνονται µεταξύ τους Αν και περίπου φορές µεγαλύτερο το DNA των ανώτερων ευκαρυωτικών οργανισµών από ότι των προκαρυωτικών αντιγράφεται πολύ γρήγορα 4

5 ΕΝΖΥΜΑ ΠΟΥ ΣHΜΜΕΤΕΧΟΥΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA Για να αρχίσει η αντιγραφή είναι απαραίτητο να ξετυλιχθούν οι δύο αλυσίδες στις θέσεις έναρξης της αντιγραφής Αυτό επιτυγχάνεται µε το ειδικό ένζυµο DNA-Ελικάση Ξετυλίγει την διπλή έλικα, σπάζει τους δεσµούς υδρογόνου µεταξύ των συµπληρωµατικών αζωτούχων βάσεων των δύο αλυσίδων Η διπλή έλικα ανοίγει και δηµιουργείται η θηλιά η οποία αυξάνεται και προς τις δύο κατευθύνσεις Οι θηλιές είναι ορατές µε το ηλεκτρονικό µικροσκόπιο 5

6 ΕΝΖΥΜΑ ΠΟΥ ΣHΜΜΕΤΕΧΟΥΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA Πριµόσωµα Ειδικό σύµπλοκο ενζύµων που αποτελείται από πολλά ένζυµα (πρωτεΐνες) Συνθέτει στις θέσεις έναρξης της αντιγραφής µικρά τµήµατα RNA που ονοµάζονται πρωταρχικά τµήµατα Το πριµόσωµα τοποθετεί συµπληρωµατικά ριβονουκλεοτίδια απέναντι από τις µητρικές αλυσίδες του DNΑ στις θέσεις έναρξης της αντιγραφής (µε προσανατολισµό 5 3 ) Τα ριβονουκλεοτίδια που τοποθετεί τα συνδέει µεταξύ τους µε 3 5 φωσφοδιεστερικό δεσµό 6

7 ΕΝΖΥΜΑ ΠΟΥ ΣHΜΜΕΤΕΧΟΥΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA DNA πολυµεράση Ένζυµο ανίκανο να αρχίσει την αντιγραφή του DNA Επιµηκύνουν τα πρωταρχικά τµήµατα τοποθετώντας 1 συµπληρωµατικά δεοξυριβονουκλεοτίδια απέναντι από τις µητρικές αλυσίδες του DNΑ (µε προσανατολισµό 5 3 ) Το πρώτο δεοξυριβονουκλεοτίδιο που τοποθετεί το συνδέει στο 3 ελεύθερο άκρο του πρωταρχικού τµήµατος µε 3-5 φωσφοδιεστερικό δεσµό Τα νέα µόρια DNA αρχίζουν να σχηµατίζονται καθώς δηµιουργούνται δεσµοί υδρογόνου µεταξύ των συµπληρωµατικών αζωτούχων βάσεων των δεοξυριβονουκλεοτιδίων 7

8 ΕΝΖΥΜΑ ΠΟΥ ΣHΜΜΕΤΕΧΟΥΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA DNA Πολυµεράση Επιδιορθώνουν λάθη που συµβαίνουν κατά την αντιγραφή 2 Βλέπουν και αποµακρύνουν νουκλεοτίδια που οι ίδιες τοποθέτησαν, κατά παράβαση του κανόνα της συµπληρωµατικότη τας και τοποθετούν τα σωστά Αποµακρύνουν τα πρωταρχικά τµήµατα RNA Τα αντικαθιστούν µε τµήµατα DNA 3 8

9 ΕΝΖΥΜΑ ΠΟΥ ΣHΜΜΕΤΕΧΟΥΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA Περιορισµοί λειτουργίας της DNA-πολυµεράσης Είναι ανίκανη να αρχίσει από µόνη της την αντιγραφή 1 Αυτό επιλύεται µε τη δηµιουργία του πρωταρχικού τµήµατος από το πριµόσωµα Έτσι δηµιουργείται µια υβριδική RNA- DNA αλυσίδα Η DNA πολυµεράση µπορεί να συνδέσει το πρώτο δεοξυριβονουκλεοτίδιο στο 3 ελεύθερο άκρο του πρωταρχικού τµήµατος µε 3-5 φωσφοδιεστερικό δεσµό 9

10 ΕΝΖΥΜΑ ΠΟΥ ΣHΜΜΕΤΕΧΟΥΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA Περιορισµοί λειτουργίας της DNA-πολυµεράσης Λειτουργεί µόνο προς καθορισµένη 2 κατεύθυνση και τοποθετεί νουκλεοτίδια στο ελεύθερο 3 άκρο κάθε αναπτυσσόµενης αλυσίδας Έτσι λέµε ότι η αντιγραφή γίνεται µε προσανατολισµό 5 3 Κάθε νέοσυντιθέµενη αλυσίδα θα έχει προσανατολισµό 5 3 Σε κάθε διπλή έλικα που παράγεται οι αλυσίδες θα είναι αντιπαράλληλες 10

11 ΣΥΝΕΧΗΣ & ΑΣΥΝΕΧΗΣ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA Η αντιγραφή γίνεται και προς τις δύο κατευθύνσεις από το σηµείο έναρξης της αντιγραφής H αντιγραφή γίνεται µε προσανατολισµό 5 3 και έτσι κάθε νεοσυντιθέµενη αλυσίδα θα έχει προσανατολισµό 5 3 Οι δύο αλυσίδες του µητρικού DNA είναι συµπληρωµατικές και αντιπαράλληλες µεταξύ τους Οι δύο νεοσυντηθέµενες θα πρέπει να είναι συµπληρωµατικές και αντιπαράλληλες των µητρικών τους Για να ακολουθηθεί αυτός ο κανόνας σε κάθε τµήµα του DNA που αντιγράφεται θα πρέπει η σύνθεση του DNA στη µια αλυσίδα να είναι συνεχής και ασυνεχής στην άλλη 11

