Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Βιολογία και αρχές Βιοδιάβρωσης Πολυμερές Μονομερές"


1 Βιολογία και αρχές Βιοδιάβρωσης Τα χημικά στοιχεία που συνθέτουν τους οργανισμούς. Στον φλοιό της γης απαντώνται 92 στοιχεία, απαραίτητα για την ζωή είναι τα 27, από τα οποία τα πιο σημαντικά είναι τα τέσσερα (άνθρακας (C), οξυγόνο (O), άζωτο (N) και υδρογόνο(h)), τα οποία συμμετέχουν στην σύνθεση βασικών δομικών και λειτουργικών μορίων των οργανισμών. Τα άλλα στοιχεία υπάρχουν σε μικρές ποσότητες, σημαντικές για την ομαλή λειτουργία του οργανισμού (ιχνοστοιχεία). Το νερό είναι ένα μόριο που διαδραματίζει σημαντικό ρόλο στο κύτταρο. Πέρα από το νερό υπάρχουν και πολλές άλλες ενώσεις που διαδραματίζουν σημαντικό ρόλο στο κύτταρο. Μία κατηγορία αυτών είναι και τα μακρομόρια. Γενικά ως "βιολογικά μακρομόρια" χαρακτηρίζονται σύνθετες οργανικές ενώσεις μεγάλου μοριακού βάρους ( ) όπως είναι οι πρωτεΐνες, τα νουκλεϊκά οξέα, οι πολυσακχαρίτες και τα λιπίδια. Οι τρεις πρώτες κατηγορίες, (εκτός των λιπιδίων), χαρακτηρίζονται και πολυμερή, αποτελούμενες από επαναλαμβανόμενες απλές μονάδες, τα μονομερή. Ειδικότερα οι πρωτεΐνες δομούνται από αμινοξέα, τα νουκλεϊκά οξέα από νουκλεοτίδια και οι πολυσακχαρίτες από μονοσακχαρίτες. Πολυμερές Πρωτεΐνες Νουκλεϊκά οξέα Πολυσακχαρίτες Λίπη Μονομερές Αμινοξέα Νουκλεοτίδια Μονοσακχαρίτες Λιπαρά οξέα Σημειώνεται ότι τα μονομερή των διαφόρων ειδών μακρομορίων δεν είναι όμοια. Ο βασικός χημικός μηχανισμός που συνδέονται μεταξύ τους λέγεται "αντίδραση συμπύκνωσης". Κατά τον μηχανισμό αυτόν, όπως φαίνονται και στο παρακάτω σχήμα, το ένα μονομερές χάνει ένα άτομο υδρογόνου (Η), ενώ το άλλο μια υδροξυλομάδα (-ΟΗ), αφαιρείται δηλ. ένα μόριο νερού. Τελικά τα δύο μονομερή συνδέονται με ομοιοπολικό δεσμό που λόγω της σημειούμενης σταθερότητάς του θεωρείται ο πλέον διαδεδομένος δεσμός στους έμβιους οργανισμούς. 1

2 Η αντίστροφη διαδικασία, η διάσπαση αυτού του δεσμού και η παραγωγή μονομερών από τα πολυμερή γίνεται με την προσθήκη νερού και ονομάζεται υδρόλυση. Στα μακρομόρια εκτός του ομοιοπολικού δεσμού που συνδέει τα μονομερή τους, απαντώνται και άλλοι δεσμοί όπως δεσμοί υδρογόνου, οι δισουλφιδικοί καθώς και οι υδρόφοβοι δεσμοί. Οι δεσμοί αυτοί, αν και δεν συμμετέχουν στην συνένωση των μονομερών, παίζουν σημαντικό ρόλο στην τελική διαμόρφωση των μακρομορίων γενικότερα. Πρωτεΐνες. Οι πρωτεΐνες είναι γραμμικά φυσικά πολυμερή, οι δομικές μονάδες των οποίων είναι τα αμινοξέα. Τα αμινοξέα είναι ενώσεις που έχουν στο μόριό τους ταυτόχρονα μια αμινοομάδα (-ΝΗ 2 )και μια καρβοξυλομάδα (-COOH). Τα φυσικά αμινοξέα έχουν την παρακάτω δομή, και διαφοροποιούνται μόνο από την φύση της πλευρικής αλυσίδας (R), η οποία καθορίζει τις φυσικές του και τις χημικές του ιδιότητες. Στα μακρομόρια των πρωτεϊνών, τα αμινοξέα συνδέονται με πεπτιδικούς δεσμούς, οι οποίοι σχηματίζονται με αντίδραση συμπύκνωσης της καρβοξυλικής ομάδας ενός αμινοξέος και την αμινομάδα ενός άλλου αμινοξέος. Το μόριο που σχηματίζεται από δύο αμινοξέα ονομάζεται διπεπτίδιο. Με την προσθήκη και άλλων αμινοξέων σχηματίζονται πολυπεπτιδικές αλυσίδες (πεπτίδια). Αν ο αριθμός των αμινοξέων είναι παραπάνω από 100 λέμε ότι 2

3 έχουμε μια πρωτεΐνη. Οι πολυπεπτιδικές αλυσίδες διαφοροποιούνται μεταξύ τους από: Τον αριθμό των αμινοξέων Την αλληλουχία τους, και Την φύση της πλευρικής αλυσίδας. Μορφολογία των πρωτεϊνών Πρωτοταγής δομή: H αλληλουχία των αμινοξέων στην πολυπεπτιδική αλυσίδα χαρακτηρίζει μια πρωτεΐνη με μοναδικό και αναμφισβήτητο τρόπο. Η αλληλουχία αυτή αποτελεί την πρωτοταγή δομή των πρωτεϊνων. Ο θεωρητικός αριθμός των πιθανών πρωτεϊνών είναι τεράστιος. Οι πρωτεΐνες δομούνται από είκοσι αμινοξέα. Αυτό σημαίνει ότι υπάρχουν = 400 πιθανά διπεπτίδια, = 8000 πιθανά τριπεπτίδια. Ας φανταστεί κανείς αυτή την πολλαπλασιαστική διαδικασία (πολλαπλασιασμός 20 για κάθε επιπλέον αμινοξύ που προστίθεται στην αλυσίδα) για μια σχετικά μικρή πρωτεΐνη εκατό αμινοξέων. Υπάρχουν πιθανές διαφορετικές πρωτεΐνες με εκατό αμινοξέα, η κάθε μια από τις οποίες έχει διαφορετική και διακριτή πρωτοταγή δομή. Δευτεροταγής δομή: Αν και η πρωτοταγής δομή κάθε πρωτεΐνης είναι μοναδική, η δευτεροταγής δομή πολλών διαφορετικών πρωτεϊνών μπορεί να είναι ίδια. Η δευτεροταγής δομή των πρωτεϊνών αποτελείται από κανονικούς και επαναλαμβανόμενους τύπους προσανατολισμών μερών της πολυπεπτιδικής αλυσίδας. Ένας τύπος δευτεροταγούς δομής, η α-έλικα είναι μια δεξιόστροφη περιέλιξη των αμινοξέων που την αποτελούν, στην κατεύθυνση μιας κανονικής δεξιόστροφης βίδας. Το μετάξι είναι ένα παράδειγμα πρωτεΐνης με ένα άλλο τύπο δευτεροταγούς δομής, τη δομή β-φύλλου. Ένας άλλος τύπος δευτεροταγούς δομής είναι η τριπλή έλικα, η οποία απαντάται σε πρωτεΐνες όπως το κολλαγόνο. Τριτοταγής δομή: Η ολική διαμόρφωση ενός πολυπεπτιδίου αποτελεί την τριτοταγή του δομή. Σε πολλές περιπτώσεις οι α-έλικες και τα β-φύλλα υπερτερούν στη συνολική δομή μιας πρωτεΐνης καθορίζοντας έτσι την τριτοταγή δομή της. Πιο συχνά όμως, μόνο μικρά τμήματα του μορίου έχουν αυτές τις δευτεροταγείς δομές έτσι ώστε αυτές να έχουν μικρή συμμετοχή στην ολική δομή μιας πρωτεΐνης. Σε μια ολοκληρωμένη περιγραφή της τριτοταγούς δομής μιας πρωτεΐνης η θέση κάθε ατόμου στο μόριο στον τρισδιάστατο χώρο καθορίζεται επακριβώς σε σχέση με όλα τα άλλα μόρια. Υπενθυμίζεται ότι και η δευτεροταγής δομή και η τριτοταγής δομή καθορίζεται από την πρωτοταγή δομή μιας πρωτεΐνης. Θεωρητικά, αν μια πρωτεΐνη θερμανθεί ώστε να της δοθεί αρκετή ενέργεια για να σπάσουν οι δεσμοί υδρογόνου οι οποίοι σταθεροποιούν τη δευτεροταγή και, κατά συνέπεια, την τριτοταγή της δομή, αυτή θα «ξεδιπλωθεί», ενώ θα αποκτήσει την αρχική της δομή όταν αποβάλλει την θερμότητα που της δόθηκε. Η μόνη πληροφορία που απαιτείται για την επιστροφή του μορίου στη φυσιολογική του δομή είναι η αλληλουχία των αμινοξέων στην πολυπεπτιδική αλυσίδα. Γενικά στις πρωτεΐνες κάτω από συγκεκριμένες συνθήκες καταστρέφονται οι δεσμοί που συγκρατούν την δευτεροταγή και τριτοταγή δομή τους. Η διαδικασία αυτή ονομάζεται μετουσίωση. Κατά την μετουσίωση δεν καταστρέφεται η πρωτοταγής δομή της, δηλαδή δεν επιτρέπεται σχάση των πεπτιδικών δεσμών. Οι πρωτεΐνες 3

4 μετουσιώνονται εύκολα, υπό την επίδραση φυσικών παραγόντων (θέρμανση, ψύξη, υπέρηχοι, κ.ά.) καθώς και από την επίδραση χημικών παραγόντων (παρουσία οξέων, βάσεων, αλάτων βαρέων μετάλλων, οργανικών διαλυτών κ.ά.) Μετουσίωση πρωτεΐνης Τεταρτοταγής δομή: Μερικές πρωτεΐνες αποτελούνται από δύο ή περισσότερες πολυπεπτιδικές αλυσίδες. Η ολική δομή μιας τέτοιας πρωτεΐνης αποτελεί την τεταρτοταγή της δομή. Η δομή αυτή καθορίζεται από δύο παράγοντες: από το πώς οι υπομονάδες που αποτελούν την πρωτεΐνη συνδυάζονται μεταξύ τους στο χώρο και από τη δομή της κάθε υπομονάδας. Η αιμογλοβίνη, η οποία μεταφέρει οξυγόνο από τους πνεύμονες στους ιστούς και το παραδίδει στη μυογλοβίνη για αποθήκευση, αποτελεί τυπικό παράδειγμα τεταρτοταγούς δομής. Υδρόφοβες αλληλεπιδράσεις, δεσμοί υδρογόνου, και ιοντικοί δεσμοί συγκρατούν ενωμένες τέσσερις πολυπεπτιδικές αλυσίδες. Καθώς η αιμογλοβίνη δεσμεύει ή απελευθερώνει οξυγόνο οι τέσσερις υπομονάδες τις μετακινούνται ελαφρά η μία σε σχέση με την άλλη μεταβάλλοντας την τεταρτοταγή της δομή. Μερικοί ιοντικοί δεσμοί σπάζουν και εσωτερικές πλευρικές αλυσίδες μετακινούνται στο εξωτερικό του μορίου αυξάνοντας τη δέσμευση του οξυγόνου. 4

5 Νουκλεϊκά οξέα. Οι πρωτεΐνες είναι πολύ σημαντικά μόρια για τον οργανισμό. Ποιος όμως καθορίζει την πρωτοταγή τους δομή; Ανακαλύφθηκε ότι τα νουκλεϊκά οξέα είναι αυτά που καθορίζουν την παραγωγή των πρωτεϊνών και ελέγχουν τα λειτουργικά και τα κληρονομικά γνωρίσματα των οργανισμών. Υπάρχουν 2 είδη νουκλεικών οξέων το δεσοξυριβονουκλεϊκό και το ριβονουκλεϊκό, τα οποία είναι γνωστότερα με τις συντομογραφίες DNA και RNA αντίστοιχα. Τα νουκλεοτίδια είναι οργανικές ενώσεις. Αυτά αποτελούνται από 3 διαφορετικά επιμέρους μόρια που συνδέονται μεταξύ τους με ομοιοπολικό δεσμό: συχνότερα μιας "πεντόζης", σάκχαρο με 5 άτομα άνθρακα, ενός μορίου φωσφορικού οξέος και μιας οργανικής αζωτούχου βάσης. Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι η αδενίνη (Α), η γουανίνη (G), η θυμίνη (Τ), η κυτοσίνη (C) και η ουρακίλη (U). Η αδενίνη, η γουανίνη και η κυτοσίνη συναντώνται και στα δύο είδη νουκλεϊκών οξέων. Η θυμίνη υπάρχει μόνο στο DNA, ενώ η ουρακίλη μόνο στο RNA. Τα πολυνουκλεοτίδια, όπως και οι πρωτεΐνες, εκτός από την πρωτοταγή δομή τους, διαθέτουν και διάταξη στο χώρο. Σε κάθε νουκλεοτίδιο η αζωτούχος βάση συνδέεται με τον 1' άνθρακα της δεοξυριβόζης και η φωσφορική ομάδα με τον 5' άνθρακα. Μια πολυνουκλεοτιδικη αλυσίδα σχηματίζεται από την ένωση πολλών νουκλεοτιδίων με ομοιοπολικό δεσμό. Ο δεσμός αυτός δημιουργείται μεταξύ του υδροξυλίου του 3' άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής ομάδας που είναι συνδεδεμένη στον 5' άνθρακα της πεντόζης του επόμενου νουκλεοτιδίου. Ο δεσμός αυτός ονομάζεται 3'-5' φωσφοδιεστερικός δεσμός. Με τον τρόπο αυτό η πολυνουκλεοτιδική αλυσίδα που δημιουργείται έχει ένα σκελετό, που αποτελείται από επανάληψη των μορίων φωσφορική ομάδα-πεντόζη-φωσφορική ομάδα- 5

6 πεντόζη. Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων από τα οποία αποτελείται η πολυνουκλεοτιδική αλυσίδα, το πρώτο της νουκλεοτίδιο έχει πάντα μία ελεύθερη φωσφορική ομάδα συνδεδεμένη στον 5' άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο της έχει ελεύθερο το υδροξύλιο του 3' άνθρακα της πεντόζης του. οι Watson και Crick διατύπωσαν το μοντέλο της διπλής έλικας του DNA, που αναφέρεται στη δομή του DNA στο χώρο. Σύμφωνα με το μοντέλο αυτό: To DNA αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες που σχηματίζουν στο χώρο μία δεξιόστροφη διπλή έλικα. Η διπλή έλικα έχει ένα σταθερό σκελετό, που αποτελείται από επαναλαμβανόμενα μόρια φωσφορικής ομάδας-δεοξυριβόζης ενωμένων με φωσφοδιεστερικό δεσμό. Ο σκελετός αυτός είναι υδρόφιλος και βρίσκεται στο εξωτερικό του μορίου. Προς το εσωτερικό του σταθερού αυτού σκελετού βρίσκονται οι αζωτούχες βάσεις που είναι υδρόφοβες. Οι αζωτούχες βάσεις της μιας αλυσίδας συνδέονται με δεσμούς υδρογόνου με τις αζωτούχες βάσεις της απέναντι αλυσίδας με βάση τον κανόνα της συμπληρωματικότητας. Η αδενίνη συνδέεται με την θυμίνη και αντίστροφα ενώ η κυτοσίνη μόνο με γουανίνη και αντίστροφα. Οι δεσμοί υδρογόνου που αναπτύσσονται μεταξύ των βάσεων σταθεροποιούν τη δευτεροταγή δομή του μορίου. Ανάμεσα στην αδενίνη και τη θυμίνη σχηματίζονται δυο δεσμοί υδρογόνου, ενώ ανάμεσα στη γουανίνη και την κυτοσίνη σχηματίζονται τρεις δεσμοί υδρογόνου. Οι δύο αλυσίδες ενός μορίου DNA είναι συμπληρωματικές, και αυτό υποδηλώνει ότι η αλληλουχία της μιας καθορίζει την αλληλουχία της άλλης. Η συμπληρωματικότητα έχει μεγάλη σημασία για τον αυτοδιπλασιασμό του DNA, μια ιδιότητα που το καθιστά το καταλληλότερο μόριο για τη διατήρηση και τη μεταβίβαση της γενετικής πληροφορίας. Κάθε αλυσίδα DNA μπορεί να χρησιμεύει ως καλούπι για τη σύνθεση μιας συμπληρωματικής αλυσίδας, ώστε τελικά να σχηματίζονται δύο δίκλωνα μόρια DNA πανομοιότυπα με το μητρικό μόριο. Οι δύο αλυσίδες είναι αντιπαράλληλες, δηλαδή το 3' άκρο της μίας είναι απέναντι από το 5' άκρο της άλλης. To DNA αποτελεί το γενετικό υλικό όλων των κυττάρων και των περισσότερων ιών. Κάποιοι ιοί έχουν ως γενετικό υλικό RNA (RNA-ιοί). Συνοπτικά οι λειτουργίες του γενετικού υλικού είναι: Η αποθήκευση τη ς γενετικής πληροφορίας. Στο DNA (ή στο RNA των RNA ιών) περιέχονται οι πληροφορίες που καθορίζουν όλα τα χαρακτηριστικά ενός οργανισμού και οι οποίες οργανώνονται σε λειτουργικές μονάδες, τα γονίδια. Η διατήρηση και η μεταβίβαση της γενετικής πληροφορίας από κύτταρο σε κύτταρο και από οργανισμό σε οργανισμό, που εξασφαλίζονται με τον αυτοδιπλασιασμό του DNA. Η έκφραση των γενετικών πληροφοριών, που επιτυγχάνεται με τον έλεγχο της σύνθεσης των πρωτεϊνών. Το γενετικό υλικό ενός κυττάρου αποτελεί το γονι-δίωμά του. Τα κύτταρα στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο, όπως 6

7 είναι τα προκαρυωτικά κύτταρα και οι γαμέτες των διπλοειδών οργανισμών, ονομάζονται απλοειδή. Στα ευκαρυωτικά κύτταρα το γενετικό υλικό κατανέμεται στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. Συνήθως όμως ο όρος γονιδίωμα αναφέρεται στο γενετικό υλικό που βρίσκεται στον πυρήνα. Για την περιγραφή του μήκους ή της αλληλουχίαςενός νουκλεϊκού οξέος χρησιμοποιείται ο όρος αριθμός ή αλληλουχία βάσεων αντίστοιχα. Στην πραγματικότητα εννοούμε τον αριθμό ή την ακολουθία των νουκλεοτιδίων του νουκλεϊκού οξέος. Η απλούστευση αυτή γίνεται γιατί το μόνο τμήμα του νουκλεοτιδίου που αλλάζει είναι η αζωτούχος βάση. Έτσι αναφέρεται ότι ένα μόριο DNA έχει μήκος ζεύγη βάσεων, επειδή είναι δίκλωνο, ενώ ένα μόριο mrna έχει μήκος βάσεις επειδή είναι μονόκλωνο. Τα μόρια του DNA φέρουν τις πληροφορίες για το σύνολο των χαρακτηριστικών που εκφράζονται σε ένα κύτταρο και, κατ' επέκταση, σε έναν οργανισμό. Έτσι το μόριο του DNA είναι ικανό: Να φέρει τις γενετικές πληροφορίες. Να ελέγχει μέσω αυτών κάθε κυτταρική δραστηριότητα. Να μεταβιβάζει τις πληροφορίες αναλλοίωτες από γενιά σε γενιά. Να επιτρέπει τη δημιουργία γενετικής ποικιλομορφίας. Το σύνολο των μορίων του DNA ενός κυττάρου αποτελεί το γενετικό του υλικό. Στα ευκαρυωτικά κύτταρα, τα κύτταρα δηλαδή που έχουν πυρήνα, το DNA βρίσκεται μέσα σ' αυτόν (πυρήνα) ως συστατικό των χρωμοσωμάτων. Ένα μικρό ποσοστό υπάρχει και στα μιτοχόνδρια και στους χλωροπλάστες. Τα οργανίδια αυτά έχουν τη δυνατότητα να πολλαπλασιάζονται ανάλογα με τις ανάγκες του κυττάρου και ανεξάρτητα από αυτό. Μπορούν επίσης και να συνθέτουν τα ίδια κάποιες από τις πρωτεΐνες τους. Δομή και βιολογικός ρόλος του RNA. 7

8 Το δεύτερο είδος νουκλεϊκού οξέος, το RNA, εκτός από τις διαφορές που έχει από το DNA στη σύσταση (η πεντόζη είναι ριβόζη αντί δεσοξυριβόζη και η μία αζωτούχα βάση είναι ουρακίλη αντί θυμίνη), διαφέρει και στη δομή. Ενώ το DNA είναι ένα δίκλωνο μόριο, το RNA είναι κατά βάση μονόκλωνο. Αποτελείται δηλαδή από μια απλή πολυριβονουκλεοτιδική αλυσίδα. Ωστόσο, μερικές φορές, αυτό το μονόκλωνο μόριο αναδιπλώνεται σε ορισμένα σημεία. Η διαμόρφωση αυτή μπορεί να σταθεροποιηθεί με δεσμούς υδρογόνου, που σχηματίζονται ανάμεσα σε βάσεις που είναι συμπληρωματικές μεταξύ τους (G-C, A-U), παρά το ότι στην περίπτωση αυτή ανήκουν στην ίδια αλυσίδα (κλώνο).to RNA εμφανίζεται με τρεις διαφορετικούς τύπους. Αναλυτικότερα τα είδη του RNA αναπτύσσονται παρακάτω. 8

9 Υδατάνθρακες Οι υδατάνθρακες αποτελούν πηγή ενέργειας για το κύτταρο. Σημαντικότεροι από αυτούς είναι η γλυκόζη, το άμυλο και το γλυκογόνο. Κάποιοι υδατάνθρακες είναι δομικά συστατικά κυττάρων. Ο πιο διαδεδομένος από τους δομικούς υδατάνθρακες είναι η κυτταρίνη, που αποτελεί το βασικό συστατικό του κυτταρικού τοιχώματος των φυτικών κυττάρων. Οι υδατάνθρακες διακρίνονται σε μονοσακχαρίτες, δισακχαρίτες και πολυσακχαρίτες. Μονοσακχαρίτες.Διακρίνονται σε τριόζες (με 3 άτομα C), πεντόζες (με 5 άτομα C) και εξόζες (με 6 άτομα C). Από τους μονοσακχαρίτες πιο διαδεδομένες είναι οι πεντόζες και οι εξόζες. Γενικώς, εκτός του ότι αποτελούν πηγή ενέργειας για τα κύτταρα, συμμετέχουν και στη σύνθεση δι- και πολυσακχαριτών. Ειδικά οι πεντόζες ριβόζη και δεσοξυριβόζη συμμετέχουν στη σύνθεση του RNA και DNA αντίστοιχα Δισακχαρίτες.Προκύπτουν από τη συνένωση δύο μονοσακχαριτών. Οι κυριότεροι δισακχαρίτες είναι η μαλτόζη, η σακχαρόζη και η λακτόζη. Η μαλτόζη προκύπτει από τη διάσπαση του αμύλου, κατά τη διαδικασία της πέψης. Η σακχαρόζη είναι συστατικό των φρούτων και αποτελεί την κύρια πηγή γλυκόζης για τους ζωικούς οργανισμούς. Η λακτόζη είναι το σάκχαρο του γάλακτος. Δισακχαρίτης Μαλτόζη Σακχαρόζη Λακτόζη Σύσταση Γλυκόζη+ Γλυκόζη Γλυκόζη + Φρουκτόζη Γλυκόζη + Γαλακτόζη Πολυσακχαρίτες.Οι πολυσακχαρίτες προκύπτουν από τη συνένωση πολλών μορίων μονοσακχαριτών. Οι κύριοι πολυσακχαρίτες είναι η κυτταρίνη, το άμυλο και το γλυκογόνο. Παρά το ότι και οι τρεις αυτοί πολυσακχαρίτες οικοδομούνται από το ίδιο μονομερές, το μόριο της γλυκόζης, διαφέρουν ως προς το μέγεθος, τη μορφή που παίρνει το μόριό τους στο χώρο και το βιολογικό τους ρόλο. Η κυτταρίνη και το άμυλο συναντώνται στα φυτικά κύτταρα, η πρώτη ως συστατικό του κυτταρικού τοιχώματος (δομικός πολυσακχαρίτης) και το δεύτερο ως αποταμιευτική ουσία. Το γλυκογόνο υπάρχει στα ζωικά κύπαρα και στα κύτταρα τωνμυκήτων ως αποταμιευτική ουσία. Λιπίδια Τα λιπίδια αποτελούν είτε δομικά συστατικά των κυττάρων (π.χ. συστατικά των μεμβρανών) είτε λειτουργικά (π.χ. αποταμιευτικές ουσίες). Κοινό χαρακτηριστικό 9

10 όλων των λιπιδίων είναι ότι δε διαλύονται στο νερό. Από τις σημαντικότερες κατηγορίες λιπιδίων είναι τα ουδέτερα λίπη, τα φωσφολιπίδια και τα στεροειδή. Ουδέτερα λίπη (τριγλυκερίδια).ένα μόριο ουδέτερου λίπους αποτελείται από τρία μόρια λιπαρών οξέων που έχουν ενωθεί με ένα μόριο γλυκερόλης. Ένας τρόπος διάκρισης των ουδέτερων λιπών βασίζεται στο αν τα λιπαρά οξέα που περιέχουν είναι κορεσμένα (περιέχουν μόνο απλούς δεσμούς) ή ακόρεστα (περιέχουν και διπλούς δεσμούς). Τα ακόρεστα λίπη, που είναι συχνότερα στα φυτά παρά στα ζώα, τείνουν, στις συνήθεις συνθήκες, να παραμένουν υγρά (ελαιόλαδο, αραβοσιτέλαιο κ.ά.). Αντίθετα τα κορεσμένα λίπη, που είναι συχνότερα στα ζώα παρά στα φυτά, στερεοποιούνται (βούτυρο κ.ά.). Τα λίπη αποτελούν για τους οργανισμούς αποθηκευτικές ουσίες, καθώς, για το ίδιο βάρος με τους υδατάνθρακες, περικλείουν διπλάσιο ποσό ενέργειας. Σε ορισμένα ζώα τα λίπη που συσσωρεύονται στον υποδόριο ιστό, εκτός από το ότι είναι αποθήκες ενέργειας, παίζουν και θερμομονωτικό ρόλο. Φωσφολιπίδια.Τα περισσότερο διαδεδομένα φωσφολιπίδια είναι αυτά που αποτελούνται από ένα μόριο γλυκερόλης συνδεδεμένο με δύο μόρια λιπαρών οξέων, ένα μόριο φωσφορικού οξέος και ένα μικρότερο πολικό μόριο. Η κεφαλή των φωσφολιπιδίων είναι υδρόφιλη, ενώ αντίθετα η ουρά του μορίου τους είναι υδρόφοβη. Για το λόγο αυτό, όταν τα φωσφολιπίδια τοποθετηθούν πάνω στο νερό, τείνουν να σχηματίσουν ένα λεπτό στρώμα, στο οποίο οι υδρόφιλες κεφαλές βρίσκονται μέσα στο νερό, ενώ οι υδρόφοβες ουρές προβάλλουν έξω από την ελεύθερη επιφάνεια. Στα κύτταρα, επειδή και το εξωτερικό και το εσωτερικό τους περιβάλλον είναι υδατικό, τα φωσφολιπίδια αυθόρμητα συγκροτούν διπλοστιβάδα. Οι υδρόφιλες κεφαλές τους στρέφονται προς το υδατικό εξωκυττάριο και ενδοκυττάριο περιβάλλον, ενώ οι υδρόφοβες ουρές τους «κρύβονται» στο εσωτερικό της διπλοστιβάδας. Η «επιθυμία» του υδρόφοβου μέρους των φωσφολιπιδίων να αποφεύγει οπωσδήποτε το νερό κάνει τα μόρια αυτά να έλκονται και να προσεγγίζουν στενά το ένα με το άλλο. Δημιουργείται έτσι μια σταθερή δομή. Η ιδιότητα αυτή είναι σημαντική για τη συγκρότηση και τη λειτουργικότητα των μεμβρανών του κυττάρου, των οποίων κύριο δομικό συστατικό είναι τα φωσφολιπίδια. Στεροειδή.Τα στεροειδή διαφέρουν από τα υπόλοιπα λιπίδια ως προς τη δομή τους. Ένα στεροειδές, που είναι γνωστό περισσότερο για τις αρνητικές συνέπειές του, στην υγεία μας, αφού προκαλεί αρτηριοσκλήρυνση, είναι η χοληστερόλη. Θα πρέπει να σημειώσουμε ωστόσο ότι η χοληστερόλη αποτελεί παράλληλα συστατικό των μεμβρανών των ζωικών κυττάρων. 10

11 Αντιγραφή. Η συμπληρωματικότητα των βάσεων του DNA ώθησε τους Watson και Crick, όταν περιέγραψαν το μοντέλο τους για τη δομή του γενετικού υλικού το 1953, να γράψουν: «είναι φανερό ότι το ειδικό ζευγάρωμα που έχουμε υποθέσει ότι δημιουργείται μεταξύ των βάσεων του DNA προτείνει έναν απλό μηχανισμό αντιγραφής του γενετικού υλικού». Οι Watson και Crick φαντάστηκαν μια διπλή έλικα η οποία ξετυλίγεται και κάθε αλυσίδα λειτουργεί σαν καλούπι για τη σύνθεση μιας νέας συμπληρωματικής αλυσίδας. Έτσι τα δύο θυγατρικά μόρια που προκύπτουν είναι πανομοιότυπα με το μητρικό και καθένα αποτελείται από μία παλιά και μία καινούρια αλυσίδα. Ο μηχανισμός αυτός ονομάστηκε ημισυντηρητικός. Η διαδικασία της αντιγραφής διαπιστώθηκε ότι η διαδικασία στην πραγματικότητα είναι ιδιαίτερα πολύπλοκη. Τα κύτταρα διαθέτουν ένα σημαντικό σύνολο εξειδικευμένων ενζύμων και άλλων πρωτεϊνών, που λειτουργούν ταυτόχρονα και καταλύουν τις χημικές αντιδράσεις της αντιγραφής με μεγάλη ταχύτητα και με εκπληκτική ακρίβεια. Η αντιγραφή του DNA αρχίζει από καθορισμένα σημεία, που ονομάζονται θέσεις έναρξης της αντιγραφής. Το βακτηριακό DNA, που είναι κυκλικό, έχει μία μόνο θέση έναρξης της αντιγραφής και αντιγράφεται κάτω από ευνοϊκές συνθήκες σε λιγότερο από 30 λεπτά. Στα ευκαρυωτικά κύτταρα, πριν την αντιγραφή, το DNA κάθε χρωμοσώματος είναι ένα μακρύ γραμμικό μόριο, το οποίο έχει πολυάριθμες θέσεις έναρξης της αντιγραφής. Έτσι το DNA των ευκαρυωτικών κυττάρων αντιγράφεται ταυτόχρονα από εκατοντάδες σημεία σε όλο το μήκος του και στη συνέχεια τα τμήματα που δημιουργούνται ενώνονται μεταξύ τους. Με αυτό τον τρόπο το DNA των ανώτερων ευκαρυωτικών οργανισμών, παρ' ότι είναι περίπου φορές μεγαλύτερο από των προκαρυωτικών, αντιγράφεται πολύ γρήγορα. Για να αρχίσει η αντιγραφή του DNA, είναι απαραίτητο να ξετυλιχθούν στις θέσεις έναρξης της αντιγραφής οι δύο αλυσίδες. Αυτό επιτυγχάνεται με τη βοήθεια ειδικών ενζύμων, που σπάζουν τους δεσμούς υδρογόνου μεταξύ των δύο αλυσίδων. Τα ένζυμα αυτά ονομάζονται DNA ελικάσες. Όταν ανοίξει η διπλή έλικα, δημιουργείται μια «θηλιά», η οποία αυξάνεται και προς τις δύο κατευθύνσεις. Οι θηλιές που δημιουργούνται κατά την έναρξη της αντιγραφής σε ένα μόριο DNA είναι ορατές με το ηλεκτρονικό μικροσκόπιο. Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA ονομάζονται DNA πολυμεράσες. Επειδή τα ένζυμα αυτά δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. DNA πολυμεράσες επιμηκύνουν τα πρωταρχικά τμήματα. Τα νέα μόρια DNA αρχίζουν να 11

12 σχηματίζονται, καθώς δημιουργούνται δεσμοί υδρογόνου μεταξύ των συμπληρωματικών αζωτούχων βάσεων των δεοξυριβονουκλεοτιδίων. DNA πολυμεράσες επιδιορθώνουν επίσης λάθη που συμβαίνουν κατά τη διάρκεια της αντιγραφής. Μπορούν, δηλαδή, να απομακρύνουν νουκλεοτίδιο που οι ίδιες τοποθετούν, κατά παράβαση του κανόνα της συμπληρωματικότητας, και να τοποθετούν τα σωστά. Ταυτόχρονα DNA πολυμεράσες απομακρύνουν τα πρωταρχικά τμήματα RNA και τα αντικαθιστούν με τμήματα DNA. Τα κομμάτια της ασυνεχούς αλυσίδας συνδέονται μεταξύ τους με τη βοήθεια ενός ενζύμου, που ονομάζεται DNA δεσμάση. Το ίδιο ένζυμο συνδέει και όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής. Το κύτταρο ελέγχει αν η αλληλουχία βάσεων του DNA είναι σωστή. Η αντιγραφή του DNA είναι απίστευτα ακριβής, μόνο ένα νουκλεοτίδιο στα μπορεί να ενσωματωθεί λάθος. Τα λάθη που δεν επιδιορθώνονται από τις DNA πολυμεράσες, επιδιορθώνονται σε μεγάλο ποσοστό από ειδικά επιδιορθωτικά ένζυμα. Έτσι ο αριθμός των λαθών περιορίζεται στους ευκαρυωτικούς οργανισμούς στο ένα στα To DNA ενός οργανισμού περιέχει αποθηκευμένες ακριβείς οδηγίες, οι οποίες καθορίζουν τη δομή και τη λειτουργία του οργανισμού. Ταυτόχρονα περιέχει την πληροφορία για τον αυτοδιπλασιασμό του, εξασφαλίζοντας έτσι τη μεταβίβαση των γενετικών οδηγιών από ένα κύτταρο στα θυγατρικά του και από έναν οργανισμό στους απογόνους του. Το πρώτο βήμα για την έκφραση της πληροφορίας που υπάρχει στο DNA είναι η μεταφορά της στο RNA με τη διαδικασία της μεταγραφής. To RNA μεταφέρει με τη σειρά του, μέσω της διαδικασίας της μετάφρασης, την πληροφορία στις πρωτεΐνες που είναι υπεύθυνες για τη δομή και λειτουργία των κυττάρων και κατ' επέκταση και των οργανισμών. Η σχέση αυτή συνοψίζεται στο ακόλουθο σχήμα, όπου τα βέλη δείχνουν την κατεύθυνση της μεταφοράς της γενετικής πληροφορίας: Το σχήμα αυτό αποτελεί το κεντρικό δόγμα της Μοριακής Βιολογίας. Η γενετική πληροφορία είναι η καθορισμένη σειρά των βάσεων. Η πληροφορία υπάρχει σε τμήματα του DNA με συγκεκριμένη ακολουθία, τα γονίδια. Αυτά, διά μέσου της μεταγραφής και της μετάφρασης, καθορίζουν τη σειρά των αμινοξέων στην πρωτεΐνη. Οι πορείες της μεταγραφής και της μετάφρασης των γονιδίων αποτελούν τη γονιδιακή έκφραση. Η αντιγραφή λοιπόν του DNA διαιωνίζει τη γενετική πληροφορία, ενώ η μετάφραση χρησιμοποιεί αυτή την πληροφορία, για να κατασκευάσει ένα πολυπεπτίδιο. Η μεταγραφή καθορίζει ποια γονίδια θα εκφραστούν, σε ποιους ιστούς (στους πολυκύτταρους ευκαρυωτικούς οργανισμούς), και σε ποια στάδια της ανάπτυξης. Όλα τα κύτταρα ενός πολυκύτταρου οργανισμού έχουν το ίδιο DNA. Σε κάθε ομάδα κυττάρων όμως εκφράζονται διαφορετικά γονίδια. Τα γονίδια διακρίνονται σε δύο κατηγορίες: 12

13 Στα γονίδια που μεταγράφονται σε mrna και μεταφράζονται στη συνέχεια σε πρωτεΐνες και Στα γονίδια που μεταγράφονται και παράγουν trna, rrna, και snrna. Το απλοειδές ανθρώπινο γονιδίωμα έχει μήκος 3x109 ζεύγη βάσεων. Από αυτό, μικρό ποσοστό μεταγράφεται σε RNA, δηλαδή αποτελεί τα γονίδια. Υπάρχουν τέσσερα είδη μορίων RNA που παράγονται με τη μεταγραφή: το αγγελιαφόρο RNA (mrna), το μεταφορικό RNA (trna), το ριβοσωμικό RNA (rrna) και το μικρό πυρηνικά RNA (snrna). Τα τρία πρώτα είδη υπάρχουν και στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς, αλλά το τέταρτο υπάρχει μόνο στους ευκαρυωτικούς. 1. Αγγελιαφόρο RNA (mrna). Τα μόρια αυτά μεταφέρουν την πληροφορία του DNA για την παραγωγή μιας πολυπεπτιδικής αλυσίδας. 2. Ριβοσωμικό RNA (rrna). Τα μόρια αυτά συνδέονται με πρωτεΐνες και σχηματίζουν το ριβόσωμα, ένα «σωματίδιο» απαραίτητο για την πραγματοποίηση της πρωτεϊνοσύνθεσης. 3. Μεταφορικό RNA (trna). Κάθε μεταφορικό RNA συνδέεται με ένα συγκεκριμένο αμινοξύ και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης. 4. Μικρό πυρηνικό RNA (snrna). Είναι μικρά μόρια RNA, τα οποία συνδέονται με πρωτεΐνες και σχηματίζουν μικρά ριβονουκλεοπρωτείνικά σωματίδια.τα σωματίδια αυτά καταλύουν την «ωρίμανση» του mrna, μια διαδικασία που, όπως θα αναφερθεί παρακάτω, γίνεται μόνο στους ευκαρυωτικούς οργανισμούς. Μεταγραφή του DNA Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Η μεταγραφή καταλύεται από ένα ένζυμο, την RNA πολυμεδη RNA πολυμεράση. Η RNA πολυμεράση προσδένεται σε ειδικές περιοχές του DNA, που ονομάζονται υποκινητές, με τη βοήθεια πρωτεϊνών που ονομάζονται μεταγραφικοί παράγοντες. Οι υποκινητές και οι μεταγραφικοί παράγοντες αποτελούντα ρυθμιστικά στοιχεία της μεταγραφής του DNA και επιτρέπουν στην RNA πολυμεράση να αρχίσει σωστά τη μεταγραφή. Οι υποκινητές βρίσκονται πάντοτε πριν από την αρχή κάθε γονιδίου. Κατά την έναρξη της μεταγραφής ενός γονιδίου η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA. Στη συνέχεια, τοποθετεί τα ριβονουκλεοτίδια απέναντι από τα δεοξυριβο-νουκλεοτίδια μίας αλυσίδας του DNA σύμφωνα με τον κανόνα της συμπληρωματικότητας των βάσεων, όπως και στην αντιγραφή, με τη διαφορά ότι εδώ απέναντι από την αδενίνη τοποθετείται το ριβονουκλεοτίδιο που περιέχει ουρακίλη. Η RNA πολυμεράση συνδέει τα ριβονουκλεοτίδια, που προστίθενται το ένα μετά το άλλο, με 3'-5'φωσφοδιεστερικό δεσμό. Η μεταγραφή έχει προσανατολισμό 5' - 3' όπως και η αντιγραφή. Η σύνθεση του RNA σταματά στο τέλος του γονιδίου, όπου ειδικές αλληλουχίες οι οποίες ονομάζονται αλληλουχίες ληξης της μεταγραφής, επιτρέπουν την απελευθέρωσή του. Το μόριο RNA που συντίθεται είναι συμπληρωματικό προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η 13

14 συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική. To RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Στους προκαρυωτικούς οργανισμούς το mrna αρχίζει να μεταφράζεται σε πρωτεΐνη πριν ακόμη ολοκληρωθεί η μεταγραφή του. Αυτό είναι δυνατό, επειδή δεν υπάρχει πυρηνική μεμβράνη. Αντίθετα, στους ευκαρυωτικούς οργανισμούς, το mrna που παράγεται κατά τη μεταγραφή ενός γονιδίου συνήθως δεν είναι έτοιμο να μεταφραστεί, αλλά υφίσταται μια πολύπλοκη διαδικασία ωρίμανσης. Η διαδικασία αυτή οδήγησε στο συμπέρασμα ότι τα περισσότερα γονίδια των ευκαρυωτικών οργανισμών (και των ιών που τους προσβάλλουν) είναι ασυνεχή ή διακεκομμένα. Δηλαδή, η αλληλουχία που μεταφράζεται σε αμινοξέα διακόπτεται από ενδιάμεσες αλληλουχίες οι οποίες δε μεταφράζονται σε αμινοξέα. Οι αλληλουχίες που μεταφράζονται σε αμινοξέα ονομάζονται εξώνια και οι ενδιάμεσες αλληλουχίες ονομάζονται εσώνια. Όταν ένα γονίδιο που περιέχει εσώνια μεταγράφεται, δημιουργείται το πρόδρομο mrna που περιέχει και εξώνια και εσώνια. Το πρόδρομο mrna μετατρέπεται σε mrna με τη διαδικασία της ωρίμανσης, κατά την οποία τα εσώνια κόβονται από μικρά ριβονουκλεοπρωτεϊνικά «σωματίδια» και απομακρύνονται. Τα ριβονουκλεοπρωτεϊνικά σωματίδια αποτελούνται από snrna και από πρωτεΐνες και λειτουργούν ως ένζυμα: κόβουν τα εσώνια και συρράπτουν τα εξώνια μεταξύ τους. Έτσι σχηματίζεται το «ώριμο» mrna. Αυτό, παρ' ότι αποτελείται αποκλειστικά από εξώνια, έχει δύο περιοχές που δε μεταφράζονται σε αμινοξέα. Η μία βρίσκεται στο 5' άκρο και η άλλη στο 3' άκρο. Οι αλληλουχίες αυτές ονομάζονται 5' και 3' αμετάφραστες περιοχές, αντίστοιχα. To mrna μεταφέρεται από τον πυρήνα στο κυπαρόπλασμα και ειδικότερα στα ριβοσώματα όπου είναι η θέση της πρωτεϊνοσύνθεσης. Ο γενετικός κώδικας είναι η αντιστοίχιση τριπλετών βασεων σε αμινοξέα. Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο mrna με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση έναν κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. Γι' αυτό η πρωτεϊνοσύνθεση είναι πραγματικά μία διαδικασία «μετάφρασης» από τη γλώσσα των βάσεων στη γλώσσα των αμινοξέων. Επειδή ο αριθμός των διαφορετικών αμινοξέων που συγκροτούν τις πρωτεΐνες είναι είκοσι και, αντίστοιχα, ο αριθμός των διαφορετικών νουκλεοτιδίων που συγκροτούν το RNA είναι τέσσερα, θεωρήθηκε πιθανό ότι τρία νουκλεοτίδια αντιστοιχούν σε ένα αμινοξύ και γι' αυτό ο γενετικός κώδικας ονομάστηκε κώδικας τριπλέτας. Ο κώδικας τριπλέτας είναι φυσική συνέπεια του γεγονότος ότι τέσσερα νουκλεοτίδια, αν συνδυαστούν ανά ένα (4 1 =4) ή ανά δύο (4 2 = 16), δε δίνουν αρκετούς συνδυασμούς για να κωδικοποιηθούν τα είκοσι αμινοξέα. Αν όμως συνδυαστούν ανά τρία (4 3 =64) οι συνδυασμοί είναι παραπάνω από αρκετοί. Τα βασικά χαρακτηριστικά του γενετικού κώδικα είναι: 1. Ο γενετικός κώδικας είναι κώδικας τριπλέτας, δηλαδή μια τριάδα νουκλεοτιδίων, το κωδικόνιο, κωδικοποιεί ένα αμινοξύ. 2. Ο γενετικός κώδικας είναι συνεχής, δηλαδή το mrna διαβάζεται συνεχώς ανά τρία νουκλεοτίδια χωρίς να παραλείπεται κάποιο νουκλεοτίδιο. 14

15 3. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος, δηλαδή κάθε νουκλεοτίδιο ανήκει σε ένα μόνο κωδικόνιο. 4. Ο γενετικός κώδικας είναι σχεδόν καθολικός. Όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα. Αυτό πρακτικά σημαίνει ότι το mrna από οποιονδήποτε οργανισμό μπορεί να μεταφραστεί σε εκχυλίσματα φυτικών, ζωικών ή βακτηριακών κυττάρων in vitro και να παραγάγει την ίδια πρωτεΐνη. 5. Ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος. Με εξαίρεση δύο αμινοξέα τα υπόλοιπα 18 κωδικοποιούνται από δύο μέχρι και έξι διαφορετικά κωδικόνια. Τα κωδικόνια που κωδικοποιούν το ίδιο αμινοξύ ονομάζονται συνώνυμα. 6. Ο γενετικός κώδικας έχει κωδικόνιο έναρξης και κωδικόνια λήξης. Το κωδικόνιο έναρξης σε όλους τους οργανισμούς είναι το AUG και κωδικοποιεί το αμινοξύ μεθειονίνη. Υπάρχουν τρία κωδικόνια λήξης, τα UAG, UGA και UAA. Η παρουσία των κωδικονίων αυτών στο μόριο του mrna οδηγεί στον τερματισμό της σύνθεσης της πολυπεπτιδικής αλυσίδας. Ο όρος κωδικόνιο δεν αφορά μόνο το mrna αλλά και το γονίδιο από το οποίο παράγεται. Έτσι, για παράδειγμα, το κωδικόνιο έναρξης AUG αντιστοιχεί στο κωδικόνιο έναρξης της κωδικής αλυσίδας του γονιδίου ATG κ.ο.κ. Το τμήμα ενός γονιδίου, και του mrna του που κωδικοποιεί μια πολυπεπτιδική αλυσίδα, αρχίζει με το κωδικόνιο έναρξης και τελειώνει με το κωδικόνιο λήξης. Μετάφραση Η μετάφραση του mrna, δηλαδή η αντιστοίχιση των κωδικονίων σε αμινοξέα και η διαδοχική σύνδεση των αμινοξέων σε πολυπεπτιδική αλυσίδα, πραγματοποιείται στα ριβοσώματα με τη βοήθεια των trna και τη συμμετοχή αρκετών πρωτεϊνών και ενέργειας. Τα ριβοσώματα μπορούν να χρησιμοποιηθούν ως θέση μετάφρασης για οποιοδήποτε mrna. Αυτό εξηγεί γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών». Κάθε ριβόσωμα αποτελείται από δύο υπομονάδες, μια μικρή και μια μεγάλη, και έχει μία θέση πρόσδεσης του mrna στη μικρή υπομονάδα και δύο θέσεις εισδοχής των trna στη μεγάλη υπομονάδα. Κάθε μόριο trna έχει μια ειδική τριπλετα νουκλεοτιδίων, το αντικωδικόνιο, με την οποία προσδένεται, λόγω συμπληρωματικότητας, με το αντίστοιχο κωδικόνιο του mrna. Επιπλέον, κάθε μόριο trna διαθέτει μια ειδική θέση σύνδεσης με ένα συγκεκριμένο αμινοξύ. Η πρωτεϊνοσύνθεση διακρίνεται σε τρία στάδια: την έναρξη, την επιμήκυνση και τη λήξη. Έναρξη: Κατά την έναρξη της μετάφρασης το mrna προσδένεται, μέσω μιας αλληλουχίας που υπάρχει στην 5' αμετάφραση περιοχή του, με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος, σύμφωνα με τους κανόνες της συμπληρωματικότητας των βάσεων. Το πρώτο κωδικόνιο του mrna είναι πάντοτε AUG και σ' αυτό προσδένεται το trna που φέρει το αμινοξύ μεθειονίνη. Όμως δεν έχουν όλες οι πρωτεΐνες του οργανισμού ως πρώτο αμινοξύ μεθειονίνη. Αυτό συμβαίνει γιατί, σε πολλές πρωτεΐνες, μετά τη σύνθεσή τους απομακρύνονται ορισμένα αμινοξέα από το αρχικό αμινικό άκρο τους. Το σύμπλοκο που 15

16 δημιουργείται μετά την πρόσδεση του mrna στη μικρή υπομονάδα του ριβοσώματος και τουtrna που μεταφέρει τη μεθειονίνη ονομάζεται σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης. Επιμήκυνση: Κατά την επιμήκυνση ένα δεύτερο μόριο trna με αντικωδικόνιο συμπληρωματικό του δεύτερου κωδικονίου του mrna τοποθετείται στην κατάλληλη εισδοχή του ριβοσώματος, μεταφέροντας το δεύτερο αμινοξύ. Μεταξύ της μεθειονίνης και του δεύτερου αμινοξέος σχηματίζεται πεπτιδικός δεσμός και αμέσως μετά, το πρώτο trna αποσυνδέεται από το ριβόσωμα και απελευθερώνεται στο κυτταρόπλασμα όπου συνδέεται πάλι με μεθειονίνη, έτοιμο για επόμενη χρήση. Το ριβόσωμα και το mrna έχουν τώρα ένα trna, πάνω στο οποίο είναι προσδεμένα δύο αμινοξέα. Έτσι αρχίζει η επιμήκυνση της πολυπεπτιδικής αλυσίδας. Στη συνέχεια το ριβόσωμα κινείται κατά μήκος του mrna κατά ένα κωδικόνιο. Ένα τρίτο trna έρχεται να προσδεθεί μεταφέροντας το αμινοξύ του. Ανάμεσα στο δεύτερο και στο τρίτο αμινοξύ σχηματίζεται πεπτιδικός δεσμός. Η πολυπεπτιδική αλυσίδα συνεχίζει να αναπτύσσεται καθώς νέα trna μεταφέρουν αμινοξέα τα οποία συνδέονται μεταξύ τους. Λήξη: Η επιμήκυνση σταματά σε ένα κωδικόνιο λήξης (UGA, UAG ή UAA), επειδή δεν υπάρχουν trna που να αντιστοιχούν σε αυτά. Το τελευταίο trna απομακρύνεται από το ριβόσωμα και η πολυπεπτιδική αλυσίδα απελευθερώνεται. Σημειώνεται ότι πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. Πολλά ριβοσώματα μπορούν να μεταφράζουν ταυτόχρονα ένα mrna, το καθένα σε διαφορετικό σημείο κατά μήκος του μορίου. Αμέσως μόλις το ριβόσωμα έχει μεταφράσει τα πρώτα κωδικόνια, η θέση έναρξης του mrna είναι ελεύθερη για την πρόσδεση ενός άλλου ριβοσώματος. Το σύμπλεγμα των ριβοσωμάτων με το mrna ονομάζεται πολύσωμα. Ένα κύτταρο μπορεί να παραγάγει μεγάλα ποσά μιας πρωτείνης από ένα ή από δύο αντίγραφα ενός γονιδίου. 16

17 Το κύτταρο Το κύτταρο είναι η θεμελιώδης δομική και λειτουργική μονάδα όλων των οργανισμών. Αυτό σημαίνει ότι το κύτταρο είναι η μικρότερη δομή στη φύση όπου εμφανίζεται το φαινόμενο της ζωής. Η κυτταρική θεωρία υποστηρίζει ότι: Όλοι οι οργανισμοί αποτελούνται από κύτταρα και από κυτταρικά παράγωγα. Όλα τα κύτταρα δομούνται από τις ίδιες χημικές ενώσεις και εκδηλώνουν παρόμοιες μεταβολικές διεργασίες. Η λειτουργία των οργανισμών είναι το αποτέλεσμα της συλλογικής δράσης και αλληλεπίδρασης των κυττάρων που τους αποτελούν. Κάθε κύτταρο προέρχεται από τη διαίρεση προϋπάρχοντος κυττάρου Τα κύτταρα, με κριτήριο την πολυπλοκότητα της κατασκευής τους και κυρίως την ύπαρξη ή όχι μεμβράνης που περιβάλλει το γενετικό τους υλικό, διακρίνονται σε προκαρυωτικά και σε ευκαρυωτικά. Η δομή των ευκαρυωτικών κυττάρων, δηλαδή ορισμένων μονοκύτταρων και των πολυκύτταρων οργανισμών, είναι συνθετότερη. Η μεμβράνη που περιβάλλει το γενετικό υλικό σχηματίζει μαζί μ' αυτό τον πυρήνα του κυττάρου (κάρυο=πυρήνας, ευ=καλώς καλά σχηματισμένος πυρήνας). Αντίθετα, στα προκαρυωτικά κύτταρα (βακτήρια και κυανοβακτήρια), που είναι απλούστερα, το γενετικό υλικό δεν περιβάλλεται από μεμβράνη και συνεπώς δεν υπάρχει πυρήνας. Θεωρείται ότι τα προκαρυωτικά κύτταρα, κατά την εξελικτική διαδικασία, προϋπήρξαν των ευκαρυωτικών. Το ευκαρυωτικό κύτταρο Τα κύτταρα αποτελούν τρισδιάστατες δομές, που σφύζουν από δραστηριότητα. Μερικά από αυτά έχουν δυνατότητα κίνησης, χάρη σε ειδικές δομές που διαθέτουν, ενώ άλλα μπορούν να συλλαμβάνουν την τροφή τους μεταβάλλοντας το σχήμα τους. Υπάρχουν όμως και ιδιότητες που είναι κοινές για όλα τα κύτταρα, όπως η μεταφορά ουσιών στο εσωτερικό τους, η αλλαγή θέσης των κυτταρικών δομών, όταν αυτό είναι απαραίτητο, και οι πολύπλοκες βιοχημικές διεργασίες. Τα κύτταρα εξάλλου δεν είναι όλα ίδια. Στον άνθρωπο, για παράδειγμα, υπάρχουν 100 περίπου διαφορετικά είδη κυττάρων. Καθένα έχει τη δική του χαρακτηριστική μορφή και κάνει μια συγκεκριμένη λειτουργία. Κάποια έχουν επίμηκες σχήμα και δυνατότητα συστολής, άλλα έχουν λεπτές προεκτάσεις, με τις οποίες μπορούν να μεταβιβάζουν και να δέχονται μηνύματα, και άλλα είναι πλατιά και έχουν καλυπτήριο ρόλο. Είναι επομένως δύσκολο, αν όχι αδύνατο, να κάνουμε μια ολοκληρωμένη παρουσίαση 17

18 του κυττάρου με βάση ένα μόνο σχήμα ή μία περιγραφή. Για να ξεπεραστεί αυτή η δυσκολία, καταφεύγουμε στην περιγραφή ενός ουσιαστικά ανύπαρκτου κυττάρου, το οποίο ονομάζεται «τυπικό κύτταρο». Ένα κύτταρο δηλαδή το οποίο συγκεντρώνει όλα τα κοινά γνωρίσματα. Τα κύτταρα, για να διατηρούν τη λειτουργικότητά τους, είναι υποχρεωμένα να βρίσκονται σε μια διαρκή ανταλλαγή ουσιών με το περιβάλλον τους. Όμως τόσο η εισαγωγή χρήσιμων ουσιών από το περιβάλλον τους όσο και η αποβολή άχρηστων ουσιών σ' αυτό γίνεται μέσω της εξωτερικής επιφάνειάς τους. Όσο μεγαλύτερη είναι λοιπόν η επιφάνεια αυτή τόσο μεγαλύτερη είναι και η δυνατότητα ανταλλαγής ουσιών με το περιβάλλον. Στο κύτταρο, εκτός από την ανταλλαγή ουσιών, η οποία καλύπτει τις μεταβολικές ανάγκες του, γίνεται και ανταλλαγή ουσιών - μηνυμάτων. Χάρη στα μηνύματα αυτά το κύτταρο «επικοινωνεί» με το περιβάλλον του και «αντιλαμβάνεται» τις μεταβολές που συμβαίνουν σ' αυτό. Με βάση τις πληροφορίες αυτές εναρμονίζει τις λειτουργίες των επιμέρους τμημάτων του. Η μεταβίβαση των μηνυμάτων από το εξωτερικό στο εσωτερικό του κυττάρου, αλλά και στο εσωτερικό μεταξύ των διαφορετικών περιοχών του, θα πρέπει να γίνεται με ταχύτητα. Αυτό μπορεί να πραγματοποιηθεί μόνο αν το κύτταρο έχει σχετικά μικρό όγκο. Πράγματι, το σχήμα των κυττάρων είναι τέτοιο, ώστε αυτά να έχουν μικρό όγκο και συγχρόνως τη μεγαλύτερη δυνατή επιφάνεια που αντιστοιχεί στον όγκο αυτό. Έτσι ικανοποιούν ταυτόχρονα και τις δύο προϋποθέσεις: μεγάλη επιφάνεια για άνετες ανταλλαγές ουσιών και υποδοχή μηνυμάτων, και μικρό όγκο για έγκαιρη μεταβίβαση των μηνυμάτων στο εσωτερικό του κυττάρου. Με μια ματιά στην εικόνα ενός «τυπικού κυττάρου», για να διαπιστώσει κανείς την πολυπλοκότητα της δομής του και την έντονη παρουσία μεμβρανών.μεμβράνη το οριοθετεί από το εξωκυτταρικό περιβάλλον. Μεμβράνη περιβάλλει τον πυρήνα του. Μεμβράνες επίσης διασχίζουν το κυτταρόπλασμα, δηλαδή την περιοχή ανάμεσα στην πυρηνική και στην πλασματική μεμβράνη. Αυτό έχει ως αποτέλεσμα τη διαμερισματοποίηση του εσωτερικού του κυττάρου. Καθένα από τα «διαμερίσματα» έχει τη δική του μορφή και λειτουργία. Αυτά τα «διαμερίσματα» είναι τα κυτταρικά οργανίδια Πλασματική μεμβράνη. Πλασματική μεμβράνη ονομάζουμε αυτήν που οριοθετεί το κύτταρο σε σχέση με το εξωτερικό του περιβάλλον. Οι λειτουργίες της, όπως και οι λειτουργίες των υπολοίπων κυτταρικών δομών, απορρέουν από τη δομή της. Σήμερα υπάρχουν διάφορα μοντέλα για τη μελέτη της δομής και της λειτουργίας των κυτταρικών μεμβρανών και σ' αυτό βοήθησε η ανάπτυξη της ηλεκτρονικής μικροσκοπίας και άλλων τεχνικών. Το μοντέλο που είναι πιο αποδεκτό σήμερα είναι αυτό του «ρευστού μωσαϊκού». Σύμφωνα με το μοντέλο αυτό, οι μεμβράνες αποτελούνται από μια διπλοστιβάδα, φωσφολιπιδίων κυρίως, ανάμεσα στα οποία παρεμβάλλονται στεροειδή όπως η χοληστερόλη και πρωτεΐνες, οι οποίες είτε βρίσκονται στην επιφάνεια της μεμβράνης είτε βυθίζονται στο εσωτερικό της είτε τη διαπερνούν κάθετα, σχηματίζοντας ένα είδος μωσαϊκού. Συχνά, πρωτεΐνες αλλά και λιπίδια της 18

19 πλασματικής μεμβράνης εμφανίζονται συνδεδεμένα με υδατάνθρακες (σάκχαρα). Τα σύνθετα αυτά μόρια ονομάζονται γλυκοπρωτεΐνες ή γλυκολιπίδια αντίστοιχο. Τα υδρόφιλα τμήματα των λιπιδίων στρέφονται προς το ενδοκυτταρικό και προς το εξωκυτταρικό περιβάλλον, που είναι υδατικά. Αντίθετα τα υδρόφοβα τμήματα, δηλαδή οι ουρές των φωσφολιπιδίων, στρέφονται προς το εσωτερικό της κατασκευής, ώστε να αποφεύγουν την επαφή τους με το νερό. Οι έλξεις που αναπτύσσονται μεταξύ των υδρόφιλων τμημάτων και των μορίων του νερού, καθώς και οι έλξεις των υδρόφοβων τμημάτων μεταξύ τους, προσδίδουν στη μεμβράνη σταθερότητα, χωρίς παράλληλα να την κάνουν στατική. Η ονομασία «ρευστό μωσαϊκό» αποδίδει ακριβώς τη δυνατότητα που έχουν τα περισσότερα λιπίδια και αρκετές από τις πρωτεΐνες της μεμβράνης να ολισθαίνουν πλαγίως, αλλάζοντας θέση με γειτονικά τους μόρια. Η διατήρηση της ρευστότητας των μεμβρανών έχει μεγάλη σημασία για τη λειτουργία τους. Μεμβράνες που έχουν «στερεοποιηθεί» παύουν να είναι λειτουργικές, γιατί πολλές από τις πρωτεΐνες τους αδρανοποιούνται. Στη διατήρηση της ρευστότητας των μεμβρανών σημαντικό ρόλο παίζει η χοληστερόλη, ένα στεροειδές που παρεμβάλλεται μεταξύ των φωσφολιπιδίων. Σε ό,τι αφορά το ρόλο των πρωτεϊνών της μεμβράνης, άλλες από αυτές αποτελούν δομικά συστατικά της και άλλες έχουν λειτουργικό ρόλο. Ελέγχουν, για παράδειγμα, την είσοδο ή έξοδο ουσιών, δέχονται και μεταβιβαζουν στο εσωτερικό του κυττάρου μηνύματα από το περιβάλλον κ.ά. Κάθε μεμβράνη που έχει τη χαρακτηριστική δίστιβη δομή που περιγράφηκε ονομάζεται απλή στοιχειώδης μεμβράνη. Οι εκφράσεις «εξωτερικό σύνορο του κυττάρου», «όριο ανάμεσα στο κυτταρόπλασμα και στο εξωκυτταρικό περιβάλλον» κ.ά., που αποδίδονται στην πλασματική μεμβράνη, ίσως την αδικούν λιγάκι, γιατί, ενώ προβάλλουν τον παθητικό ρόλο της στην οριοθέτηση του κυττάρου αποκρύπτουν την καθοριστική συμμετοχή της σε άλλες κυτταρικές λειτουργίες, όπως είναι: Ο έλεγχος του είδους των ουσιών που εισέρχονται ή εξέρχονται από το κύτταρο. 19

20 Η υποδοχή και η ερμηνεία μηνυμάτων από το περιβάλλον του κυττάρου. Μεταφορά ουσιών διαμέσου της πλασματικής μεμβράνης Είναι εύκολο να κατανοήσουμε ότι αν η μεμβράνη ήτα" ένα τελείως αδιαπέραστο περίβλημα, το κύτταρο θα ηταν ανίκανο να προσλάβει τις απαραίτητες θρεπτικές ουσίες, να αποβάλει τα άχρηστα προϊόντα του μεταβολισμού του, αλλά και να εξαγάγει ουσίες που μπορούν να χρησιμοποιηθούν άλλου στην περίπτωση πολυκύτταρων οργανισμών. Αν πάλι η μεμβράνη ήταν τελείως διαπερατή από κάθε χημική ουσία, τότε η χημική σύσταση του κυττάρου δε θα μπορούσε να διατηρηθεί. Θα γινόταν, λόγω διάχυσης, εντελώς όμοια με τη χημική σύσταση του περιβάλλοντος του. Έτσι θα έχανε την υψηλή συγκέντρωση εκείνων των συστατικών που είναι απαραίτητα για την εκδήλωση του φαινομένου της ζωής. Είναι λοιπόν φανερό ότι η δομή της πλασματικής μεμβράνης πρέπει να καθορίζει ποιες από τις διάφορες ουσίες θα τη διαπερνούν εύκολα και ποιες θα τη διαπερνούν δύσκολα ή και καθόλου. Με άλλα λόγια, η μεμβράνη πρέπει να είναι εκλεκτικά διαπερατή. Οι φυσιολόγοι διακρίνουν τρεις κύριους τύπους μεταφοράς ουσιών μέσω της μεμβράνης. Την παθητική μεταφορά, την ενεργητική μεταφορά και την ενδοκύττωση και εξωκύττωση. Παθητική μεταφορά Η παθητική μεταφορά ουσιών δια μέσου της πλασματικής μεμβράνης γίνεται με δύο τρόπους. Με τη διάχυση και την ώσμωση. Διάχυση: Με τον όρο διάχυση, γενικά, χαρακτηρίζουμε την τάση των μορίων να διασπείρονται από τις περιοχές υψηλής συγκέντρωσης προς τις περιοχές χαμηλής συγκέντρωσης. Για παράδειγμα, η συγκέντρωση οξυγόνου στο εξωτερικό του κυττάρου είναι υψηλή σε σχέση με αυτήν στο εσωτερικό του κυττάρου, γιατί εκεί το οξυγόνο καταναλώνεται συμμετέχοντας σε αντιδράσεις του μεταβολισμού. Η διαφορά αυτή στις συγκεντρώσεις οδηγεί τα μόρια του οξυγόνου στο εσωτερικό του κυττάρου. Αντίθετα η υψηλή συγκέντρωση του διοξειδίου του άνθρακα στο εσωτερικό του κυττάρου (παράγεται συνεχώς κατά τις αντιδράσεις του μεταβολισμού) το οδηγεί έξω από αυτό, όπου η συγκέντρωση είναι χαμηλότερη. Ώσμωση: Είναι μια ειδική περίπτωση διάχυσης μορίων νερού μέσω μιας ημιπερατής μεμβράνης. Είναι ιδιαίτερα σημαντική διαδικασία για τη ζωή και τη λειτουργικότητα του κυττάρου, γιατί η πλασματική μεμβράνη, ενώ επιτρέπει τη διέλευση μορίων νερού, περιορίζει ή εμποδίζει ολοκληρωτικά τη διέλευση ουσιών που έχουν μεγάλο μέγεθος. Έτσι, όταν η ενδοκυτταρική συγκέντρωση μιας ουσίας είναι μεγαλύτερη από την εξωκυτταρική, για να επέλθει ισορροπία, εισέρχεται νερό στο κύπαρο. Στην αντίθετη περίπτωση, όταν η ενδοκυτταρική συγκέντρωση μιας ουσίας είναι μικρότερη από την εξωκυτταρική, εξέρχεται νερό. Μεταφορά ιόντων - Αντλία Κ + - Na + : Αν η μεταφορά ουσιών μέσω της κυτταρικής μεμβράνης γινόταν μόνο παθητικά, όπως περιγράφηκε στην προηγούμενη παράγραφο, τα κύτταρα, αργά ή γρήγορα, θα αποκτούσαν στο εσωτερικό τους τις ίδιες συγκεντρώσεις ουσιών με το εξωκυτταρικό περιβάλλον. Η μελέτη όμως των κυττάρων δείχνει πως αυτό δε συμβαίνει. Στα κύτταρα του ανθρώπου, για παράδειγμα, η ενδοκυτταρική συγκέντρωση των ιόντων Κ + είναι μεγαλύτερη από την εξωκυτταρική και η ενδοκυτταρική συγκέντρωση των ιόντων Na + μικρότερη από 20

