Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ"


1 Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που συμμετέχουν στη δομή των βιολογικών μορίων συγκαταλέγονται α- νάμεσα στα στοιχεία πυ συνθέτουν το φλοιό της Γης. Συσχετίσει τις ιδιότητες αυτών των στοιχείων - και τη δυνατότητα που έχουν να συνδέονται και να αλληλεπιδρούν - με τις ιδιότητες των μορίων στα οποία συμμετέχουν. Τη δυνατότητα να αιτιολογεί τον κεντρικό ρόλο του νερού στο φαινόμενο της ζωής. Τη δυνατότητα να αναφέρει τις σπουδαιότερες ομάδες βιολογικών μακρομορίων (πρωτεΐνες, νουκλεϊκά οξέα, υδατάνθρακες και λιπίδια) και τους δομικούς λίθους από τους οποίους αυτά αποτελούνται. Διακρίνει ομοιότητες στον τρόπο με τον οποίο σχηματίζονται τα διάφορα είδη μακρομορίων. Διαπιστώσει ότι οι δομές και οι λειτουργίες που σχετίζονται με τις εκδηλώσεις της ζωής δεν είναι παρά προεκτάσεις της δομής των ιδιοτήτων και των αλληλεπιδράσεων των μακρομορίων που συναντάμε ένα ζωντανό κύτταρο.

2 1.2 ΠΡΩΤΕΪΝΕΣ: ΔΙΑΔΕΔΟΜΕΝΕ!, ΠΟΛΥΠΛΟΚΕ! ΚΑΙ ΕΥΘΡΑΓΓΕ! Διδακτικοί στόχοι Στο τέλος της διδασκαλίας της υποενότητας αυτής ο μαθητής θα πρέπει: Να αναγνωρίζει το είδος των μονομερών των πρωτεϊνών και να περιγράφει τον τρόπο με τον οποίο αυτά συνδέονται, ώστε να αποτελέσουν πολυπεπτιδικές α- λυσίδες. Να συσχετίζει την «προσωπικότητα» κάθε πρωτεΐνης με τη συγκεκριμένη αλληλουχία των αμινοξέων, τα οποία δομούν την πολυπεπτιδική αλυσίδα. Να αναγνωρίζει ότι κάθε συγκεκριμένη αλληλουχία αμινοξέων προσδιορίζει μια συγκεκριμένη στερεοδιάταξη, που με τη σειρά της προσδιορίζει έναν καθορισμένο βιολογικό ρόλο για την πρωτεΐνη. Να κατατάσσει τις πρωτεΐνες με βάση τη λειτουργία τους και να αναγνωρίζει ό- τι αυτές είναι τα μακρομόρια χάρη στα οποία επιτελείται ένα πλήθος από διαφορετικές κυπαρικές λειτουργίες. Περιεχόμενο Πρωτείνες: Διαδεδομένες, πολύπλοκες και εύθραυστες Αμινοξέα, οι δομικοί λίθοι Οργάνωση των πρωτεϊνικών μορίων Η δομή των πρωτεϊνικών μορίων καθορίζει τη λειτουργία τους Ενδεικτικές διδακτικές ενέργειες Γ ια να πετύχετε τους διδακτικούς σας στόχους: 1. Μπορείτε να ξεκινήσετε τη διδασκαλία των πρωτεϊνών, ζητώντας από τους μαθητές σας να σας αναφέρουν πρωτεΐνες τις οποίες γνωρίζουν και να προσδιορίσουν, με βάση την προηγούμενη γνώση τους, το βιολογικό ρόλο τους. Μπορείτε να τους κατευθύνετε, ώστε να αναζητήσουν προϊόντα που διαφημίζονται για

3 το περιεχόμενο τους σε πρωτεΐνη (π.χ. κρέμες καλλυντικών που περιέχουν κολλαγόνο) ή φαρμακευτικά προϊόντα (π.χ. ινσουλίνη). Συζητήστε μαζί τους σύντομα που συναντώνται οι πρωτεΐνες που ανέφεραν, τι ρόλο επιτελούν και κάνετε αναφορά σε πρωτεΐνες που ίσως τους είναι άγνωστες (π.χ. ακτίνη, μυοσίνη, α- ντισώματα κ.ά.). 2. Αφού έχετε εξετάσει ένα μικρό αλλά ποικίλο δείγμα πρωτεϊνών, παρουσιάστε το δομικό τους λίθο, τα αμινοξέα. Προβάλλοντάς τους μάλιστα ένα πίνακα με τα 20 διαφορετικά αμινοξέα, μπορείτε να τους οδηγήσετε να ανακαλύψουν ότι ό- λα τους διαθέτουν μια τουλάχιστον καρβοξυλομάδα και μια τουλάχιστον αμινομάδα, αλλά καθένα έχει μια χαρακτηριστική, γι' αυτό, πλευρική ομάδα R. Στη συνέχεια συζητήστε τον τρόπο σύνδεσης των αμινοξέων μεταξύ τους (πεπτιδικό δεσμό), προσπαθώντας να τους βοηθήσετε να κατανοήσουν ότι είναι ανυδριτικός και ότι στην πεπτιδική αλυσίδα το 1ο αμινοξύ έχει ελεύθερη αμινομάδα, ενώ το τελευταίο έχει ελεύθερη καρβοξυλομάδα. 3. Μπορείτε να τους ζητήσετε να γράψουν όσες περισσότερες λέξεις μπορούν χρησιμοποιώντας τα γράμματα α, ν, ε. Αφού συνθέσουν λέξεις, όπως: νέα, αν, εάν, ένα, εννέα, Αννα κ.ά., ρωτήστε τους τι είναι αυτό που διαφοροποιεί τις λέξεις αυτές μεταξύ τους. Όταν οδηγηθούν στην απάντηση ότι είναι το είδος και η καθορισμένη σειρά των γραμμάτων που τις συνθέτουν, και η διαφορετική κάθε φορά σημασία τους, εξηγήστε ότι με παρόμοιο τρόπο τα 20 διαφορετικά αμινοξέα μπορούν να συνθέσουν ένα ποικίλο αριθμό διαφορετικών πρωτεϊνών. 4. Παρουσιάστε στους μαθητές σας τα διαφορετικά επίπεδα οργάνωσης των πρωτεϊνών και εξηγήστε τους τον τρόπο με τον οποίο η στερεοδιάταξη της πρωτεΐνης τελικά καθορίζεται από την πρωτοταγή δομή της. Παράλληλα βοηθήστε τους να διακρίνουν τη διαφορά ανάμεσα στους όρους πολυπεπτίδιο και πρωτεΐνη, δείχνοντας ότι μερικές πρωτεΐνες αποτελούνται από περισσότερες της μίας πολυπεπτιδικές αλυσίδες. 5. Κάντε μια πολύ σύντομη αναφορά στα ένζυμα ως πρωτεΐνες που έχουν την ικανότητα να επιταχύνουν τις χημικές αντιδράσεις που γίνονται μέσα στο κύπαρο. αλλά και έξω από αυτό, στον οργανισμό (π.χ. στομάχι), και παρουσιάστε με κατάλληλα σχήματα τη στερεοδιάταξη μερικών ενζύμων και μερικών υποστρωμάτων. 6. Ζητήστε από τους μαθητές σας να διακρίνουν με ποιό υπόστρωμα συνδέεται κάθε ένζυμο και στη συνέχεια τους ρωτάτε από τι εξαρτάται η ικανότητα κάθε ενζύμου να επιταχύνει μια συγκεκριμένη χημική αντίδραση. Αφού απαντήσουν

4 ότι η μορφή τους είναι αυτή που προσδιορίζει την ικανότητα τους να συνδέονται με το ένα ή με το άλλο υπόστρωμα, μπορείτε να επανέλθετε ρωτώντας τους από τι εξαρτάται η μορφή τους. Έτσι θα βοηθήσετε τους μαθητές να κατανοήσουν και να αιτιολογήσουν τη λογική σειρά: Πρωτοταταγής δομή» στερεοδιάταξη * βιολογικός ρόλος 7. Παρουσιάστε στην τάξη τον πίνακα του σχολικού βιβλίου στον οποίο αναφέρεται η κατάταξη των πρωτεϊνών. Στη συνέχεια προκαλέστε μια συζήτηση η οποία θα αποσκοπεί στο να καταδειχτεί ότι οι πρωτεΐνες είναι τα πολυδιάστατα στη χρήση τους μοριακά εργαλεία των κυττάρων. 33

5 1.2 ΝΟΥΚΛΕΙΚΑ ΟΞΕΑ: ΝΗΜΑΤΑ ΚΑΙ ΑΓΓΕΛΙΑΦΟΡΟΙ ΤΗΣ ΖΩΗΣ Διδακτικοί στόχοι Στο τέλος της διδασκαλίας της υποενότητας αυτής ο μαθητής θα πρέπει: Να αναγνωρίζει τα νουκλεοτίδια ως τους δομικούς λίθους των νουκλεϊκών οξέων και να περιγράφει τον τρόπο με τον οποίο συνδέονται μεταξύ τους, ώστε να συνθέτουν πολυνουκλεοτιδικές αλυσίδες. Να διακρίνει τα νουκλεοτίδια σε δεσοξυριβονουκλεοτίδια και σε ριβονουκλεοτίδια, με βάση το είδος της πεντόζης και των αζωτούχων βάσεων που διαθέτουν. Να συσχετίζει την «προσωπικότητα» κάθε νουκλεοτιδίου την ιδιαίτερη αζωτούχα βάση που διαθέτει. Να αναγνωρίζει ότι υπάρχει μια απεριόριστη ποικιλία αλληλουχιών νουκλεοτιδίων σε μια πολυνουκλεοτιδική αλυσίδα και ότι κάθε μιά από αυτές συνιστά ένα ιδιαίτερο γενετικό μήνυμα. Να περιγράφει τη δομή του DNA και να συσχετίζει τη συμπληρωματικότητα των αζωτούχων βάσεων με τη δομή και τη λειτουργικότητα του μορίου. Να περιγράφει τη δομή του RNA, τα είδη του και να αναγνωρίζει τη βιολογική σημασία καθενός. Να μπορεί να διακρίνει τα δύο είδη νουκλεϊκών οξέων, σε σχέση με τη σύστασή τους, τη δομή τους, τη λειτουργία τους και τις περιοχές του κυπάρου στις οποίες εντοπίζονται. 34

6 Περιεχόμενο Νουκλεϊκά οξέα: νήματα και αγγελιαφόροι της ζωής Νουλεοτίδια: οι δομικοί λίθοι Δομή και βιολογικός ρόλος ίου DNA Δομή και βιολογικός ρόλος του RNA Ενδεικτικές διδακτικές ενέργειες Γ ια να πετύχετε τους διδακτικούς σας στόχους: 1. Μπορείτε να ξεκινήσετε τη διδασκαλία των νουκλεϊνικών οξέων ζητώντας από τους μαθητές σας να αναφέρουν από τι, κατά τη γνώμη τους, εξαρτώνται μερικά γνωρίσματα ή λειτουργίες του οργανισμού τους, όπως για παράδειγμα, η ρύθμιση του σακχάρου του αίματος, ή ικανότητα του οργανισμού να αναγνωρίζει και να εξουδετερώνει καθετί ξένο (π.χ. παθογόνο μικροοργανισμό) που μπαίνει στο σώμα του, το χρώμα του δέρματος, των μαλλιών ή των ματιών τους κ.ά. (Αν έχουν ενημερωθεί για τον πίνακα με τα είδη των πρωτεϊνών, μπορούν να βοηθηθούν στην απά\πησή τους). 2. Αφού απαντήσουν ότι η ύπαρξη ινσουλίνης και αντισωμάτων είναι υπεύθυνη για τις αντίστοιχες λειτουργίες κτλ., επανέλθετε ρωτώντας τους από τι εξαρτάται η ικανότητα του οργανισμού να φέρει σε πέρας αυτές τις λειτουργίες. 3. Μετά την αναμενόμενη απάντησή τους, ότι δηλαδή η λειτουργία μιας πρωτεΐνης καθορίζεται από τη στερεοδιάταξή της, που με τη σειρά της καθορίζεται από την πρωτοταγή της δομή, θέστε το ερώτημα: και την πρωτοταγή δομή της πρωτεΐνης ποιος την καθορίζει; 4. Μπορείτε λοιπόν να αρχίσετε εισάγοντας την έννοια του γενετικού υλικού, της «μυστηριώδους» δηλαδή ουσίας που καθορίζει τις ιδιότητες και τις λειτουργίες των κυπάρων και κατ' επέκταση των οργανισμών. 5. Ρωτήστε τους ποιες ιδιότητες πρέπει, κατά τη γνώμη τους, να έχει μια τέτοια ουσία. Βοηθήστε τους με κατάλληλα ερωτήματα (π.χ.: είναι δυνατόν η ουσία αυτή να είναι ασταθής; Είναι δυνατόν να μη μεταβιβάζεται από γενιά σε γενιά;) να ανακαλύψουν ότι μια τέτοια ουσία πρέπει: α. να λειτουργεί ως φορέας πληροφοριών, β. να είναι σταθερή,

7 γ, να αντιγράφεται με ακρίβεια, ώστε οι πληροφορίες της να μεταβιβάζονται αναλλοίωτες από γενιά σε γενιά. Σημειώστε στον πίνακα αυτές τις ιδιότητες. 6. Προχωρήστε στην παρουσίαση των νουκλεϊνικών οξέων ως των μορίων τα ο- ποία, καθορίζοντας το είδος των πρωτεϊνών που παράγει ένα κύτταρο, καθορίζουν και το σύνολο των χαρακτηριστικών του. 7. Παρουσιάστε τους τα νουκλεοτίδια και διακρίνετε τα δεσοξυριβονουκλεοτίδια α- πό τα ριβονουκλεοτίδια. Δώστε έμφαση στο ότι αυτό που διαφοροποιεί κάθε νουκλεοτίδιο των νουκλεϊνικών οξέων από ένα άλλο είναι η αζωτούχα βάση του. Μπορείτε επίσης να τους αναφέρετε ότι τα νουκλεοτίδια δεν είναι υποχρεωτικά μονοφωσφορικά, είναι και τριφωσφορικά. Επισημάνετε όμως ότι ως συστατικά των νουκλεϊνικών οξέων είναι μονοφωσφορικά. 8. Όταν διδάσκετε πώς δημιουργείται μια πολυνουκλεοτιδική αλυσίδα (γενικά, όχι υποχρεωτικά δεσοξυριβονουκλεοτιδική, ή ριβονουκλεοτιδική), αναφέρετε α- πλώς ότι ο φωσφοδιεστερικός δεσμός είναι και αυτός, όπως όλοι οι δεσμοί που συνδέουν μονομερή για το σχηματισμό πολυμερών, ανυδριτικός. 9. Αφού έχετε δείξει στους μαθητές σας από τι αποτελείται μια πολυνουκλεοτιδική αλυσίδα, εξηγήστε τους ότι, όπως και στην περίπτωση των πολυπεπτιδικών αλυσίδων, υπάρχει πληροφοριακότητα. Κάθε αλληλουχία αζωτούχων βάσεων είναι μοναδική και αντιστοιχεί σε μια ιδιαίτερη πληροφορία. 10. Παρουσιάστε τους το μοντέλο της δίκλωνης έλικας και συζητήστε μαζί τους για το γεγονός ότι η ανακάλυψή της είναι ένας θρίαμβος της επιστημονικής γνώσης, που άνοιξε τον δρόμο για τα σύγχρονα επιτεύγματα και τις εφαρμογές της επιστήμης της Βιολογίας. 11. Εξηγήστε τους ότι η συμπληρωματικότητα, δηλαδή το στερεοχημικό ταίριασμα ζευγών αζωτούχων βάσεων, μεταξύ των οποίων αναπτύσσονται δεσμοί υ- δρογόνου, έχει μεγάλη σημασία στη λειτουργία του μορίου. Χάρη σ' αυτήν η δίκλωνη έλικα σταθεροποιείται στο χώρο, αλλά και καθίστανται δυνατές λειτουργίες όπως η αντιγραφή και η μεταγραφή, τις οποίες οι μαθητές θα γνωρίσουν αργότερα. 12. Ρωτήστε αν μπορούν, τώρα που γνωρίζουν το μοντέλο της δίκλωνης έλικας και τα χαρακτηριστικά του, να απαντήσουν στο ερώτημα: είναι το DNA κατάλληλο για γενετικό υλικό, ικανοποιεί δηλαδή τις ιδιότητες που σημειώθηκαν πρωτύτερα στον πίνακα; (Η πληροφοριακότητά του και η σταθερότητά του εύ- 36

8 κολα αποδεικνύονται από την ποικιλία της διαδοχής των αζωτούχων βάσεων στους δύο κλώνους και από τους δεσμούς υδρογόνου που το σταθεροποιούν). Σε ό,τι αφορά όμως τη δυνατότητα της ακριβούς αντιγραφής του, μπο- ' ρείτε να περιοριστείτε λέγοντάς τους ότι κάθε κλώνος χρησιμεύει -με βάση την αρχή της συμπληρωματικότητας- για την δημιουργία ενός θυγατρικου και ότι έτσι κάθε μόριο DNA αυτοαντιγράφεται σε δύο πανομοιότυπα με αυτό μόρια. 13. Παρουσιάστε στους μαθητές τη δομή του RNA, τα είδη και τη βιολογική λειτουργία τους. Ζητήστε τους να διακρίνουν τα δύο είδη νουκλεϊνικών οξέων σε σχέση με τη σύστασή τους, τη δομή τους, τη θέση τους στο κύτταρο και το βιολογικό τους ρόλο. 37

9 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΑΣΚΗΣΕΙΣ ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ Ανίχνευση αμύλου, λίπους και πρωτεΐνης. Κατασκευή μακρομορίων με μοριακά μοντέλα ή με άλλα απλά υλικά. Παρατήρηση της μετουσίωσης των πρωτεϊνών. 38

10 ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q- ΟΗ Η -0- ΟΗ Η-0-ΟΗ Η-0-ΟΗ Η,Ο Η -DDDD-oh α = μονομερή, β = υδρόλυση, γ = μακρομόριο, δ = σύνθεση Τα μονομερή συνδέονται μεταξύ τους με ένα χημικό μηχανισμό, που λέγεται συμπύκνωση. Κατά τη συμπύκνωση το ένα μονομερές χάνει ένα άτομο υδρογόνου (Η), ενώ το άλλο μια υδροξυλομάδα (ΟΗ). Αφαιρείται δηλαδή τελικά ένα μόριο νερού. Στην υδρόλυση του μακρομορίου συμμετέχει το νερό. 2. Σημειώστε την ένδειξη Σ ή Λ δίπλα σε κάθε πρόταση, ανάλογα εάν το νόημά της είναι αντίστοιχα σωστό ή λάθος. α) Το μόριο του RNA διαφέρει από το μόριο του DNA, γιατί το RNA είναι κατά βάση μονόκλωνο. β) Το μόριο του DNA περιέχει την αζωτούχο βάση ουρακίλη (U). γ) Το μόριο του DNA περιέχει την πεντόζη ριβόζη. δ) Το μόριο του DNA αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες που σχηματίζουν διπλή έλικα. ε) Το μόριο του RNA περιέχει την αζωτούχο βάση θυμίνη (Τ). στ) Τα μονομερή των πρωτεϊνών είναι τα νουκλεϊκά οξέα. θ) Μία από τις ιδιότητες του DNA είναι να μεταφέρει τις γενετικές πληροφορίες αλλοιωμένες και τροποποιημένες στις δύο επόμενες γενιές, α)(σ), β)(α), γ)(λ), δ)(σ), ε)(λ), στ)(α), ζ)(λ). 3. Σημειώστε την ένδειξη Σ ή Λ δίπλα σε κάθε πρόταση, ανάλογα εάν το νόημά της είναι αντίστοιχα σωστό ή λάθος. α) To DNA είναι πρωτείνη. β) Τα νουκλεοτίδια είναι τα μονομερή των πρωτεϊνών. γ) Η δομή των πρωτεϊνικών μορίων καθορίζει τη λειτουργία τους.

11 δ) Το μονομερές των πρωτεϊνών είναι ένα σάκχαρο. ε) Κάθε αμινοξύ περιέχει στο μόριό του ένα σταθερό τμήμα που ονομάζεται πλευρική ομάδα. στ) Η έκθεση της πρωτείνης σε ακραίες τιμές ΡΗ ονομάζεται μετουσίωση, ζ) Η κατάταξη των πρωτεϊνών σε δομικές και λειτουργικές γίνεται με κριτήριο τη δομή τους. η) Οι υδατάνθρακες διακρίνονται μόνο σε μονοσακχαρίτες και δισακχαρίτες. θ) Οι δισακχαρίτες προκύπτουν από την συνένωση δύο νουκλεοτιδίων της α- δενίνης. ι) Οι πολυσακχαρίτες προκύπτουν από την συνένωση πολλών αμινοξέων. α)(λ), β)(λ), γ)(σ), δ)(λ), ε)(λ), στ)(σ), ζ)(λ), η)(λ), θ)(λ), ι)(λ). 40. Συμπληρώστε τα κενά ώστε οι προτάσεις να αποδίδουν το σωστό νόημα. Αν μία πρωτείνη αποτελείται μόνο από μια, το τελικό στάδιο της διαμόρφωσής της μπορεί να είναι μέχρι και η τριτοταγής δομή. Τα φωσφολιπίδια εμφανίζουν ένα ιδιαίτερο χαρακτηριστικό σε σχέση με το νερό. Η κεφαλή του μορίου τους είναι, ενώ αντίθετα η ουρά του μορίου τους είναι Τα στεροειδή ανήκουν στην ευρύτερη κατηγορία μακρομορίων των Η χοληστερίνη αποτελεί συστατικό των των Οι κύριοι πολυσακχαρίτες είναι η, το, και το Οι μονοσακχαρίτες διακρίνονται σε, και Η μαλτόζη προκύπτει από τη διάσπαση του με τη διαδικασία της Η λακτόζη είναι το σάκχαρο του Τα μονομερή των διαφορετικών ειδών μακρομορίων συνδέονται μεταξύ τους με τον ίδιο πάντοτε βασικό μηχανισμό, που ονομάζεται Κατά τη διαδικασία αυτή το ένα μονομερές χάνει ένα, ενώ το άλλο Αν μεταξύ των μακρομορίων αναζητούσες το πιο διαδεδομένο και πολυδιάστατο στη μορφή και τη λειτουργία μόριο, αργά ή γρήγορα θα κατέληγες στις Οι δύο κλώνοι του DNA συγκρατούνται μεταξύ τους με Το μόριο του DNA φέρει τις Το σύνολο των μορίων του DNA ενός κυττάρου αποτελεί το To DNA του ευκαρυωτικού κυπάρου βρίσκεται κυρίως μέσα στο. Μικρό μέρος του υπάρχει στα μιτοχόνδρια και στους ηολυπεπτιδική αλυσίδα, υδρόφιλη, υδρόφοβη, λιπιδίων, μεμβρανών, ζωικών, κυττάρων, κυτταρίνη, άμυλο, γλυκογόνο, τριόζες, πεντόζες, εξόζες, αμύλου, πέ-

12 ψης, γάλακτος, συμπύκνωση, άτομο, υδρογόνου, γενετικές, πληροφορίες, γενετικό, υλικό, πυρήνα, χλωροπλάστες. 5. Περιγράψτε τα τέσσερα επίπεδα οργάνωσης των πρωτεϊνών. Πρωτοταγής, δευτεροταγής, τριτοταγής και τεταρτοταγής δομή. Πα συμπλήρωση της απάντησης βλέπε την παράγραφο «Οργάνωση των πρωτεϊνικών μορίων», στο βιβλίο του μαθητή 6. Μια πρωτείνη χάνει την ενζυμική της δράση, μετά από θέρμανση στους 80 C. Πώς χαρακτηρίζεται το σχετικό φαινόμενο και πού οφείλεται. Χαρακτηρίζεται ως μετουσίωση και οφείλεται στην καταστροφή της τρισδιάστατης δομής του πρωτεϊνικού μορίου. Γ ια συμπλήρωση της απάντησης βλέπε την παράγραφο «Η δομή των πρωτεϊνικών μορίων καθορίζει τη λειτουργία τους». 7. To RNA διαφέρει από το DNA, γιατί το RNA: α. είναι μονόκλωνο β. περιέχει το σάκχαρο ριβόζη γ. έχει ουρακίλη δ. για όλα τα παραπάνω Επιλέξτε τη σωστή απάντηση. Η σωστή απάντηση είναι η δ. 8. Περιγράψτε τη δομή των νουκλεϊνικών οξέων (DNA, RNA). Αναφέρατε τις διαφορές των δύο μορίων σε ότι αφορά τη δομή, τη λειτουργία τους και τις περιοχές του κυπάρου όπου συναντώνται. Για την περιγραφή της δομής των νουκλεϊνικών οξέων βλέπε τις παραγράφους «Δομή και βιολογικός ρόλος του DNA» και «Δομή και βιολογικός ρόλος του RNA». Διαφορές στη δομή μεταξύ DNA και RNA. DNA 1. Τα νουκλεοτίδιά του περιέχουν δεσοξυριβόζη. 2. Αποτελείται από τις συμπληρωματικές βάσεις Α,ΓΓ και G/C. RNA 1. Τα νουκλεοτίδιά του περιέχουν ριβόζη. 2. Αντί της Τ περιέχει U. 3. Αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες, τους κλώνους, που σχηματίζουν δεξιόστροφη έλικα. 3. Είναι κατά βάση μονόκλωνο. Μερικές φορές αυτό το μονόκλωνο μόριο αναδιπλώνεται σε ορισμένα σημεία δημιουργώντας δίκλωνες περιοχές. 41

13 Διαφορές στη λειτουργία του DNA και του RNA. DNA 1. To DNA αποτελεί το γενετικό υλικό του κυττάρου και μεταφέρει τις γενετικές πληροφορίες. 2. Ελέγχει μέσω αυτών κάθε κυπαρική δραστηριότητα. 3. Μεταβιβάζει τις πληροφορίες α- ναλλοίωτες από γενιά σε γενιά. RNA 1. To RNA εμφανίζεται σε τεις διαφορετικούς τύπους: mrna, trna και rrna. Καθένας απ' αυτούς έχει ένα ιδιαίτερο βιολογικό ρόλο. (Για συμπλήρωση της απάντησης ο μαθητής να ανατρέξει στην αντίστοιχη παράγραφο του βιβλίου). 4. Επιτρέπει τη δημιουργία γενετικής ποικιλότητας. To DNA απαντάται στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. To RNA απαντάται στον πυρήνα, και στο κυπαρόπλασμα είτε ως συστατικό των ριβοσωμάτων (rrna) είτε ελεύθερο (trna, mrna). Επίσης απαντάται στα μιτοχόνδρια και στους χλωροπλάστες. 9. Αναφέρατε τους κυριότερους πολυσακχαρίτες και τον βιολογικό ρόλο του καθενός. Ποιες διαφορές εμφανίζουν στη δομή τους; Οι τρεις κύριοι πολυσακχαρίτες είναι: το άμυλο, το γλυκογόνο και η κυπαρίνη. Ο βιολογικός τους ρόλος συνίσταται στο ότι: η κυτταρίνη είναι συστατικό του κυτταρικού τοιχώματος στα φυτικά κύπαρα, το άμυλο αποταμιευτική ουσία στα φυτικά κύπαρα και το γλυκογόνο αποταμιευτική ουσία στα ζωϊκά κύπαρα και στα κύπαρα των μυκήτων. Κατά τη διάσπαση (υδρόλυση) του αμύλου και του γλυκογόνου αποδίδονται μόρια γλυκόζης. (Η απάντηση μπορεί να συμπληρωθεί από τις πληροφορίες που υπάρχουν στον πίνακα της αντίστοιχης παραγράφου.) Οι διαφορές που εμφανίζουν στη δομή τους είναι: το άμυλο σχηματίζει σπειροειδή αλυσίδα, το γλυκογόνο διακλαδισμένη, ενώ η κυπαρίνη ευθεία. 10. Η υπάλληλος του κυλικείου του σχολείου σας, σας προτείνει ένα επιδόρπιο, διαβεβαιώνπντάς σας, ότι δεν περιέχει υδατάνθρακες. Η ετικέτα του προϊόντος αναφέρει ότι περιέχει σακχαρόζη. Σας είπε την αλήθεια η υπάλληλος; Αιτιολογήστε την απάντησή σας. Η υπάλληλος του κυλικείου δεν λέει την αλήθεια, αφού η σακχαρόζη είναι έ- νας δισακχαρίτης και ως εκ τούτου ανήκει στους υδατάνθρακες. 42

14 11. Συμπληρώστε τον πίνακα που ακολουθεί: Μακρομόριο Μονομερές Λειτουργία DNA Δεσοξυριβονουκλεοτίδιο Στην αλληλουχία των βάσεων του κρύβεται ο γενετικός κώδικας Γλυκογόνο Γλυκόζη Αποθηκευτικός πολυσακχαρίτης στα ζωϊκά κύπαρα και τους μύκητες Ένζυμο Αμινοξύ Επιταχύνει τις βιοχημικές αντιδράσεις 12. Δικαιολογήστε γιατί είναι σημαντικός ο ρόλος της πλευρικής ομάδας (R) των αμινοξέων. Όταν η σειρά των αμινοξέων είναι διαφορετική, δημιουργούνται διαφορετικοί δεσμοί ανάμεσα στις πλευρικές ομάδες (R) των αμινοξέων στα διάφορα σημεία της πεπτιδικής αλυσίδας. Αυτό οδηγεί σε διαφορετική αναδίπλωση του μορίου επομένως σε διαφορετική τριτοταγή δομή. Η τρισδιάστατη δομή μιας πρωτεΐνης καθορίζει και τη λειτουργία της. 13. Αιτιολογήστε το γεγονός ότι το πλήθος των διαφορετικών πρωτεϊνών που υπάρχουν σε ένα κύτταρο, καθορίζει το πλήθος των διαφορετικών λειτουργιών και δομικών χαρακτηριστικών του. Με τον όρο διαφορετικές πρωτεΐνες εννοούμε εκείνες που έχουν διαφορετική πρωτοταγή δομή. Διαφορετική πρωτοταγής δομή σημαίνει και διαφορετική τριτοταγής δομή, άρα και διαφορετική λειτουργία. Για παράδειγμα, στο μυϊκό κύπαρο οι πρωτεΐνες ακτίνη και μυοσίνη συμβάλλουν στη μυϊκή συστολή, ταυτόχρονα στα οργανίδιά του υπάρχουν ένζυμα που εξυπηρετούν ενζυμικές αντιδράσεις. Κύπαρα που επιτελούν συγκεκριμένη λειτουργία περιέχουν συγκεκριμένη πρωτεΐνη, για να φέρουν σε πέρας τη λειτουργία αυτή, (για παράδειγμα τα ερυθρά αιμοσφαίρια περιέχουν αιμοσφαιρίνη.) 14. Μια πρωτείνη έχει μοριακό βάρος Αν η πρωτείνη αποτελείται από τέσσερις πολυπεπτιδικές αλυσίδες, που είναι ανά δύο όμοιες, η μία από αυτές έχει μοριακό βάρος και το μέσο μοριακό βάρος των αμινοξέων είναι 100 να βρείτε τον αριθμό των αμινοξέων κάθε πολυπεπτιδικής α- λυσίδας. Το Μ.Β. των πολυπεπτιδικών αλυσίδων είναι: και 8.000; Επομένως η μία 43

15 έχει 90 αμινοξέα και η άλλη 80 αμινοξέα αντίστοιχα. Άρα ο αριθμός των αμινοξέων είναι 90x2+80x2=340. Σημείωση: Η άσκηση μπορεί να λυθεί και λαμβάνοντας υπόψη την αφαίρεση νερού κατά το σχηματισμό του πεπτιδικού δεσμού. 44

16 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1. Η πρωτοταγής δομή ενός τριπεπτιδίου είναι Λ-Τ-Μ, ενώ κάποιου άλλου είναι Μ- Τ-Λ. (όπου: Λ=Λυσίνη, Τ=Τρυπτοφάνη, Μ=Μεθειονίνη). Τα δύο τριπεπτίδια είναι ίδια ή διαφορετικά; Να αιτιολογήσετε την απάντησή σας. 2. Μετά την προσθήκη κατάλληλων ενζύμων στο διάλυμα ενός εννεαπεπτιδίου, βρέθηκαν τα εξής τμήματα: Αλα-Λευ-Ασπ-Τυρ-Βαλ-Λευ, Τυρ-Βαλ-Λευ, Ασπ-Τυρ- Βαλ-Λευ, Ν-Γλυ-Προ-Αευ, και Ν-Γλυ-Προ-Λευ-Αλα-Λευ. Αν το Ν υποδηλώνει το άκρο των πεπτιδίων που είναι συνδεδεμένο με ελεύθερη αμινομάδα, να προσδιορίσετε τη πρωτοταγή δομή του εννεαπεπτιδίου. Ποιο αμινοξύ είναι συνδεδεμένο με ελεύθερη καρβοξυλομάδα; 3. Μιά πλήρης στροφή της έλικας του DNA, έχει μήκος 3,4 nm και περιέχει 10 ζευγάρια συμπληρωματικών αζωτούχων βάσεων. Αν ένα τμήμα DNA έχει μήκος nm και το 30% των βάσεων του είναι αδενίνες, να βρεθεί ο αριθμός κάθε είδους βάσεων και οι αριθμοί των φωσφοδιεστερικών δεσμών, και των δεσμών υδρογόνου του μορίου. 4. Ανάμεσα στις «παράξενες» ιδιότητες των ιών είναι και το ότι το γενετικό υλικό μερικών αντί για-dna είναι RNA, που μάλιστα μπορεί να είναι μονόκλωνο ή δίκλωνο. Στον πίνακα παρουσιάζεται ο αριθμός των αζωτούχων βάσεων που έχουν αποσπαστεί από το γενετικό υλικό τριών διαφορετικών ιών. Μπορείτε να διακρίνετε τι είδους γενετικό υλικό έχει ο καθένας τους; Δικαιολογήστε την απάντησή σας. Α ιός Β ιός Γ ιός Τ: 650 U: 830 U: 830 Α: 650 G: 715 G: 567 G:280 Α: 830 Α: 1080 C:280 0:715 C: Σε ένα μόριο DNA, στη μία από τις δύο πολυνουκλεοτιδικές αλυσίδες του, παρατηρείται λόγος αθροίσματος των αζωτούχων βάσεων της Α + G - ο,8. C "ft Ποιά είναι η τιμή του ιδίου λόγου στην συμπληρωματική της αλυσίδα; 6. Ποια κατηγορία λιπιδίων συμμετέχει κυρίως στη δομή των μεμβρανών; Ποιο χαρακτηριστικό τους παίζει καθοριστικό ρόλο στη διαμόρφωση της συγκεκριμένης δομής; 45

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα


ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου. 1.1 Η χημεία της ζωής 1.2 Μακρομόρια

Χημική σύσταση του κυττάρου. 1.1 Η χημεία της ζωής 1.2 Μακρομόρια Πρότυπο του μορίου της δεϋδρογονασης της αλκοόλης (ένζυμο), Οι μοβ σφαίρες αντιστοιχούν σε μορια συνένζυμου NAD. Χημική σύσταση του κυττάρου 1.1 Η χημεία της ζωής 1.2 Μακρομόρια ΔΙΔΑΚΤΙΚΟΙ ΣΤΟΧΟΙ Στο τέλος

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα


ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015)

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015) Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Ομαδοποιημένα ανά κεφάλαιο (σχολικό έτος 2014-2015) Ιωαννίδης Θωμάς Βιολόγος 11 ου ΓΕΛ Ηρακλείου 1 ΠΕΡΙΕΧΟΜΕΝΑ Εξεταστέα Ύλη 2014-15.. σελ.3 1 ο Κεφάλαιο..σελ.

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1 ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1 ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΕΡΩΤΗΣΕΙΣ ΤΟΥ ΣXOΛΙΚΟΥ ΒΙΒΛΙΟΥ 1. Τοποθετήστε, στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα.

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα



Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις:

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: ΘΕΜΑ Β: Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΟ: 1 1. Τι είναι τα µακροµόρια και ποια είναι η δοµή τους; (SOS) Σελίδα 20: Οι πρωτεϊνες.ονοµάζεται συµπύκνωση. ΜΑΚΡΟΜΟΡΙΑ ΟΜΙΚΟΙ ΛΙΘΟΙ ΕΝ ΙΑΜΕΣΑ ΣΥΣΤΑΤΙΚΑ 1) ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ

Διαβάστε περισσότερα

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του;

ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; ΑΣΚΗΣΗ 1 Δύο αμινοξέα Α, και Β, συνιστούν ένα διπεπτίδιο. Το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του. Ποια είναι η δομή του; Β-Α γιατί το αμινοξύ Α έχει ελεύθερη την καρβοξυλομάδα του άρα θα γράφεται

Διαβάστε περισσότερα


«ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» «ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» Τι είναι οι πρωτεΐνες; Από τι αποτελούνται; Ποιος είναι ο βιολογικός του ρόλος; Ας ρίξουμε μία ματιά σε όλα αυτά τα ερωτήματα που μας απασχολούν ΚΕΦΑΛΑΙΟ 1:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία(Γενικής(Παιδείας Β Λυκείου

Βιολογία(Γενικής(Παιδείας Β Λυκείου Βιολογία(Γενικής(Παιδείας Β Λυκείου Ελληνογαλλική Σχολή Jeanne D Arc 2011-2012 Δημοσθένης Καρυοφύλλης email: dkariofi@e-biology.gr www.ibrain.gr Κεφ. 1 ο Χημική σύσταση του κυττάρου Χαρακτηριστικά των

Διαβάστε περισσότερα

α) Σε ποια σημεία ενός ευκαρυωτικού κυττάρου που βρίσκεται στη μεσόφαση, μπορούμε να εντοπίσουμε μόρια DNA; (6μ)

α) Σε ποια σημεία ενός ευκαρυωτικού κυττάρου που βρίσκεται στη μεσόφαση, μπορούμε να εντοπίσουμε μόρια DNA; (6μ) ΘΕΜΑ Β: Ι. Οι πολυσακχαρίτες αποτελούν μια πολύ διαδεδομένη ομάδα μακρομορίων στα ζωικά και φυτικά κύτταρα. Να απαντήσετε στις ερωτήσεις: α) Ποιοι είναι οι κύριοι πολυσακχαρίτες και ποιο είναι το κοινό

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους:

2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ Οι οργανικές ουσίες είναι εξαιρετικά χρήσιμες για όλους τους ζωντανούς οργανισμούς για τρεις κύριους λόγους: (α) Αποτελούν βασικά δομικά συστατικά του σώματος (β) Εξυπηρετούν ενεργειακές

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Το νερό και οι ιδιότητές του Οι µοναδικές φυσικοχηµικές ιδιότητες του νερού οφείλονται στο ότι:

Το νερό και οι ιδιότητές του Οι µοναδικές φυσικοχηµικές ιδιότητες του νερού οφείλονται στο ότι: Το νερό και οι ιδιότητές του Οι µοναδικές φυσικοχηµικές ιδιότητες του νερού οφείλονται στο ότι: το µόριο του είναι πολύ µικρό, είναι πολικό και µεταξύ των µορίων του σχηµατίζονται δεσµοί υδρογόνου. Οι

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΗΝΟ 3 ΝΗ 3 Η 2 Ο Μονάδες 3 β) Ποιο από τα παραπάνω ζεύγη, στο ίδιο υδατικό διάλυµα, µπορεί να αποτελέσει ρυθµιστικό διάλυµα; Μονάδες 2 ΑΠ.

ΗΝΟ 3 ΝΗ 3 Η 2 Ο Μονάδες 3 β) Ποιο από τα παραπάνω ζεύγη, στο ίδιο υδατικό διάλυµα, µπορεί να αποτελέσει ρυθµιστικό διάλυµα; Μονάδες 2 ΑΠ. ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 12 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΕΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ 1 ο Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1.Ποια χηµικά στοιχεία συµµετέχουν στην σύνθεση των µορίων των οργανισµών σε σηµαντικό βαθµό; (σελ.18) 2. Γιατί είναι σηµαντικά τα ιχνοστοιχεία;(σελ.18)

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ


Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια

BIO111 Μικροβιολογια ιαλεξη 3. Κυτταρικη Χηµεια BIO111 Μικροβιολογια ιαλεξη 3 Κυτταρικη Χηµεια Mικροβιολογία = Bιολογία των µονοκύτταρων οργανισµών και των ιών H µεγάλη σας φίλη Το βακτηριο E.coli 1.000.000X C Γλυκόζη trna αντισωµα ριβοσωµα ATP DNA

Διαβάστε περισσότερα