12 ΕΝΖΥΜΑ ΠΟΥ ΣHΜΜΕΤΕΧΟΥΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA DNA δεσµάση Συνδέει µεταξύ τους τα κοµµάτια της ασυνεχούς αλυσίδας Συνδέει και όλα τα κοµµάτια που προκύπτουν από τις διάφορες θέσεις έναρξης της αντιγραφής 12

13 Η ΑΠΙΣΤΕΥΤΑ ΑΚΡΙΒHΣ AΝΤΙΓΡΑΦΗ ΤΟΥ DNA Οι DNA- πολυµεράσες επιδιορθώνουν λάθη που συµβαίνουν κατά την αντιγραφή Βλέπουν και αποµακρύνουν νουκλεοτίδια που οι ίδιες τοποθέτησαν, κατά παράβαση του κανόνα της συµπληρωµατικότητας και τοποθετούν τα σωστά Χάρη σε αυτήν την ιδιότητα µόνο 1 στα νουκλεοτίδια ενσωµατώνεται κατά παράβαση του κανόνα της συµπληρωµατικότητας Τα λάθη που δεν επιδιορθώνονται από τις DNA-πολυµεράσες πολυµεράσες, επιδιορθώνονται σε µεγάλο ποσοστό από τα επιδιορθωτικά ένζυµα Έτσι ο αριθµός του λάθους περιορίζεται στους ευκαρυωτικούς οργανισµούς στο 1 στα

14 ΡΟΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Κεντρικό δόγµα της µοριακής βιολογίας διατυπωµένο από τον F. Crick To DΝΑ ενός οργανισµού είναι ο µοριακός σκληρός δίσκος που περιέχει αποθηκευµένες ακριβείς οδηγίες οι οποίες καθορίζουν τη δοµή και λειτουργία του οργανισµού Το DNA περιέχει τις πληροφορίες για τον αντιγραφή του Έτσι εξασφαλίζεται η µεταβίβαση των γενετικών πληροφοριών από κύτταρο στα θυγατρικά του και από έναν οργανισµό στους απογόνους του 14

15 ΡΟΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Κεντρικό δόγµα Με τη διαδικασία της µεταγραφής Γίνεται το πρώτο βήµα για την έκφραση της πληροφορίας που υπάρχει στο DNA Η γενετική πληροφορία µεταφέρεται από το DNA στο RNA Με τη διαδικασία της µετάφρασης Το RNA µεταφέρει την πληροφορία στον τόπο παραγωγής των πρωτεϊνών η οποία καθορίζει τι είδους πρωτεΐνη θα παραχθεί Οι πρωτεΐνες είναι υπεύθυνες για τη δοµή και λειτουργία των κυττάρων και κατά επέκταση και των οργανισµών Όπως το διατύπωσε ο F. Crick to

16 ΡΟΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Κεντρικό δόγµα H γενετική πληροφορία υπάρχει σε τµήµατα του DNA τα γονίδια που έχουν ξεχωριστή ακολουθία αζωτούχων βάσεων το καθένα Τα γονίδια δια µέσου της µεταγραφής και µετάφρασης καθορίζουν τη σειρά των αµινοξέων στην πρωτεΐνη Οι πορείες της µεταγραφής και µετάφρασης των γονιδίων αποτελούν τη γονιδιακή έκφραση 16

17 ΡΟΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Το κεντρικό δόγµα της µοριακής βιολογίας όπως περιγράφεται σήµερα Για αρκετό καιρό οι ερευνητές πίστευαν ότι η ροή της γενετικής πληροφορίας γινόταν προς µια µόνο κατεύθυνση Σήµερα είναι γνωστό ότι µερικοί ιοί έχουν RNA ως γενετικό υλικό Σε αυτούς τους ιούς υπάρχει ένα ένζυµο η αντίστροφη µεταγραφάση Ένζυµο που καταλύει την αντίστροφη µεταγραφή δηλαδή χρησιµοποιεί ως καλούπι το RNA για να συνθέσει DNA Αντίστροφη µεταγραφή Σε ορισµένους ιούς το RNA έχει την ικανότητα να αυτοδιπλασιάζεται 17

18 ΙΑΚΡΙΣΗ ΤΩΝ ΓΟΝΙ ΙΩΝ ΣΕ ΥΟ ΚΑΤΗΓΟΡΙΕΣ Όλα τα κύτταρα ενός οργανισµού έχουν το ίδιο DNA αλλά σε κάθε οµάδα κυττάρων εκφράζονται διαφορετικά γονίδια Τα γονίδια διακρίνονται σε δυο κατηγορίες: Σε αυτά που µεταγράφονται σε m-rna και µεταφράζονται στη συνέχεια σε πρωτεΐνες Σε αυτά που µεταγράφονται και δεν µεταφράζονται: t-rna r-rna sn-rna 18

19 Υπάρχουν 4 είδη µορίων RNA που παράγονται µε τη µεταγραφή Αγγελιοφόρο RNA (m-rna) Μεταφέρουν την πληροφορία του DNA στο κυτταρόπλασµα στον τόπο παραγωγής των πρωτεϊνών για να παραχθούν οι πρωτεΐνες Παράγεται τόσο από τους προκαρυωτικούς όσο και από τους ευκαρυωτικούς οργανισµούς ΕΙ Η ΜΟΡΙΩΝ RNA 19

20 Υπάρχουν 4 είδη µορίων RNA που παράγονται µε τη µεταγραφή Ριβοσωµικό RNA (r-rna) Τα µόρια r-rna συνδέονται µε πρωτεΐνες και σχηµατίζουν τα ριβοσώµατα Οργανίδια παραγωγής των πρωτεϊνών Παράγεται τόσο από τους προκαρυωτικούς όσο και από τους ευκαρυωτικούς οργανισµούς ΕΙ Η ΜΟΡΙΩΝ RNA 20

21 Υπάρχουν 4 είδη µορίων RNA που παράγονται µε τη µεταγραφή Μεταφορικό t-rna ιαθέτει µια ειδική θέση σύνδεσης µε ένα συγκεκριµένο αµινοξύ και το µεταφέρει στη θέση της πρωτεïνοσύνθεσης Έχει και µια ειδική τριπλέτα νουκλεοτιδίων το αντικωδικόνιο που παίζει σηµαντικό ρόλο κατά τη µετάφραση Παράγεται τόσο από τους προκαρυωτικούς όσο και από τους ευκαρυωτικούς οργανισµούς ΕΙ Η ΜΟΡΙΩΝ RNA 21

22 Υπάρχουν 4 είδη µορίων RNA που παράγονται µε τη µεταγραφή Μικρό πυρηνικό RNA (sn-rna) Μικρά µόρια RNA που συνδέονται µε πρωτεΐνες και σχηµατίζουν µικρά ριβονουκλεοπρωτεïνικά νικά σωµατίδια Παράγεται ΜΟΝΟ από τους ευκαρυωτικούς οργανισµούς Αυτά τα σωµατίδια καταλύουν την ωρίµανση m-rna που πραγµατοποιείται µόνο στους ευκαρυωτικούς οργανισµούς ΕΙ Η ΜΟΡΙΩΝ RNA 22

23 ΓΕΝΙΚΟΣ ΜΗΧΑΝΙΣΜΟΣ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ Ο µηχανισµός της µεταγραφή είναι ο ίδιος στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισµούς Η µεταγραφή καταλύεται από το ένζυµο RNA πολυµεράση (οι ευκαρυωτικοί έχουν 3 είδη) H RNA πολυµεράση προσδένεται σε ειδικές περιοχές του DNA που ονοµάζονται υποκινητές Ο υποκινητής είναι πάντα πριν από την αρχή κάθε γονιδίου Η RNA πολυµεράση συνδέεται στον υποκινητή µε τη βοήθεια πρωτεϊνών, τους µεταγραφικούς παράγοντες 23

24 ΓΕΝΙΚΟΣ ΜΗΧΑΝΙΣΜΟΣ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ Ο µηχανισµός της µεταγραφή είναι ο ίδιος στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισµούς Ο υποκινητής και οι µεταγραφικοί παράγοντες αποτελούν: Tα ρυθµιστικά στοιχεία της µεταγραφής του DNA Επιτρέπουν στην RNA πολυµεράση να αρχίσει σωστά τη µεταγραφή 24

25 ΓΕΝΙΚΟΣ ΜΗΧΑΝΙΣΜΟΣ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ Μεταγραφή ενός γονιδίου 1 Η RNA-πολυµεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγµα της διπλής έλικας του DNA 2 Τοποθετεί συµπληρωµατικά ριβονουκλεοτίδια απέναντι από τα δεοξυριβονουκλεοτίδια της µιας αλυσίδας του DNA σύµφωνα µε τον κανόνα της συµπληρωµατικότητας των βάσεων Απέναντι από την: Α τοποθετεί U Τ τοποθετεί Α G τοποθετεί C C τοποθετεί G 3 Τα ριβονουκλεοτίδια που προσθέτει το ένα µετά το άλλο τα συνδέει µε 3-5 φωσφοδιεστερικό δεσµό 25

26 ΓΕΝΙΚΟΣ ΜΗΧΑΝΙΣΜΟΣ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ Μεταγραφή ενός γονιδίου Η µεταγραφή γίνεται µε προσανατολισµό 5 3 όπως και η αντιγραφή 4 Η σύνθεση του RNA σταµατά στο τέλος του γονιδίου Στο τέλος κάθε γονιδίου υπάρχουν ειδικές αλληλουχίες οι οποίες ονοµάζονται αλληλουχίες λήξης της µεταγραφής Αυτές επιτρέπουν την απελευθέρωση του παραγόµενου RNA στο κυτταρόπλασµα 26

27 ΓΕΝΙΚΟΣ ΜΗΧΑΝΙΣΜΟΣ ΤΗΣ ΜΕΤΑΓΡΑΦΗΣ Το µόριο του RNA που συντίθεται είναι συµπληρωµατικό προς τη µία αλυσίδα της διπλής έλικας του DNA του γονιδίου Η µεταγραφόµενη αλυσίδα της διπλής έλικας του DNA του γονιδίου ονοµάζεται µη κωδική και είναι συµπληρωµατική του παραγόµενου RNA Η συµπληρωµατική αλυσίδα της διπλής έλικας του DNA του γονιδίου που δεν µεταγράφεται ονοµάζεται κωδική Το RNA είναι το κινητό αντίγραφο της πληροφορίας του γονιδίου 27

28 ΤΟ ΜΟΡΙΟ m-rna ΕΙΝΑΙ ΣΥΜΠΛΗΡΩΜΑΤΙΚΟ ΠΡΟΣ ΤΗ ΜΗ ΚΩ ΙΚΗ ΑΛΥΣΙ Α ΤΟΥ DNA TOY ΓΟΝΙ ΙΟΥ 28

29 ΓΟΝΙ ΙΑΚΗ ΕΚΦΡΑΣΗ ΣΤΟΥΣ ΠΡΟΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Η µεταγραφή και η µετάφραση γίνεται στον ίδιο χώρο την ίδια χρονική στιγµή Τα βακτήρια που είναι πρωκαρυωτικά κύτταρα δεν έχουν πυρήνα Πριν ολοκληρωθεί η µεταγραφή του m-rna αρχίζει να µεταφράζεται σε πρωτεΐνη Αυτό έχει σαν αποτέλεσµα η γονιδιακή έκφραση στους προκαρυωτικούς οργανισµούς να διαρκεί λιγότερο σε σχέση µε εκείνη στους ευκαρυωτικούς 29

30 ΓΟΝΙ ΙΑΚΗ ΕΚΦΡΑΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Η µεταγραφή και η µετάφραση γίνεται σε διαφορετικό χώρο και σε διαφορετική χρονική στιγµή Τα ευκαρυωτικά κύτταρα παρουσιάζουν διαµερισµατοποίηση, έχουν πυρήνα Η µεταγραφή γίνεται στον πυρήνα Στον πυρήνα το m-rna που παράγεται χαρακτηρίζεται πρόδροµο και δεν είναι έτοιµο να µεταφραστεί αλλά υφίσταται µια διαδικασία την ωρίµανση Στη συνέχεια το ώριµο m-rna µεταφέρεται από τον πυρήνα στο κυτταρόπλασµα και ειδικότερα στο ριβοσώµατα όπου είναι η θέση της πρωτεïνοσύνθεσης 30

31 ΑΣΝΕΧΗ Ή ΙΑΚΕΚΟΜΜΕΝΑ ΓΟΝΙ ΙΑ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Τα περισσότερα γονίδια των ευκαρυωτικών οργανισµών και των ιών που τους προσβάλουν είναι ασυνεχή ή διακεκοµµένα Η αλληλουχία που µεταφράζεται σε αµινοξέα διακόπτεται από ενδιάµεσες αλληλουχίες οι οποίες δεν µεταφράζονται σε αµινοξέα Οι αλληλουχίες που µεταφράζονται σε αµινοξέα ονοµάζονται εξώνια Οι ενδιάµεσες αλληλουχίες που δεν µεταφράζονται σε αµινοξέα ονοµάζονται εσώνια 31

32 ΩΡIΜΑΝΣΗ ΤΩΝ ΠΡΟ ΡΟΜΩΝ m-rna ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Κατά τη µεταγραφή ενός ασυνεχούς γονιδίου δηµιουργείται το πρόδροµο m-rna που περιέχει και εξώνια και εσώνια Αυτό θα υποστεί ωρίµανση κατά την οποία τα εσώνια κόβονται από τα ριβονουκλεοπρωτεϊνικά σωµατίδια και αποµακρύνονται Τα ριβονουκλεοπρωτεϊνικά σωµατίδια αποτελούνται από: sn-rna και πρωτεΐνες Λειτουργούν ως ένζυµα κόβουν τα εσώνια και συρράπτουν τα εξώνια µεταξύ τους Με αυτό τον τρόπο σχηµατίζεται το ώριµο m-rna 32

33 Το ώριµο m-rna αποτελείται αποκλειστικά από εξώνια και δύο περιοχές που δεν µεταφράζονται σε αµινοξέα Την 5 και 3 αµετάφραστη περιοχή Η µία βρίσκεται στο 5 άκρο και η άλλη στο 3 άκρο του ώριµου m-rna Το ώριµο m-rna µεταφέρεται από τον πυρήνα στο κυτταρόπλασµα και ειδικότερα στα ριβοσώµατα όπου είναι η θέση της πρωτεϊνοσύνθεσης ΩΡIΜΑΝΣΗ ΤΩΝ ΠΡΟ ΡΟΜΩΝ m-rna ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 33

34 Είναι η αντιστοίχηση τριπλετών βάσεων σε αµινοξέα Με τη µεταγραφή η πληροφορία που βρίσκονταν στο γονίδιο µεταφέρθηκε στο m-rna µε βάση τη συµπληρωµατικότητα Η αλληλουχία των αζωτούχων βάσεων στο m-rna καθορίζει την αλληλουχία των αµινοξέων στις πρωτεΐνες Με βάση το γενετικό κώδικα που είναι ένας κώδικας αντιστοίχισης νουκλεοτιδίων του m-rna µε αµινοξέα της πρωτεΐνης O ΓΕΝΕΤΙΚΟΣ ΚΩ ΙΚΑΣ 34

35 Τα διαφορετικά αµινοξέα που συγκροτούν τις πρωτεΐνες είναι 20 Ο αριθµός των διαφορετικών νουκλεοτιδίων που συγκροτούν το RNA είναι 4 O ΓΕΝΕΤΙΚΟΣ ΚΩ ΙΚΑΣ Αν τα τέσσερα νουκλεοτίδια συνδυαστούν ανά ένα 1 4 =4 δίνουν 4 διαφορετικούς συνδυασµούς νουκλεοτιδίων που κωδικοποιούν µόνο 4 από τα είκοσι αµινοξέα Αν τα τέσσερα νουκλεοτίδια συνδυαστούν ανά δύο 2 4 =16 δίνουν 16 διαφορετικούς συνδυασµούς νουκλεοτιδίων που κωδικοποιούν µόνο 16 από τα είκοσι αµινοξέα 35

36 Θεωρήθηκε πιθανό ότι τρία νουκλεοτίδια αντιστοιχούν σε ένα αµινοξύ Για αυτό ο γενετικός κώδικας ονοµάστηκε κώδικας τριπλέτας Αν τα τέσσερα νουκλεοτίδια συνδυαστούν ανά τρία 3 4 =64 δίνουν 64 διαφορετικούς συνδυασµούς νουκλεοτιδίων που είναι παραπάνω από αρκετοί Από τις 64 τριπλέτες µόνο οι 61 κωδικοποιούν αµινοξέα Υπάρχουν διαφορετικές τριπλέτες που κωδικοποιούν το ίδιο αµινοξύ O ΓΕΝΕΤΙΚΟΣ ΚΩ ΙΚΑΣ 36

37 ΒΑΣΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΚΩ ΙΚΑ Ο γενετικός κώδικας είναι κώδικας τριπλέτας Μια τριάδα νουκλεοτιδίων, το κωδικόνιο κωδικοποιεί ένα αµινοξύ 37

38 ΒΑΣΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΚΩ ΙΚΑ Ο γενετικός κώδικας είναι συνεχής Το m-rna διαβάζεται συνεχώς ανά τρία νουκλεοτίδια (ανά κωδικόνιο) χωρίς να παραλείπεται κάποιο νουκλεοτίδιο Ο γενετικός κώδικας είναι µη επικαλυπτόµενος Το κάθε νουκλεοτίδιο ανήκει σε ένα µόνο κωδικόνιο 38

39 ΒΑΣΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΚΩ ΙΚΑ Ο γενετικός κώδικας είναι σχεδόν καθολικός Όλοι οι οργανισµοί έχουν τον ίδιο γενετικό κώδικα Το m-rna από οποιονδήποτε οργανισµό µπορεί να µεταφραστεί σε εκχυλίσµατα φυτικών, ζωικών ή βακτηριακών κυττάρων in vitro και να παραγάγει την ίδια πρωτεΐνη 39

40 ΒΑΣΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΚΩ ΙΚΑ Ο γενετικός κώδικας είναι εκφυλισµένος Με εξαίρεση τη µεθειονίνη και την τρυπτοφάνη που κωδικοποιούνται από ένα κωδικόνιο 6 τα υπόλοιπα 18 αµινοξέα κωδικοποιούνται από 2 µέχρι και 6 διαφορετικά κωδικόνια 6 Τα κωδικόνια που κωδικοποιούν το ίδιο αµινοξύ ονοµάζονται συνώνυµα

41 ΒΑΣΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΚΩ ΙΚΑ Ο γενετικός κώδικας έχει κωδικόνιο έναρξης και κωδικόνια λήξης Το κωδικόνιο έναρξης σε όλους τους οργανισµούς είναι το ΑUG και κωδικοποιεί το αµινοξύ µεθειονίνη Υπάρχουν 3 κωδικόνια λήξης: UAG, UGA, UAA Η παρουσία αυτών στο µόριο m-rna οδηγεί στον τερµατισµό της σύνθεσης της πολυπεπτιδικής αλυσίδας 41

42 OΡOΣ ΚΩ ΙΚΟΝΙΟ εν αφορά µόνο τις τριπλέτες των αζωτούχων βάσεων στο m-rna Αφορά και τις τριπλέτες των αζωτούχων βάσεων του γονιδίου από το οποίο παράγεται Το κωδικόνιο έναρξης του m-rna ΑUG αντιστοιχεί στο κωδικόνιο έναρξης της µη κωδικής αλυσίδας του γονιδίου το ΤΑC Αντιστοιχεί και στο κωδικόνιο έναρξης της κωδικής αλυσίδας του γονιδίου το ΑΤG Πριν από το κωδικόνιο ΤAC θα είναι πάντα το 3 άκρο την µη κωδικής αλυσίδας του γονιδίου Πριν από το κωδικόνιο ΑΤG θα είναι πάντα το 5 άκρο την κωδικής αλυσίδας του γονιδίου 42

43 Το τµήµα ενός m-rna που κωδικοποιεί µια πολυπεπτιδική αλυσίδα: Αρχίζει µε το κωδικόνιο έναρξης και τελειώνει µε το κωδικόνιο λήξης OΡOΣ ΚΩ ΙΚΟΝΙΟ Το τµήµα ενός γονιδίου που κωδικοποιεί µια πολυπεπτιδική αλυσίδα: Αρχίζει µε το κωδικόνιο έναρξης και τελειώνει µε το κωδικόνιο λήξης 43

44 Μετάφραση του m- RNA ΜΕΤΑΦΡΑΣΗ Η αντιστοίχιση των κωδικονίων σε αµινοξέα και η διαδοχική σύνδεση των αµινοξέων σε πολυπεπτιδική αλυσίδα Πραγµατοποιείται στα ριβοσώµατα µε τη βοήθεια: t-rna Συµµετοχή αρκετών πρωτεϊνών Ενέργειας Τα ριβοσώµατα µπορούν να χρησιµοποιηθούν ως θέση µετάφρασης για οποιοδήποτε m-rna 44

45 ΟΜΗ ΡΙΒΟΣΩΜΑΤΩΝ & t-rna Κάθε ριβόσωµα αποτελείται από δύο υποµονάδες µια µικρή και µία µεγάλη Η µικρή υποµονάδα έχει µία θέση πρόσδεσης του m-rna Η µεγάλη υποµονάδα έχει δύο θέσεις εισδοχής των t-rna Κάθε t-rna έχει µια ειδική θέση σύνδεσης και µια ειδική τριπλέτα νουκλεοτιδίων Το t-rna διαθέτει µια ειδική θέση σύνδεσης µε ένα συγκεκριµένο αµινοξύ Το t-rna έχει µία ειδική τριπλέτα νουκλεοτιδίων το αντικωδικόνιο Συνδέεται µε δεσµούς υδρογόνου µε το συµπληρωµατικό κωδικόνιο του m-rna 45

46 Σύµπλοκο έναρξης πρωτεïνοσύνθεσης Μια αλληλουχία που υπάρχει στην 5 αµετάφραστη περιοχή του m-rna προσδένεται µε το r-rna της µικρής υποµονάδας του ριβοσώµατος σύµφωνα µε τον κανόνα της συµπληρωµατικότητας Με αυτό τον τρόπο καθορίζεται και ο 5 3 προσανατολισµός της µετάφρασης Το πρώτο κωδικόνιο του m-rna είναι πάντα το AUG και σε αυτό προσδένεται το t-rna που φέρει τη µεθειονίνη ΕΝΑΡΞΗ ΤΗΣ ΜΕΤΑΦΡΑΣΗΣ 46

47 Σύµπλοκο έναρξης της πρωτεïνοσύνθεσης Ονοµάζεται το σύµπλοκο που δηµιουργείται µετά την πρόσδεση: Tου m-rna στη µικρή υποµονάδα του ριβοσώµατος και του t-rna που µεταφέρει την µεθειονίνη Στη συνέχεια η µεγάλη υποµονάδα του ριβοσώµατος συνδέεται µε τη µικρή ΕΝΑΡΞΗ ΤΗΣ ΜΕΤΑΦΡΑΣΗΣ 47

48 Ένα δεύτερο t-rna µε αντικωδικόνιο συµπληρωµατικό του δευτέρου κωδικονίου του m-rna τοποθετείται στην κατάλληλη εισδοχή του ριβοσώµατος µεταφέροντας το 2ο αµινοξύ Μεταξύ της µεθειονίνης και του δευτέρου αµινοξέος σχηµατίζεται πεπτιδικός δεσµός Το πρώτο t-rna αποσυνδέεται από το ριβόσωµα και απελευθερώνεται στο κυτταρόπλασµα όπου συνδέεται πάλι µε µεθειονίνη για να είναι έτοιµο για επόµενη χρήση Το ριβόσωµα και το m-rna έχουν ένα t-rna στο οποίο είναι προσδεµένα δύο αµινοξέα ΕΠΙΜΗΚYΝΣΗ 48

49 Το ριβόσωµα κινείται κατά µήκος του m-rna κατά ένα κωδικόνιο Ένα τρίτο t-rna εισέρχεται να προσδεθεί µεταφέροντας το αµινοξύ του Ανάµεσα στο 2ο και στο 3ο αµινοξύ σχηµατίζεται πεπτιδικός δεσµός Η πολυπεπτιδική αλυσίδα συνεχίζει να αναπτύσσεται καθώς νέα t-rna µεταφέρουν αµινοξέα τα οποία συνδέονται µεταξύ τους ΕΠΙΜΗΚYΝΣΗ 49

50 H επιµήκυνση σταµατά σε ένα από τα κωδικόνια λήξης (UAA, UGA, UAG) ΛΗΞΗ Επειδή δεν υπάρχουν t- RNA που να αντιστοιχούν σε αυτά Το τελευταίο t-rna αποµακρύνεται από το ριβόσωµα και η πολυπεπτιδική αλυσίδα απελευθερώνεται εν έχουν όλες οι πρωτεΐνες του οργανισµού ως πρώτο αµινοξύ µεθειονίνη Σε πολλές πρωτεΐνες µετά τη σύνθεση τους αποµακρύνονται ορισµένα αµινοξέα από το αρχικό αµινικό άκρο 50

51 Είναι ένα σύµπλεγµα ριβοσωµάτων µε ένα m-rna Πολλά ριβοσώµατα µπορούν να µεταφράζουν ταυτόχρονα ένα m-rna το καθένα σε διαφορετικό σηµείο κατά µήκος του µορίου του m-rna Μόλις το ριβόσωµα έχει µεταφράσει τα πρώτα κωδικόνια η θέση έναρξης του m-rna είναι ελεύθερη για την πρόσδεση ενός άλλου ριβοσώµατος Η πρωτεϊνοσύνθεση είναι οικονοµική διαδικασία Ένα κύτταρο µπορεί να παράγει µεγάλα ποσά µιας πρωτεΐνης από 1 ή από 2 αντίγραφα ενός γονιδίου ΠΟΛΥΣΩΜΑΤΑ 51

52 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ:Ο ΕΛΕΓΧΟΣ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ Γονιδιακή έκφραση αναφέρεται σε όλη τη διαδικασία µε την οποία ένα γονίδιο ενεργοποιείται για να παράγει µια πρωτεΐνη Οι πορεία της µεταγραφής και µετάφρασης του γονιδίου αποτελούν τη γονιδιακή έκφραση Σε κάθε κύτταρο δεν παράγονται όλες οι πρωτεΐνες σε κάθε χρονική στιγµή Οι πρωτεΐνες ενός κυττάρου δεν παράγονται σε ίσες ποσότητες γιατί το κύτταρο χρειάζεται κάθε πρωτεΐνη σε συγκεκριµένη ποσότητα Για αυτό είναι απαραίτητη η ύπαρξη και λειτουργία ενός προγράµµατος ρύθµισης της γονιδιακής έκφρασης 52

53 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ:Ο ΕΛΕΓΧΟΣ ΤΗΣ ΓΟΝΙ ΙΑΚΗΣ ΕΚΦΡΑΣΗΣ Πρόγραµµα ρύθµισης της γονιδιακής έκφρασης Παρέχει τις οδηγίες: Για τo είδος των πρωτεϊνών που θα παραχθούν Την ποσότητα των πρωτεϊνών που θα παραχθούν Τη χρονική στιγµή που πρέπει να παραχθούν 53

54 ΚΥΤΤΑΡΙΚΗ ΙΑΦΟΡΟΠΟΙΗΣΗ Τα κύτταρα που ανήκουν σε ένα βακτηριακό στέλεχος είναι πανοµοιότυπα µεταξύ τους Σε αντίθεση µε τα κύτταρα ενός πολυκύτταρου οργανισµού που διαφέρουν στη δοµή και στη λειτουργία τους Η ζωή αρχίζει όταν ένα γονιµοποιηµένο ωάριο διαιρείται µε µίτωση και παράγει τρισεκατοµµύρια κύτταρα που έχουν τα ίδια γονίδια Στα αρχικά στάδια της εµβρυογένεσης τα κύτταρα εξειδικεύονται για να εκτελούν επιµέρους λειτουργίες Η διαδικασία αυτή ονοµάζεται Κυτταρική διαφοροποίηση 54

55 Τα κύτταρα ενός πολυκύτταρου οργανισµού (όπως νευρικά, µυϊκά, ηπατικά) διαφέρουν στη µορφή και λειτουργία τους αλλά έχουν όλα το ίδιο γενετικό υλικό άρα και τα ίδια γονίδια ΚΥΤΤΑΡΙΚΗ ΙΑΦΟΡΟΠΟΙΗΣΗ Τι τα κάνει να διαφέρουν τόσο πολύ; Έχουν αναπτύξει µηχανισµούς που τους επιτρέπει να εκφράζουν τη γενετική τους πληροφορία επιλεκτικά Κάθε κυτταρικός τύπος έχει εξειδικευµένη λειτουργία και πρέπει να υπάρχει πλήρης συντονισµός των λειτουργιών όλων των κυττάρων 55

56 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Λόγω της πολυπλοκότητας των ευκαρυωτικών κυττάρων Λόγω ότι πρέπει να ελέγχεται προσεκτικά η ανάπτυξη των πολυκύτταρων οργανισµών Η ρύθµιση της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα γίνεται µε ιδιαίτερα πολύπλοκους µηχανισµούς Μέχρι και σήµερα αποτελεί αντικείµενο ερευνητικής µελέτης Η γονιδιακή έκφραση ρυθµίζεται σε 4 επίπεδα: Της µεταγραφής Μετά τη µεταγραφή Της µετάφρασης Μετά τη µετάφραση 56

57 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Στο επίπεδο της µεταγραφής Ένας αριθµός µηχανισµών ελέγχουν ποια γονίδια και µε ποια ταχύτητα θα µεταγραφούν Το κάθε γονίδιο έχει το δικό του υποκινητή και µεταγράφεται αυτόνοµα Κάθε κυτταρικός τύπος περιέχει διαφορετικά είδη µεταγραφικών παραγόντων µιας που παρουσιάζουν µεγάλη ποικιλία ιαφορετικός συνδυασµός µεταγραφικών παραγόντων ρυθµίζει τη µεταγραφή κάθε γονιδίου Μόνο όταν ο σωστός συνδυασµός των µεταγραφικών παραγόντων µοναδικός για κάθε γονίδιο προσδεθεί στον υποκινητή αρχίζει η RΝΑ πολυµεράση τη µεταγραφή του γονιδίου 57

58 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Στο επίπεδο µετά τη µεταγραφή Περιλαµβάνονται µηχανισµοί: Με τους οποίους γίνεται η ωρίµανση του πρόδροµου m-rna Και καθορίζεται η ταχύτητα µε την οποία το ώριµο m RNA αφήνει τον πυρήνα και εισέρχεται στο κυτταρόπλασµα 58

59 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Στο επίπεδο της µετάφρασης Το κάθε m-rna στο κυτταρόπλασµα έχει ένα συγκεκριµένο χρονικό διάστηµα «ζωής» µετά από αυτό αποικοδοµούνται Ποικίλει η ικανότητα πρόσδεσης του m-rna στα ριβοσώµατα 59

60 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΕΥΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Στο επίπεδο µετά τη µετάφραση Όταν ολοκληρωθεί η µετάφραση και παραχθεί η κατάλληλη πρωτεΐνη µπορεί και πρέπει να υποστεί τροποποιήσεις για να γίνει βιολογικά λειτουργική Μπορεί να αποµακρυνθούν ορισµένα αµινοξέα από το αρχικό αµινικό τους άκρο Έτσι εξηγείται γιατί οι περισσότερες πρωτεΐνες δεν έχουν ως πρώτο αµινοξύ τη µεθειονίνη 60

61 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΠΡΟΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Στα βακτήρια η γονιδιακή ρύθµιση αποσκοπεί κυρίως στην προσαρµογή του οργανισµού στις εναλλαγές του περιβάλλοντος Έτσι εξασφαλίζονται καλύτερες συνθήκες για τη βασική λειτουργία του: Θρεπτικά συστατικά, ph, Παρουσία ή απουσία Ο2, θερµοκρασία Που είναι η αύξηση και διαίρεση 61

62 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΠΡΟΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Ένα βακτηριακό κύτταρο Ε. Coli έχει περισσότερα από γονίδια Μερικά γονίδια µεταγράφονται συνεχώς και κωδικοποιούν πρωτεΐνες που χρειάζεται για τις βασικές του λειτουργίες Άλλα µεταγράφονται µόνο όταν αναπτύσσεται σε ειδικές περιβαλλοντικές συνθήκες Επειδή τα προϊόντα των γονιδίων (πρωτεΐνες) είναι απαραίτητα για την επιβίωση του στις συνθήκες αυτές 62

63 ΓΟΝΙ ΙΑΚΗ ΡΥΘΜΙΣΗ ΣΤΟΥΣ ΠΡΟΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Βακτήρια Ε. Coli Χρησιµοποιούν ως πηγή άνθρακα για την επιβίωση τους το σάκχαρο γλυκόζη Αν στο περιβάλλον τους αντί για γλυκόζη υπάρχει ο δισακχαρίτης λακτόζη τα βακτήρια καταφέρνουν να επιβιώσουν Ρυθµίζουν την παραγωγή των κατάλληλων ενζύµων που θα διασπάσουν τη λακτόζη σε γλυκόζη και γαλακτόζη 63

64 ΜΕΛΕΤΕΣ ΓΙΑ ΤΗ ΡΥΘΜΙΣΗ ΤΩΝ ΓΟΝΙ ΙΩΝ Οι αρχικές µελέτες της ρύθµισης των γονιδίων έγιναν από τους Jacob & Monod το 1961 Οι ερευνητές περιέγραψαν την ικανότητα του βακτηρίου Ε. Coli να παράγει τρία ένζυµα που χρειάζεται για να µεταβολίσει το δισακχαρίτη λακτόζη όταν δεν υπάρχει γλυκόζη στη τροφή του Απέδειξαν µε γενετικές µελέτες ότι τα γονίδια που κωδικοποιούν τα τρία αυτά ένζυµα βρίσκονται το ένα δίπλα στο άλλο πάνω στο γονιδίωµα και αποτελούν: Το οπερόνιο της λακτόζης 64

65 ΟΠΕΡΟΝΙΟ ΤΗΣ ΛΑΚΤΟΖΗΣ Είναι µια οµάδα γονιδίων που υπόκεινται σε κοινό έλεγχο η έκφραση τους Αποτελείται από τα 3 δοµικά γονίδια Ζ, Υ και Α που βρίσκονται το ένα δίπλα στο άλλο Οι υπόλοιπες αλληλουχίες που βρίσκονται µπροστά από τα δοµικά γονίδια είναι για να ρυθµίζουν την έκφραση τους και είναι: Ρυθµιστικό γονίδιο Υποκινητής Χειριστής 65

66 ΚΑΤΑΣΤΟΛΗ ΤΟΥ ΟΠΕΡΟΝΙΟΥ ΤΗΣ ΛΑΚΤΟΖΗΣ Αν στο θρεπτικό υλικό απουσιάζει η λακτόζη Το οπερόνιο της λακτόζης δεν µεταγράφεται και ούτε µεταφράζεται Τα γονίδια που το αποτελούν είναι σε καταστολή Πως επιτυγχάνεται η καταστολή; ύο είναι τα ρυθµιστικά µόρια: Ο χειριστής που είναι µια αλληλουχία DNA µεταξύ του υποκινητή και του πρώτου δοµικού γονιδίου Η πρωτεΐνη καταστολέας που κωδικοποιείται από το ρυθµιστικό γονίδιο που είναι µπροστά από τον υποκινητή 66

67 ΚΑΤΑΣΤΟΛΗ ΤΟΥ ΟΠΕΡΟΝΙΟΥ ΤΗΣ ΛΑΚΤΟΖΗΣ Το ρυθµιστικό γονίδιο ανεξάρτητα συνθηκών µεταγράφεται και µεταφράζεται συνέχεια στη πρωτεΐνη-καταστολέα Ο καταστολέας προσδένεται ισχυρά στο χειριστή και εµποδίζει την RNA πολυµεράση να αρχίσει τη µεταγραφή των γονιδίων του οπερονίου 67

68 ΕΝΕΡΓΟΠΟΙΗΣΗ ΤΟΥ ΟΠΕΡΟΝΙΟΥ ΤΗΣ ΛΑΚΤΟΖΗΣ Αν στο θρεπτικό υλικό υπάρχει ΜΟΝΟ λακτόζη Το ρυθµιστικό γονίδιο ανεξάρτητα συνθηκών µεταγράφεται και µεταφράζεται συνέχεια στη πρωτεΐνη-καταστολέα Η λακτόζη προσδένεται στον καταστολέα και δεν του επιτρέπει να προσδεθεί στο χειριστή Η RNA πολυµεράση είναι ελεύθερη να αρχίσει τη µεταγραφή Η λακτόζη λειτουργεί ως επαγωγέας της µεταγραφής των γονιδίων του οπερονίου 68

69 Η RΝΑ πολυµεράση µεταγράφει σε ένα ενιαίο m-rna και τα τρία γονίδια Το m-rna περιέχει κωδικόνια έναρξης και λήξης για κάθε ένζυµο Τα τρία ένζυµα µεταφράζονται ταυτόχρονα από το ενιαίο m-rna Όταν η λακτόζη διασπαστεί πλήρως ο καταστολέας θα είναι ελεύθερος να προσδεθεί στο χειριστή και να καταστείλει το οπερόνιο Συµπερασµατικά η ίδια η λακτόζη ενεργοποιεί την διάσπαση της ΟΠΕΡΟΝΙΟ ΤΗΣ ΛΑΚΤΟΖΗΣ 69

70 ΟΡΓΑΝΩΣΗ ΤΩΝ ΓΟΝΙ ΙΩΝ ΣΤΟΥΣ ΠΡΟΚΑΡΥΩΤΙΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Τα γονίδια των ενζύµων που παίρνουν µέρος σε µια µεταβολική οδό όπως: H διάσπαση της λακτόζης H βιοσύνθεση των αµινοξέων οργανώνονται σε οπερόνια Είναι οµάδες γονιδίων που υπόκεινται σε κοινό έλεγχο η έκφραση τους Αποτελούνται από τα δοµικά γονίδια που βρίσκονται το ένα δίπλα στο άλλο Οι υπόλοιπες αλληλουχίες που βρίσκονται µπροστά από τα δοµικά γονίδια είναι για να ρυθµίζουν την έκφραση τους και είναι: Χειριστής Υποκινητής Ρυθµιστικό γονίδιο 70

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ 1. Ούλωφ Πάλμε & Επάφου & Χρυσίππου 1 Ζωγράφου, 210 74 88 030 2. Φανερωμένης 13 Χολαργός, 210 65 36 551 www.en-dynamei.gr ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α. συνεπικρατή

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ Α Α. 1 Β. 4 Γ. 3 Δ. 2 Ε. 1 ΘΕΜΑ Β Β1. Οι λόγοι που μπορεί να

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: ΜΑΘΗΜΑ: 3 η ΤΑΞΗ ΕΠΑ.Λ. (Β ΟΜΑ Α) ΒΙΟΛΟΓΙΑ ΙΙ Ηµεροµηνία: Παρασκευή 19 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1-β, Α2-γ, Α3-γ, Α4-α, Α5-α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Με τη µέθοδο της επιλογής

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ)

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 2000 ΗΜΕΡΗΣΙΟ Ζήτηµα 2ο Α. Η διαδικασία της αντιγραφής

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Β ΤΡΙΜΗΝΟ ΚΟΝΤΟΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Γ2 Ιανουάριος 2015 ΕΙΣΑΓΩΓΗ Ο ι Watson και Crick, το 1953, διατύπωσαν το μοντέλο της διπλής έλικας

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. 1.α, 2.β, 3.δ, 4.γ, 5.α ΜΟΝΑ ΕΣ 10 (2 ΓΙΑ ΚΑΘΕ ΣΩΣΤΗ ΕΠΙΛΟΓΗ) Β. i) λήξης ii) αµινικό iii) τροποποιήσεις,

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Aριστοβάθμιο ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

Aριστοβάθμιο ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ριστοβάθμιο ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr ΚΕΦΑΛΑΙΟ 1 TO ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ερωτήσεις

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα