Βιολογία Β Λυκείου. Απλά και περιληπτικά

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Βιολογία Β Λυκείου. Απλά και περιληπτικά"

Transcript

1 Βιολογία Β Λυκείου Απλά και περιληπτικά Καλαϊτζής Στυλιανός Μόναχο, 2007

2 Το παρόν έργο πνευµατικής ιδιοκτησίας προστατεύεται κατά τις διατάξεις της ελληνικής νοµοθεσίας (Ν.2121/1993 όπως έχει τροποποιηθεί και ισχύει µέχρι σήµερα) και τις διεθνείς συµβάσεις περί πνευµατικής ιδιοκτησίας. Απαγορεύεται απολύτως η άνευ γραπτής άδειας του συγγραφέα κατά οποιονδήποτε τρόπο ή µέσο (ηλεκτρονικό, µηχανικό ή άλλο) αντιγραφή, φωτοανατύπωση και εν γένει αναπαραγωγή, εκµίσθωση ή δανεισµός, µετάφραση, διασκευή, αναµετάδοση στο κοινό σε οποιαδήποτε µορφή και η εν γένει εκµετάλλευση του συνόλου ή µέρους του έργου. Dieses Werk ist urheberrechtlich geschützt. Alle Rechte, auch die der Übersetzung, des Nachdrucks und der Vervielfältigung des Buches- oder von Teilen daraus sind vorbehalten. Kein Teil des Werkes darf ohne schriftliche Genehmigung des Autors in irgendeiner Form (Fotokopie, Mikrofilm oder ein anderes Verfahren), auch nicht für Zwecke der Unterrichtsgestaltung, reproduziert oder unter Verwendung elektronischer Systeme verarbeitet werden. Zuwiderhandlungen unterliegen den Strafbestimmungen des Urheberrechtsgesetztes. Der Inhalt des Werkes wurde sorgfältig erarbeitet. Dennoch übernimmt der Autor für die Richtigkeit von Angaben, Hinweisen und Ratschlägen sowie für eventuelle Druckfehler keine Haftung. Εισαγωγή Το παρόν έγγραφο είναι µια περίληψη της ύλης που διδάσκεται στα σχολεία των οµογενών στο Μόναχο. Περιλαµβάνει τα κεφάλαια 1,2,3 και το 4 µέχρι την σελίδα 133 (κεφάλαιο 4.2). Η ύλη αυτή συνήθως υπερκαλύπτει την ύλη που διδάσκεται στο σχολείο. Οι συµειώσεις ενδεικνείονται για µια επανάληψη ή σαν Handout την ώρα του επαναληπτικού µαθήµατος. Επειδή περιέχουν µόνο τα σηµαντικότερα σηµεία δεν συνίσταται η µελέτη των σηµειώσεων µόνο. Σ αυτό το σηµείο θέλω να επισηµάνω ότι το φυλλάδιο περιέχει πολλά λάθη και πληροφορίες οι οποίες δεν ισχύουν (το ότι υπάρχουν µόνο 20 αµινοξέα, πάρα πολλά σηµεία στο κεφάλαιο 2 µέχρι την περιγραφή του ευκαρυωτικού κυττάρου, ειδικά στους µηχανισµούς που περιγραφουν τη µεταφορά ουσιών), οι οποίες υπάρχουν εις γνώση του συγγραφέα, έτσι ώστε το φυλλάδιο να είναι σε πλήρη νοηµατική ταύτιση µε το βιβλίο, το οποίο περιέχει πολλά λάθη/ή παραλείψεις στους βασικούς µηχανισµούς και λειτουργίες του κυττάρου. Σκοπός του φυλλαδίου είναι η καλύτερη προετοιµασία για τις εξετάσεις και λιγότερο η απολύτως σωστή µετάδωση γνώσεων. Όπου γινόταν βέβαια έχει γίνει διόρθωση ή διασαφήνηση. Επίσης θέλω να ευχαριστήσω τους κατόχους πνευµατικής ιδιοκτησίας των εικόνων που µου επέτρεψαν να τις χρησιµοποιήσω. Για οποιαδήποτε κριτική ή πληροφορία: Εύχοµαι καλή επιτυχία στις εξετάσεις Μόναχο, Στυλιανός Καλαϊτζής

3 Βιολογία Β Λυκείου Κυριότερα σηµεία - Περίληψη 1.1 Χηµεία της ζωής Η αναλογία των χηµικών στοιχείων του οργανισµού είναι διαφορετική από την αναλογία στο περιβάλλον. Στον οργανισµό τα κυριότερα στοιχεία είναι H,O,C,N. Τα στοιχεία αυτά µπορούν να αναπτύσσουν οµοιοπολικούς δεσµούς (και µεταξύ τους) εκτος του H και πολλαπλούς. Αυτό οδηγεί σε µεγάλη ποικιλία ενώσεων. Τα υπόλοιπα 23 (από 27) στοιχεία του οργανισµού υπάρχουν σε µικρή αναλογία και ονοµάζονται ιχνοστοιχεία (πχ. φώσφορο, θείο, νάτριο, κάλιο κτλ. Σε οποιοδήποτε µπουκάλι νερου αναγράφονται). Το νερό είναι πολύ σηµαντικό γιατι κάθε κύτταρο α) βασικά ζει µέσα στο νερό β) περιέχει 80% νερό) 1.2 Μακροµόρια - γενικά Πολλά µόρια αποτελούνται απο ίδιες, επαναλαµβανόµενες µονάδες όπως πχ. ένα κολιέ αποτελείται από πολλές χάντρες. Οι ίδιες µονάδες (χάντρες) ονοµάζονται µονοµερή και το µεγάλο µόριο (κολιέ) πολυµερές ή µακροµόριο. Τα µονοµερή συνδέονται µεταξύ τους µε οµοιοπολικούς δεσµούς, που έχουν ιδιαίτερη ονοµασία αναλόγως το µακροµόριο που βρίσκονται (δες πίνακα) Μονοµερές Πολυµερές εσµός Αµινοξύ Πολυπεπτίδιο (Πρωτεϊνη) Πεπτιδικός Νουκλεοτίδιο Νουκλεϊκό οξύ (DNA ή RNA) (3'-5' φωσφοδιεστερικός) Μονοσακχαρίτες Πολυσακχαρίτες Γλυκερίνη, Λιπαρά οξέα Λιπίδια Άλλοι δεσµοί που συναντώνται: υδρογόνου, υδρόφοβοι, Van der Waals (όχι τόσο σταθεροί)(σηµασία στη δευτεροταγή ή τριτοταγή δοµή). Όταν ενώνονται µονοµερή για να φτιάξουν πολυµερές (µε σχηµατισµό νερου), ονοµάζεται συµπύκνωση. Το αντίθετο (σπάσιµο του πολυµερούς σε µονοµερή, χρειάζεται νερό) υδρόλυση.

