Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα"

Transcript

1 Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Υπεύθυνη καθηγήτρια: Δασκαλάκη Κατερίνα Μοίρες

2 Περιεχόμενα Πρόλογος.2 Μεθοδολογία...3 Δομή του DNA 4 Λειτουργία του DNA...7 DNA μιτοχονδρίων και χλωροπλαστών...13 Περιγραφή πειράματος..14 Επίλογος.16 Βιβλιογραφία..17 1

3 Πρόλογος Παρόλο που το DNA εντοπίστηκε στον πυρήνα των κυττάρων στα μέσα του 19ου αιώνα, δεν ήταν γνωστό ότι αποτελεί το γενετικό υλικό των οργανισμών μέχρι που επιβεβαιώθηκε από πολλά πειράματα. Το μόριο του DNA είναι ένα μακρομόριο που αποτελείται από νουκλειοτίδια τα οποία αποτελούνται από μια αρκετά περίπλοκη δομή. Τα μόριο αυτό είναι δίκλωνο και σχηματίζει διπλή έλικα στον χώρο, συσπειρώνεται όμως σε τέτοιο βαθμό ώστε να χωράει στον πυρήνα του κυττάρου. Το DNA είναι υπεύθυνο για την διατήρηση, την μεταβίβαση και την έκφραση των γενετικών πληροφοριών. Χάρη σε αυτό λοιπόν οφείλουμε τα ιδιαίτερα προσωπικά χαρακτηριστικά μας. 2

4 Μεθοδολογία Αρχικά επιλέξαμε το project <<An Experimental Biology museum >> και στην συνέχεια χωριστήκαμε σε ομάδες. Εμείς φτιάξαμε μια ομάδα πέντε ατόμων και αναλάβαμε ένα από τα τέσσερα πειράματα που είχε προετοιμάσει η υπεύθυνη καθηγήτρια, Δασκαλάκη Κατερίνα. Το πείραμα μας ήταν η απομόνωση γενετικού υλικού από μπανάνα και φρουτόκρεμα. Το πρώτο πράγμα με το οποίο ασχοληθήκαμε ήταν η πραγματοποίηση του πειράματος μας και έπειτα η βιντεοσκόπηση του. Αφού τελειώσαμε με αυτό ξεκινήσαμε να ασχολούμαστε με την γραπτή εργασία μας. Για την γραπτή εργασία χρειάστηκε να βρούμε πληροφορίες από σχολικά βιβλία μεγαλύτερων τάξεων για την δομή και την λειτουργία του DNA καθώς επίσης και να περιγράψουμε τον τρόπο που εκτελέσαμε το πείραμα. Ο κάθε ένας από εμάς ανέλαβε ένα τμήμα της και έτσι καταφέραμε να την τελειοποιήσουμε στο ορισμένο χρονικό διάστημα. 3

5 Δομή του DNA Νουκλεοτίδια Το DNA, είναι ένα μακρομόριο, που αποτελείται από νουκλεοτίδια. Τα νουκλεοτίδια είναι οργανικές ενώσεις, σύνθετα οργανικά μόρια, που σχηματίζουν τη βασική μονάδα των νουκλεϊκών οξέων. Κάθε νουκλεοτίδιο του DNA αποτελείται από μία πεντόζη, τη δεοξυριβόζη, ενωμένη με μία φωσφορική ομάδα και μία αζωτούχο βάση. Στα νουκλεοτίδια του DNA η αζωτούχος βάση μπορεί να είναι μία από τις: αδενίνη (Α), γουανίνη (G), κυτοσίνη (C) και θυμίνη (Τ). Μια πολυνουκλεοτιδικη αλυσίδα σχηματίζεται από την ένωση πολλών νουκλεοτιδίων με ομοιοπολικό δεσμό. Ο δεσμός αυτός ονομάζεται φωσφοδιεστερικός δεσμός. H πολυνουκλεοτιδική αλυσίδα που δημιουργείται έχει ένα σκελετό, που αποτελείται από επανάληψη των μορίων φωσφορική ομάδα-πεντόζηφωσφορική ομάδα-πεντόζη. Διπλή έλικα Δεδομένα από την ανάλυση του ποσοστού των βάσεων σε μόρια DNA από διαφορετικούς οργανισμούς έδειχναν ότι σε κάθε μόριο DNA ο αριθμός των νουκλεοτιδίων που έχουν ως βάση την αδενίνη είναι ίσος με τον αριθμό των νουκλεοτιδίων που έχουν θυμίνη, και ο αριθμός των νουκλεοτιδίων που έχουν ως βάση τη γουανίνη είναι ίσος με τον αριθμό αυτών που έχουν κυτοσίνη. Επίσης, βρέθηκε ότι η αναλογία των βάσεων διαφέρει από είδος σε είδος και σχετίζεται με το είδος του οργανισμού. Τα αποτελέσματα αυτά σε συνδυασμό με αποτελέσματα που αφορούσαν την απεικόνιση του μορίου του DNA με χρήση ακτίνων-χ βοήθησαν στην ανακάλυψη της διπλής έλικας του DNA και απέδειξαν τις μοναδικές ιδιότητές του που το καθιστούν μόριο ιδανικό ως γενετικό υλικό. Η ανακάλυψη της διπλής έλικας του DNA είναι η μεγαλύτερη βιολογική ανακάλυψη του 20ού αιώνα. Σύμφωνα με το μοντέλο αυτό: 4