21 την εξωκυτταρική και αυτό διατηρείται. Αυτό σημαίνει ότι υπάρχει ένας μηχανισμός μεταφοράς, ο οποίος, αντί να μεταφέρει ιόντα από την περιοχή υψηλής συγκέντρωσης προς την περιοχή χαμηλής συγκέντρωσης, τα μεταφέρει αντίθετα. Η μεταφορά βέβαια στην περίπτωση αυτή δε μπορεί να γίνεται παθητικά και βέβαια προϋποθέτει την κατανάλωση ενέργειας. Είναι δηλαδή ένας μηχανισμός ενεργητικής μεταφοράς ουσιών. 0 μηχανισμός που αφορά τα παραπάνω ιόντα χαρακτηρίζεται ως αντλία Κ + - Na +. Το ρόλο της αντλίας τον παίζει μια διαμεμβρανική πρωτεΐνη, η οποία για κάθε 3Na +, που εξάγει, εισάγει ταυτόχρονα 2Κ +. Ο μηχανισμός αυτός υπάρχει σε όλα τα ζωικά κύτταρα, με ιδιαίτερα σημαντικό ρόλο στη λειτουργία των νευρικών κυττάρων. Έχει διαπιστωθεί ότι στα κύτταρα, εκτός από την αντλία Κ + - Na +, υπάρχουν και άλλοι μηχανισμοί ενεργητικής μεταφοράς διάφορων ουσιών. Κοινό χαρακτηριστικό των μηχανισμών αυτών είναι ότι όλοι χρησιμοποιούν ενέργεια και ότι σε όλους καθοριστικό ρόλο παίζουν συγκεκριμένες πρωτεΐνες της μεμβράνης. Μεταφορά ουσιών μεγάλου μοριακού βάρους: Εκτός από τα ιόντα ή τις ουσίες μικρού μοριακού βάρους, την πλασματική μεμβράνη υπάρχει δυνατότητα να τη διαπεράσουν και ουσίες μεγάλου μοριακού βάρους, όπως οι πρωτεΐνες ή οι πολυσακχαρίτες, αλλά σε κάποιες περιπτώσεις και μικροοργανισμοί. Αυτό γίνεται με μια διαδικασία που ονομάζεται ενδοκύττωση. Πλασματική μεμβράνη περισφίγγεται και αποκόπτεται με αποτέλεσμα τη δημιουργία ενός κυστιδίου που απελευθερώνεται στο κυτταρόπλασμα.το φαινόμενο της ενδοκύττωσης μικροοργανισμών παρατηρείται σε μονοκύτταρους οργανισμούς όπως τα πρωιόζωα αμοιβάδα και Didinium και εξυπηρετεί τη θρέψη τούς, αλλά και σε κύτταρα πολυκύτταρων οργανισμών, όπως του ανθρώπου, ως αμυντικός μηχανισμός (λευκά αιμοσφαίρια του αίματος). Στις περιπτώσεις αυτές ονομάζεται και φαγοκύττωοη. Η εξωκύττωση αποτελεί την αντίστροφη διαδικασία της ενδοκύττωσης. Με τη διαδικασία αυτή τα κύτταρα απομακρύνουν άχρηστα υπολείμματα των τροφών, τοξικές ουσίες ή ουσίες που έχουν παραχθεί σ' αυτά και πρέπει να μεταφερθούν, για να χρησιμοποιηθούν αλλού (διάφορες ορμόνες, πρωτείνες, υδατάνθρακες κ.ά). Αυτό που πρόκειται να αποβληθεί κλείνεται σε ένα κυστίδιο, το οποίο προσεγγίζει την πλασματική μεμβράνη και περιβάλλεται από αυτήν. Στη συνέχεια η μεμβράνη περισφίγγεται στο συγκεκριμένο σημείο και απελευθερώνει προς την εξωτερική πλευρά του κυττάρου τις ουσίες. Σημειώνεται ότι τόσο η ενδοκύττωση όσο και η εξωκύττωση γίνονται με κατανάλωση ενέργειας. Η πλασματική μεμβράνη ως δέκτης μηνυμάτων.τα κύτταρα δε μπορούν να ζουν απομονωμένα από το περιβάλλον τους ούτε όμως και να το αντιμετωπίζουν απλώς ως το χώρο από τον οποίο θα αποσπάσουν χρήσιμες ουσίες ή θα αποβάλουν τα άχρηστα προϊόντα του μεταβολισμού τους. Αντίθετα ανάμεσα στα κύτταρα και στο περιβάλλον τους (άλλα κύτταρα ή μεσοκυττάριο υγρό) αναπτύσσεται μια διαρκής ανταλλαγή μηνυμάτων, χάρη στην οποία μπορούν: α. Να αναγνωρίζονται μεταξύ τους. Αν αναγνωρίζονται ως κύτταρα ίδιου τύπου, συνδέονται και συνιστούν ιστούς. Αν αναγνωρίζονται ως ξένα, στο επίπεδο του οργανισμού, κινητοποιούνται μηχανισμοί απόρριψης ή εξόντωσης του ξένου κυττάρου, β. Να συντονίζουν τη δράση τους. Με τον τρόπο αυτό ο ιστός ή το όργανο στο οποίο ανήκουν εμφανίζει ενιαία λειτουργία, 21

22 γ. Να τροποποιούν τη λειτουργία τους. Με τον τρόπο αστό εξυπηρετούνται σε κάθε περίπτωση οι ανάγκες του οργανισμού παρά τις όποιες μεταβολές του περιβάλλοντος. Εσωτερικό του κυττάρου. Αν παρατηρήσουμε ένα ευκαρυωτικό κύτταρο στο οπτικό μικροσκόπιο, δε θα δούμε τίποτε περισσότερο από μια οριοθετημένη ομογενή μάζα, μέσα στην οποία συνήθως διακρίνεται ο πυρήνας και γύρω του μια ημίρρευστη μάζα την οποία ονόμασαν πρωτόπλασμα. Με την βοήθεια του ηλεκτρονικού μικροσκοπίου και στις σύγχρονες μεθόδους βιοχημικής ανάλυσης, γνωρίζουμε ότι τα κύτταρα έχουν πολύπλοκη εσωτερική οργάνωση. Στο κυτταρόπλασμά τους, όπως έχει καθιερωθεί πλέον να ονομάζεται το πρωτόπλασμα, υπάρχει ένα πλήθος διαφορετικών δομών, που ονομάζονται οργανίδια. Καθένα από αυτά είναι ικανό για μια συγκεκριμένη λειτουργία. Κάποια οργανίδια έχουν ανα-λάβει την αξιοποίηση, προς όφελος του κυττάρου, ενέργειας που μπορούν να δεσμεύσουν από το εξωτερικό περιβάλλον. Άλλα παράγουν πρωτεΐνες, άλλα είναι υπεύθυνα για την κίνηση των κυττάρων κ.ο.κ. Όποια κι αν είναι όμως η λειτουργία που έχουν αναλάβει να κάνουν, υπακούουν πάντα στις εντολές που εκπορεύονται από το ίδιο «κέντρο ελέγχου», τον πυρήνα του κυττάρου. Πυρήνας.Ο πυρήνας είναι το πιο ευδιάκριτο οργανίδιο των ευκαρυωτικών κυττάρων. Κατά κανόνα υπάρχει ένας πυρήνας σε κάθε κύτταρο. Υπάρχουν ωστόσο και κύτταρα με δύο πυρήνες, όπως το κύπαρο του πρωτόζωου Παραμέτσιουμ (Paramecium), ή κύτταρα με πολυάριθμους πυρήνες, όπως ορισμένα μυϊκά. Υπάρχουν όμως και κύτταρα, όπως είναι τα ερυθρά αιμοσφαίρια, που κατά τη διάρκεια της διαφοροποίησής τους χάνουν τον πυρήνα τους. Το σχήμα του πυρήνα είναι συνήθως σφαιρικό ή ωοειδές και η διάμετρος του, αν και ποικίλλει, προσεγγίζει τα 5 μm. Σε μερικά κύτταρα βρίσκεται περίπου στο κέντρο τους, σε άλλα όμως δε φαίνεται να έχει σταθερή θέση.ο πυρήνας περιβάλλεται από τον πυρηνικό φάκελο ή πυρηνική μεμβράνη, που αποτελείται από δύο στοιχειώδεις μεμβράνες, μια εσωτερική και μια εξωτερική. Η παρατήρηση του πυρηνικού φακέλου με το ηλεκτρονικό μικροσκόπιο δείχνει ότι κατά διαστήματα παρουσιάζει πόρους, που σχηματίζονται από τη συνένωση της εσωτερικής με την εξωτερική μεμβράνη. Οι πυρηνικοί πόροι παίζουν σημαντικό ρόλο στην επικοινωνία του πυρήνα με το κυτταρόπλασμα, γιατί ελέγχουν τα μακρομόρια που ανταλλάσσονται μεταξύ τους. Το εσωτερικό του πυρήνα καταλαμβάνεται από το πυρηνόπλασμα. Είναι μια ημίρρευστη ουσία, στην οποία περιέχονται το σύνολο σχεδόν του DNA του ευκαρυωτικού κυττάρου, ένας ή περισσότεροι πυρηνίσκοι και διάφορες χημικές ενώσεις (νουκλεοτίδια, ένζυμα, πρωτεΐνες κ.ά.). 0 πυρηνίσκος είναι μια δομή που διακρίνεται εύκολα στο μικροσκόπιο από το σφαιρικό σχήμα της και την πυκνή υφή της. Αποτελείται κυρίως από RNA και DNA και δεν περιβάλλεται από στοιχειώδη μεμβράνη. Σ' αυτόν συντίθεται το rrna (συστατικό των ριβοσωμάτων). 22

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα


ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης Περιήγηση στο εσωτερικό του Κυττάρου Φώτης Καρβέλης Όλα τα κύτταρα οριοθετούνται από την πλασματική μεμβράνη ή το κυτταρικό τοίχωμα που την περιβάλλει. Εσωτερικά της πλασματικής μεμβράνης υπάρχουν τα οργανίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα



Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα


ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα


ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18


Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής

ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής Ενότητα 2.1: Το πορτραίτο του ευκαρυωτικού κυττάρου Ενότητα 2.2: Πλασματική μεμβράνη: το λεπτό σύνορο ανάμεσα στην άβια ύλη και στη ζωή Ενότητα 2.3: Μια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΚΥΤΤΑΡΟ. Η θεμελιώδης μονάδα της ζωής

ΚΥΤΤΑΡΟ. Η θεμελιώδης μονάδα της ζωής ΚΥΤΤΑΡΟ Η θεμελιώδης μονάδα της ζωής Κύτταρο Η βασική δομική και λειτουργική μονάδα που εκδηλώνει το φαινόμενο της ζωής. Πρώτος ο Βρετανός Robert Hooke το 1665 παρατηρώντας με το μικροσκόπιο λεπτές τομές

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα


ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα