ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ"

Transcript

1 ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων, στο αντίστοιχο βοήθημα των Εκδόσεων Πατάκη προκύπτει η ανάγκη να γίνουν οι παρακάτω διορθώσεις συμπληρώσεις στις ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΤΟΥ Υ Υ. σελ ο ΚΕΦΑΛΑΙΟ Στο Κεφάλαιο 1 δεν υπάρχουν οι ερωτήσεις με αριθμό 7 και 12 του βοηθήματος. Η αντιστοιχία ερωτήσεων σχολικού βιβλίου και βοηθήματος των Εκδόσεων Πατάκη είναι η εξής: 2 (βλ. παρακάτω) 3 (βλ. παρακάτω) 4 (βλ. παρακάτω) (βλ. παρακάτω) Ερώτηση 2: α) Σ, β) Λ. γ) Λ, δ) Σ, ε) Λ, στ) Λ, θ) Λ. Ερώτηση 3: α) Λ, β) Λ, γ) Σ, δ) Λ, ε) Λ, στ) Λ, θ) Λ, ι) Λ. Ερώτηση 4: (με έντονα γράμματα είναι οι λέξεις που συμπληρώνουν τα κενά) Αν μία πρωτεΐνη αποτελείται μόνο από μια πολυπεπτιδική αλυσίδα, το τελικό στάδιο της διαμόρφωσή ς της μπορεί να είναι μέχρι και η τριτοταγής δομή. Τα 1

2 φωσφολιπίδια εμφανίζουν ένα ιδιαίτερο χαρακτηριστικό σε σχέση με το νερό. Η κεφαλή του μορίου τους είναι υδρόφιλη, ενώ αντίθετα η ουρά του μορίου τους είναι υδρόφοβη. Τα στεροειδή ανήκουν στην ευρύτερη κατηγορία μακρομορίων των λιπιδίων. Η χοληστερίνη αποτελεί συστατικό των μεμβρανών των ζωικών κυττάρων. Οι κύριοι πολυσακχαρίτες είναι η κυτταρίνη, το άμυλο, και το γλυκογόνο. Οι μονοσακχαρίτες διακρίνονται σε τριόζες, πεντόζες και εξόζες. Η μαλτόζη προκύπτει από τη διάσπαση του αμύλου με τη διαδικασία της πέψης. Η λακτόζη είναι το σάκχαρο του γάλακτος. Τα μονομερή των διαφορετικών ειδών μακρομορίων συνδέονται μεταξύ τους με τον ίδιο πάντοτε βασικό μηχανισμό, που ονομάζεται συμπύκνωση. Κατά τη διαδικασία αυτή το ένα μονομερές χάνει ένα άτομο υδρογόνου, ενώ το άλλο μια υδροξυλομάδα. Αν μεταξύ των μακρομορίων αναζητούσες το πιο διαδεδομένο και πολυδιάστατο στη μορφή και τη λειτουργία μόριο, αργά ή γρήγορα θα κατέληγες στις πρωτεΐνες. Οι δύο κλώνοι του DΝΑ συγκρατούνται μεταξύ τους με δεσμούς υδρογόνου. Το μόριο του DΝΑ φέρει τις γενετικές πληροφορίες. Το σύνολο των μορίων του DΝΑ ενός κυττάρου αποτελεί το γενετικό υλικό. Το DΝΑ του ευκαρυωτικού κυττάρου βρίσκεται κυρίως μέσα στο πυρήνα. Μικρό μέρος του υπάρχει στα μιτοχόνδρια και στους χλωροπλάστες. Ερώτηση 10: Η υπάλληλος του κυλικείου δεν είπε την αλήθεια, διότι οι υδατάνθρακες διακρίνονται σε μονοσακχαρίτες, δισακχαρίτες και πολυσακχαρίτες και η σακχαρόζη είναι ένας δισακχαρίτης που αποτελείται από φρουκτόζη και γλυκόζη, επομένως ανήκει στους υδατάνθρακες. 2ο ΚΕΦΑΛΑΙΟ σελ Στο Κεφάλαιο 2 δεν υπάρχουν οι ερωτήσεις με αριθμό 2 και 14 του βοηθήματος. Η αντιστοιχία ερωτήσεων σχολικού βιβλίου και βοηθήματος των Εκδόσεων Πατάκη είναι η εξής: 2 (βλ. παρακάτω) 3 (βλ. παρακάτω) 4 (βλ. παρακάτω) 5 (βλ. παρακάτω) (βλ. παρακάτω) 8 (βλ. παρακάτω)

3 Ερώτηση 2: α) Λ, β) Λ, γ) Σ. δ) Λ, ε) Λ, στ) Σ, ζ) Σ, η) Σ, θ) Λ, ι) Λ, κ) Λ, λ) Λ, μ) Σ, ν) Λ. Ερώτηση 3: α) Λ, β) Λ, γ) Λ, δ) Σ, ε) Λ, στ) Λ. Ερώτηση 4: α) Σ, β) Λ, γ) Λ, δ) Σ, ε) Λ, στ) Λ. Ερώτηση 5: Οι υδρόφοβοι δεσμοί αναπτύσσονται μεταξύ μη πολικών ενώσεων, όταν αυτές βρεθούν σε υδάτινο περιβάλλον και προκαλούν την συσσωμάτωση των ενώσεων αυτών που προσπαθούν να απομακρυνθούν από τα μόρια του νερού. Οι δεσμοί αυτοί αναπτύσσονται μεταξύ των μη πολικών πλάγιων ομάδων R των αμινοξέων και συμβάλλουν μαζί με άλλους δεσμούς στη χωροδιάταξη των πρωτεϊνών. Τους συναντάμε επίσης μεταξύ των υδρόφοβων τμημάτων (ουρές) των φωσφολιπιδίων και συμβάλλουν στο σχηματισμό της διπλοστιβάδας φωσφολιπιδίων των στοιχειωδών μεμβρανών οι οποίες με τη σειρά τους συμμετέχουν στο σχηματισμό τόσο της πλασματικής και πυρηνικής μεμβράνης όσο και των μεμβρανωδών οργανιδίων των κυττάρων. Ερώτηση 7: 1. Η φρουκτόζη και η γλυκόζη είναι μονοσακχαρίτες οι οποίοι περνούν την ημιπερατή μεμβράνη. Προκειμένου να επιτευχθεί ισορροπία των συγκεντρώσεων τόσο στο εσωτερικό του τεχνητού κύτταρου όσο και στο εξωτερικό, θα γίνει μετακίνηση των δισακχαριτών προς την κατεύθυνση της χαμηλότερης συγκέντρωσης (διάχυση). Η γλυκόζη έχει μεγαλύτερη συγκέντρωση στο εσωτερικό του κυττάρου, άρα μόρια της θα μετακινηθούν προς τα έξω, ενώ η φρουκτόζη έχει μεγαλύτερη συγκέντρωση έξω και μόρια της θα κινηθούν προς το εσωτερικό του κυττάρου. 2. Η Σακχαρόζη σαν δισακχαρίτης δεν διαπερνά τη κυτταρική μεμβράνη. Παρατηρούμε πως η συγκέντρωση της είναι μεγαλύτερη στο εσωτερικό του τεχνητού κυττάρου. Προκειμένου να επιτευχθεί ισορροπία των συγκεντρώσεων μεταξύ του εσωτερικού και του εξωτερικού του τεχνητού κυττάρου, μόρια νερού θα μετακινηθούν από το εξωτερικό προς το εσωτερικό του κυττάρου (ώσμωση). 3. Αποτέλεσμα του οσμωτικού φαινόμενου θα είναι η διόγκωση (φούσκωμα) του κυττάρου. 3

4 Ερώτηση 8: 1. Η ουσία Α παρατηρούμε ότι αρχικά έχει την ίδια συγκέντρωση τόσο ενδοκυτταρικά όσο και εξωκυτταρικά, ενώ τελικά μειώνεται και στις δύο περιοχές. Αυτό σημαίνει ότι ουσία μετακινήθηκε εσωτερικά και μετά χρησιμοποιήθηκε από το κύτταρο είτε ως πηγή ενέργειας ή για κάποια βιοσύνθεση. Για να μετακινηθεί ουσία αντίθετα από την φορά ισορροπίας πρέπει να γίνει κατανάλωση ενέργειας και επομένως οξυγόνου. Άρα, η ουσία Α μετακινείται με ενεργητική μεταφορά. Η ουσία Β έχει μεγαλύτερη συγκέντρωση εξωκυτταρικά, ενώ τελικά οι δύο συγκεντρώσεις εξισορροπούνται. Αυτό σημαίνει ότι έγινε παθητική μετακίνηση της ουσίας προς τη κατεύθυνση χαμηλότερης συγκέντρωσης και τελικά επήλθε ισορροπία. Επομένως, η ουσία Β μεταφέρθηκε με παθητική μεταφορά (διάχυση). Η ουσία Γ έχει μεγαλύτερη συγκέντρωση εξωκυτταρικά αρχικά, ενώ στο τέλος αυτή η διαφορά αυξάνεται, γεγονός που σημαίνει ότι η ουσία μεταφέρθηκε αντίθετα με τη φορά παθητικής μεταφοράς. Βάσει των παραπάνω συμπεραίνουμε ότι και η ουσία Γ, όπως και η Α, μεταφέρεται με ενεργητική μεταφορά. 2. Το οξυγόνο χρειάζεται για το καταβολισμό του κυττάρου από τον οποίο παράγεται ενέργεια απαραίτητη και για τις διαδικασίες ενεργητικής μεταφοράς ουσιών. Οπότε, μείωση του οξυγόνου συνεπάγεται μείωση παραγωγής ενέργειας, που με τη σειρά της προκαλεί επιβράδυνση των διαδικασιών ενεργητικής μεταφοράς. Αυτό, στη περίπτωσή μας, θα προκαλέσει επιβράδυνση της μεταφοράς των ουσιών Α και Γ, μιας και αυτές μεταφέρονται με το παραπάνω τρόπο. 3. Με το μηχανισμό της παθητικής μεταφοράς μεταφέρεται το απαραίτητο οξυγόνο μέσα στα κύτταρα, ενώ απομακρύνεται το παραγόμενο διοξείδιο του άνθρακα από αυτά. Με τη διαδικασία της ενεργητικής μεταφοράς γίνεται μεταφορά ιόντων Na+ και Κ+ μέσω του μηχανισμού της αντλίας ιόντων Νατρίου Καλίου. 4. Ουσίες μεγάλου Μ.Β. εισέρχονται μέσα στο κύτταρο με τη διαδικασία της ενδοκύττωσης, ενώ εξέρχονται με τη διαδικασία εξωκύττωσης. (Περιγραφή των δύο διαδικασιών γίνεται στη σελίδα 52 του σχολικού βιβλίου.) 3ο ΚΕΦΑΛΑΙΟ ΕΝΟΤΗΤΑ 3.1 Στην Ενότητα 3.1 δεν υπάρχει αλλαγή στη αρίθμηση των ασκήσεων. ΕΝΟΤΗΤΑ 3.2 σελ Στην Ενότητα 3.2 αλλάζει η ερώτηση 10 και προστίθεται η ερώτηση 15. Ερώτηση 10: α) Σ, β) Λ, γ) Λ, δ) Λ. 4

5 Ερώτηση 15: Η αντίδραση είναι εξώθερμη, οπότε η ενέργεια των προϊόντων (ουσία Β) θα είναι μικρότερη από την ενέργεια των αντιδρώντων (ουσία Α). Η ενέργεια ενεργοποίησης της αντίδρασης παρουσία ενζύμου είναι μικρότερη από την αντίστοιχη χωρίς ένζυμο. Βάσει των παραπάνω, το σχήμα 1 είναι λάθος, διότι δείχνει ότι η ενέργεια ενεργοποίησης της αντίδρασης χωρίς ένζυμο είναι μικρότερη της αντίστοιχης με ένζυμο. Το σχήμα 2 είναι λάθος, διότι δείχνει ότι η ουσία Β (προϊόν) έχει περισσότερη ενέργεια από την ουσία Α (αντιδρών). Αυτό συμβαίνει μόνο όταν η αντίδραση είναι ενδόθερμη. Το σχήμα 3 είναι λάθος, διότι δείχνει ότι κατά την διάρκεια της αντίδρασης με ένζυμο προκύπτουν ενδιάμεσα προϊόντα με χαμηλότερη ενέργεια από το τελικό προϊόν. Το σχήμα 4 είναι λάθος, διότι συνδυάζει τους λόγους που είναι λάθος τα σχήματα 1 και 3. ΕΝΟΤΗΤΑ 3.3 σελ Στην Ενότητα 3.3 έχει τροποποιηθεί η ερώτηση 1 και δεν υπάρχουν οι ερωτήσεις με αριθμό 3, 8 και 9 του βοηθήματος. Η αντιστοιχία ερωτήσεων σχολικού βιβλίου και βοηθήματος των Εκδόσεων Πατάκη είναι η εξής: 1 (βλ. παρακάτω) Ερώτηση 1: 2 ε, 3 δ, 4 α. ΕΝΟΤΗΤΑ 3.4 σελ Στην Ενότητα 3.4 δεν υπάρχει η ερώτηση με αριθμό 5 του βοηθήματος. Η αντιστοιχία ερωτήσεων σχολικού βιβλίου και βοηθήματος των Εκδόσεων Πατάκη είναι η εξής: 5

6 (βλ. παρακάτω) Ερώτηση 7: Το βάρος του σώματος σε φυσιολογικές συνθήκες είναι ανάλογο του ύψους. Η κοντύτερη γυναίκα παρατηρούμε ότι έχει μεγαλύτερο βάρος από την ψηλότερη. Αυτό σημαίνει ότι, αν δεν υπάρχει πιο ανεπτυγμένη μυϊκή μάζα (από γυμναστική), τότε η διαφορά βάρους οφείλεται σε εναπόθεση λίπους στον υποδόριο ιστό. Για την αξιολόγηση του ύψους του μεταβολισμού πέρα από το ύψος του σώματος θα πρέπει να λάβουμε υπό όψη τον τρόπο ζωής των γυναικών (καθιστική ή όχι ζωή, γυμναστική ή όχι), τη λήψη της μέσης ημερήσιας ποσότητας τροφής καθώς και την ποιότητα της τροφής (τροφή με περισσότερα λιπαρά, υδατάνθρακες ή πρωτεΐνες). 4ο ΚΕΦΑΛΑΙΟ ΕΝΟΤΗΤΑ 4.2 σελ Στην Ενότητα 4.2 η αντιστοιχία ερωτήσεων σχολικού βιβλίου και βοηθήματος των Εκδόσεων Πατάκη είναι η εξής: (βλ. παρακάτω) 6

7 Ερώτηση 10: Τα ένζυμα είναι πρωτεΐνες και για τη σύνθεσή τους ακολουθείται η τυπική διαδικασία της πρωτεϊνοσύνθεσης. Επομένως, η χημική ουσία μπορεί να παρεμβαίνει σε οποιοδήποτε στάδιο της πρωτεϊνοσύνθεσης. Μπορεί να επεμβαίνει στη διαδικασία της μεταγραφής, που γίνεται στο πυρήνα για τη σύνθεση του αντίστοιχου m RNA, είτε δημιουργώντας λάθη κατά τη μεταγραφή είτε διακόπτοντας την. Μπορεί επίσης να επεμβαίνει στη διαδικασία της μετάφρασης, που γίνεται στα ριβοσώματα του κυτταροπλάσματος, αναστέλλοντας τη σύνθεση της πολυπεπτιδικής αλυσίδας. Μπορεί τέλος να επεμβαίνει στη τελική επεξεργασία της πολυπεπτιδικής αλυσίδας, ώστε αυτή να πάρει τη τελική διαμόρφωσή της στο χώρο, προκειμένου να καταστεί ενζυμικά λειτουργική. ΕΝΟΤΗΤΑ 4.5 σελ Στην Ενότητα 4.5 η αντιστοιχία ερωτήσεων σχολικού βιβλίου και βοηθήματος των Εκδόσεων Πατάκη είναι η εξής: (βλ. παρακάτω) 7

8 18 (βλ. παρακάτω) (βλ. παρακάτω) Ερώτηση 17: 1. Παρατηρούμε ότι η ποσότητα γενετικού υλικού στην αρχή και στο τέλος του κυτταρικού κύκλου είναι ίδια και ίση με α και αυτό συμβαίνει κατά την μίτωση. 2. Η βιολογική σημασία της μίτωσης έχει να κάνει με τη διατήρηση των γενετικών πληροφοριών στα θυγατρικά κύτταρα, ευνοώντας έτσι τη γενετική σταθερότητα. 3. Με τη μορφή δικτύου χρωματίνης το γενετικό υλικό υπάρχει σε όλη τη μεσόφαση. Με τη μορφή χρωμοσωμάτων που αποτελούνται από 2 χρωματίδες παρουσιάζεται μετά το διπλασιασμό του DNA, στα διαστήματα όπου η ποσότητα του γενετικού υλικού είναι 2α (ΒΓ, ΓΔ, ΔΕ, Ε ΣΤ). Με τη μορφή χρωματίδων που αντιπροσωπεύουν χρωμοσώματα στα στάδια εκείνα όπου δεν είναι διπλασιασμένο το DNA, δηλαδή εκεί όπου η ποσότητα του γενετικού υλικού είναι α (ΑΒ, ΣΤ Ζ). 4. Τα δύο βασικά είδη κυτταροδιαίρεσης των ευκαρυωτικών κυττάρων είναι η μίτωση και η μείωση. Η μείωση διαφέρει από την μίτωση στα εξής: α) Η μείωση ολοκληρώνεται με 2 διαδοχικές κυτταρικές διαιρέσεις έναντι 1 διαίρεσης με την οποία ολοκληρώνεται η μίτωση. β) Προκύπτουν 4 θυγατρικά κύτταρα αντί 2 της μίτωσης. γ) Τα θυγατρικά κύτταρα (γαμέτες) της μείωσης περιλαμβάνουν τη μισή ποσότητα γενετικού υλικού σε σχέση με το μητρικό κύτταρο, σε αντίθεση με τα θυγατρικά κύτταρα της μίτωσης, που περιλαμβάνουν την ίδια ποσότητα γενετικού υλικού σε σχέση με το μητρικό κύτταρο. Ερώτηση 18: 1. Παρατηρούμε από το σχήμα ότι το κύτταρο αποτελείται από 4 χρωμοσώματα ανά 2 όμοια (ομόλογα χρωμοσώματα), άρα πρόκειται για διπλοειδή οργανισμό. 2. Εφόσον τα χρωμοσώματα είναι ορατά (μέγιστος βαθμός συμπύκνωσης), η πυρηνική μεμβράνη δεν έχει ακόμα ολοκληρωτικά διαλυθεί και το κεντροσωμάτιο έχει διπλασιαστεί, καταλαμβάνοντας αντιδιαμετρικές θέσεις ως προς τον πυρήνα. Η φάση στην οποία βρίσκεται το κύτταρο είναι η πρόφαση και συγκεκριμένα στο τέλος της πριν το κύτταρο μπει στη μετάφαση. 8

9 3. Κατά τη μετάφαση Ι της μείωσης τα ομόλογα χρωμοσώματα τοποθετούνται ζευγάρια στο ισημερινό πεδίο της μειωτικής ατράκτου. Το κάθε ζευγάρι τοποθετείται ανεξάρτητα από τα υπόλοιπα και υπάρχουν 2 δυνατές θέσεις τοποθέτησης για κάθε ζευγάρι ως προς τους πόλους της ατράκτου. Κατά την τελόφαση Ι δημιουργούνται 2 κύτταρα και το καθένα έχει μία σειρά μη ομολόγων χρωμοσωμάτων. Λόγω του ανεξάρτητου διαχωρισμού των χρωμοσωμάτων μπορούν να προκύψουν 2 n συνδυασμοί μη ομολόγων χρωμοσωμάτων (n = ο αριθμός των μη ομολόγων χρωμοσωμάτων εδώ n = 2). Το κάθε ένα κύτταρο που προκύπτει έχει 1 από τους παραπάνω συνδυασμούς, δηλαδή σε κάθε μείωση προκύπτουν 2 συνολικά από τους παραπάνω συνδυασμούς. Επομένως οι διαφορετικοί γαμέτες που μπορούν να προκύψουν γενικά είναι 2 n = 2 2 = 4 4. Κατά τη πρόφαση και την μετάφαση Ι το κύτταρο έχει 4 μονάδες (4 χρωμοσώματα με 2 χρωματίδες το καθένα) μάζας DNA, ενώ κατά τη πρόφαση ΙΙ και μετάφαση ΙΙ έχει 2 μονάδες (2 χρωμοσώματα με 2 χρωματίδες το καθένα). Στην ανάφαση Ι έχει 2+2 μάζες DNA (διαχωρισμός των χρωμοσωμάτων), ενώ στην ανάφαση ΙΙ 1+1 (διαχωρισμός των αδελφών χρωματίδων των μη ομολόγων χρωμοσωμάτων). Στην τελόφαση Ι έχει 2 μάζες DNA το κάθε θυγατρικό κύτταρο (2 μη ομόλογα χρωμοσώματα), ενώ στη τελόφαση ΙΙ το κάθε θυγατρικό κύτταρο γαμέτης περιέχει 1 μάζα DNA ½ + ½ (μια χρωματίδα από κάθε μη ομόλογο χρωμόσωμα). Ερώτηση 20: 1. Αφού οι πρωτεΐνες έχουν το ίδιο Μ.Β., άρα θα έχουν και τον ίδιο αριθμό αμινοξέων, δηλαδή : 100 = 60 αμινοξέα η κάθε μια. Επομένως, το βακτήριο θα περιέχει : 60 = 66 πρωτεΐνες. 2 και 3. Γνωρίζουμε με βάση το γενετικό κώδικα ότι κάθε αμινοξύ αντιστοιχεί σε ένα κωδικόνιο του m RNA, δηλαδή σε μία τριάδα αζωτούχων βάσεων (νουκλεοτιδίων). Επομένως, τα νουκλεοτίδια του m RNA που κωδικοποιούν αμινοξέα για κάθε πρωτεΐνη θα είναι συνολικά 3 x 60 = 180 (συμπεριλαμβάνονται και τα 3 νουκλεοτίδια που αντιστοιχούν στο μήνυμα έναρξης). Στο τέλος του μηνύματος υπάρχει πάντα τουλάχιστον ένα κωδικόνιο λήξης, δηλαδή + 3 νουκλεοτίδια. Άρα, το m RNA θα έχει συνολικά 183 νουκλεοτίδια (δεν υπολογίζονται οι αμετάφραστες περιοχές στην αρχή και στο τέλος του m RNA). Το m RNA (μονόκλωνο μόριο) προκύπτει από τη μεταγραφή του DNA και γνωρίζουμε ότι μεταγράφεται η μία από της 2 αλυσίδες του αντίστοιχου τμήματος DNA. Επομένως, το αντίστοιχο τμήμα DNA που φέρει τη πληροφορία για τη σύνθεση της πρωτεΐνης θα περιέχει 2 x 183 = 366 νουκλεοτίδια. 9

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ ΤΑΞΗ B ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ Απαντήστε στο απαντητικό φύλλο: για τις ερωτήσεις πολλαπλής επιλογής με το γράμμα που αντιστοιχεί στη σωστή απάντηση και για τις ερωτήσεις ανάπτυξης

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2015 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Λέξεις-κλειδιά Κυτταρική ή πλασματική μεμβράνη... Βασικές ιδιότητες της πλασματικής μεμβράνης... Βασικές λειτουργίες

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Βιολογία(Γενικής(Παιδείας Β Λυκείου

Βιολογία(Γενικής(Παιδείας Β Λυκείου Βιολογία(Γενικής(Παιδείας Β Λυκείου Ελληνογαλλική Σχολή Jeanne D Arc 2011-2012 Δημοσθένης Καρυοφύλλης email: dkariofi@e-biology.gr www.ibrain.gr Κεφ. 1 ο Χημική σύσταση του κυττάρου Χαρακτηριστικά των

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 3 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης.

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης. ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΕΝΟΤΗΤΑ: ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΑΘΗΓΗΤΗΣ: ΠΑΤΗΡ ΑΝΑΣΤΑΣΙΟΣ ΙΣΑΑΚ ΖΗΤΗΜΑ Α Το σχεδιάγραμμα δείχνει τμήμα κυτταρικής μεμβράνης. (α) Να ονομάσετε τα

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015)

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015) Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Ομαδοποιημένα ανά κεφάλαιο (σχολικό έτος 2014-2015) Ιωαννίδης Θωμάς Βιολόγος 11 ου ΓΕΛ Ηρακλείου 1 ΠΕΡΙΕΧΟΜΕΝΑ Εξεταστέα Ύλη 2014-15.. σελ.3 1 ο Κεφάλαιο..σελ.

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Η επιστήμη της Φυσιολογίας μελετά: 1. Τα χαρακτηριστικά και 2. Τους μηχανισμούς λειτουργίας του ανθρωπίνου σώματος τα οποία τον καθιστούν ζωντανό όν

Η επιστήμη της Φυσιολογίας μελετά: 1. Τα χαρακτηριστικά και 2. Τους μηχανισμούς λειτουργίας του ανθρωπίνου σώματος τα οποία τον καθιστούν ζωντανό όν Η επιστήμη της Φυσιολογίας μελετά: 1. Τα χαρακτηριστικά και 2. Τους μηχανισμούς λειτουργίας του ανθρωπίνου σώματος τα οποία τον καθιστούν ζωντανό όν 01/27 -Η μικρότερη δομική και λειτουργική μονάδα ζωντανής

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ

ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡIΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ 2010 2 ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ ΚΕΦΑΛΑΙΟ ΤΡΙΤΟ ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ Η κυτταρική ή πλασματική μεμβράνη αποτελεί το εξωτερικό όριο του κυττάρου από το περιβάλλον και περικλείει

Διαβάστε περισσότερα

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις:

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: ΘΕΜΑ Β: Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί

3.1 Ενέργεια και οργανισμοί Δημήτρης Η. Β 1 25.3.14 3 Ο Κεφάλαιο 3.1 Ενέργεια και οργανισμοί Η ενέργεια έχει κεντρική σημασία για έναν οργανισμό, γιατί ό,τι και να κάνουμε χρειαζόμαστε ενέργεια. Ο κλάδος της βιολογίας που ασχολείται

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Μείωση-Βιολογία Κατεύθυνσης

Μείωση-Βιολογία Κατεύθυνσης κύτταρο -γυναίκας 1η μειωτική διαίρεση-αποχωρισμός ομολόγων 2η μειωτική διαίρεση-αποχωρισμός αδελφών Γαμέτης-3 Γαμέτης-4 Χ.Κ.ΦΙΡΦΙΡΗΣ-ΦΡΟΝΤΙΣΤΗΡΙΑ ΠΡΟΟΠΤΙΚΗ-ΠΑΠΑΝΑΣΤΑΣΙΟΥ 101 Σελίδα 1 κύτταρο -άνδρα 1η

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 2 Στα ακόλουθα σχήματα απεικονίζονται δύο κύτταρα. Ι. Να ονομάσετε 3 δομές που υπάρχουν και στα δύο είδη κυττάρων. Να ονομάσετε επίσης μια δομή που ενώ υπάρχει στα κύτταρα

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα