Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:"

Transcript

1 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα άνθρακα) Μιας οργανικής αζωτούχας βάσης Ενός μορίου φωσφορικού οξέος Ριβονουκλεοτίδια Τα νουκλεοτίδια του RNA περιέχουν την πεντόζη ριβόζη Δεσοξυριβονουκλεοτίδια Τα νουκλεοτίδια του DNA περιέχουν την πεντόζη δεσοξυριβόζη Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: Αδενίνη (Α), γουανίνη (G), κυτοσίνη (C) και θυμίνη (Τ) για το DNA Αδενίνη (Α), γουανίνη (G), κυτοσίνη (C) και ουρακίλη (U) για το RNA

2 2 ΑΣΚΗΣΗ 2 Πως σχηματίζεται ένα πολυνουκλεοτίδιο; Για να σχηματιστεί ένα δινουκλεοτίδιο. Δύο μονοφωσφορικά νουκλεοτίδια ενώνονται με ομοιοπολικό δεσμό, (φωσφοδιεστερικός δεσμός) που δημιουργείται μεταξύ του Η του ΟΗ- του φωσφορικού οξέος του ενός νουκλεοτιδίου και του ΟΗ- της πεντόζης του δευτέρου. Είναι αντίδραση συμπύκνωσης, κατά την οποία αποβάλλεται ένα μόριο νερού. Αν στο δινουκλεοτίδιο προστεθεί ένα ακόμη νουκλεοτίδιο τότε δημιουργείται ένα τρινουκλεοτίδιο με ταυτόχρονη απόσπαση ενός δευτέρου μορίου νερού κ.τ.λ. Αν η διαδικασία επαναληφθεί πολλές φορές τότε δημιουργείται ένα πολυνουκλεοτίδιο, που αποτελείται από ν νουκλεοτίδια και αποσπώνται ν-1 συνολικά μόρια νερού. ΑΣΚΗΣΗ 3 Πόσα μόρια νερού αποσπάστηκαν ώστε να σχηματιστεί μια πολυνουκλεοτιδική αλυσίδα που αποτελείται από 60 νουκλεοτίδια;(τα μόρια του νερού που απαιτούνται για τον σχηματισμό των νουκλεοτιδίων να μη υπολογιστούν) Η αντίδραση συμπύκνωσης κατά την ένωση δύο μονοφωσφορικών νουκλεοτιδίων που ενώνονται με ομοιοπολικό δεσμό, γίνεται με απόσπαση ενός μορίου νερού. Αν στο σχηματιζόμενο δινουκλεοτίδιο προστεθεί ένα ακόμη νουκλεοτίδιο αποσπάται και δεύτερο μόριο νερού. Επομένως για ένα πολυνουκλεοτίδιο, που αποτελείται από ν νουκλεοτίδια θα αποσπώνται ν-1 συνολικά μόρια νερού.

3 3 ν-1 = 60 1 =59 μόρια νερού. ΑΣΚΗΣΗ 4 Πόσα συνολικά μόρια νερού αποσπάστηκαν ώστε να σχηματιστεί μια πολυνουκλεοτιδική αλυσίδα που αποτελείται από 60 νουκλεοτίδια; Για τον σχηματισμό ενός νουκλεοτιδίου αποβάλλονται 2 μόρια νερού, ένα για την σύνδεση με το ζάχαρο και ένα με το φωσφορικό οξύ επομένως για να σχηματιστούν 60 νουκλεοτίδια αποσπάστηκαν 2Χ60=120 μόρια νερού. Επειδή και τα δύο άκρα της νουκλεοτιδικής αλυσίδας είναι φωσφορυλιωμένα απαιτείται η απόσπαση ενός επιπλέον μορίου νερού την σύνδεση στο ένα μόνο άκρο της ενός μορίου φωσφορικού οξέος. Το άλλο άκρο έχει ήδη στο νουκλεοτίδιό του συνδεδεμένο το φωσφορικό οξύ. κατά Έχουμε μια πολυνουκλεοτιδική αλυσίδα με 60 νουκλεοτίδια. ν-1 = 60-1 =59 φωσφοδιεστερικοί δεσμοί Επομένως νουκλεοτιδίων. αποσπάστηκαν 59 μόρια νερού κατά την σύνδεση των Τα συνολικά μόρια νερού που αποσπάστηκαν για την σύνθεση της πολυνουκλεοτιδικής αλυσίδας είναι: =180 μόρια νερού ΑΣΚΗΣΗ 5 Με 1000 νουκλεοτίδια πόσες διαφορετικές πολυνουκλεοτιδικές αλυσίδες μπορούν να προκύψουν; Όλες οι δυνατές λύσεις θα δίνονται από τον τύπο α ν, όπου α τα νουκλεοτίδια με τις τέσσερις διαφορετικές αζωτούχες βάσεις που έχω (α=4) και ν ο συνολικός αριθμός των νουκλεοτιδίων της πολυνουκλεοτιδικής αλυσίδας (ν= 1000) α ν =

4 4 ΑΣΚΗΣΗ 6 Πόσες πολυνουκλεοτιδικές αλυσίδες των 150 ριβονουκλεοτιδίων μπορείτε να κατασκευάσετε συνδυάζοντας όλα τα είδη αζωτούχων βάσεων; Όλες οι δυνατές λύσεις θα δίνονται από τον τύπο α ν, όπου α τα νουκλεοτίδια με τις τέσσερις διαφορετικές αζωτούχες βάσεις που έχω (α=4) και ν ο συνολικός αριθμός των νουκλεοτιδίων της πολυνουκλεοτιδικής αλυσίδας (ν= 150) α ν = ΑΣΚΗΣΗ 7 Ποιες από τις αζωτούχες βάσεις των νουκλεοτιδίων είναι συμπληρωματικές μεταξύ τους και γιατί; Α πάντηση : Οι αζωτούχες βάσεις που έχουν την δυνατότητα να συνδέονται μεταξύ τους με δεσμούς υδρογόνου λέγονται συμπληρωματικές. Η Αδενίνη είναι συμπληρωματική τη Θυμίνη και ενώνονται με δύο δεσμούς υδρογόνου. με Η Γουανίνη είναι συμπληρωματική με τη Κυτοσίνη και ενώνονται με τρεις δεσμούς υδρογόνου. Η αδενίνη στο RNA είναι συμπληρωματική με την Ουρακίλη ΑΣΚΗΣΗ 8 Ποια είναι η δομή του RΝΑ; Το RΝA είναι μονόκλωνο μόριο, το οποίο μπορεί να αναδιπλωθεί στο χώρο και να σχηματίσει δίκλωνες περιοχές, από ένωση συμπληρωματικών βάσεων (αδενίνη-ουρακίλη και γουανίνη-κυτοσίνη) με δεσμούς υδρογόνου.

5 5 ΑΣΚΗΣΗ 9 Ποια είναι η δομή του DΝΑ Απάντ ηση : Το DΝΑ είναι δίκλωνο μόριο, αποτελούμενο από δύο πολυνουκλεοτιδικές αλυσίδες (κλώνοι). Οι δύο κλώνοι περιστρέφονται γύρω από τον ίδιο άξονα, σχηματίζοντας δεξιόστροφη έλικα. Στο εσωτερικό των κλώνων προεξέχουν οι αζωτούχες βάσεις, που είναι ενωμένες με δεσμούς υδρογόνου. 'Έτσι, στους δύο κλώνους απέναντι βρίσκονται πάντα οι συμπληρωματικές βάσεις, δηλαδή απέναντι από αδενίνη βρίσκεται θυμίνη και απέναντι από γουανίνη κυτοσίνη και αντιστρόφως.

6 6 ΑΣΚΗΣΗ 10 Διαφορές των DΝΑ και RΝΑ Α πάντηση : DNA α Το DΝΑ αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες, τους κλώνους, που σχηματίζουν διπλή έλικα. β Το DΝΑ αποτελείται από νουκλεοτίδια που περιέχουν την δεσοξυριβόζη (δεσοξυριβονουκλεοτίδια) γ Οι αζωτούχες βάσεις των νουκλεοτιδίων του DΝΑ είναι η αδενίνη, η γουανίνη, η κυτοσίvn και η θυμίvn με σταθερή αναλογία μεταξύ των βάσεων = = 1: 1 A G T C δ Το DΝΑ είναι το γενετικό υλικό του κυττάρου και ο ρόλος του είναι να μεταφέρει τις γενετικές πληροφορίες και να τις μεταβιβάζει από γενιά σε γενιά, καθώς επίσης να ελέγχει την κυτταρική δραστηριότητα και να επιτρέπει τη δημιουργία γενετικής ποικιλομορφίας ε Το DΝΑ των ευκαρυωτικών κυττάρων βρίσκεται στον πυρήνα, στα μιτοχόνδρια και τους χλωροπλάστες. RNA Το RΝΑ συνήθως μονόκλωνο. Το RΝΑ αποτελείται από νουκλεοτίδια που περιέχουν ριβόζη (ριβονουκλεοτίδια). Οι αζωτούχες βάσεις των νουκλεοτιδίων του RΝΑ είναι η αδενίνη, η γουανίνη, η κυτοσίνη και η ουρακίλη. Μεταξύ των βάσεων δεν υπάρχει σταθερή αναλογία. Το RΝΑ υπάρχει σε τρεις τύπους, το m-rnα, που μεταφέρει τη γενετική πληροφορία στα ριβοσώματα, το t=rνα, που μεταφέρει τα αμινοξέα στα ριβοσώματα και το r-rνa, που αποτελεί δομικό συστατικό των ριβοσωμάτων. Τέλος, το RNΑ μπορεί να αποτελεί το γενετικό υλικό ορισμένων ιών. Το RΝΑ βρίσκεται στον πυρήνα, στα μιτοχόνδρια, στους χλωροπλάστες και το κυτταρόπλασμα.

7 7 ΑΣΚΗΣΗ 11 Πόσα μόρια νερού αποσπάστηκαν ώστε να σχηματιστεί το μόριο ενός νουκλεϊκού οξέος που αποτελείται από 60 νουκλεοτίδια; Για τον σχηματισμό ενός νουκλεοτιδίου αποβάλλονται 2 μόρια νερού, ένα για την σύνδεση με το ζάχαρο και ένα με το φωσφορικό οξύ επομένως για να σχηματιστούν 60 νουκλεοτίδια αποσπάστηκαν 2Χ60=120 μόρια νερού. Επειδή και τα δύο άκρα της νουκλεοτιδικής αλυσίδας είναι φωσφορυλιωμένα απαιτείται η απόσπαση ενός επιπλέον μορίου νερού κατά την σύνδεση στο ένα μόνο άκρο της, ενός μορίου φωσφορικού οξέος Το άλλο άκρο έχει ήδη στο νουκλεοτίδιό του συνδεδεμένο το φωσφορικό οξύ. Δ ίκλωνο: 60/2=30 νουκλεοτίδια ανά κλώνο άρα 29 φωσφοδιεστερικοί δεσμοί Επομένως αποσπάστηκαν 29Χ2=58 μόρια νερού κατά την σύνδεση των νουκλεοτιδίων. Συνολικά =180 μόρια νερού Μ ονόκλωνο: 60 νουκλεοτίδια, άρα 59 φωσφοδιεστερικοί δεσμοί Επομένως αποσπάστηκαν 59 μόρια νερού κατά την σύνδεση των νουκλεοτιδίων. Συνολικά =180 μόρια νερού

8 8 ΑΣΚΗΣΗ 12 Πόσα μόρια νερού απελευθερώνονται κατά τον σχηματισμό τμήματος μορίου DNA που αποτελείται από 120 νουκλεοτίδια και ενός μονόκλωνου RNA που αποτελείται από 120 νουκλεοτίδια; Για τον σχηματισμό ενός νουκλεοτιδίου αποβάλλονται 2 μόρια νερού, ένα για την σύνδεση με το ζάχαρο και ένα με το φωσφορικό οξύ επομένως για να σχηματιστούν 120 νουκλεοτίδια αποσπάστηκαν 2Χ120=240 μόρια νερού. Επειδή και τα δύο άκρα της νουκλεοτιδικής αλυσίδας είναι φωσφορυλιωμένα απαιτείται η απόσπαση ενός επιπλέον μορίου νερού κατά την σύνδεση στο ένα μόνο άκρο της, ενός μορίου φωσφορικού οξέος Το άλλο άκρο έχει ήδη στο νουκλεοτίδιό του συνδεδεμένο το φωσφορικό οξύ. Τ ο DNA είναι δίκλωνο: 120/2=60 νουκλεοτίδια ανά κλώνο άρα 59 φωσφοδιεστερικοί δεσμοί Επομένως αποσπάστηκαν 59Χ2=118 μόρια νερού κατά την σύνδεση των νουκλεοτιδίων. Συνολικά =360 μόρια νερού Τ ο RNA είναι μονόκλωνο: 120 νουκλεοτίδια, άρα 119 φωσφοδιεστερικοί δεσμοί Επομένως αποσπάστηκαν 119 μόρια νερού κατά την σύνδεση των νουκλεοτιδίων. Συνολικά =360 μόρια νερού Σημείωση Αν το μόριο του νουκλεϊκού οξέος είναι κυκλικό τότε ο αριθμός των φωσφοδιεστερικών δεσμών σε κάθε κλώνο θα είναι ίσος με τον αριθμό των νουκλεοτιδίων στον κλώνο αυτό Η περίπτωση αυτή ισχύει και πρέπει να εφαρμόζεται όταν πληρούνται οι παρακάτω προϋποθέσεις: (α) να πρόκειται για DΝΑ προκαρυωτικών κυττάρων καθώς και για το DΝΑ μιτοχονδρίων και χλωροπλαστών τα οποία είναι κυκλικά. (β) ο αριθμός των νουκλεοτιδίων της άσκησης να είναι αρκετά μεγάλος να θεωρηθεί ότι το μόριο μπορεί να σχηματίζει κύκλο (γ) η άσκηση να αναφέρεται σε «μόριο DΝΑ «και όχι σε «τμήμα μορίου DΝΑ». Και τούτο γιατί ένα «τμήμα μορίου» δεν μπορεί εξ

9 9 ορισμού να είναι ποτέ κυκλικό. ΑΣΚΗΣΗ 13 Ένα τμήμα DΝΑ έχει 10 φωσφοδιεστερικούς δεσμούς και 15 δεσμούς υδρογόνου. Πόσες Α, G, C, Τ περιέχει; Οι φωσφοδιεστερικοί δεσμοί σχηματίζονται μεταξύ των νουκλεοτιδίων μίας νουκλεοτιδικής αλυσίδας. Αφού το DΝΑ είναι δίκλωνο θα υπάρχουν 10/2=5 φωσφοδιεστερικοί δεσμοί σε κάθε αλυσίδα. Μεταξύ δύο νουκλεοτιδίων σχηματίζεται ένας φωσφοδιεστερικός δεσμός, μεταξύ τριών νουκλεοτιδίων δύο φωσφοδιεστερικοί δεσμοί κ.ο.κ., δηλαδή ισχύει: δ = ν - 1 όπου δ ο αριθμός των φωσφοδιεστερικών δεσμών και ν ο αριθμός των νουκλεοτιδίων κάθε αλυσίδας. Αν θέσουμε δ = 5, τότε προκύπτει ότι: ν=δ+1=} ν = 6 Άρα, θα υπάρχουν 6 νουκλεοτίδια σε κάθε κλ ώνο και άρα 2 6=12 νουκλεοτίδια συνολικά στο τμήμα αυτό του DΝA. Αφού το τμήμα του DΝA αποτελείται από 12 νουκλεοτίδια, θα υπάρχουν 12/2 = 6 ζεύγη συμπληρωματικών βάσεων. Αν α είναι ο αριθμός του αθροίσματος αδενίνης-θυμίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της θυμίνης ή της αδενίνης στο μόριο του DNA και β ο αριθμός του αθροίσματος γουανίνης-κυτοσίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της γουανίνης ή κυτοσίνης στο μόριο του DNA θα ισχύει: α + β = ν =>α + β = 6 Επειδή μεταξύ αδενίνης και θυμίνης αναπτύσσονται δύο δεσμοί υδρογόνου και μεταξύ γουανίνης και κυτοσίνης τρεις, θα ισχύει : 2α+3β = 15 Λύνοντας το σύστημα των α+β=6 και 2α+3β=15 προκύπτει: α=3 και β = 3. Άρα ο αριθμός των ζευγών Α-Τ εί ναι 3 και των ζευγών G-C είναι 3 και θα υπάρχ ουν:3 νουκλεοτίδια με αδενίνη 3 νουκλεοτίδια με θυμίνη 3 νουκλεοτίδια με γουανίνη και 3 νουκλεοτίδια με κuτοσίνη. Αν το μόριο ήταν κυκλικό τότε ο αριθμός των φωσφοδιεστερικών δεσμών σε κάθε κλώνο θα ήταν ίσος με τον αριθμό των νουκλεοτιδίων στον κλώνο αυτό δηλ. δ = ν => ν = 5 Στην περίπτωση αυτή η σχέση α + β = ν θα έδινε α + β = 5 Λύνοντας το σύστημα των α + β = 5 και 2α + 3β = 15 θα προέκυπτε ότι: α=0 και β=5 Συνεπώς θα υπήρχαν 5 γουανίνες 5 κυτοσίνες και καμία αδενίνη ή θυμίνη. Η περίπτωση αυτή όπως ήδη αναφέραμε ισχύει και πρέπει να εφαρμόζεται όταν πληρούνται οι παρακάτω προϋποθέσεις: (α) να πρόκειται για DΝΑ προκαρυωτικών κυττάρων καθώς και για το DΝΑ μιτοχονδρίων και χλωροπλαστών τα οποία είναι κυκλικά. (β) ο αριθμός των νουκλεοτιδίων της άσκησης να είναι αρκετά μεγάλος να θεωρηθεί ότι το μόριο μπορεί να σχηματίζει κύκλο (γ) η άσκηση να αναφέρεται σε «μόριο DΝΑ «και όχι σε «τμήμα μορίου DΝΑ». Και τούτο γιατί ένα «τμήμα μορίου» δεν μπορεί εξ ορισμού να είναι ποτέ κυκλικό. Είναι, επομένως, προφανές, ότι η περίπτωση κυκλικού DΝΑ στην συγκεκριμένη άσκηση αποκλείεται εφόσον δεν πληρούνται οι προϋποθέσεις (β)

10 10 και (γ). ΑΣΚΗΣΗ 14 Σε ένα μόριο DNA στη μία από τις δύο πολυνουκλεοτιδικές αλυσίδες ο λόγος Α+G/C+Τ είναι ίσος με 0,7. ποια είναι η τιμή του ίδιου λόγου στη συμπληρωματική αλυσίδα; Η Αδενίνη (Α) είναι συμπληρωματική με τη Θυμίνη (Τ) και η Γουανίνη (G) είναι συμπληρωματική με τη Κυτοσίνη (C). T + C Ο λόγος στη συμπληρωματική αλυσίδα θα είναι = 0, 7 G + A Εμείς όμως ζητάμε την τιμή του ίδιου λόγου στη συμπληρωματική A + G 1 αλυσίδα = = 1, 43 C + T 0,7 ΑΣΚΗΣΗ 15 Δεδομένου ότι ο λόγος (T+C)/(A+G) στη μία αλυσίδα της διπλής έλικας του DNA είναι 0,7, να υπολογιστεί ο αντίστοιχος λόγος για τη συμπληρωματική της αλυσίδα, καθώς και για το σύνολο του μορίου του DNA. Η Αδενίνη (Α) είναι συμπληρωματική με τη Θυμίνη (Τ) και η Γουανίνη (G) είναι συμπληρωματική με τη Κυτοσίνη (C). A + G Ο λόγος στη συμπληρωματική αλυσίδα θα είναι: = 0,7 T + C Εμείς όμως ζητάμε την τιμή του ίδιου λόγου στη συμπληρωματική T + C 1 αλυσίδα, οπότε αντιστρέφω το κλάσμα και έχω: = = 1,43 A + G 0,7 Με βάση τη συμπληρωματικότη τα των βάσεων κατασκευάζω τον πίνακα 1 η αλυσίδα 2 η αλυσίδα Δίκλωνο μόριο Α α β α+β G γ δ γ+δ T β α α+β C δ γ γ+δ η T + C β + δ Στη 1 αλυσίδα έχω από την εκφώνηση ότι: = = 0,7 A + G α + γ η T + C α + γ 1 Στη 2 αλυσίδα έχω υπολογίσει ότι: = = = 1,43 A + G β + δ 0,7 T + C α + β + γ + δ Στο δίκλωνο μόριο έχω: = = 1 A + G α + β + γ + δ ος 2 τρόπ ος T A = C G T C Στο μόριο του DNA ισχύει: = = 1 A G T A T + C A + G T + C C = = = = 1 C G C G A + G G

11 11 ΑΣΚΗΣΗ 16 Αν το DNA ενός είδους έχει το μοριακό κλάσμα G+C =0,36 να υπολογιστεί το μοριακό κλάσμα της Α. G + C Το μοριακό κλάσμα G+C είναι της μορφής = 0, 36 A + T + G + C A + T + G + C A + T G + C A + T G + C = 1 + = 1 = 1 A + T + G + C A + T + G + C A + T + G + C A + T + G + C A + T + G + C A + T A + T A T = 1 0,36 = 0,64 + = 0,64 A + T + G + C A + T + G + C A + T + G + C A + T + G + C Λόγω όμως της συμπληρωματικότητας των βάσεων στο μόριο του DNA ο αριθμός των νουκλεοτιδίων της Αδενίνης είναι ίσος με τον αριθμό των νουκλεοτιδίων της θυμίνης οπότε; A T A A 0,64 + = 0,64 2 = 0,64 = A + T + G + C A + T + G + C A + T + G + C A + T + G + C 2 A = 0,32 A + T + G + C Άρα το μοριακό κλάσμα της Αδενίνης (Α) είναι 0,32 ΑΣΚΗΣΗ 17 Ένα μόριο DNA περιέχει δεσμούς υδρογόνου και μόρια θυμίνης. Να βρεθεί η ποσοστιαία αναλογία νουκλεοτιδίων (βάσεων) που δομούν το μόριο αυτό Η αδενίνη (Α) είναι συμπληρωματική με τη θυμίνη (Τ) κατά συνέπεια αφού υπάρχουν μόρια θυμίνης θα υπάρχουν και μόρια αδενίνης. Ανάμεσα στ η θυμίνη και την αδενίνη σχηματίζονται δύο δεσμοί υδρογόνου, άρα = δεσμοί υδρογόνου = οι δεσμοί υδρογόνου που σχηματίζονται ανάμεσα στη κυτοσίνη (C) και την γουανίνη (G), οι οποίες ενώνονται ανά μόριο με τρεις δεσμούς υδρογόνου, οπότε :3= μόρια κυτοσίνης και μόρια γουανίνης 2 ος τρόπος Αν α είναι ο αριθμός του αθροίσματος αδενίνης-θυμίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της θυμίνης ή της αδενίνης στο μόριο του DNA και β ο αριθμός του αθροίσματος γουανίνης-κυτοσίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της γουανίνης ή κυτοσίνης στο μόριο του DNA, θα έχουμε:α=5.000 Επειδή μεταξύ αδενίνης και θυμίνης αναπτύσσονται δύο δεσμοί υδρογόνου και μεταξύ γουανίνης και κυτοσίνης τρεις, θα ισχύει: 2α+3β= β= β= β= β= β= : 3 β= Το μόριο του DNA περιέχει: μόρια αδενίνης (12.5%) μόρια θυμίνης (12,5%)

12 μόρια κυτοσίνης (37,5%) μόρια γουανίνης (37,5%) ΑΣΚΗΣΗ 18 Από τη γενετική ανάλυση ενός κλάσματος του DNA βρέθηκε ότι υπάρχουν 100 ζεύγη βάσεων στο κλάσμα αυτό, από τις οποίες 45 είναι κυτοσίνες. Πόσες αδενίνες υπάρχουν στο κλάσμα; Η κυτοσίνη (C) είναι συμπληρωματική με τη γουανίνη (G) κατά συνέπεια αφού υπάρχουν 45 μόρια κυτοσίνης θα υπάρχουν και 45 μόρια γουανίνης. Έχουμε 100 ζεύγη βάσεων, άρα 2 100= 200 μόρια βάσεων συνολικά =110 αδενίνη και θυμίνη Η αδενίνη (Α) είναι συμπληρωματική με τη θυμίνη (Τ) κατά συνέπεια τα μόρια της θυμίνης θα είναι ίσαμε τα μόρια της αδενίνης. Άρα 110:2=55 αδενίνες υπάρχουν στο κλάσμα. ΑΣΚΗΣΗ 19 Ένα μόριο του DNA απομονώθηκε και μετρήθηκαν οι αζωτούχες βάσεις του, οι οποίες ήταν συνολικά Το 20% από αυτές το αποτελεί η βάση αδενίνη. α) Να υπολογισθεί το ποσοστό και των υπόλοιπων βάσεων καθώς και η αριθμητική τους τιμή. β) Πόσοι δεσμοί υδρογόνου απαιτούνται για τη συγκρότηση αυτού του μορίου του DNA; α) Η αδενίνη (Α) είναι συμπληρωματική με τη θυμίνη (Τ) κατά συνέπεια αφού υπάρχει 20% αδενίνη θα υπάρχει και 20% θυμίνη. Το υπόλοιπο 60% ισομοιράζεται κατά 30% στη κυτοσίνη και 30% στη συμπληρωματική της γουανίνη. Στα A 20 T 30 G και 30 C α; β; γ; δ; Οπότε έχω α= Α, β= T, γ= G και δ= C β) Αν α είναι ο αριθμός του αθροίσματος αδενίνης-θυμίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της θυμίνης ή της αδενίνης στο μόριο του DNA και β ο αριθμός του αθροίσματος γουανίνης-κυτοσίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της γουανίνης ή κυτοσίνης στο μόριο του DNA και επειδή μεταξύ αδενίνης και θυμίνης αναπτύσσονται δύο δεσμοί υδρογόνου και μεταξύ γουανίνης και κυτοσίνης τρεις, θα ισχύει: 2α+3β= = = δεσμοί υδρογόνου

13 13 ΑΣΚΗΣΗ 20 Ένα μόριο DNA απομονώθηκε και υπολογίστηκε ότι περιέχει 9000 αζωτούχες βάσεις. Το 30% των βάσεων είναι κυτοσίνη α. να υπολογίσετε το ποσοστό των υπολοίπων βάσεων β. να υπολογιστούν οι δεσμοί υδρογόνου που απαιτούνται για την συγκρότηση αυτού του μορίου DNA α) Η κυτοσίνη είναι συμπληρωματική με τη γουανίνη κατά συνέπεια αφού υπάρχει 30% κυτοσίνη θα υπάρχει και 30% γουανίνη. Το υπόλοιπο 40% ισομοιράζεται κατά 20% στη θυμίνη (Τ) και 20% στη συμπληρωματική της αδενίνη (Α). Στα A 20 T 30 G και 30 C α; β; γ; δ; Οπότε έχω α=1.800 Α, β=1.800 T, γ=2.700 G και δ=2.700 C β) Αν α είναι ο αριθμός του αθροίσματος αδενίνης-θυμίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της θυμίνης ή της αδενίνης στο μόριο του DNA και β ο αριθμός του αθροίσματος γουανίνης-κυτοσίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της γουανίνης ή κυτοσίνης στο μόριο του DNA και επειδή μεταξύ αδενίνης και θυμίνης αναπτύσσονται δύο δεσμοί υδρογόνου και μεταξύ γουανίνης και κυτοσίνης τρεις, θα ισχύει: 2α+3β= = = δεσμοί υδρογόνου ΑΣΚΗΣΗ 21 Σε ένα τμήμα του μορίου DNA η βάση αδενίνη αποτελεί το 25% των συνολικών βάσεων. Ποιο είναι το ποσοστό των υπολοίπων βάσεων που υπάρχουν σε αυτό το τμήμα του μορίου και πόσοι δεσμοί υδρογόνου σχηματίζονται στο τμήμα αυτό του μορίου αν γνωρίζετε ότι αποτελείται από 800 νουκλεοτίδια. 25% Α, 25% T, 25%G και 25%C 200 Α, 200 T, 200 G και 200 C 2α+3β= = =1.000 δεσμοί υδρογόνου

14 14 ΑΣΚΗΣΗ 22 Ένα μόριο DNA αποτελείται από νουκλεοτίδια, από τα οποία περιέχουν την αζωτούχο βάση αδενίνη (Α). α) Από πόσα νουκλεοτίδια αποτελείται η κάθε αλυσίδα αυτού του μορίου; β) Να υπολογισθεί ο αριθμός των νουκλεοτιδίων του μορίου, που περιέχουν την αζωτούχο βάση γουανίνη (G). γ) Να υπολογισθεί ο συνολικός αριθμός των δεσμών υδρογόνου που συνδέουν τις συμπληρωματικές βάσεις αυτού του μορίου. α) Το μόριο του DNA είναι δίκλωνο άρα θα έχει δύο αλυσίδες, οι οποίες θα περιέχουν :2= νουκλεοτίδια β) Η αδενίνη (Α) είναι συμπληρωματική με τη θυμίνη (Τ) κατά συνέπεια αφού υπάρχουν 4000 νουκλεοτίδια που περιέχουν αδενίνη θα υπάρχει και νουκλεοτίδια που θα περιέχουν θυμίνη. Το υπόλοιπο =4000= ισομοιράζεται νουκλεοτίδια που περιέχουν κυτοσίνη και νουκλεοτίδια που περιέχουν τη συμπληρωματική της γουανίνη. γ) Αν α είναι ο αριθμός του αθροίσματος αδενίνης-θυμίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της θυμίνης ή της αδενίνης στο μόριο του DNA και β ο αριθμός του αθροίσματος γουανίνης-κυτοσίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της γουανίνης ή κυτοσίνης στο μόριο του DNA και επειδή μεταξύ αδενίνης και θυμίνης αναπτύσσονται δύο δεσμοί υδρογόνου και μεταξύ γουανίνης και κυτοσίνης τρεις, θα ισχύει: 2α+3β= = = δεσμοί υδρογόνου ΑΣΚΗΣΗ 23 Τμήμα DNA περιέχει 20% αδενίνη και έχει μήκος 3,4μm. Ποια είναι η εκατοστιαία αναλογία των υπολοίπων βάσεων, πόσες πλήρεις στροφές στο χώρο σχηματίζει το μόριο αυτό και με πόσους δεσμούς υδρογόνου συνδέονται οι δύο αλυσίδες του; (Στο DNA κάθε πλήρης στροφή περιλαμβάνει 10 ζεύγη βάσεων και η απόσταση μεταξύ δύο διαδοχικών ζευγών βάσεων είναι ίση με 0,34nm) Περιέχει 20% θυμίνη, 30% γουανίνη και 30% κυτοσίνη. Στο DNA κάθε πλήρης στροφή περιλαμβάνει 10 ζεύγη βάσεων 3,4μm=3,4Χ1000nm=3.400nm Άρα 3400:0,34= ζεύγη βάσεων Άρα :10=1.000 στροφές Το μόριο περιέχει ζεύγη αδενίνης-θυμίνης, άρα 4.000Χ2=8.000 δεσμοί υδρογόνου και ζεύγη γουανίνης-κυτοσίνης, άρα 6.000Χ3= δεσμοί υδρογόνου. Συνολικά = δεσμοί υδρογόνου στο μόριο του DNA

15 15 ΑΣΚΗΣΗ 24 Μια πλήρη στροφή της έλικας του DNA περιλαμβάνει 10 ζεύγη συμπληρωματικών αζωτούχων βάσεων και η απόσταση μεταξύ δύο διαδοχικών ζευγών βάσεων είναι ίση με 0,34nm. Αν ένα τμήμα DNA έχει μήκος nm και το 30% των βάσεών του είναι αδενίνες, να βρεθεί: α) ο αριθμός κάθε είδους βάσεων. β)οι πλήρεις στροφές στο χώρο που σχηματίζει το μόριο αυτό γ)οι αριθμοί των φωσφοδιεστερικών δεσμών και δ)οι δεσμοί υδρογόνου που υπάρχουν στο μόριο; α)13.600nm:0,34nm= ζεύγη βάσεων Η αδενίνη (Α) είναι συμπληρωματική με τη θυμίνη (Τ) κατά συνέπεια αφού υπάρχει 30% αδενίνη θα υπάρχει και 30% θυμίνη. Το υπόλοιπο 40% ισομοιράζεται κατά 20% στη κυτοσίνη και 20% στη συμπληρωματική της γουανίνη ζεύγη βάσεων = = νουκλεοτίδια Στα A 30 T 20 G και 20 C α; β; γ; δ; Οπότε έχω α= Α, β= T, γ= G και δ= C β) ζεύγη βάσεων : 10 ζεύγη ανά στροφή =4.000 στροφές γ)οι φωσφοδιεστερικοί δεσμοί σχηματίζονται μεταξύ των νουκλεοτιδίων των αλυσίδων. Στο εξεταζόμενο τμήμα του DΝΑ υπάρχουν ζεύγη βάσεων άρα θα υπάρχουν και νουκλεοτίδια σε κάθε αλυσίδα. Μεταξύ δύο νουκλεοτιδίων σχηματίζεται ένας φωσφοδιεστερικός δεσμός, μεταξύ τριών νουκλεοτιδίων δύο φωσφοδιεστερικοί δεσμοί κ.ο.κ., δηλαδή ισχύει: δ = ν - 1 όπου δ ο αριθμός των φωσφοδιεστερικών δεσμών και ν ο αριθμός των νουκλεοτιδίων κάθε αλυσίδας. Άρα δ= = για κάθε αλυσίδα και = φωσφοδιεστερικοί δεσμοί για το τμήμα αυτό του DNA. δ)το τμήμα μορίου του DNA περιέχει ζεύγη αδενίνηςθυμίνης, άρα Χ2= δεσμοί υδρογόνου και ζεύγη γουανίνης-κυτοσίνης, άρα Χ3= δεσμοί υδρογόνου. Συνολικά = δεσμοί υδρογόνου στο τμήμα μορίου του DNA

16 16 ΑΣΚΗΣΗ 25 Μια πλήρη στροφή της έλικας του DNA έχει μήκος 3,4nm και περιλαμβάνει 10 ζεύγη συμπληρωματικών αζωτούχων βάσεων. Αν ένα τμήμα DNA έχει μήκος nm και το 30% των βάσεών του είναι αδενίνες, να βρεθεί: α) ο αριθμός κάθε είδους βάσεων. β)οι πλήρεις στροφές στο χώρο που σχηματίζει το μόριο αυτό γ)οι αριθμοί των φωσφοδιεστερικών δεσμών και δ)οι δεσμοί υδρογόνου που υπάρχουν στο μόριο; α)τα 10 ζεύγη των συμπληρωματικών αζωτούχων βάσεων έχουν μήκος 3,4 nm. Οπότε 3,4 nm : 10 = 0,34 nm ανά ζεύγος nm:0,34nm= ζεύγη βάσεων Η αδενίνη (Α) είναι συμπληρωματική με τη θυμίνη (Τ) κατά συνέπεια αφού υπάρχει 30% αδενίνη θα υπάρχει και 30% θυμίνη. Το υπόλοιπο 40% ισομοιράζεται κατά 20% στη κυτοσίνη και 20% στη συμπληρωματική της γουανίνη ζεύγη βάσεων = = νουκλεοτίδια Στα A 30 T 20 G και 20 C α; β; γ; δ; Οπότε έχω α= Α, β= T, γ= G και δ= C β) ζεύγη βάσεων : 10 ζεύγη ανά στροφή =4.000 στροφές γ)οι φωσφοδιεστερικοί δεσμοί σχηματίζονται μεταξύ των νουκλεοτιδίων των αλυσίδων. Στο εξεταζόμενο τμήμα του DΝΑ υπάρχουν ζεύγη βάσεων άρα θα υπάρχουν και νουκλεοτίδια σε κάθε αλυσίδα. Μεταξύ δύο νουκλεοτιδίων σχηματίζεται ένας φωσφοδιεστερικός δεσμός, μεταξύ τριών νουκλεοτιδίων δύο φωσφοδιεστερικοί δεσμοί κ.ο.κ., δηλαδή ισχύει: δ = ν - 1 όπου δ ο αριθμός των φωσφοδιεστερικών δεσμών και ν ο αριθμός των νουκλεοτιδίων κάθε αλυσίδας. Άρα δ= = για κάθε αλυσίδα και = φωσφοδιεστερικοί δεσμοί για το τμήμα αυτό του DNA. δ)το τμήμα μορίου του DNA περιέχει ζεύγη αδενίνηςθυμίνης, άρα Χ2= δεσμοί υδρογόνου και ζεύγη γουανίνης-κυτοσίνης, άρα Χ3= δεσμοί υδρογόνου. Συνολικά = δεσμοί υδρογόνου στο τμήμα μορίου του DNA

17 17 ΑΣΚΗΣΗ 26 Μια πλήρη στροφή της έλικας του DNA έχει μήκος 3,4nm και περιλαμβάνει 10 ζεύγη συμπληρωματικών αζωτούχων βάσεων Το DNA ενός του φυσιολογικού ιού έχει μήκος 12μm.Αν το μήκος του DNA ενός μεταλλαγμένου ιού είναι 10μm.Πόσες λιγότερες στροφές σχηματίζει στο χώρο και πόσα λιγότερα ζεύγη βάσεων έχει το μεταλλαγμένο αυτό μόριο; Το μεταλλαγμένο DNA έχει μικρότερο μήκος κατά: 12μm-10μm=2μm=2 1000nm=2.000 nm 2000:3,4 = 588 στροφές και έχει = 5880 λιγότερα ζεύγη συμπληρωματικών αζωτούχων βάσεων από το φυσιολογικό. 2 ος τρόπος: Τα 10 ζεύγη των συμπληρωματικών αζωτούχων βάσεων έχουν μήκος 3,4 nm. Οπότε 3,4 nm : 10 = 0,34 nm ανά ζεύγος 2000:0,34 = 5882 λιγότερα ζεύγη συμπληρωματικών αζωτούχων βάσεων από το φυσιολογικό. 5882:10 = 588 λιγότερες στροφές. ΑΣΚΗΣΗ 27 Ένα τμήμα μορίου DNA αποτελείται από 500 νουκλεοτίδια μεταξύ των οποίων αναπτύσσονται 570 δεσμοί υδρογόνου. Να βρεθεί ο αριθμός των νουκλεοτιδίων που περιέχουν καθεμιά από τις αζωτούχες βάσεις στο τμήμα αυτό του DNA To DNA είναι δίκλωνο άρα 500:2=250 νουκλεοτίδια σε κάθε αλυσίδα. Αν α είναι ο αριθμός του αθροίσματος αδενίνης-θυμίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της θυμίνης ή της αδενίνης στο μόριο του DNA και ίσος με τον αριθμό των ζευγών αδενίνης θυμίνης. Ο αριθμός β είναι το άθροισμα γουανίνης-κυτοσίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της γουανίνης ή της κυτοσίνης στο μόριο του DNA και ίσος με τον αριθμό των ζευγών γουανίνης κυτοσίνης. Επομένως θα ισχύει α+β=250 Επειδή μεταξύ αδενίνης και θυμίνης αναπτύσσονται δύο δεσμοί υδρογόνου και μεταξύ γουανίνης και κυτοσίνης τρεις, θα ισχύει: 2α+3β=570 Επιλύω το σύστημα των δύο εξισώσεων: α+β=250 β=250-α 2α+3β=570 2α+3(250-α)=570 2α+750-3α=570 -α= α=-1800 α=180 β=250-α β= β=70 Άρα ο αριθμός των ζευγών Α-Τ είναι 180 και των ζευγών G-C είναι 70 και θα υπάρχουν: 180 νουκλεοτίδια με αδενίνη 180 νουκλεοτίδια με θυμίνη 70 νουκλεοτίδια με γουανίνη και 70 νουκλεοτίδια με κuτοσίνη.

18 18 ΑΣΚΗΣΗ 28 Μια πλήρη στροφή της έλικας του DNA έχει μήκος 3,4nm και περιλαμβάνει 10 ζεύγη συμπληρωματικών αζωτούχων βάσεων. Αν ένα τμήμα DNA έχει μήκος 6,12 μm και το κλάσμα A+T/G+C είναι ίσο με 2/3. Να βρεθούν οι δεσμοί υδρογόνου που υπάρχουν στο τμήμα αυτό του μορίου του DNA. 6,12 μm=6, nm=6.120 nm 6.120:3,4 = στροφές και έχει = ζεύγη συμπληρωματικών αζωτούχων βάσεων. To DNA είναι δίκλωνο άρα νουκλεοτίδια σε κάθε αλυσίδα. Αν α είναι ο αριθμός του αθροίσματος αδενίνης-θυμίνης (A+T) στο κλώνο, οποίος είναι ίσος με τον αριθμό της θυμίνης ή της αδενίνης στο μόριο του DNA και ίσος με τον αριθμό των ζευγών αδενίνης θυμίνης. Ο αριθμός β είναι το άθροισμα γουανίνης-κυτοσίνης (G+C) στο κλώνο, οποίος είναι ίσος με τον αριθμό της γουανίνης ή της κυτοσίνης στο μόριο του DNA και ίσος με τον αριθμό των ζευγών γουανίνης κυτοσίνης. Θα ισχύει: α+β= A + T G + C = 2 3 α = β 2 3 Επιλύω το σύστημα των δύο εξισώσεων: β= α α 2 = 2( α) = 3α α = 3α = 5α α α = α = και β= α β= β= Επειδή μεταξύ αδενίνης και θυμίνης αναπτύσσονται δύο δεσμοί υδρογόνου και μεταξύ γουανίνης και κυτοσίνης τρεις, θα ισχύει: 2α+3β= = =46.800

19 19 ΑΣΚΗΣΗ 29 Ένα μόριο του DNA απομονώθηκε και μετρήθηκαν οι αζωτούχες βάσεις του, οι οποίες ήταν συνολικά Αν το μοριακό κλάσμα της Αδενίνης (Α) στο μόριο αυτό είναι 0,30 α) Να υπολογισθεί το ποσοστό των αζωτούχων βάσεων που περιέχονται σ αυτό καθώς και η αριθμητική τους τιμή. β) Πόσοι δεσμοί υδρογόνου απαιτούνται για τη συγκρότηση αυτού του μορίου του DNA; A α)το μοριακό κλάσμα της (Α) είναι της μορφής = 0, 30 A + T + G + C που σημαίνει ότι το 30% των αζωτούχων βάσεων του είναι αδενίνες. Η αδενίνη (Α) είναι συμπληρωματική με τη θυμίνη (Τ) κατά συνέπεια αφού υπάρχει 30% αδενίνη θα υπάρχει και 30% θυμίνη. Το υπόλοιπο 40% ισομοιράζεται κατά 20% στη κυτοσίνη και 20% στη συμπληρωματική της γουανίνη. Στα A 30 T 20 G και 20 C α; β; γ; δ; Οπότε έχω α=9.000 Α, β=9.000 T, γ=6.000 G και δ=6.000 C β) Αν α είναι ο αριθμός του αθροίσματος αδενίνης-θυμίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της θυμίνης ή της αδενίνης στο μόριο του DNA και β ο αριθμός του αθροίσματος γουανίνης-κυτοσίνης στο κλώνο, οποίος είναι ίσος με τον αριθμό της γουανίνης ή κυτοσίνης στο μόριο του DNA και επειδή μεταξύ αδενίνης και θυμίνης αναπτύσσονται δύο δεσμοί υδρογόνου και μεταξύ γουανίνης και κυτοσίνης τρεις, θα ισχύει: 2α+3β= = = δεσμοί υδρογόνου

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ Βιολογία ΘΕΜΑ Α κατεύθυνσης 1. δ 2. α 3. γ 4. δ 5. γ 6. α 7. δ 8. α 9. α 10. α ΘΕΜΑ Β Β1. Η ραδιενέργεια 32 Ρ θα βρίσκεται στο κλάσμα Β, δηλαδή στο κλάσμα εκείνο που περιλαμβάνει τα βακτήρια που έχουν

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ)

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01%

ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% Ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο συμμετέχουν, σε σημαντικό βαθμό, στη

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Οργά νωση Γενετικού Υλικού

Οργά νωση Γενετικού Υλικού Βιολογία Γ Γυμνασίου: Διατήρηση και Συνέχεια της Ζωής Οργά νωση Γενετικού Υλικού Γονίδιο: Η μονάδα της κληρονομικότητας. Ουσιαστικά είναι ένα κομμάτι από το DNA που αποθηκεύει πληροφορίες για κάποιο συγκεκριμένο

Διαβάστε περισσότερα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1

ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1 ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ ΚΕΦ. 1 ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΕΡΩΤΗΣΕΙΣ ΤΟΥ ΣXOΛΙΚΟΥ ΒΙΒΛΙΟΥ 1. Τοποθετήστε, στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ

ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Β ΤΡΙΜΗΝΟ ΚΟΝΤΟΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΣΤΟΥΣ ΕΥΚAΡΥΩΤΙΚΟΥΣ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙ- ΚΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ Γ2 Ιανουάριος 2015 ΕΙΣΑΓΩΓΗ Ο ι Watson και Crick, το 1953, διατύπωσαν το μοντέλο της διπλής έλικας

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Υπεύθυνη καθηγήτρια: Δασκαλάκη Κατερίνα Μοίρες 2012-2013 Περιεχόμενα

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες;

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Οι πρωτεΐνες αποτελούν δομικά ή λειτουργικά συστατικά των κυττάρων και δομούνται από απλούστερες ενώσεις, τα αμινοξέα.

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ Β ΤΡΙΜΗΝΟΥ Γ 4 23.1.12 ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΕΡΓΑΣΤΗΚΑΝ: ΑΛΕΞΑΝΔΡΟΣ ΔΕΛΗΜΙΧΑΛΗΣ ΑΡΤΕΜΗΣ ΑΝΑΣΤΑΣΙΑΔΗΣ 1 ΕΙΣΑΓΩΓΗ Το δεοξυριβονουκλεϊκό οξύ (Deoxyribonucleic acid -

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Τύποι νουκλεϊκών οξέων

Τύποι νουκλεϊκών οξέων Τύποι νουκλεϊκών οξέων DNA ένας τύπος, μια λειτουργία RNA - 4 τύποι, 4 λειτουργίες Ριβοσωμικό RNA Αγγελιαφόρο RNA Μεταφορικό RNA Καταλυτικό RNA Βιοχημεία Ι Δ-1 Βιοχημεία Ι Δ-2 3 5 φωσφοδιεστερικός δεσμός

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών.

Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών. Κεφάλαιο 1: ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών. Βιολογικά μακρομόρια ( ή πολυμερή ): Κατηγορία βιομορίων με μεγάλο ΜΒ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

Φίλη μαθήτρια, φίλε μαθητή,

Φίλη μαθήτρια, φίλε μαθητή, Φίλη μαθήτρια, φίλε μαθητή, Το βιβλίο αυτό φιλοδοξεί να σε βοηθήσει στην κατανόηση των σύγχρονων δεδομένων της Μοριακής Βιολογίας και της Βιοτεχνολογίας, να αποτελέσει σύμμαχό σου στη μελέτη και να προκαλέσει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα ΚΕΦΑΛΑΙΟ 1 Οργάνωση της ζωής βιολογικά συστήματα 1.1 Τα μόρια της ζωής Καινούριες γνώσεις Ποια μόρια συμμετέχουν στη δομή και στις λειτουργίες των οργανισμών. Ποια είναι η σημασία του νερού για τη ζωή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 β, Α4 δ, Α5 α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Για τη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2013 ΘΕΜΑ Α Α1 Α2 Α3 Α4 Α5 γ β α δ α ΘΕΜΑ Β Β1 Σελ. 123-124: «Η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού

Διαβάστε περισσότερα

ΒΙΟΧΗΜΕΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ. Στοιχείο O C H N Ca P K S Na Mg περιεκτικότητα % ,5 1 0,35 0,25 0,15 0,05

ΒΙΟΧΗΜΕΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ. Στοιχείο O C H N Ca P K S Na Mg περιεκτικότητα % ,5 1 0,35 0,25 0,15 0,05 ΒΙΟΧΗΜΕΙΑ Βιοχημεία: είναι η επιστήμη που ασχολείται με τη μελέτη των οργανικών ενώσεων που συναντώνται στον οργανισμό, καθώς και με τον μεταβολισμό τους. ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ 108 στοιχεία

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

στην Βιολογία Σάββατο 7/12/2013

στην Βιολογία Σάββατο 7/12/2013 Ε.Κ.Φ.Ε. ΑΙΓΑΛΕΩ Προκριματικός διαγωνισμός για την 12 th EUSO 2014 στην Βιολογία Σάββατο 7/12/2013 Ονοματεπώνυμα μελών ομάδας 1) 2) 3) Σχολείο: Διάρκεια: 1 ώρα 1. Απομόνωση Νουκλεϊκών οξέων από φυτικά

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου 2011 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA

ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ-ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 4.1. Τι ονομάζεται ανασυνδυασμένο DNA, που χρησιμοποιείται; 4.2. Τι είναι η γενετική μηχανική, ποιοι είναι οι στόχοι της και

Διαβάστε περισσότερα