4 Πρωτεϊνες οµή: Αποτελούνται από πολλά αµινοξέα. Κάθε αµινοξύ έχει ένα σταθερό τµήµα και ένα µεταβλητό (R) που ονοµάζεται πλευρική οµάδα. Αναλόγως το µεταβλητό τµήµα έχουµε και διαφορετικό αµινοξύ. Υπάρχουν σύµφωνα µε το βιβλίο σας- 20 διαφορετικά αµινοξέα που χρησιµοποιούνται στις πρωτεϊνες. Αν ενώσουµε 2 αµινοξέα σχηµατίζεται διπεπτίδιο, αν ενώσουµε 3 τότε εχουµε ενα τρίπεπτίδιο κ.ο.κ. Πολλά (πάνω από 50) µας κάνουν ένα πολυπεπτίδιο. Στις πρωτεϊνες διακρίνουµε 4 επίπεδα οργάνωσης: Πρωτοταγής δοµή: Αλληλουχία των αµινοξέων, δηλ. η σειρά των αµινοξέων. ευτεροταγής δοµή: Στην πραγµατικότητα όµως τα αµινοξέα δεν είναι απλώς µια αλυσίδα, αλλα αναδιπλώνονται σε έλικα η πτυχωτό φύλλο. Τριτοταγής δοµή: 3D δοµή (διαµόρφωση) της αλυσίδας στο χώρο Τεταρτοταγής δοµή: Αν µια πρωτεϊνη αποτελείται από περισσότερες πολυπεπτιδικές αλυσίδες τότε υπάρχει µια τεταρτοταγής δοµή που δείχνει την διαµόρφωση όλων των αλυσιδών. ιαφορετική πρωτεϊνη ιαφορετική αλληλουχία αµινοξέων (1 ο ταγή µορφή) ιαφορετική 2 ο, 3 ο, 4 ο ταγή µορφή ιαφορετική λειτουργία. Λειτουργία: α) οµικές πρωτεϊνες: οµικός λίθος των κυττάρων β)λειτουργικές πρωτεϊνες: Κάνουν κάποια δουλειά (πχ. αιµοσφαιρίνη: µεταφορά οξυγόνου) Σε ακραίες τιµές ph ή θερµοκρασίας, σπάνε οι διάφοροι δεσµοί (εκτός από τους πεπτιδικους) και το µόριο χάνει τη τρεισδιάστατη µορφή του(και έτσι και τη λειτουργικότητά της). Τότε µιλάµε για µετουσίωση.

5 Νουκλεϊκά οξέα Είναι το RNA (Ρίβονουκλεϊκό οξύ ή DNΑ δεοξυριβονουκλεϊκό οξύ). Αποτελούνται από πολλά νουκλεοτίδια. Κάθε νουκλεοτίδιο που απαντάται στο RNA ή DNA αποτελείται από Αζωτούχα βάση (A,T, C, G, U) Πεντόζη (Ρίβόζη ή εσοξυριβόζη) Φωσφορική οµάδα ύο νουκλεοτίδια στη σειρά:δινουκλεοτίδιο κ.ο.κ. Πολλά νουκλεοτίδια: πολυνουκλεοτίδιο (νουκλεϊκό οξύ) ιαφορές RNA-DNA DΝΑ είναι δίκλωνο περιέχει δεοξυριβόζη για πεντόζη θυµίνη για αζωτούχα βάση RΝΑ είναι µονόκλωνο περιέχει ριβόζη για πεντόζη ουρακίλη για αζωτούχα βάση Μοντέλο Watson&Crick για δοµή DΝΑ Το DNA αποτελείται από 2 πολυνουκλεοτιδικές αλυσίδες που σχηµατίζουν διπλή έλικα. Οι αζωτούχες βάσεις είναι κάθετες στον κύριο άξονα του µορίου και προεξέχουν στο εσωτερικό του. Οι βάσεις των δυο αλυσιδών συνδέονται µεταξύ τους µε δεσµούς υδρογόνου. εν ενώνονται όµως τυχαία. Κάθε γουανίνη µε κυτοσίνη (3 δεσµούς υδρογόνου) και κάθε αδενίνη µε θυµίνη (DNA) ή ουρακίλη (RNA) και αντίστροφα (2 δεσµούς υδρογόνου). Τα ζεύγη των βάσεων ονοµάζονται συµπληρωµατικά. Ρόλος DNA Φέρει γενετικές πληροφορίες (πχ. αν κάποιος έχει µπλέ ή πράσινα µάτια) Να ελέγχει κάθε κυτταρική δραστηριότητα Να µεταβιβάυει αναλλοίωτες απο κύτταρο σε κύτταρο και από γενιά σε γενία. Να επιτρέπει τη δηµιουργία γενετικής ποικιλοµορφίας Αυτό το κοµµατι είναι δυσνόητο, γιατι δεν αναλύεται καθόλου. Γενικώς να γνωρίζετε ότι το DNA ενός κυττάρου αποτελεί το γενετικό υλικό.

6 οµή και Ρόλος RNA οµή: Μονόκλωνο (δίκλωνα τµήµατα: δες σχήµα). Ρόλος: mrna: (αγγελιοφόρο rna): µεταφέρει τη γενετική πληροφορία (πχ. χρώµα µατιών) στα ριβοσώµατα. trna: (µεταφορικό rna): µεταφέρει αµινοξέα στα ριβοσώµατα rrna (ριβοσωµικό rna): συστατικό ριβοσωµάτων Υδατάνθρακες Ρόλος: Αποθήκη ενέργειας (κυρίως), δοµικά συστατικά Μόνοσακχαρίτες: Τριόζες ενδιάµεσα προϊόντα φωτοσύνθεσης & αναπνοής Πεντόζες ριβόζη, δεοξυριβόζη (συστατικά νουκλεοτιδίων) Εξόζες: Πηγές ενέργειας (γλυκόζη, γαλακτόζη, φρουκτόζη) ισακχαρίτες: Ένωση από δύο µονοσακχαρίτες (συγκεκτιµένα εξόζες) Μαλτόζη γλυκόζη + γλυκόζη Σακχαρόζη γλυκόζη + φρουκτόζη Λακτόζη γλυκόζη + γαλακτόζη Πολυσακχαρίτες: Αποτελούνται από πολλες γλυκόζες ενωµένες µεταξύ τους µε οµοιοπολικό δεσµό Κυτταρίνη συστατικό κυτταρικού τοιχώµατος (φυτά) ευθεία αλυσίδα Άµυλο αποθήκη ενέργειας (φυτά) διακλαδιζόµενη αλυσίδα Γλυκογόνο αποθήκη ενέργειας (ζώα) διακλαδιζόµενη αλυσίδα Οι παραπάνω πληροφορίες βρίσκονται σε πλαίσια στο βιβλίο. Θεωρητικά δεν είναι στην ύλη. εν είναι βασικές, αλλά αυτό βέβαια κρίνεται από τον έκαστο καθηγητή.

7 Λιπίδια α) Oυδέτερα Λίπη (τριγλυκερίδια) Αποτελούνται απο 3 µόρια λιπαρών οξέων + ένα µόριο γλυκερόλης ιακρίνονται σε κορεσµένα µόνο απλοί δεσµοί υγρα συχνότερα στα φυτά (ελαιόλαδο) Και ακόρεστα και διπλοί δεσµοί στερεά συχνότερα στα ζώα (βούτηρο) Ρόλος: Αποθήκη ενέργειας και -ιδιαίτερα σε µερικά ζωα-θερµοµονωτικός. β) Φωσφολιπίδια Αποτελείται από 2 λιπαρά οξέα + γλυκερόλη + φωσφορικό οξύ + µικρό πολικό µόριο Έχουν µια υδρόφιλη κεφαλή και µια υδρόφοβη ουρά. Γι αυτό το λόγο όταν τοποθετηθούν σε νερό παίρνουν τη µορφή που φαίνεται στο σχήµα, έτσι ώστε τα υδρόφοβα να «κρύβονται» στο εσωτερικό. Στην ιδιότητα αυτή στηρίζεται η ικανότητα να σχηµατίζουν διπλοστοιβάδες και γι αυτόν τον λόγο τα φωσφολιπίδια είναι συστατικά των µεµβρανών του κυττάρου (κεφάλαιο 3). γ) Στεροειδή Έχουν διαφορετική δοµή. Παράδειγµα: χοληστερόλη συστατικό µεµβράνων

8 2. Εισαγωγή Κυτταρική θεωρία Όλοι οι οργανισµοί αποτελούνται από κύτταρα και από κυτταρικά οργανίδια Όλα τα κύτταρα αποτελούνται από τις ίδιες χηµικές ενώσεις και εκδηλώνουν παρόµοιες µεταβολικές διεργασίες Τα κύτταρα δρούν και αλληλεπιδρουν συλλογικά και έτσι λειτουργεί ο οργανισµός. Κάθε κύτταρο προέρχεται από τη διαίρεση προϋπάρχοντος κυττάρου ιαφορές ευκαριωτικού / προκαρυωτικού κυττάρου Ευκαρυωτικά κύτταρα Έχουν (καλά σχηµατισµένο) πυρήνα Είναι εξελικτικά πιο νέα Έχουν πολλά κυτταρικά οργανίδια Το DNA στο πυρήνα είναι σε ευθεία (στα µιτοχόνδρια και χλωροπλάστες είναι όµως κυκλικό) Προκαρυωτικά κύτταρα εν έχουν πυρήνα Προϋπήρξαν των ευκαρυωτών εν έχουν κυτταρικά οργανίδια που περιβάλλονται από στοιχειώδη µεµβράνη Τo DNA είναι κυκλικό 2.1 Πορτραίτο ευκαρυωτικού κυττάρου εν λέει τίποτα συγκεκριµένο... καντε το µια ανάγνωση. Λέει ότι τα κύτταρα διαφέρουν µεταξύ τους πάρα πολύ θα µιλάµε για ένα «τυπικό κύτταρο» και µερικά άλλα πληροφοριακά στοιχεία.

9 2.2 Πλασµατική µεµβράνη οµή: Το µοντέλο που έχει το βιβλίο σας (ολίγον τι απαρχαιωµένο - σε γενικά πλαίσια όµως είναι σωστό) είναι του ρευστού µωσαϊκού. Υπάρχει µια διπλοστοιβάδα φωσφολιπιδίων (κεφαλές πρός τα έξω, ουρές προς τα µέσα) και µέσα σε αυτήν υπάρχουν διάφορα άλλα χηµικά µόρια (γι αυτό «µωσαϊκό») όπως πρωτεϊνες, υδατάνθρακες, άλλα λιπίδια (πχ. χοληστερόλη), γλυκοπρωτεϊνες, γλυκολιπίδια κτλ. Αυτά τα µόρια µπορούνε να µετακινηθούν πλαγίως (γι αυτό «ρευστό») πολύ εύκολα, αλλά πολύ σπάνια από την µία στοιβάδα στην άλλη. Κάθε µεµβράνη που είναι σαν την παραπάνω ονοµάζεται στοιχειώδης µεµβράνη. Ρόλος: Εκλεκτική διαπερατότητα: Η διαπερατότητα της µεµβράνης για διάφορες ουσίες µπορεί να ρυθµιστεί, δηλ. η µεµβράνη αφήνει επιλεκτικά να περάσουν µερικές ουσίες, ενώ αλλές τις αφήνει λιγότερο ή καθόλου. έκτης µυνηµάτων: Επίσης η µεµβράνη υποδέχεται και ερµηνεύει µυνήµατα από το περιβάλλον του κυττάρου. (Το «ερµηνεύει» είναι ψιλολάθος, αλλά έτσι το έχει το βιβλίο σας). Πληροφοριακά: γνωστό παράδειγµα: ορµόνες. Μεταφορά ουσιών Η µεταφορά των ουσιών µπορεί να γίνει χωρίς κατανάλωση ενέργειας (παθητική µεταφορά) µε κατανάλωση ενέργειας (ενεργητική µεταφορα) ενδο- ή εξωκύττωση (βασικά ανήκει στην ενεργητική µεταφορα, αλλά το βιβλίο σας το βάζει σε ξεχωριστή κατηγορία)

10 Παθητική µεταφορά: ιάχυση: Αν ρίξουµε λίγο χρώµα σε ένα ποτήρι νερό θα δούµε ότι σιγά σίγα το χρώµα θα πάει σε ολόκληρο το ποτήρι και δεν θα µείνει µόνο στο σηµείο που εµείς το ρίξαµε. Το φαινόµενο αυτό ονοµάζεται διάχυση. Επιστηµονικά: διάχυση είναι το φαινόµενο κατά το οποίο περισσότερα µόρια κινούνται από την υψηλή συγκέντρωση στη χαµηλή. Επακόλουθο της διάχυσης είναι να εξισσοροπούνται οι συγκεντρώσεις τα διαλύµατα. Ώσµωση: Για να παρατηρήσουµε το φαινόµενο της ώσµοσης, πρέπει να έχουµε δυο διαλύµατα διαφορετικών συγκεντρώσεων που να διαχωρίζονται από µια µεµβράνη που άφηνει να περάσουν µόνο µόρια νερού. Αυτή ή µεµβράνη που είναι διαπερατή µόνο για νερό ονοµάζεται ηµιπερατή. Video: Αν κάνουµε το παραπάνω πείραµα θα παρατηρήσουµε ότι τα περισσοτερα µόρια νερού κινούνται από το διάλυµα χαµηλής συγκέντρωσης στο διάλυµα υψηλής συγκέντρωσης. Αποτέλεσµα: το πυκνο διάλυµα αραιώνει (αφου δέχεται νερό) και το αραιό διάλυµα πυκνώνει (αφού φεύγει νερό) και πάλι εξισσοροπούνται οι συγκεντρώσεις. Σηµείωση: µπορεί να είναι οποιοδήποτε υγρό, δεν πρέπει να είναι οπωσδήποτε νερό. Ενεργητική µεταφορά: Μεταφορά ιόντων µέσω αντλίας: Ένα παράδειγµα είναι η αντλία Να + - Κ +. Αυτή η αντλία είναι µια πρωτεϊνη που µε καταλάλωση ενέργειας µεταφέρει 3 ιόντα Να + προς τα έξω (µπορείτε να θυµόσαστε Να Νach aussen) για κάθε 2 ιόντα Κ + προς τα µέσα. Έτσι µπορεί να υπάρχει και να διατηρείται διαφορά συγκεντρώσεων µεταξύ µέσα στο κύτταρο και έξω από το κύτταρο. Μεταφορά µε ενδοκύττωση εξωκύττωση: Για να µεταφερθούν µεγάλα µόρια χρησιµοποιείται συνήθως η ενδοκύττωση ή εξωκύττωση. Στην ενδοκύττωση σχηµατίζεται εγκόλπωση γύρω από το µόριο που είναι να µπει (γύρω από προεκβολές του κυτταροπλάσµατος που ονοµάζονται ψευδοπόδια). Στη συνέχεια η εγκόλπωση περισφίγγεται και το κυστίδιο εισέρχεται στο κύτταρο. Έξωκύττωση είναι η αντίστροφη διαδικασία κατά την οποία το µόριο (ή τα µόρια) εξέρχεται από το κύτταρο. Σε περίπτωση που ενδοκυττώνεται κυρίως µεγάλη, στερεά ουσία µιλάµε για φαγοκύττωση. Παράδειγµα: θρέψη σε πρωτόζωα ή και σε λευκά αιµοσφαίρια (άµυνα) του αίµατος. Σηµείωση: είτε τα σχήµατα του βιβλίου. Έτσι µαθαίνονται ευκολότερα!

11 Πλασµατική µεµβράνη ως δέκτης µυνηµάτων: Τα κύτταρα κατά κάποιο τρόπο «µιλάνε» µεταξύ τους. Ανταλλάζουν συνεχώς µυνήµατα και έτσι µπορούν: Να αναγνωρίζονται µεταξύ τους και να κάνουν ιστούς. Όσα αναγνωριστούν ως ξένα απορρίπτονται ή εξοντώνονται. Συντονίζουν τη δράση τους. Τροποποιούν την λειτουργία τους, αναλόγως τα µυνήµατα από το περιβάλλον. Η αναγνώριση επιτελείται (γίνεται) χάρη σε γλυκοπρωτεϊνες/γλυκολιπίδια. 2.3 Μια περιήγηση στο εσωτερικό του κυττάρου Τώρα που γνωρίσαµε την κυτταρική µεµβράνη, ας δούµε και τι έχει µέσα της αυτή!!! Το βασικό υγρό µέσα στο κύτταρο, στο οποιό «κολυµπάνε» όλα τα οργανίδια και ουσίες ονοµάζεται κυτταρόπλασµα (εκτός στον πυρήνα εκεί ονοµάζεται πυρηνόπλασµα). Οργανίδια είναι διάφορες δοµές που θα βρούµε σε ένα κύτταρο που το καθένα κάνει και διαφορετική δουλειά: Πυρήνας οµή: Κατά κανόνα υπάρχει ένας πυρήνας σε κάθε κύτταρο (υπάρχουν και εξαιρέσεις). Το σχήµα του είναι σφαιρικό ή ωοειδές. Ο πυρήνας περιβάλλεται από δυο στοιχειώδεις µεµβράνες που µαζί ονοµάζονται πυρηνικός φάκελος ή πυρηνική µεµβράνη. Υπάρχουν πόροι για την πυρηνοκυτταροπλασµατική επικοινωνία, οι πυρηνικοί πόροι. Στον πυρήνα µπορούµε να δούµε τον πυρηνίσκο, όπου γίνεται η σύνθεση rrna. Ρόλος: α) φυλάσσει το γενετικό υλικό (DNA). β) στον πυρήνα διπλασιάζεται το γενετικό υλικό και έτσι µεταβιβάζονται από κύτταρο σε κύτταρο και από οργανισµό σε οργανισµό. γ) Στον πυρήνα συντίθεται το RNA. Περισσότερες πληροφορίες για αυτές τις διαδικασίες στο 4 ο κεφάλαιο Ενδοµεµβρανικό σύστηµα Στο κύτταρο υπάρχουν µερικά οργανίδια που όλα µαζί αποτελούν το ενδοµεµβρανικό σύστηµα. Αυτά είναι το ενδοπλασµατικό δίκτυο, το σύµπλεγµα Golgi, τα λυσοσώµατα, τα υπεροξειδιοσώµατα και κενοτόπια.

12 Ενδοπλασµατικό δίκτυο Το ενδοπλασµατικό δίκτυο είναι ένα δίκτυο στοιχειωδών µεµβράνων που συχνά είναι συνδεδεµένο µε τον πυρηνικό φάκελο, την πλασµατική µεµβράνη ή τις µεµβράνες των άλλων οργανιδίων. Χωρίζεται σε αδρό και λείο ενδοπλασµατικό δίκτυο, αναλόγως αν έχει (αδρό) ή δεν έχει (λείο) ριβοσώµατα. Είναι κοινός αγωγός µεταφοράς και τροποποίησης των πρωτεϊνών. Το λείο ενδοπλασµατικό δίκτυο έχει κυρίως άλλες λειτουργίες όπως τη σύνθεση λιπιδίων και εξουδετέρωση τοξικών ουσιών κα. Τα ριβοσώµατα είναι οργανίδια χωρίς µεµβράνη, όπου γίνεται η σύνθεση πρωτεϊνών. Αποτελούνται από rrna και πρωτεϊνες. Μπορεί να υπάρχουν ελεύθερα στο κυτταρόπλασµα ή συνδεδεµένο στο αδρό E. Σύµπλεγµα Golgi Αποτελείται από παράλληλες οµάδες κυστιδίων που αποτελούνται από απλή στοιχειώδη µεµβράνη. Το σύµπλεγµα Golgi συγκεντρώνει και τροποποιεί τις πρωτεϊνες και απο εκεί οι πρωτεϊνες πακετάρονται και στέλνονται στο µέρος που χρειάζονται µέσα ή έξω από το κύτταρο. Λυσοσώµατα Σφαιρικά οργανίδια που περιβάλλονται από στοιχειώδη µεµβράνη. Περιέχουν υδρολυτικά ένζυµα που τεµαχίζουν τα άχρηστα και πολλές φορές επικίνδυνα µόρια. Μπορεί να πει κάποιος ότι τα λυσωσόµατα είναι τα εργοστάσια ανακύκλωσης. Υπεροξειδιοσώµατα Και αυτά είναι σφαιρικά και περιβάλλονται από στοιχειώδη µεµβράνη. Σε ηπατικά και νεφρικά κύτταρα γίνεται µετατροπή του οινοπνεύµατος σε ακεταλδεϋδη και έτσι αποτοξινώνεται ο οργανισµός. Κάνουν και µια χηµική µετατροπή απ όπου πήραν και το ονοµά τους. Η 2 Ο 2 Η 2 Ο + 1/2 Ο 2 Υπεροξείδιο του νερό οξυγόνο Υδρογόνου (τοξικό) Κενοτόπια Ονοµάζεται έτσι όποιο κυστίδιο έχει υδατώδες υγρό, περιβάλλεται από απλή στοιχειώδης µεµβράνη (και δεν ανήκει στις παραπάνω κατηγορίες). Πεπτικά κενοτόπια: έχουν τροφή ή ολόκληρο µικροοργανισµό Χυµοτόπιο: υπάρχει στα κύτταρα και είναι ένας µεγάλος αποθηκευτικός χώρος για διάφορες ουσίες.

13 Χλωροπλάστες και Μιτοχόνδρια Οι χλωροπλάστες (µόνο στα φυτά) και τα µιτοχόνδρια (όλοι οι ευκαρυώτες) είναι «εργοστάσια παραγωγής ενέργειας». Η βασική διαφορά: στους χλωροπλάστες η ενέργεια προέρχεται κυρίως από τη φωτοσύνθεση, δηλ. άµεσα από ηλιακή ενέργεια, ενώ στα µιτοχόνδρια από χηµικές ουσίες. Τα µιτοχόνδρια και οι χλωροπλάστες έχουν και άλλα κοινά σηµεία. Περιέχουν κυκλικό DNA, ένζυµα και ριβοσώµατα, πράγµα που τους εξασφαλίζει µια σχετική αυτονοµία. Έχουν διπλή στοιχειώδη µεµβράνη. Στους χλωροπλάστες είναι και οι δυο λείες, ενώ στα µιτοχόνδρια η εσωτερική έχει πτυχώσεις. Χλωροπλάστες Βρίσκονται στα πράσινα τµήµατα των φυτών και περιέχουν χλωροφύλλη (γι αυτόν τον λόγο το χρώµα). Το εσωτερικό υγρό ονοµάζεται στρώµα και υπάρχει ένα σύστηµα µεµβρανών που σχηµατίζουν σωρούς (σαν κέρµατα το ένα πάνω στο άλλο) που ονοµάζονται grana. Οι σωροί αυτοί συνδέονται µε δοµές που ονοµάζονται ελασµάτια. Μιτοχόνδριο Το εσωτερικό υγρό ονοµάζεται εδώ µήτρα. Το σχήµα τους µπορεί να ποικίλει, καθώς και ο αριθµός τους. Κύτταρα όπως τα µυϊκά που έχουν αυξηµένες απαιτήσεις ενέγειας έχουν πολλά και µεγάλα µιτοχόνδρια. Σηµείωση: τα ερυθρά αιµοσφαίρια δεν έχουν ούτε πυρήνα, ουτε µιτοχόνδρια Κυτταρικός σκελετός Ο κυτταρικός σκελετός είναι ένα σύστηµα που δίνει σχήµα και σταθερότητα στο κύτταρο και στα οργανίδια ή τα µεταφέρει. Αποτελείται από µίκρο- και µακροϊνίδια, ενδιάµεσα ινίδια και µικροσωληνίσκους (από µικροσωληνίσκους αποτελείται και το κεντροσωµάτιο σηµαντικό στη κυτταρική διαίρεση). Τα φυτά έχουν επιπρόσθετα ένα ανθεκτικό εξωτερικό περίβληµα που αποτελείται κυρίως από κυτταρίνη (πολυσακχαρίτης), που ονοµάζεται κυτταρικό τοίχωµα.

14 3.1 Ενέργεια και οργανισµοί/atp Η ενέργεια έχει κεντρική σηµασία για έναν οργανισµό, γιατί ότι και να κάνουµε (πχ. να κινήσουµε ενα χέρι) χρειαζόµαστε ενέργεια. Μέχρι και όταν δεν κάνουµε τίποτα χρειαζόµαστε ενέργεια (πχ. για αναπνοή, σκέψη, για την καρδιά, νεφρά και άλλα όργανα). Ο κλάδος της βιολογίας που ασχολείται µε τη µελέτη του τρόπου αξιοποίησης της ενέργειας για την υλοποίηση των δραστηριοτήτων της ζωής ονοµάζεται βιοενεργητική. Οι οργανισµοί λοιπόν παίρνουν ενέργεια και υλικά από το περιβάλλον και τις χρησιµοποιούν προς όφελός τους. Οι οργανισµοί λοιπόν µπορούν από απλές χηµικές ενώσεις να φτιάξουνε σύνθετες. Αυτό για να γίνει απαιτείται συνήθως ενέργεια (ενδόθερµες αντιδράσεις) και ονοµάζεται αναβολισµός. Γίνεται όµως και το αντίθετο. Σύνθετες ενώσεις να διασπαστούν σε απλούστερες. Έτσι συνήθως κερδίζουµε ενέργεια, γιατί οι αντιδράσεις είναι εξώθερµες. Το σύνολο αυτών των αντιδράσεων ονοµάζεται καταβολισµός. Αναβολισµός και καταβολισµός µαζί µας κάνουν τον µεταβολισµό. Το ΑTP (τριφωσφορική αδενοσίνη) είναι ένα µόριο που χρησιµοποιείται από τον οργανισµό κάθε φορά που χρειαζόµαστε λίγη ενέργεια. Κάθε φόρα που διασπάται ATP, η ενέργεια που εκλύεται (βγαίνει) µπορεί να χρησιµοποιηθεί για να προχωρήσει κάποια ενδόθερµη αντίδραση. Όπως όταν θέλουµε να αγοράσουµε κάτι έχουµε λεφτά και τα δίνουµε σαν αντάλλαγµα για αυτό που πρόκειται να αγοράσουµε, ετσι και κάθε φορα που θέλουµε για κάτι ενέργεια δίνουµε συνήθως ATP. Γι αυτόν τον λόγο το ATP χαρακτηρίζεται ως ενεργειακό νόµισµα. Το ATP βασικά είναι όπως ένα ριβονουκλεοτίδιο που γνωρίσαµε στο RNA, αλλά αντί για µια φωσφορική οµάδα υπάρχουν 3 (δες σχήµα). Και εκεί είναι και η µεγάλη διαφορά, γιατί αυτοί οι δεσµοί µεταξύ των φωσφορικών οµάδων είναι δεσµοί υψηλής ενέργειας. Μόλις σπάσουν, απελευθερώνουν την ενέργεια που έχουν µεσα τους. Οπότε αν η τριφωσφορική αδενοσίνη σπάσει και φύγει µια φωσφορική οµάδα, τι θα µας µείνει; 3-1=2. Θα µείνει δίφωσφορική αδενοσίνη (ADP). ηλ. ATP ADP+Pi+ενέργεια. To ATP λοιπόν είναι κάτι σαν µια φορτισµένη µπαταρία, ενώ το ADP είναι κάτι σε αποφωρτισµένη µπαταρία. Την ενέργεια για την «φόρτιση» µπορούµε να την βρούµε είτε από την φωτοσύνθεση, είτε απο καταβολικές οδούς µε διάσπαση οργανικών ενώσεων όπως πχ. η οξείδωση της γλυκόζης.

15 3.2 Ένζυµα Βιολογικοί καταλύτες Πολλές από τις χηµικές αντιδράσεις χρειάζονται ενέργεια για να πραγµατοποιηθούν. Μέχρι και αυτές που στο τέλος θα µας δώσουν ενέργεια (εξώθερµες). Ο λόγος είναι ότι για να γίνουν θα πρέπει πρώτα να υπερβαστεί ένα «ενεργειακό εµπόδιο», πριν η αντίδραση αρχίσει να «κυλάει» από µόνη της. Αυτή η ενέργεια που πρέπει να δωθεί πριν η αντίδραση µπορέσει να προχωρίσει από µόνη της ονοµάζεται ενέργεια ενεργοποίησης (δες σχηµα. Ενέργεια ενεργοποίησης = activation energy). Πολλές φορές η ενέργεια ενεργοποίησης είναι τόσο µεγάλη που χρειάζονται µεγάλα ποσά ενέργειας. Έτσι θεωρητικά οι αντιδράσεις θα γίνονταν πολύ αργά ή θα απαιτούσαν µεγάλη θερµοκρασία. Και ακριβώς σ αυτό το σηµείο επεµβαίνουν τα ένζυµα. Ένζυµα είναι βιολογικοί καταλύτες που µειώνουν την ενέργεια ενεργοποίησης, επιτρέποντας έτσι την αύξηση της ταχύτητας της αντίδρασης µέχρι και φορές. Αυτό επιτυγχάνεται λόγω του ότι το ένζυµο προσανατολίζει κατάλληλα τα µόρια υποστρώµα τα (δη λ. τα µόρια που πρόκειται να αντιδράσουν). Προσοχή: η ενέργεια ενεργοποίησης µειώνεται, το ολικό κέρδος όµως παραµένει το ίδιο.

16 Τα ένζυµα σε γενικά πλαίσια είναι πολύ ειδικά (όπως ένα κλειδί ταιριάζει σε µια κλειδαριά) και καταλύουν συνήθως µόνο µια αντίδραση. Το τµήµα του ενζύµου που είναι υπεύθυνο για την πρόσδεση του υποστρώµατος ονοµάζεται ενεργό κεντρο. Τα ένζυµα είναι συνήθως πρωτεϊνικά µόρια και έχουν ορισµένες ιδιότητες: Η δράση τους εξαρτάται από την τρισδιάστατη δοµή τους. Αν αυτή αλλάξει (πχ. µετουσίωση δες 1 ο κεφάλαιο), το ένζυµο χάνει τη λειτουργία του. ρούν πάρα πολύ γρήγορα Παραµένουν αναλοίωτα µετά το πέρας της αντίδρασης (όπως και κάθε καταλύτης) Εµφανίζουν υψηλό βαθµό εκειδίκευσης (κλειδι κλειδαριά) Η δράση τους εξαρτάται από διάφορους παράγοντες όπως θερµοκρασία, ph κτλ. Τα ένζυµα µπορεί να βρίσκονται εξωκυτταρικά ή ενδοκυτταρικά. Επίσης µπορεί να εµφανίζονται µόνο σε ένα κυτταρικό οργανίδιο, ελεύθερα ή επάνω σε µεµβράνες. Τα ένζυµα παίρνουν το όνοµα τους συνήθως από την αντίδραση που καταλύουν και την κατάληξη αση. Παράγοντες που επηρρεάζουν τη δράση των ενζύµων: ph και θεµοκρασία: Κάθε ένζυµο έχει µια τιµή θερµακρασίας και ph που είναι η βέλτιστη και στην οποία το ένζυµο δρα µε την µεγαλύτερη ταχύτητα. Πάνω ή κάτω από από αυτήν τη βέλτιστη τιµή η ταχύτητα ελλατώνεται. Συνήθως αν επανέλθει η θερµοκρασια/ph στην βέλτιστη τιµή το ένζυµο θα έχει πάλι την µέγιστη δραστικότητα. Έτσι η δράση του ενζύµου για µικρές µεταβολές είναι µεταστρεπτή. Αν όµως αλλάξουν οι συνθήκες πολύ τότε το ένζυµο «καταστρέφεται» και δεν µπορεί να δράσει ξανα (βασικά µετουσιώνεται µη αντιστρεπτα). Σχέση συγκέντρωσης ενζύµου & υποστρώµατος: Η αύξηση της συγκέντρωσης του υποστρώµατος οδηγεί σε µια αύξηση της ταχύτητας, µεχρι το σηµείο που όλα τα ένζυµα «θα δουλεύουν στο full» (πλήρη κάλυψη). Τότε η ταχύτητα παραµένη σταθερή και µπορεί να αυξηθεί µόνο µε την προσθήκη επιπρόσθετων µορίων ενζύµου.

17 Υπάρχουν και ουσίες που µπορούν να σταµατήσουν τη δράση ενζύµων και ονοµάζονται αναστολείς. Οι αναστολείς µπορεί να είναι αντιστρεπτοί (δηλ. µπορούν να αποµακρυνθούν και το ένζυµο να ξανααποκτήσει τη λειτουργία του) ή µη αντιστρεπτοί (δηλ. συνδέονται µόνιµα και δεν αφήνουν το ένζυµο να δράσει µια για πάντα παραδείγµατα: ιόντα βαρέων µετάλλων και διάφορα αέρια(εντοµοκτόνα)). Μερικές φορές τα ένζυµα για να δράσουν χρειάζονται τη βοήθεια µη πρωτεϊνικών µορίων. Αυτοί οι βοηθοί ονοµάζονται συνπαράγοντες και χωρίς αυτούς το ένζυµο είναι ανενεργό. Οι συµπαράγοντες µπορεί να είναι ανόργανα ιόντα ή οργανικές ενώσεις. Σε περίπτωση που είναι οργανικές ενώσεις τότε συνήθως πρόκειται για κάτι που ονοµάζεται συνένζυµο. Πολλές βιταµίνες είναι συνένζυµα ή τουλάχιστον συναποτελούν τα συνένζυµα.

18 4.1 Κύκλος ζωής του κυττάρου Τη ζωή του κυττάρου από την στιγµή που θα δηµιουργηθεί µέχρι την στιγµή που θα διαιρεθεί για να δηµιουργηθούν 2 καινούργια (θυγατρικά) κύτταρα την ονοµάζουµε κυτταρικό κύκλο ή κύκλο ζωής του κυττάρου. Τη φάση που «ζει κανονικά» την ονοµάζουµε µεσόφαση. Σε αυτήν την φάση συνθέτει, αυξάνει τον όγκο του κτλ. Χρονικά καταλαµβάνει και το µεγαλύτερο ποσοστο (90%-95%). Την φάση που διαιρείται την ονοµάζουµε µίτωση και υποδιαιρείται σε πρόφαση, µετάφαση, ανάφαση και τελόφαση. 4.2 Μοριακή γενετική Κεντρικό δόγµα Το DNA είναι το γενετικό υλικό χάρη στις ιδιοτήτες του να: Παράγει ακριβές αντίγραφα του εαυτού του και έτσι η γενετική πληροφορία µεταβιβάζεται απο κύτταρο σε κύτταρο και απο γενιά σε γενιά. Προσδιορίζει την παραγωγή RNA και µέσω του RNA- των πρωτεϊνών Η κατεύθυνση µε την οποία ρέει η γενετική πληροφορία ονοµάστηκε κεντρικο δόγµα της (µοριακής) Βιολογίας. Μεταγραφή Μετάφραση αντιγραφή Στο παραπάνω σχήµα βλέπουµε ότι το DNA αντιγράφεται για να φτιάξει αντίγραφό του (DNA). Στη συνέχεια µπορεί να µεταγραφεί για να φτιάξει RNA. Το RNA µπορεί να µεταφραστεί µετά στη γλώσσα των αµινοξέων. Μερικοί ιοί, οι οποίοι διαθέτουν RNA (και όχι DNA) σαν γενετικό υλικό έχουν ειδικά ένζυµα µε τα οποία µπορούν να αντιγράψουν RNA σε RNA, καθώς και να κάνουν αντίστροφη µεταγραφή (RNA σε DNA).

19 Αντιγραφή του DNA H αντιγραφή παρακάτω περιγράφεται για προκαρυωτικούς οργανισµούς. Η διαδικασιά στο επίπεδο που µελετάµε είναι σχεδόν ίδια και στους ευκαρυωτικούς οργανισµούς. Η διαδικασία παρουσιάζεται απλουστευµένα. Σπάσιµο των δεσµών υδρονόνου είχαν ανεπτυχθεί µεταξύ των συµπληρωµατικών βάσεων σε µια περιοχή. Ξετύλιγµα της διπλής έλικας στην περιοχή αυτή Αντιγραφή και των δυο κλώνων του DNA µε τη βοήθεια του ενζύµου DNA πολυµεράση ΙΙΙ (µόνο πρόκαρυωτες - ευκαρυώτες έχουν άλλες DNA πολυµεράσες). Η αντιγραφή γίνεται καθώς το ένζυµο αυτό τοποθετεί νουκλεοτίδια µε συµπληρωµατικές βάσεις απέναντι στον κάθε κλώνο. Απέναντι απο νουκλεοτίδια µε γουανίνη τοποθετουνται νουκλεοτίδια µε κυτοσίνη κτλ. Αν γίνει κάποιο λάθος στην τοποθέτηση η ίδια η πολυµεράση τα διορθώνει. Έτσι στο τέλος έχουµε δυο καινούργια δίκλωνα µόρια DNA, που το καθένα έχει έναν «παλιό» και ένα νεοσυντιθέµενο κλώνο. Γι αυτόν τον λόγο ονοµάζεται αυτός ο µηχανισµός ηµισυντηρητικός τρόπος αντιγραφής. Σηµείωση: µια διαφορά που την λέει το βιβλίο είναι ότι στους ευκαρυώτες η αντιγραφή δεν γίνεται σε ένα σηµείο, αλλά σε πολλά ταυτόχρονα Links:

20 Μέταγραφη εδοµένο ότι το DNA είναι στον πυρήνα και τα ριβοσώµατα στα οποία γίνεται η πρωτεϊνοσύνθεση είναι εκτός πυρήνα, λογικά χρειάζεται ένα µόριο για να µεταφέρει τη γενετική πληροφορία στο ριβόσωµα. Αυτό το µόριο είναι το mrna. Η διαδικασία µε την οποία δηµιουργείται το mrna (και όλα τα υπόλοιπα RNA επίσης ονοµάζεται µεταγραφή. Απλουστευµένα περιγράφεται ως εξής: Υπάρχει ένα ένζυµα, η RNA πολυµεράση, το οποίο Σπάει τους δεσµούς υδρογόνου και ξετιλύγει τοπικά την έλικα. Μεταγράφει έναν από τους κλώνους του DNA (µεταγράφει σηµαίνει ότι απέναντι από κάθε δεσόξυριβονουκλεοτίδιο τοποθετεί το συµπληρωµατικό του ρίβονουκλεοτίδιο πχ. απένατι από DNA-κυτοσίνη τοποθετεί RNAγουανίνη. Προσοχή: το RNA έχει ουρακίλη αντί για θυµίνη. Η µεταγραφή γίνεται µόνο σε ένα τµήµα του DNA που µας ενδιαφέρει και ονοµάζεται γονίδιο. Γενετικός κώδικας Τα νουκλεοτίδια του RNA είναι 4, ενώ τα αµινοξέα που πρέπει να κωδικοποιηθούν είναι 20. Άρα πως θα γίνει η κωδικοποίηση; Η απάντηση είναι σε τριπλέτες. 3 νουκλεοτίδια κωδικοποιούν ένα αµινοξύ και το λεξικό που χρησιµοποιείται για τη µετάφραση ονοµάζεται γενετικός κώδικας, ο οποιος έχει τα εξής χαρακτηριστικά: Είναι κωδικός τριπλέτας. Κάθε τριπλέτα ονοµάζεται κωδικόνιο Είναι µη επικαλυπτόµενος, δηλαδή κάθε νουκλεοτίδιο διαβάζεται µια φορά, σε µία τριπλέτα. Το mrna διαβάζεται πάντα σε βήµατα των 3 νουκλεοτιδίων Υπάρχουν 4 3 =16 διαφορετικοί συνδιασµοί τριπλετών, αλλά χρειάζονται να κωδικοποιηθούν µόνο 20 αµινοξέα. Άρα περισσεύουν πολλοί συνδιασµοι. Ως αποτέλεσµα: το ίδιο αµινοξύ συχνά κωδικοποιείται από πολλές διαφορετικές τριπλέτες που µεταξύ τους ονοµάζονται συνώνυµες. Ο γενετικός κώδικας γι αυτόν το λόγο ονοµάζεται εκφυλισµένος. Είναι παγκόσµιος(καθολικός). Σηµαίνει ότι ο ίδιο γενετικός κώδικας ισχύει σε όλους τους οργανισµούς. Υπάρχουν 3 τριπλέτες που κωδικοποιούν την λήξη της µετάφρασης και ένα (ΑUG) που κωδικοποιεί την έναρξη καθώς και το αµινοξύ µεθειονίνη.

21 Μετάφραση Η µετάφραση (πρωτεϊνοσύνθεση) µαθαίνεται µόνο µε σχήµατα, γι αυτό και δεν θα πολυαναλυθει έδω. Για να ξεκινήσει η µετάφραση χρειάζονται διάφοροι παράγοντες όπως t-rna, ένζυµα, ATP (δίνει ενέργεια), mrna, ριβοσώµατα, αµινοξέα Έναρξη: το mrna συνδέεται µε το ριβόσωµα και επίσης συνδέεται και ένα µόριο t-rna που φέρνει το πρώτο αµινοξύ που είναι πάντα µεθειονίνη και αντιστοιχει στο κωδικόνιο AUG. Το t-rna συνδέεται πάντα στην περιοχή του κωδικονίου του mrna. Η αντίστοιχη δικιά του περιοχή που είναι συµπληρωµατική ονοµάζεται αντικωδικόνιο. Επιµύκηνση: Έρχεται και το επόµενο t-rna που φέρει το επόµενο αµινοξύ και πλέον τα αµινοξέα συνδέονται µεταξύ τους µε πεπτιδικό δεσµό. Το ένα (πρώτο) t-rna µένει έτσι χωρίς αµινοξύ και στη συνέχει µε κίνηση του ριβοσώµατος φεύγει το t-rna χωρίς αµινοξύ και έρχεται το t-rna µε τα δυο αµινοξέα στη θέση του. Την κενή θέση την καταλαµβάνει ένα νέο µόριο t- RNA, του οποιου αµινοξύ σχηµατίζει πάλι πεπτιδικό δεσµό κ.ο.κ. (χωρίς σχήµα δεν γίνεται τίποτα, γι αυτό δείτε σελ. 128 του βιβλίου). Λήξη: Η πρωτεϊνοσύνθεση σταµατάει όταν το ριβώσωµα φτάσει σε ένα από τα τρία κωδικώνια λήξης (UAG, UAA, UGA). Τότε απελευθερώνεται η πολυπεπτιδική αλυσίδα. Video Link: Σηµείωση: Είναι δυνατόν για εξοικονόµιση ενέργειας & χρόνου σε ένα ριβόσωµα να προσδεθούν πολλά µόρια mrna και έτσι να έχουµε ταυτόχρονη µετάφραση. Χρωµατίνη και χρωµόσωµα To DNA σε έναν ευκαρυώτη δεν θα το βρούµε µόνο του, αλλά συνδεδεµένο µε πρωτεϊνες και λίγο RNA. Έτσι µπορεί να αναδιπλωθεί και από «νήµα» να γίνει «κουβάρι». Όταν δεν έχει αναδιπλωθεί σε µεγάλο βαθµό (µεσόφαση) ονοµάζεται χρωµατίνη, ενώ όταν αναδιπλώνεται πάρα πολύ (µίτωση) ονοµάζεται χρωµόσωµα. Τα χρωµοσώµατα µπορούµε να τα δούµε µε το οπτικό µικροσκόπιο!!! Τα χρωµοσώµατα είναι σε ζεύγη στα σωµατικά κύτταρα. ηλαδή η γενετική πληροφορία υπάρχει σε δύο αντίγραφα. Γι αυτό αυτά τα κύτταρα χαρακτηρίζονται ως διπλοείδη, ενώ οι γαµέτες που έχουν ένα αντίγραφο χαρακτηρίζονται ως απλοειδή. Σηµείωση: Λύστε την άσκηση 4 στην σελίδα 131

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί

3.1 Ενέργεια και οργανισμοί Δημήτρης Η. Β 1 25.3.14 3 Ο Κεφάλαιο 3.1 Ενέργεια και οργανισμοί Η ενέργεια έχει κεντρική σημασία για έναν οργανισμό, γιατί ό,τι και να κάνουμε χρειαζόμαστε ενέργεια. Ο κλάδος της βιολογίας που ασχολείται

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

Βιολογία(Γενικής(Παιδείας Β Λυκείου

Βιολογία(Γενικής(Παιδείας Β Λυκείου Βιολογία(Γενικής(Παιδείας Β Λυκείου Ελληνογαλλική Σχολή Jeanne D Arc 2011-2012 Δημοσθένης Καρυοφύλλης email: dkariofi@e-biology.gr www.ibrain.gr Κεφ. 1 ο Χημική σύσταση του κυττάρου Χαρακτηριστικά των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 3 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 Το θέμα που απασχολεί το κεφάλαιο σε όλη του την έκταση είναι ο μεταβολισμός και χωρίζεται σε τέσσερις υποκατηγορίες: 3.1)Ενέργεια και οργανισμοί,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. της Νικολέτας Ε. 1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ)

ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. της Νικολέτας Ε. 1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ) ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ της Νικολέτας Ε. 3ο Κεφάλαιο Περιληπτική Απόδοση 3.1. Ενέργεια και οργανισμοί Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται

Διαβάστε περισσότερα

Εργασία Βιολογίας 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ

Εργασία Βιολογίας 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ Εργασία Βιολογίας Καθηγητής: Πιτσιλαδής Β. Μαθητής: Μ. Νεκτάριος Τάξη: Β'2 Υλικό: Κεφάλαιο 3 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ Την ενέργεια και τα υλικά που οι οργανισμοί εξασφαλίζουν από το περιβάλλον

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί με εξαίρεση τους φωτοσυνθετικούς εξασφαλίζουν την απαραίτητη ενέργεια διασπώντας θρεπτικές ουσίες που

3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί με εξαίρεση τους φωτοσυνθετικούς εξασφαλίζουν την απαραίτητη ενέργεια διασπώντας θρεπτικές ουσίες που 3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί με εξαίρεση τους φωτοσυνθετικούς εξασφαλίζουν την απαραίτητη ενέργεια διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Αντίθετα οι φωτοσυνθετικοί,

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

Μεταβολισμός και Βιοενεργητική. [Τίτλος εγγράφου] ΣΠΥΡΟΣ Ξ. Β 2

Μεταβολισμός και Βιοενεργητική. [Τίτλος εγγράφου] ΣΠΥΡΟΣ Ξ. Β 2 Μεταβολισμός και Βιοενεργητική [Τίτλος εγγράφου] ΣΠΥΡΟΣ Ξ. Β 2 ΑΠΡΙΛΙΟΣ 2013 - Μεταβολισμός - Εισαγωγή Πολύ μεγάλο ρόλο στην λειτουργία ενός οργανισμού παίζει η ενέργεια και η κατάλληλη αξιοποίησή της.

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΕΘΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΚΕΝΤΡΟ ΕΚΠΑΙ ΕΥΤΙΚΗΣ ΕΡΕΥΝΑΣ ΑΞΙΟΛΟΓΗΣΗ ΤΩΝ ΜΑΘΗΤΩΝ ΤΗΣ Β ΛΥΚΕΙΟΥ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΥΠΟΥΡΓΕΙΟ ΕΘΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΚΕΝΤΡΟ ΕΚΠΑΙ ΕΥΤΙΚΗΣ ΕΡΕΥΝΑΣ ΑΞΙΟΛΟΓΗΣΗ ΤΩΝ ΜΑΘΗΤΩΝ ΤΗΣ Β ΛΥΚΕΙΟΥ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΥΠΟΥΡΓΕΙΟ ΕΘΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΚΕΝΤΡΟ ΕΚΠΑΙ ΕΥΤΙΚΗΣ ΕΡΕΥΝΑΣ ΑΞΙΟΛΟΓΗΣΗ ΤΩΝ ΜΑΘΗΤΩΝ ΤΗΣ Β ΛΥΚΕΙΟΥ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΑΘΗΝΑ 2000 Οµάδα σύνταξης Συντονίστρια: ρ. Μουτζούρη-Μανούσου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1.Ποια χηµικά στοιχεία συµµετέχουν στην σύνθεση των µορίων των οργανισµών σε σηµαντικό βαθµό; (σελ.18) 2. Γιατί είναι σηµαντικά τα ιχνοστοιχεία;(σελ.18)

Διαβάστε περισσότερα

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις:

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: ΘΕΜΑ Β: Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΠΙΜΕΛΕΙΑ: Κ. ΔΗΜΗΤΡΙΟΣ ΤΜΗΜΑ:Β 1 ΚΕΦΑΛΑΙΟ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Είναι γνωστό πως οποιοσδήποτε οργανισμός, για να λειτουργήσει χρειάζεται ενέργεια. Η ενέργεια αυτή βρίσκεται

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015

ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚΑΔΗΜΑΙΚΟΥ ΕΤΟΥΣ 2014-2015 ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΔΥΤΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ TECHNOLOGICAL EDUCATION INSTITUTION OF WESTERN MACEDONIA ΚΟΙΛΑ ΚΟΖΑΝΗΣ-GR 50100 I KILA, GR 50101 KOZANI-GREECE http://www.teiwm.gr ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015)

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015) Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Ομαδοποιημένα ανά κεφάλαιο (σχολικό έτος 2014-2015) Ιωαννίδης Θωμάς Βιολόγος 11 ου ΓΕΛ Ηρακλείου 1 ΠΕΡΙΕΧΟΜΕΝΑ Εξεταστέα Ύλη 2014-15.. σελ.3 1 ο Κεφάλαιο..σελ.

Διαβάστε περισσότερα

Κεφάλαιο τρίτο. 3.1: Ενέργεια και οργανισμοί

Κεφάλαιο τρίτο. 3.1: Ενέργεια και οργανισμοί Κεφάλαιο τρίτο 3.1: Ενέργεια και οργανισμοί Όλοι οι οργανισμοί εξασφαλίζουν την ενέργεια που χρειάζονται με την διάσπαση των θρεπτικών ουσιών της τροφής τους. Οι οργανισμοί που έχουν την ικανότητα να φωτοσυνθέτουν

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ ΤΑΞΗ B ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2015 Α ΦΑΣΗ Απαντήστε στο απαντητικό φύλλο: για τις ερωτήσεις πολλαπλής επιλογής με το γράμμα που αντιστοιχεί στη σωστή απάντηση και για τις ερωτήσεις ανάπτυξης

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛ. ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 2010 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Βιολογία είναι η επιστήμη

Διαβάστε περισσότερα

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ ΒΙΟΛΟΓΙΑ - ΓΕΝΕΤΙΚΗ ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ Επικ. Καθηγήτρια Βιολογίας-Γενετικής Α.Τ.Ε.Ι.Θ. Τμήμα Νοσηλευτικής Σ.Ε.Υ.Π. Α.Τ.Ε.Ι. Θεσσαλονίκης ΘΕΣΣΑΛΟΝΙΚΗ 2010 «Αν δώσουμε τη δυνατότητα στους αδύνατους

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

α) Σε ποια σημεία ενός ευκαρυωτικού κυττάρου που βρίσκεται στη μεσόφαση, μπορούμε να εντοπίσουμε μόρια DNA; (6μ)

α) Σε ποια σημεία ενός ευκαρυωτικού κυττάρου που βρίσκεται στη μεσόφαση, μπορούμε να εντοπίσουμε μόρια DNA; (6μ) ΘΕΜΑ Β: Ι. Οι πολυσακχαρίτες αποτελούν μια πολύ διαδεδομένη ομάδα μακρομορίων στα ζωικά και φυτικά κύτταρα. Να απαντήσετε στις ερωτήσεις: α) Ποιοι είναι οι κύριοι πολυσακχαρίτες και ποιο είναι το κοινό

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 2 Στα ακόλουθα σχήματα απεικονίζονται δύο κύτταρα. Ι. Να ονομάσετε 3 δομές που υπάρχουν και στα δύο είδη κυττάρων. Να ονομάσετε επίσης μια δομή που ενώ υπάρχει στα κύτταρα

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Χηµείας Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Ζήτηµα 1ο Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο στους

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΠΕΡΙΛΗΠΤΙΚΗ ΕΡΓΑΣΙΑ 3 ου ΚΕΦΑΛΑΙΟΥ (μεταβολισμός)

ΠΕΡΙΛΗΠΤΙΚΗ ΕΡΓΑΣΙΑ 3 ου ΚΕΦΑΛΑΙΟΥ (μεταβολισμός) ΠΕΡΙΛΗΠΤΙΚΗ ΕΡΓΑΣΙΑ 3 ου ΚΕΦΑΛΑΙΟΥ (μεταβολισμός) ΜΑΘΗΤΗΣ: Ν. ΑΠΟΣΤΟΛΟΣ ΤΜΗΜΑ: Β2 Ο όρος «ενέργεια» πρωτοχρησιμοποιήθηκε πριν από δύο περίπου αιώνες, με τη βιομηχανική επανάσταση, και έγινε οικείος στον

Διαβάστε περισσότερα