6 To DNA αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες που σχηματίζουν στο χώρο μία δεξιόστροφη διπλή έλικα. Η διπλή έλικα έχει ένα σταθερό σκελετό, που αποτελείται από επαναλαμβανόμενα μόρια φωσφορικής ομάδας-δεοξυριβόζης ενωμένων με φωσφοδιεστερικό δεσμό. Ο σκελετός αυτός είναι υδρόφιλος και βρίσκεται στο εξωτερικό του μορίου. Προς το εσωτερικό του σταθερού αυτού σκελετού βρίσκονται οι αζωτούχες βάσεις που είναι υδρόφοβες. Οι αζωτούχες βάσεις της μιας αλυσίδας συνδέονται με δεσμούς υδρογόνου με τις αζωτούχες βάσεις της απέναντι αλυσίδας με βάση τον κανόνα της συμπληρωματικότητας. Η αδενίνη συνδέεται μόνο με θυμίνη και αντίστροφα, ενώ η κυτοσίνη μόνο με γουανίνη και αντίστροφα. Οι δεσμοί υδρογόνου που αναπτύσσονται μεταξύ των βάσεων σταθεροποιούν τη δευτεροταγή δομή του μορίου. Αναμεσα στην αδενίνη και τη θυμίνη σχηματίζονται δυο δεσμοί υδρογόνου, ενώ ανάμεσα στη γουανίνη και την κυτοσίνη σχηματίζονται τρεις δεσμοί υδρογόνου. Οι δύο αλυσίδες ενός μορίου DNA είναι συμπληρωματικές, και αυτό υποδηλώνει ότι η αλληλουχία της μιας καθορίζει την αλληλουχία της άλλης. Η συμπληρωματικότητα έχει τεράστια σημασία για τον αυτοδιπλασιασμό του DNA, μια ιδιότητα που το καθιστά το καταλληλότερο μόριο για τη διατήρηση και τη μεταβίβαση της γενετικής πληροφορίας. Κάθε αλυσίδα DNA μπορεί να χρησιμεύει ως καλούπι για τη σύνθεση μιας συμπληρωματικής αλυσίδας, ώστε τελικά να σχηματίζονται δύο δίκλωνα μόρια DNA πανομοιότυπα με το μητρικό μόριο. Το γενετικό υλικό των ευκαρυωτικών κυττάρων έχει μεγαλύτερο μήκος από αυτό των προκαρυωτικών. Το συνολικό DNA που υπάρχει σε κάθε ευκαρυωτικό κύτταρο δεν είναι ένα ενιαίο μόριο, αλλά αποτελείται από πολλά γραμμικά μόρια, ο αριθμός και το μήκος των οποίων είναι χαρακτηριστικά για τα διάφορα είδη των οργανισμών. Τα μόρια του DNA πακετάρονται με πρωτεΐνες και σχηματίζουν τα ινίδια χρωματίνης. Το συνολικό DNA σε κάθε διπλοειδές κύτταρο του ανθρώπου έχει μήκος περίπου 2 m και συσπειρώνεται σε τέτοιο βαθμό, ώστε να χωράει στον πυρήνα, που έχει διάμετρο δέκα εκατομμυριοστά του μέτρου! Στο ηλεκτρονικό μικροσκόπιο, ύστερα από ειδική επεξεργασία, τα ινίδια χρωματίνης μοιάζουν με κομπολόγια από χάντρες. Κάθε «χάντρα» 5

7 ονομάζεται νουκλεόσωμα και αποτελεί τη βασική μονάδα οργάνωσης της χρωματίνης, το νουκλεόσωμα, αποτελείται από DNA μήκους 146 ζευγών βάσεων και από οκτώ μόρια πρωτεϊνών, που ονομάζονται ιστόνες. To DNA είναι τυλιγμένο γύρω από το οκταμερές των ιστονών. Τα νουκλεοσώματα αναδιπλώνονται με αποτέλεσμα το DNA να πακετάρεται σε μεγαλύτερο βαθμό, σχηματίζοντας τελικά τα ινίδια της χρωματίνης. Στην αναδίπλωση συμμετέχουν και άλλα είδη πρωτεϊνών. 6

8 Λειτουργία του DNA Το DNA βρίσκεται στον πυρήνα του κυττάρου για να επιτελεί τις σημαντικότερες λειτουργίες του οι οποίες είναι: Η αποθήκευση της γενετικής πληροφορίας. Στο DNA περιέχονται οι πληροφορίες που καθορίζουν όλα τα χαρακτηριστικά ενός οργανισμού και οι οποίες οργανώνονται σε λειτουργικές μονάδες, τα γονίδια. Η διατήρηση και η μεταβίβαση της γενετικής πληροφορίας από κύτταρο σε κύτταρο και από οργανισμό σε οργανισμό, που εξασφαλίζονται με τον αυτοδιπλασιασμό του DNA. Η έκφραση των γενετικών πληροφοριών, που επιτυγχάνεται με τον έλεγχο της σύνθεσης των πρωτεϊνών. Διατήρηση και μεταβίβαση της γενετικής πληροφορίας. ΑΝΤΙΓΡΑΦΗ Η αντιγραφή είναι το πρώτο στάδιο λειτουργίας του γενετικού υλικού. Με την διαδικασία της αντιγραφής γίνετε ο αναδιπλασιασμός του μορίου του γενετικού υλικού, έτσι η γενετική πληροφορία μεταβιβάζεται από τους οργανισμούς στους απογόνους τους. 7

9 Βήματα αναδιπλασιασμού του γενετικού υλικού: 1) Αρχικά γίνεται το σπάσιμο των δεσμών του υδρογόνου μεταξύ των συμπληρωματικών βάσεων(αλυσίδων) μιας περιοχής. 2) Στην συνέχεια ξεδιπλώνει η δίκλωνη έλικα που βρίσκεται στην περιοχή αυτή. 3) Έπειτα γίνεται η αντιγραφή και των δυο κλώνων του γενετικού υλικού ταυτόχρονα με την βοήθεια ειδικών ενζύμων. Η διαδικασία της αντιγραφής είναι αρκετά πολύπλοκη. Αρχίζει από καθορισμένα σημεία που ονομάζονται θέσεις έναρξης της αντιγραφής. Σύμφωνα με την αρχή συμπληρωματικότητας των βάσεων του DNA απέναντι από κάθε νουκλεοτίδιο και των δυο μητρικών κλώνων που περιέχουν αζωτούχες βάσεις αδενίνη, θυμίνη, γουανίνη, κυτοσίνη τοποθετούνται απέναντι νουκλεοτίδια που περιέχουν αντίστοιχα αζωτούχες βάσεις θυμίνη, αδενίνη, κυτοσίνη, γουανίνη και συνδέονται με ομοιοπολικό δεσμό, με αυτόν τον τρόπο σχηματίζονται οι δυο θυγατρικές πολυνουκλεοτιδικές αλυσίδες όπου η κάθε μια από αυτές είναι συμπληρωματική της μητρική που χρησιμοποιήθηκε ως πρότυπο. Το αποτέλεσμα αυτής της διαδικασίας είναι ότι στο τέλος έχουν παραχθεί δυο μόρια που το κάθε ένα από αυτά αποτελείται από μια μητρική και από την συμπληρωματική της θυγατρική αλυσίδα. Τα μόρια αυτά που θα προκύψουν θα έχουν πανομοιότυπες αλληλουχίες βάσεων μεταξύ τους αλλά και με το αρχικό μόριο. Αυτός ο τρόπος αναδιπλασιασμού του γενετικού υλικού χαρακτηρίζεται ως ημισυντηρητικός για τον λόγο ότι κάθε καινούριο μόριο αποτελείται από έναν παλαιό μητρικό κλώνο και από ένα εξ ολοκλήρου νέο θυγατρικό. Στο τέλος διασφαλίζεται η επιδιόρθωση των λαθών της αντιγραφής από το όλοενζυμο της DNA πολυμεράση III η οποία έχει την δυνατότητα να διαπιστώνει και να διορθώνει τα λάθη που πιθανόν έχουν γίνει κατά την αντιγραφή. Πιο συγκεκριμένα ανακαλύπτει και απομακρύνει τα νουκλεοτίδια που είναι λάθος τοποθετημένα και αποτελούν παράβαση της αρχής της συμπληρωματικής. Αφού τελειώσει ο αναδιπλασιασμός του DNA που γίνεται στον πυρήνα πριν από την διαίρεση του κυττάρου τα θυγατρικά κύτταρα που προκύπτουν παίρνουν ακριβώς την ίδια ποσότητα και ποιότητα του γενετικού υλικού με αυτή που είχε το μητρικό κύτταρο. Δηλαδή οι 8

10 γενετικές πληροφορίες αντιγράφονται και μεταφράζονται με εκπληκτικά μεγάλη ακρίβεια από γενιά σε γενιά κυττάρων και οργανισμών. Έκφραση των γενετικών πληροφοριών. ΜΕΤΑΓΡΑΦΗ Με δεδομένο ότι το DNA, στο οποίο είναι καταγραμμένες οι γενετικές πληροφορίες, βρίσκεται στον πυρήνα του κυττάρου, ενώ οι πρωτεΐνες συντίθενται στα ριβοσώματα, που βρίσκονται στην εξωτερική επιφάνεια των αγωγών του αδρού ενδοπλασματικού δικτύου και στο κυτταρόπλασμα, γίνεται φανερή η ανάγκη οι γενετικές πληροφορίες, για να κατευθύνουν την παραγωγή των πρωτεϊνών, να μεταφέρονται από τον πυρήνα στο κυτταρόπλασμα. Θα μπορούσε βέβαια το ίδιο το μόριο του DNA ή μικρά τμήματα του να μετακινούνται από τον πυρήνα στο κυτταρόπλασμα. Όμως η πυρηνική μεμβράνη δεν είναι διαπερατή από το DNA, γι αυτό άλλωστε δεν έχει ποτέ ανιχνευτεί πυρηνικό DNA στο κυτταρόπλασμα. Μια ανάγκη που επίσης εμφανίζεται συχνά σε όλα τα κύτταρα (προκαρυωτικά και ευκαρυωτικά) είναι να παράγουν ταυτόχρονα πολυάριθμα μόρια της ίδιας πρωτεΐνης. Είναι επομένως πρακτικά αδύνατο το ίδιο μόριο DNA να βρίσκεται ταυτόχρονα σε διαφορετικά ριβοσώματα τα οποία απαιτούνται για την παραγωγή πολλών μορίων της ίδιας πρωτεΐνης. Λύση στο πρόβλημα αυτό δίνει ένα ενδιάμεσο μόριο, το οποίο παράγεται με πρότυπο το DNA και το οποίο μεταφέρει την πληροφορία από τον πυρήνα στο κυτταρόπλασμα. Το ενδιάμεσο αυτό μόριο μπορεί να παραχθεί σε πολλά αντίγραφα. Έτσι εξηγείται η δυνατότητα να γίνεται σύνθεση πολλών μορίων της ίδιας πρωτεΐνης. Η ύπαρξη του ενδιάμεσου αυτού μορίου, ονομάστηκε αγγελιαφόρο RNA (mrna) και η διαδικασία με την οποία παράγεται ονομάζεται μεταγραφή. Ας δούμε τον τρόπο με τον οποίο γίνεται. 9

11 Στο τμήμα του DNA όπου υπάρχει η γενετική πληροφορία την οποία το κύτταρο θέλει να μεταγράψει σπάνε οι δεσμοί υδρογόνου, που συγκρατούν οι αζωτούχες βάσεις, και ανοίγει η διπλή έλικα. Αρχίζει στη συνέχεια η σύνθεση ενός μορίου mrna, με πρότυπο τον ένα από τους δύο κλώνους του DNA, που φέρει την πληροφορία για την σύνθεση της συγκεκριμένης πρωτεΐνης. Απέναντι από κάθε δεσοξυριβονουκλεοτίδιο αυτού του κλώνου τοποθετείται ένα ριβονουκλειοτίδιο σύμφωνα με την αρχή της συμπληρωματικότητας των βάσεων, που εφαρμόστηκε και κατά την αντιγραφή, με μία όμως διαφορά: απέναντι από κάθε δεσοξυριβονουκλειοτίδιο του μεταγραφόμενου κλώνου, που περιέχει αδενίνη, τοποθετείται ένα ριβονουκλειτίδιο, που περιέχει ουρακίλη. Το ένζυμο RNA πολυμεράση συνδέει τα ριβονουκλειοτίδια, που προστίθενται το ένα μετά το άλλο, με ομοιοπολικό δεσμό. Όταν ολοκληρωθεί η διαδικασία, έχει πλέον συντεθεί ένα μονόκλωνο μόριο mrna, του οποίου η αλληλουχία των ριβονουκλειοτιδίων «υπαγορεύτηκε» από την αλληλουχία των δεσοξυριβονουκλεοτιδίων του μεταγραφόμενου τμήματος του DNA, δηλαδή από ένα γονίδιο. Χρησιμοποιούμε για την διαδικασία αυτή τον όρο «μεταγραφή», γιατί η γενετική πληροφορία που ήταν καταγραμμένη στη γλώσσα του DNA (Α,Τ,G,C) μεταγράφεται στη γλώσσα του RNA, στην οποία αντί της θυμίνης χρησιμοποιείται η αζωτούχα βάση ουρακίλη. Όπως η αντιγραφή, έτσι και η μεταγραφή είναι μια ακριβής διαδικασία. Ωστόσο και στην μεταγραφή συμβαίνουν λάθη, που είναι μάλιστα πιθανότερα από ότι στην αντιγραφή, γιατί η RNA πολυμεράση δεν παίζει ρόλο ελεγκτή της ορθής τοποθέτησης των ριβονουκλειοτιδίων. Βέβαια τα λάθη αυτά, σε αντίθεση με τα λάθη της αντιγραφής, δε διαιωνίζονται μεταβιβαζόμενα από γενιά σε γενιά. Αφορούν μόνο το μόριο ή τα μόρια πρωτεΐνης που θα παραχθούν από το συγκεκριμένο mrna. Με μεταγραφή δεν παράγεται μόνο το mrna αλλά και τα άλλα είδη RNA, όπως το trna, που συμμετέχει στην διαδικασία της πρωτεϊνοσύνθεσης, και το rrna, που αποτελεί δομικό συστατικό των ριβοσωμάτων. ΜΕΤΑΦΡΑΣΗ Το τελευταίο στάδιο στην έκφραση της γενετικής πληροφορίας είναι η μετάφραση της, δηλαδή η παραγωγή του πρωτεϊνικού μορίου. Στην διαδικασία αυτή, που γίνεται στα ριβοσώματα, η αλληλουχία των νουκλεοτιδίων του mrna «υπαγορεύει» την παραγωγή μίας πολυπεπτιδικής αλυσίδας με καθορισμένη αλληλουχία αμινοξέων. Με τον τρόπο αυτό η γενετική πληροφορία, που είναι καταγραμμένη στα νουκλεϊνικά οξέα στην γλώσσα των τεσσάρων 10

12 γραμμάτων, μεταφράζεται σε μια εντελώς διαφορετική γλώσσα με 20 διαφορετικά γράμματα, όσα είναι δηλαδή, τα διαφορετικά αμινοξέα που συνθέτουν τις πρωτεΐνες όλων των οργανισμών. Όμως, ενώ κατά την μεταγραφή δεν παρουσιάζονται προβλήματα κωδικοποίησης, αφού κάθε βάση του DNA αντιστοιχεί σε μια συμπληρωματική της του mrna, κατά τη μετάφραση παρουσιάζεται το εξής πρόβλημα: οι διαφορετικές αζωτούχες βάσεις είναι τέσσερις, ενώ τα διαφορετικά αμινοξέα που συνθέτουν τις πρωτεΐνες είναι είκοσι. Συνεπώς δεν είναι δυνατό ένα νουκλεοτίδιο να κωδικοποιεί ένα αμινοξύ, διότι τότε δεν θα μπορούσαν να χρησιμοποιηθούν περισσότερα από τέσσερα διαφορετικά αμινοξέα. Ούτε είναι πιθανό μια δυάδα νουκλεοτιδίων να κωδικοποιεί ένα αμινοξύ, διότι τότε θα κωδικοποιούνταν το πολύ δεκαέξι διαφορετικά αμινοξέα, όσες είναι δηλαδή οι διαφορετικές δυάδες νουκλειοτιδίων που μπορούν να σχηματιστούν. Αν όμως μια τριάδα νουκλειοτιδίων κωδικοποιεί ένα αμινοξύ, τότε οι συνδυασμοί είναι εξήντα τέσσερις, δηλαδή αριθμός ικανός για την κωδικοποίηση των είκοσι διαφορετικών αμινοξέων. Κάθε τριάδα νουκλειοτιδίων ονομάζεται κωδικόνιο. Έτσι συντάχθηκε ο γενετικός κώδικας, το λεξικό δηλαδή με βάση το οποίο μεταφράζεται η γενετική πληροφορία. Εκτός από το mrna, τα ριβοσώματα και φυσικά τα αμινοξέα, στην πρωτεϊνοσύνθεση μετέχουν επίσης το trna και διαφορά ένζυμα. Τα trna διαθέτουν μια χαρακτηριστική τριάδα νουκλεοτιδίων, που λέγεται αντικωδικόνιο, και είναι συμπληρωματική με ένα κωδικόνιο του mrna. Έτσι τα διάφορα είδη trna μπορούν να αναγνωρίζουν τα κωδικόνια που είναι συμπληρωματικά των αντικωδικονίων τους, και να συνδέονται μαζί τους με δεσμούς υδρογόνου. Το trna διαθέτει επίσης μια θέση σύνδεσης του με ένα αμινοξύ. Μάλιστα, κάθε μόριο trna, ανάλογα με το αντικωδικόνιο του, συνδέεται με ένα συγκεκριμένο είδος αμινοξέος. Η διαδικασία της μετάφρασης περιλαμβάνει τρία στάδια: Έναρξη: Το mrna, που έχει συντεθεί στον πυρήνα, μεταναστεύει στο κυτταρόπλασμα και συνδέεται με ένα ριβόσωμα σε συγκεκριμένη θέση. Το πρώτο κωδικόνιο, το κωδικόνιο έναρξης, σηματοδοτεί την έναρξη της πρωτεϊνοσύνθεσης. Ταυτόχρονα μεταφέρεται και συνδέεται στο ριβόσωμα ένα μόριο trna, που φέρει το κατάλληλο αμινοξύ με αντικωδικόνιο συμπληρωματικό του κωδικονίου έναρξης. 11

13 Επιμήκυνση: Ένα δεύτερο μόριο trna με αντικωδικόνια συμπληρωματικό του δεύτερου, κατά σειρά, κωδικονίου τοποθετείται στο ριβόσωμα, δίπλα στο πρώτο, μεταφέροντας εκεί το δεύτερο αμινοξύ. Ανάμεσα στα αμινοξέα δημιουργείται ένα δεσμός (πεπτιδικός) που τα συγκρατεί ενωμένα. Το πρώτο trna αποδεσμεύεται από το αμινοξύ του και απελευθερώνεται στο κυτταρόπλασμα, ενώ το ριβόσωμα μετατοπίζεται προς το επόμενο κωδικόνιο. Κάθε φορά που το ριβόσωμα μετατοπίζεται στο επόμενο σε θέση κωδικόνιο του mrna, ένα νέο trna, με το αμινοξύ που μεταφέρει, τοποθετείται απέναντι από το κωδικόνιο αυτό. Το νέο αμινοξύ ενώνεται με πεπτιδικό δεσμό με το προηγούμενο και η διαδικασία αυτή επαναλαμβάνεται, επιμηκύνοντας την πεπτιδική αλυσίδα μέχρι την ολοκλήρωση της σύνθεσης της. Λήξη: όταν το ριβόσωμα φτάσει σε ένα από τα τρία κωδικόνια λήξης, σταματάει η πρωτεϊνοσύνθεση. Η πολυπεπτιδική αλυσίδα απελευθερώνεται από τα ριβοσώματα. Αξίζει να σημειωθεί ότι είναι δυνατό σε ένα μόριο mrna να συνδέονται ταυτόχρονα πολλά ριβοσώματα. Έτσι τα κύτταρα μπορούν να παράγουν σε μικρό χρονικό διάστημα πολυάριθμα αντίγραφα του ίδιου πρωτεϊνικού μορίου. 12

14 DNA μιτοχονδρίων και χλωροπλαστών Τα μιτοχόνδρια και οι χλωροπλάστες έχουν DNA. Το γενετικό υλικό των μιτοχονδρίων και χλωροπλαστών περιέχει πληροφορίες σχετικές με τη λειτουργία τους, δηλαδή σχετικά με την οξειδωτική φωσφορυλίωση και την φωτοσύνθεση αντίστοιχα, και κωδικοποιεί μικρό αριθμό πρωτεϊνών. Οι περισσότερες όμως πρωτεΐνες, που είναι απαραίτητες για τη λειτουργία των μιτοχονδρίων και των χλωροπλαστών, κωδικοποιούνται από γονίδια που βρίσκονται στο DNA του πυρήνα. Το γεγονός αυτό ότι τα οργανίδια αυτά δεν είναι ανεξάρτητα από τον πυρήνα του κυττάρου και για το λόγο αυτό χαρακτηρίζονται ως ημιαυτόνομα. Το μιτοχονδριακό DΝΑ στους περισσότερους οργανισμούς είναι κυκλικό μόριο. Κάθε μιτοχόνδριο περιέχει δυο έως δέκα αντίγραφα του κυκλικού μορίου DNA. Σε ορισμένα όμως κατώτερα πρωτόζωα είναι γραμμικό. Το ζυγωτό των ανώτατων οργανισμών περιέχει μόνο τα μιτοχόνδρια που περιέρχονται από το ωράριο. Επομένως, η προέλευση των μιτοχονδριακών γονιδίων είναι μητρική. 13

15 Περιγραφή πειράματος Υλικά που χρησιμοποιήσαμε: μπανάνα φρουτόκρεμα απορρυπαντικό αλάτι νερό κουτάλι πλαστική σακούλα σωλήνες παγωμένη αλκοόλη ΑΠΟΜΟΝΩΣΗ DNA ΑΠΟ ΜΠΑΝΑΝΑ Αρχικά σε ένα γυάλινο δοχείο βάλαμε 10ml ή ένα κουτάλι απορρυπαντικό. Το απορρυπαντικό σπάει τις κυτταρικές και τις πυρηνικές μεμβράνες των κυττάρων. Μετά βάλαμε 10g ή μισό κουτάλι αλάτι. Προσθέσαμε νερό μέχρι 100ml και ανακατέψαμε καλά το διάλυμα. Κόψαμε τη μισή μπανάνα, τη βάλαμε στην πλαστική σακούλα και την πολτοποιήσαμε. Προσθέσαμε μέρος του διαλύματος στην σακούλα και συνεχίσαμε να πολτοποιούμε. Το διάλυμα αυτό σπάει τις κυτταρικές και τις πυρηνικές μεμβράνες επομένως το 14

16 γενετικό υλικό που βρίσκεται στα κύτταρα μπορεί να κυκλοφορεί ελεύθερο στο μείγμα. Μετά βάλαμε λίγη ποσότητα από το μείγμα που φτιάξαμε στη σακούλα σε ένα σωλήνα. Προσθέσαμε πολύ αργά παγωμένη αλκοόλη. Παρατηρήσαμε ότι σχηματίζονται δύο στρώματα. Το πάνω στρώμα ήταν με αλκοόλη ενώ το κάτω με νερό. Το DNA έκανε συσσωματώματα στο στρώμα της αλκοόλης. Αυτό γίνεται επειδή οι αζωτούχες βάσεις που αποτελούν μέρος του γενετικού υλικού είναι υδρόφοβες. Συνεπώς όταν υπάρχουν δύο στρώματα και το ένα είναι υδατικό διάλυμα, το DNA προτιμάει την αλκοόλη και γι' αυτό ανεβαίνει στο πάνω στρώμα ΑΠΟΜΟΝΩΣΗ DNA ΑΠΟ ΦΡΟΥΤΟΚΡΕΜΑ Σε ένα δοκιμαστικό σωλήνα βάλαμε μισό κουτάλι φρουτόκρεμα. Μετά προσθέσαμε μικρή ποσότητα από το διάλυμα που φτιάξαμε προηγουμένως (απορρυπαντικό με αλάτι και νερό). Ανακατέψαμε και περιμέναμε λίγο ώστε να σπάσουν οι πυρηνικές και οι κυτταρικές μεμβράνες των κυττάρων. Μετά προσθέσαμε πολύ αργά παγωμένη αλκοόλη και περιμέναμε λίγα λεπτά. Δημιουργήθηκαν πάλι δύο στρώματα. Όπως και στο προηγούμενο πείραμα το γενετικό υλικό έκανε συσσωματώματα στο πάνω στρώμα, το στρώμα της αλκοόλης. Αυτό γίνεται, όπως ήδη αναφέραμε, γιατί οι αζωτούχες βάσεις που αποτελούν μέρος του γενετικού υλικού είναι υδρόφοβες συνεπώς προτιμούν το στρώμα της αλκοόλης. 15

17 Επίλογος Συνοψίζοντας μπορούμε να καταλάβουμε από πόσο περίπλοκη δομή και τι περίπλοκες λειτουργίες επιτελεί το DNA.Ήταν λοιπόν εξαιρετικά ενδιαφέρον για εμάς να ασχοληθούμε με αυτό και να το δούμε να ξεχωρίζει από τα υπόλοιπα μέρη του κυττάρου μπροστά στα μάτια μας στο πείραμα μας. Παρόλο που ασχοληθήκαμε με ύλη μεγαλύτερων τάξεων, καταφέραμε να ολοκληρώσουμε την γραπτή εργασία μας και να αποκτήσουμε πολλές επιπλέον γνώσεις. 16

18 Βιβλιογραφία 1. Βιολογία γενικής παιδείας Β τάξης γενικού Λυκείου, Ινστιτούτο Τεχνολογίας Υπολογιστών και Εκδόσεων 2. Βιολογία Θετικής κατεύθυνσης Γ τάξης γενικού Λυκείου, Οργανισμός Εκδόσεων Διδακτικών βιβλίων 17

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΘΕΜΑ 1 Ο 1. γ 2. δ 3. α 4. δ 5. δ ΘΕΜΑ 2 Ο Α) Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα δίκλωνο

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών.

Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών. Κεφάλαιο 1: ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών. Βιολογικά μακρομόρια ( ή πολυμερή ): Κατηγορία βιομορίων με μεγάλο ΜΒ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Β ΤΡΙΜΗΝΟ ΚΟΝΤΟΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Γ2 Ιανουάριος 2015 ΕΙΣΑΓΩΓΗ Ο ι Watson και Crick, το 1953, διατύπωσαν το μοντέλο της διπλής έλικας

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α.1. γ Α.2. β Α.3. α Α.4. δ Α.5. α ΘΕΜΑ Β Β.1. Σελ.

Διαβάστε περισσότερα

Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1 ΚΕΦΑΛΑΙΟ 1 Ο Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Οι επιστήµονες αρχικά πίστευαν ότι το γενετικό υλικό ήταν οι πρωτεΐνες και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 28 ΝΟΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2015 2 0 1 5 ΗΜΕΡΗΣΙΑ ΛΥΚΕΙΑ ΕΣΠΕΡΙΝΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα