SUPPORTING INFORMATION
|
|
|
- Όσιρις Ανδρεάδης
- 6 χρόνια πριν
- Προβολές:
Transcript
1 SUPPORTING INFORMATION Trichodermides A E: New Peptaibols isolated from Australian Termite Nestderived Fungus Trichoderma virens CMB-TN16 Wei-Hua Jiao,, Zeinab Khalil, Pradeep Dewapriya, Angela A. Salim, Hou-Wen Lin, and Robert J. Capon* Institute for Molecular Bioscience, The University of Queensland, St. Lucia, QLD, 4072, Australia Research Center for Marine Drugs, State Key Laboratory of Oncogenes and Related Genes, Department of Pharmacy, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, , China 1
2 Table of contents 1. DNA taxonomy of the fungus CMB-TN ITS gene sequence of the fungus CMB-TN BLAST search (closest match) Spectroscopic characterization for trichodermides A-E (1-5) MS/MS fragmentation for tichodermides A-E (1-5) C3 Marfey analysis Cytotoxicity assay Antimicrobial assay List of Tables Table S1. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for Table S2. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for Table S3. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for Table S4. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for Table S5. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for List of Figures Figure S1. 1 H NMR (600 MHz, DMSO-d 6 ) spectrum of Figure S2. 13 C NMR (150 MHz, DMSO-d 6 ) spectrum of Figure S3. HSQC (600 MHz, DMSO-d 6 ) spectrum of Figure S4. COSY (600 MHz, DMSO-d6) spectrum of Figure S5. COSY (600 MHz, DMSO-d 6 ) spectrum of Figure S6. HMBC (600 MHz, DMSO-d 6 ) spectrum of Figure S7. HMBC (600 MHz, DMSO-d 6 ) spectrum of Figure S8. HMBC (600 MHz, DMSO-d 6 ) spectrum of Figure S9. ROESY (600 MHz, DMSO-d 6 ) spectrum of Figure S10. ROESY (600 MHz, DMSO-d 6 ) spectrum of Figure S11. HR-QTOF-MS spectrum of Figure S12. 1 H NMR (600 MHz, DMSO-d 6 ) of Figure S C NMR (150 MHz, DMSO-d 6 ) of Figure S14. HR-QTOF-MS spectrum of Figure S15. 1 H NMR (600 MHz, DMSO-d 6 ) spectrum of Figure S C NMR (150 MHz, DMSO-d 6) spectrum of Figure S17. HR-QTOF-MS spectrum of Figure S18. 1 H NMR (600 MHz, DMSO-d 6 ) spectrum of Figure S C NMR (150 MHz, DMSO-d 6 ) of Figure S20. HR-QTOF-MS spectrum of Figure S21. 1 H NMR (600 MHz, DMSO-d 6 ) of Figure S C NMR (150 MHz, DMSO-d 6 ) of Figure S23. HR-QTOF-ESI-MS spectrum of Figure S24. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of Figure S25. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of Figure S26. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of Figure S27. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of Figure S28. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of Figure S29. C 3 Marfey s method analysis of
3 Figure S30. C 3 Marfey s method analysis of Figure S31. C 3 Marfey s method analysis of Figure S32. C 3 Marfey s method analysis of Figure S33. C 3 Marfey s method analysis of Figure S34. Cytotoxicity assay of the trichodermids 1 5 against (a) NCI-H460 (lung cancer cell line) and (b) SW620 (human colon cancer cell line) Figure S35. Antimicrobial assay screening graphs of trichodermides A-E (1 5)
4 1. DNA taxonomy of the fungus CMB-TN16 Genomic DNA of the fungus CMB-TN16 was extracted from the mycelia using the DNeasy Plant Mini Kit (Qiagen) as per the manufacturers protocol. The 18S rrna genes were amplified from genomic DNA by PCR using the universal primers ITS 1 (5ʹ-TCCGTAGGTGAACCTGCGG-3ʹ) and ITS 4 (5ʹ- TCCTCCGCTTATTGATATGC-3ʹ). The PCR mixture (50 μl) contained 1 μl of genomic DNA (20 40 ng), 200 μm of each deoxynucleoside triphosphate (dntp), 1.5 mm MgCl2, 0.3 μm of each primer, 1 U of Taq DNA polymerase (Fisher Biotec) and 5 μl of PCR buffer. PCR was performed using the following conditions: initial denaturation at 95 C for 3 min, 30 cycles in series of 94 C for 30 s (denaturation), 55 C for 60 s (annealing) and 72 C for 60 s (extension), followed by one cycle at 72 C for 6 min. The PCR products were purified with PCR purification kit (Qiagen) and sequenced. The BLAST search showed the amplified ITS sequence (GenBank accession no. KU ) has 99% homology with other members of the genus Trichoderma virens ITS gene sequence of the fungus CMB-TN16 TCCCAACCCATGTGACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTG CGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTAT ACCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTC GAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAAC GCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT GAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTC AACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGC CCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTC GCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAACTTCTGAAATGTTG ACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCATAA CGGGAGG 4
5 1.2. BLAST search (closest match) 5
6 2. Spectroscopic characterization for trichodermides A-E (1-5) Table S1. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for 1 No. C H (J in Hz) COSY HMBC ROESY Ac , a C , CH , s 1 Iva 1 -NH D-Iva , C , C , CH , i m 4 NH 1.69, m , CH , o dd 3 2, 3 NH , CH , s 1, 2, 3 NH NH 8.48, s Ac-1, 1, 2, 3,5 Ac-2, Gln 2 -NH, 3, 4, 5 L-Gln , b C , CH 3.96, m NH, 3 1, 2 Ile 3 -NH , c CH , i m 2, 4 NH 1.85, j m 2, , CH , m 3, 5 2, , m 3, 5 2, , C NH 8.73, d (5.4) 2 Iva 1-1, 2, 3 Iva 1 -NH, Ile 3 -NH, 3 5-NH , s 5-NH , s 5-NH 5 L-Ile , a C , CH 3.89, m NH, 3 1, 3, 4, , d CH 1.91, i m 2, 4, 6 2, , c CH , k m 3, , m 3, , CH , l t , e CH , q d 3 2 NH NH 7.73, d (7.2) 2 Gln 2-1, 2, 3 Gln 2 -NH, Val 4 -NH L-Val , b C , CH 4.09, m NH, 3 1, 3, 4 NH , CH 2.09, m 2, 4, 5 1, , CH , l d 3 2, 3, 5 NH , CH , l d 3 NH, Aib 5 -NH NH 7.24, d (8.4) 2 Ile 3-1, 2, 3 Ile 3 -NH, Aib 5 -NH Aib , C , C , c CH , s 1, 2, 4 NH , f CH , s 1, 2, 3 NH NH 7.92, s Val 4-1, 1, 3, 4 Val 4 -NH, 3, 4, Pro 6-5 6
7 No. C H (J in Hz) COSY HMBC ROESY L-Pro , n C , CH 4.20, d (7.8, 7.8) 3 1, 3, 4 Ile 7 -NH , g CH , m 2, 4 1, , m 2, 4 1, , c CH , j m 3, , k m 3, , CH , m 4 Aib 5 -NH 3.39, m 4 Aib 5 -NH L-Ile , C , CH 3.80, t (7.8) NH, 3 1, 3, , d CH 1.91, i m 2, 4, , c CH , k m 3, , m 3, , CH , l t , e CH , l d 3 2 NH 7.38, d (7.8) 2 1, 2, 3 Pro 6-2 L-Leu , n C , CH 4.24, m NH, 3 1, 3 Aib 9 -NH , CH , m 2, , CH 1.37, m 3, , CH , p d , CH , o d 4 Leu 8-3 NH 7.08, m d 2 2, 3 Aib , h C , C , c CH , s 1, 2, 4 NH , CH , s 1, 2, 3 NH 7.60, s Leu 8-1, 1, 2, 4 3, Pro 10-5, Leu 8-2 L-Pro , h C , CH 4.25, m NH, 3 1, 4, , g CH , m 2, 4 1, , m 2, , c CH , j m 3, , k m , CH , m 4 Aib 9 -NH 3.25, m 4 Aib 9 -NH L-Leuol , CH 3.72, m NH, 2, 3, , CH , m 1, , m 1, , CH 1.59, m 2, 4, , CH , q d , f CH , p d , CH , m 1 NH 3.12, m 1 NH NH 7.08, m d 1 1 a-q Assignments for overlapping 1 H and 13 C NMR resonances with the same superscript may be interchanged. 7
8 Table S2. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for 2 No. C H (J in Hz) COSY 1 H 13 C HMBC ROESY Ac , a C , CH , s 1 Aib 1 -NH Aib , C , C , CH , s 1, , CH , s 1, 2, 3 NH 8.74, s Ac-1, 1, 2, 3 Gln 2 -NH, Ac-2 L-Gln , b C , CH 3.94, t (5.4) NH, 3 1, 3, 4 Ile 3 -NH, NH , c CH , f m 2, , g m 2, , CH , m 3 2, , m 3 2, , C NH 8.79, d (5.4) 2 Aib 1-1 Ile 3 -NH, 2 5-NH , s , s 4, 5 L-Ile , d C , CH 3.89, m NH, 3 1, 3, 4, , n CH 1.93, o m 2, 4, 6 2, 4, , c CH , m 3, , m 3, , CH , h t , CH , h d 3 2 NH 7.68, d (7.2) 2 Gln 2-1, 2, 3 Gln 2 -NH, Val 4 -NH L-Val , b C , CH 4.07, m NH, 3 1, 3, 4 Aib 5 -NH , CH 2.08, m 2, 4, 5 1, , CH , h d 3 2, 3, , CH , q d 3 NH 7.31, d (8.4) 2 Ile 3-1 Ile 3 -NH, Aib 5 -NH Aib , e C , C , c CH , s 1, 2, , CH , s 1, 2, 3 NH NH 7.96, s Val 4-1, 2, 3, 4 Val 4 -NH, Pro 6-2 8
9 No. C H (J in Hz) COSY 1 H 13 C HMBC ROESY L-Pro , C , CH 4.20, dd (7.8, 7.8) 3 1, 3, 4 Ile 7 -NH , i CH , m 2, 4 1, , m 2, 4 1, , c CH , f m 3, , g m 3, , CH , m , m 4 L-Ile , d C , CH 3.80, t (7.8) NH, 3 1, 3, 4, , n CH 1.93, o m 2, 4, , c CH , j m 3, , m 3, , CH , h t , CH , h d 3 2 NH 7.39, d (7.8) 2 Pro 6-1, 2 Pro 6-2, Pro 6-5 L-Leu , e C , CH 4.24, k m NH, 3 1, 3 Aib 9 -NH , CH , m 2, , r CH 1.59, l m 3, , CH , p d (7.2) 4 4, , CH , d (6.6) 4 3, 5 NH 7.09, m d Aib , d C , C , s CH , s 1, 2, 4 NH , s CH , s 1, 2, 3 NH 7.61, s 1, 2, 3 Pro 10-2 L-Pro , a C , CH 4.25, k m 3 3, 4, 5 Aib 9 -NH , i CH , m 2, , m 2, , c CH , j m 3, , CH , m , m 4 L-Leuol , CH 3.71, m NH, 2, , CH , m 1, , m 1, , r CH 1.59, l m 2, 4, , CH , q d , CH , p d (6.6) , CH , m 1 NH 3.12, m 1 NH NH 7.09, m d a-s Assignments for overlapping 1H and 13C NMR resonances with the same superscript may be interchanged. 9
10 Table S3. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for 3 position C, mult H (J in Hz) COSY 1 H 13 C ROESY HMBC Ac , C , CH , s Ac-1 Iva 1 -NH D-Iva , C , a C , CH , i m , m , CH , t (6.6) 3 2, 3 NH , CH , s 1, 2, 3 NH, Gln 2 -NH NH 8.50, s Ac-1, 1, 2, 3, 5 Ac-2, Gln 2 -NH, 3, 5 L-Gln , b C , c CH 3.97, m NH, 3 1, 3 Ile 3 -NH , CH , m 2, , j m 2, , CH , k m 3 2, , m 3 2, , C NH 8.72, d (5.4) 2 Iva 1-1, 2, 3 Iva 1 -NH, Ile 3 -NH 5-NH , s 5 5-NH 6.91, s 5 5-NH L-Ile , d C , CH 3.90, m NH, 3 1, 3, 4, , e CH 1.91, i m 2, 4, 6 2, , CH , l m 3, 5 NH 1.21, m 3, , CH , m t , f CH , o d 3 2 NH NH 7.75, d (7.2) 2 Gln 2 -NH, Val 4 -NH L-Val , b C , a CH 4.09, m NH, 3 1, 3, 4 NH , CH 2.08, m 2, 4, 5 1, , CH , m d 3 2, 3, 5 NH , CH , n d 3 NH, Aib 5 -NH NH 7.30, d (8.4) 2 Ile 3-1 Ile 3 -NH, Aib 5 -NH Aib , C , C , g CH , s 1, 2, 4 NH , h CH , s 1, 2, 3 NH 10
11 position C, mult H (J in Hz) COSY 1 H 13 C ROESY HMBC NH 7.97, s Val 4-1, 1, 3, 4 Val 4 -NH, Pro 6-5 L-Pro , C , CH 4.20, dd (7.8, 7.8) 3 1, 3, 4 Ile 7 -NH , CH , k m 2, 4 1, , m 2, 4 1, , g CH , j m 3, , m 3, , CH , p m 4 Aib 5 -NH 3.40, m 4 L-Ile , d C , CH 3.81, t (7.8) NH, 3 1, 3, 6 Leu 8 -NH , e CH 1.94, m 2, 4, , g CH , l m 3, , m 3, , CH , m t , f CH , o d 3 3 Leu 8 -NH NH 7.42, d (7.8) 2 Pro 6-1 Pro 6-2, Leu 8 -NH L-Leu , C , CH 4.24, q m NH, 3 1, 3 Aib 9 -NH , CH , m 2, , CH 1.59, m 3, , h CH , n d , CH , d (6.6) 4 3 NH 7.12, d (8.4) 2 Ile 7-1 Ile 7 -NH, Aib 9 -NH Aib , d C , C , h CH , s 1, 2, 4 NH , CH , s 1, 2, 3 NH 7.62, s Leu 8-1, 1, 2, 4 Leu 8 -NH, Pro 10-5 L-Pro , d C , CH 4.25, q m 3 1, 4, 5 Valol 11 -NH , CH , m 2, 4 1, , m 2, , g CH , m 3, , l m 3, , CH , m 4 Aib 9 -NH 3.31, m 4 L-Valol , c CH 3.64, p m NH, 2, 6 Pro 10-1, 3, , CH 1.84, m 3, , CH , n d , CH , n d , CH , m 1 2 NH 3.35, m 1 2 NH NH 7.00, d (9.6) 2 Pro 10-1 Pro 10-2, 5 a-q Assignments for overlapping 1H and 13C NMR resonances with the same superscript may be interchanged. 11
12 Table S4. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for 4 position C H (J in Hz) COSY 1 H 13 C HMBC ROESY Ac , C , i CH , s 1 Aib 1 -NH Aib , C , C , CH , k s 2, 4 NH , CH , k s 1, 2, 3 NH 8.72, s Ac-1, 1, 2, 3 Gln 2 -NH, 3 L-Gln , a C , CH 3.94, m NH, 3 1, 3 Ile 3-3, Ile 3-3, NH , b CH , m 2, , l m 2, , CH , m 3 2, , m 3 2, , C NH 8.78, d (5.4) 2 Aib 1-1 Aib 1-4, Ile 3 -NH, 2 5-NH , s , s 5 L-Ile , c C , d CH 3.89, m NH, 3 1, 3, 4, , e CH 1.93, m 2, 4, 6 2, 4 Gln , b CH , l m 3, , m 3, , f CH , m t (6.6) , g CH , n d (7.2) 3 2 NH 7.66, d (7.2) 2 Gln 2-2, 2, 3 Gln 2 -NH, Val 4 -NH L-Val , h C , CH 4.07, m NH, 3 1, 3, 4 NH , CH 2.07, o m 2, 4, 5 1, , CH , n d (6.6) 3 2, 3, , CH , n d (6.0) 3 NH 7.30, d (8.4) 2 Ile 3-1 Ile 3 -NH, Aib 5 -NH Aib , a C 12
13 position C H (J in Hz) COSY 1 H 13 C HMBC ROESY , C , b CH , s 1, 2, , i CH , s 1, 2, 3 NH NH 7.95, s Val 4-1, 3, 4 Val 4 -NH, Val 4-2, Pro 6-5 L-Pro , C , CH 4.20, dd (7.8, 7.8) 3 1, 3, 4 Ile 7 -NH , CH , o m 2, 4 1, , p m 2, 4 1, , b CH , m 3, , l m 3, , j CH , m Ile 7-1, Aib 5 -NH 3.40, m 4 Aib 5-1, 2 L-Ile , c C , d CH 3.81, t (7.8) NH, 3 1, 3, , e CH 1.93, m 2, 4, , b CH , m 3, , m 3, , f CH , m t (6.6) , g CH , m d (7.2) 3 2 NH 7.41, d (7.8) 2 Pro 6-1 Pro 6-2, Leu 8 -NH L-Leu , h C , CH 4.26, q m NH, 3 1, 3 Aib 9 -NH , CH , l m 2, , CH 1.60, m 3, , i CH , d (7.2) , CH , d (6.6) 4 3 NH 7.12, d (8.4) 2 Ile 7-1 Ile 7 -NH, Aib 9 -NH Aib , c C , C , b CH , k s 1, 2, 4 NH , CH , s 1, 2, 3 NH 7.62, s 1, 2, 4 Leu 8 -NH, Pro 10-5 L-Pro , c C , CH 4.25, q m 3 1, 4, 5 Valol 11 -NH , CH , m 2, 4 1, , p m 2, , b CH , m 3, , l m 3, , j CH , m 4 Aib 9 -NH 3.30, m 4 Aib 9 -NH L-Valol , CH 3.64, m NH, 2, 6 3, , CH 1.85, m 3, , CH , m d , CH , d , CH , m 1 2 NH 3.34, m 1 2 NH NH 7.00, d (9.6) 2 Pro 10-1 Pro 10-2, 5 a-q Assignments for overlapping 1 H and 13 C NMR resonances with the same superscript may be interchanged. 13
14 Table S5. 1D and 2D NMR (600 MHz, DMSO-d 6 ) data for 5 position C H (J in Hz) COSY 1 H 13 C HMBC ROESY Ac , C , CH , h s 1 Iva 1 -NH D-Iva , C , C , CH , h m , m , CH , i dd , CH , s 1, 2, 3 NH 8.47, s Ac-1, 1, 2, 5 L-Gln , a C , b CH 3.99, m NH, 3 1, , c CH , m 2, , p m 2, , CH , j m 3 2, , m 3 2, , C NH 8.71, d (4.8) 2 Iva 1-1, 1, 2 Val 3 -NH 5-NH , k s 6.89, s L-Val , d C , CH 3.91, m NH, 3 1, 3, 4, , e CH 2.13 m 2, 4, 5 2, , f CH , l d , f CH , m d 3 2 NH 7.75, d (7.2) 2 Gln 2-1 Gln 2 -NH, Val 4 -NH L-Val , g C , CH 4.11, m NH, 3 1, 3, , CH 2.09, m 2, 4, 5 1, , CH , m d 3 2, 3, , CH , l d 3 NH 7.38, d (7.2) 2 Val 3-1, 1 Val 3 -NH, Aib 5 -NH 14 5
15 position C H (J in Hz) COSY 1 H 13 C HMBC ROESY Aib , a C , C , c CH , s 1,2, , CH , s 1, 2, 3 NH 8.02, s Val 4-1, 1, 3, 4 Val 4 -NH L-Pro , g C , CH 4.23, q m 3 1, 3, 4 Ile 7 -NH , CH , j m 2, 4 1, , m 2, 4 1, , c CH , m 3, , n m 3, , CH , o m 3.39, m 4 Aib 5-1, 2 L-Ile , d C , CH 3.81, t (5.4) NH, 3 1, 3, , CH 1.93, m 2, 4, , c CH , m 3, , n m 3, , CH , dd , CH , m d 3 2 NH 7.42, k d 2 Pro 6-1, 1 Leu 8 -NH, Pro 6-2 L-Leu , d C , l CH 4.25, q m NH, 3 1, , m CH , m 2, , CH 1.59, m 3, , CH , i d , CH , i d 4 3 NH 7.12, d (8.4) 2 1 Ile 7 -NH, Aib 9 -NH Aib , a C , C , c CH , s 1, 2, , CH , s 1, 2, 3 NH 7.62, s Leu 8-1/ Pro 10-1, 1, 2, 4 Leu 8 -NH, Pro 10-5 L-Pro , d C , CH 4.20, dd (7.8, 7.8) 3 1, 4, , e CH , j m 2, 4 1, , m 2, , c CH , p m 3, , n m 3, , CH , o m 4 Aib 9-1, 2 Aib 9 -NH 3.30, m 4 Aib 9-1, 3 L-Valol , b CH 3.64, o m , CH 1.89, h m 3, , CH , i d , CH , i d , CH , m 3.35, m NH 6.99, d (9.6) 2 Pro 10-1 Pro 10-2, 5 a-q Assignments for overlapping 1 H and 13 C NMR resonances with the same superscript may be interchanged. 15
16 Figure S1. 1 H NMR (600 MHz, DMSO-d 6 ) spectrum of 1 16
17 Figure S2. 13 C NMR (150 MHz, DMSO-d 6 ) spectrum of 1 Figure S3. HSQC (600 MHz, DMSO-d 6 ) spectrum of 1 17
18 Figure S4. COSY (600 MHz, DMSO-d 6 ) spectrum of 1 Figure S5. COSY (600 MHz, DMSO-d 6 ) spectrum of 1 18
19 Figure S6. HMBC (600 MHz, DMSO-d 6 ) spectrum of 1 Figure S7. HMBC (600 MHz, DMSO-d 6 ) spectrum of 1 19
20 Figure S8. HMBC (600 MHz, DMSO-d 6 ) spectrum of 1 Figure S9. ROESY (600 MHz, DMSO-d 6 ) spectrum of 1 20
21 Figure S10. ROESY (600 MHz, DMSO-d 6 ) spectrum of 1 Figure S11. HR-QTOF-MS spectrum of 1 21
22 Figure S12. 1 H NMR (600 MHz, DMSO-d 6 ) spectrum of 2 22
23 Figure S C NMR (150 MHz, DMSO-d 6 ) spectrum of 2 Figure S14. HR-QTOF-MS spectrum of 2 23
24 Figure S15. 1 H NMR (600 MHz, DMSO-d 6 ) spectrum of 3 24
25 Figure S C NMR (150 MHz, DMSO-d 6 ) spectrum of 3 Figure S17. HR-QTOF-MS spectrum of 3 25
26 Figure S18. 1 H NMR (600 MHz, DMSO-d 6 ) spectrum of 4 26
27 Figure S C NMR (150 MHz, DMSO-d 6 ) spectrum of 4 Figure S20. HR-QTOF-MS spectrum of 4 27
28 Figure S21. 1 H NMR (600 MHz, DMSO-d 6 ) spectrum of 5 28
29 Figure S C NMR (150 MHz, DMSO-d 6 ) spectrum of 5 Figure S23. HR-QTOF-ESI-MS spectrum of 5 29
30 3. MS/MS fragmentation for trichodermides A-E (1-5) Figure S24. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of 1 Figure S25. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of 2 30
31 Figure S26. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of 3 Figure S27. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of 4 31
32 Figure S28. Positive and negative ion HR-QTOF-ESI-MS/MS spectra of 5 32
33 4. C3 Marfey analysis (a) * (b) L-Glu D-Glu (c) L-Pro D-Pro ion abundance (d) L-Ile L-allo-Ile L-Leu D-allo-Ile D-Leu D-Ile (e) L-Val L-Iva L-Leuol D-Iva D-Val D-Leuol (f) Aib retention time (min) Figure S29. HPLC-DAD-MS spectrum extracted from a C 3 Marfey s method analysis of 50 g of 1 derivatized with L-FDAA: (a) UV (340 nm), where * = residue L-FDDA; (b) SIE (m/z 398) for L-FDAA- L-Glu; (c) SIE (m/z 366) for L-FDDA-L-Pro; (d) SIE (m/z 382) for L-FDAA-L-Ile and L-FDAA-L-Leu; (e) SIE (m/z 368) for L-FDAA-L-Val, L-FDAA-D-Iva, and L-FDAA-L-Leuol; (f) SIE (m/z 354) for L- FDAA-Aib. Note for (b)-(f) L-FDAA derivatives of authentic amino acid standards are also displayed (dotted line). 33
34 (a) * (b) L-Glu D-Glu (c) L-Pro D-Pro ion abandance (d) L-Leu L-Ile L-allo-Ile D-Leu D-allo-Ile D-Ile (e) L-Val L-Leuol D-Val D-Leuol (f) Aib retention time (min) Figure S30. HPLC-DAD-MS spectrum extracted from a C 3 Marfey s method analysis of 50 g of 2 derivatized with L-FDAA: (a) UV (340 nm), where * = residue L-FDDA; (b) SIE (m/z 398) for L-FDAA- L-Glu; (c) SIE (m/z 366) for L-FDAA-L-Pro; (d) SIE (m/z 382) for L-FDAA-L-Ile and L-FDAA-L-Leu; (e) SIE (m/z 368) for L-FDAA-L-Val and L-FDAA-L-Leuol; (f) SIE (m/z 354) for L-FDAA-Aib. Note for (b)-(f) L-FDAA derivatives of authentic amino acid standards are also displayed (dotted line). 34
35 (a) * (b) L-Glu D-Glu (c) L-Pro D-Pro ion abundance (d) L-Ile L-Leu L-allo-Ile D-Leu D-allo-Ile D-Ile (e) L-Val L-Iva D-Iva D-Val (f) L-Valol Aib D-Valol retention time (min) Figure S31. HPLC-DAD-MS spectrum extracted from a C 3 Marfey s method analysis of 50 g of 3 derivatized with L-FDAA: (a) UV (340 nm), where * = residue L-FDAA; (b) SIE (m/z 398) for L-FDAA- L-Glu; (c) SIE (m/z 366) for L-FDAA-L-Pro; (d) SIE (m/z 382) for L-FDAA-L-Ile and L-FDAA-L-Leu; (e) SIE (m/z 368) for L-FDAA-L-Val and L-FDAA-D-Iva; (f) SIE (m/z 354) for L-FDAA-Aib and L- FDAA-L-Valol. Note for (b)-(f) L-FDAA derivatives of authentic amino acid standards are also displayed (dotted line). 35
36 (a) * (b) L-Glu D-Glu (c) L-Pro D-Pro ion abundance (d) L-Ile L-Leu D-Leu D-Ile L-allo-Ile D-allo-Ile (e) L-Val D-Val (f) L-Valol Aib D-Valol retention time (min) Figure S32. HPLC-DAD-MS spectrum extracted from a C 3 Marfey s method analysis of 50 g of 4 derivatized with L-FDAA: (a) UV (340 nm), where * = residue L-FDAA; (b) SIE (m/z 398) for L-FDAA- L-Glu; (c) SIE (m/z 366) for L-FDAA-L-Pro; (d) SIE (m/z 382) for L-FDAA-L-Ile and L-FDAA-L-Leu; (e) SIE (m/z 368) for L-FDAA-L-Val; (f) SIE (m/z 354) for L-FDAA-Aib and L-FDAA-L-Valol. Note for (b)-(f) L-FDAA derivatives of authentic amino acid standards are also displayed (broken line). 36
37 ion abundance (a) * (b) L-Glu D-Glu (c) L-Pro D-Pro (d) L-Ile L-Leu D-Leu D-Ile L-allo-Ile D-allo-Ile (e) L-Val L-Iva D-Iva D-Val (f) L-Valol Aib D-Valol retention time (min) Figure S33. HPLC-DAD-MS spectrum extracted from a C 3 Marfey s method analysis of 50 g of 5 derivatized with L-FDAA: (a) UV (340 nm), where * = residue L-FDAA; (b) SIE (m/z 398) for L-FDAA- L-Glu; (c) SIE (m/z 366) for L-FDAA-L-Pro; (d) SIE (m/z 382) for L-FDAA-L-Ile and L-FDAA-L-Leu; (e) SIE (m/z 368) for L-FDAA-L-Val and L-FDAA-D-Iva; (f) SIE (m/z 354) for L-FDAA-Aib and L- FDAA-L-Valol. Note for (b)-(f) L-FDDA derivatives of authentic amino acid standards are also displayed (dotted line). 37
38 % cell viability % cell viability 5. Cytotoxicity assay 150 (a) DMSO (1%) doxorubicin (30 mm) 150 (b) DMSO (1%) doxorubicin (30 mm) Concentration (mm) Concentration (mm) Figure S34. Cytotoxicity assay of the trichodermides 1 5 against (a) NCI-H460 (lung cancer cell line) and (b) SW620 (human colon cancer cell line) 0 38
39 Absorbance at 600 nm Absorbance at 600 nm Absorbance at 600 nm Absorbance at 600 nm Absorbance at 600 nm Absorbance at 600 nm Absorbance at 600 nm 6. Antimicrobial assay Candida albicans ATCC Candida parapsilosis ATCC DMSO amphotericin B DMSO amphotericin B conc [µm] conc [µm] Candida krusei ATCC 6258 Bacillus subtilis ATCC DMSO amphotericin B DMSO rifampicin conc [µm] conc [µm] Staphylococcus aureus ATCC Escherichia coli ATCC DMSO rifampicin DMSO rifampicin conc [µm] conc [µm] Pseudomonas aeruginosa ATCC DMSO rifampicin conc [µm] Figure S35. Antimicrobial assay screening graphs of trichodermides A-E (1 5) and ampicillin and amphotericin served as controls for bacteria and fungi respectively, while DMSO served as positive control. Trichodermide A (1) showed MIC of 30 M. 39
SUPPORTING INFORMATION
SUPPORTING INFORMATION Heronamides A C, new polyketide macrolactams from an Australian marine-derived Streptomyces sp. A biosynthetic case for synchronized tandem electrocyclization. Ritesh Raju, Andrew
Malgorzata Korycka-Machala, Marcin Nowosielski, Aneta Kuron, Sebastian Rykowski, Agnieszka Olejniczak, Marcin Hoffmann and Jaroslaw Dziadek
Molecules 2017, 21, 154; doi:10.3390/molecules22010154 Supplementary Materials: Naphthalimides Selectively Inhibit the Activity of Bacterial, Replicative DNA Ligases and Display Bactericidal Effect against
Cyclic Cystine-Bridged Peptides from the Marine. Sponge Clathria basilana Induce Apoptosis in. Tumor Cells and Depolarize the Bacterial
Supporting information Cyclic Cystine-Bridged Peptides from the Marine Sponge Clathria basilana Induce Apoptosis in Tumor Cells and Depolarize the Bacterial Cytoplasmic Membrane Amin Mokhlesi,, Fabian
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Supporting Information. Research Center for Marine Drugs, Department of Pharmacy, State Key Laboratory
Supporting Information Dysiherbols A C and Dysideanone E, Cytotoxic and NF-κB Inhibitory Tetracyclic Meroterpenes from a Dysidea sp. Marine Sponge Wei-Hua Jiao,, Guo-Hua Shi,, Ting-Ting Xu,, Guo-Dong Chen,
A new ent-kaurane diterpene from Euphorbia stracheyi Boiss
SUPPLEMENTARY MATERIAL A new ent-kaurane diterpene from Euphorbia stracheyi Boiss Tie Liu a, Qian Liang a,b, Na-Na Xiong a, Lin-Feng Dai a, Jun-Ming Wang a,b, Xiao-Hui Ji c, Wen-Hui Xu a, * a Key Laboratory
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Natural Products Research Institute, College of Pharmacy, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Republic of Korea
Supporting Information Nicrophorusamides A and B, Antibacterial Chlorinated Cyclic Peptides from a Gut Bacterium of the Carrion Beetle Nicrophorus concolor Yern-Hyerk Shin, Suhyun Bae, Jaehoon Sim,,ǁ Joonseong
Eremophila spp. by Combined use of Dual High-Resolution PTP1B and α- Glucosidase Inhibition Profiling and HPLC-HRMS-SPE-NMR
Supporting Information for: Identification of PTP1B and α-glucosidase Inhibitory Serrulatanes from Eremophila spp. by Combined use of Dual High-Resolution PTP1B and α- Glucosidase Inhibition Profiling
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Supporting Information for. A New Diketopiperazine, Cyclo-(4-S-Hydroxy-R-Proline-R-Isoleucine), from an Australian Specimen of the Sponge
1 Supporting Information for A New Diketopiperazine, Cyclo-(4-S-Hydroxy-R-Proline-R-Isoleucine), from an Australian Specimen of the Sponge Stelletta Sp. Simon P. B. Ovenden, Jonathan L. Nielson, Catherine
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
New Cytotoxic Constituents from the Red Sea Soft Coral Nephthea sp.
SUPPLEMENTARY MATERIAL New Cytotoxic Constituents from the Red Sea Soft Coral Nephthea sp. Mohamed-Elamir F. Hegazy a,*, Amira M. Gamal-Eldeen b, Tarik A. Mohamed a, Montaser A. Alhammady c, Abuzeid A.
SUPPORTING INFORMATION
SUPPRTING INFRMATIN Per(-guanidino--deoxy)cyclodextrins: Synthesis, characterisation and binding behaviour toward selected small molecules and DNA. Nikolaos Mourtzis, a Kyriaki Eliadou, a Chrysie Aggelidou,
Supporting Information for. Update of spectroscopic data for 4-hydroxyldictyolactone and dictyol E isolated from a Halimeda stuposa - Dictyota
1 Supporting Information for Update of spectroscopic data for 4-hydroxyldictyolactone and dictyol E isolated from a Halimeda stuposa - Dictyota sp. Assemblage Simon P. B. Ovenden, Jonathan L. Nielson,
Highly enantioselective cascade synthesis of spiropyrazolones. Supporting Information. NMR spectra and HPLC traces
Highly enantioselective cascade synthesis of spiropyrazolones Alex Zea a, Andrea-Nekane R. Alba a, Andrea Mazzanti b, Albert Moyano a and Ramon Rios a,c * Supporting Information NMR spectra and HPLC traces
Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3
Supporting Information Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3 Shohei Shimokawa, Yuhsuke Kawagoe, Katsuhiko Moriyama, Hideo Togo* Graduate
Supporting Information
Supporting Information Synthesis and Electroactive Properties of Poly(amidoamine) Dendrimers with an Aniline Pentamer Shell Wei-I Hung a, Chih-Bing Hung a, Ya-Han Chang a, Jiun-Kuang Dai a, Yan Li b, Hai
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2015 Supporting Information New PKS-NRPS tetramic acids and pyridinone from
SUPPLEMENTARY MATERIAL
10.1071/CH16014_AC The Authors 2016 Australian Journal of Chemistry 2016, 69(9), 1049-1053 SUPPLEMENTARY MATERIAL A Green Approach for the Synthesis of Novel 7,11-Dihydro-6H-chromeno[3,4- e]isoxazolo[5,4-b]pyridin-6-one
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Supporting Information
Supporting Information for Lewis acid-catalyzed redox-neutral amination of 2-(3-pyrroline-1-yl)benzaldehydes via intramolecular [1,5]-hydride shift/isomerization reaction Chun-Huan Jiang, Xiantao Lei,
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
Room Temperature Highly Diastereoselective Zn-Mediated. Allylation of Chiral N-tert-Butanesulfinyl Imines: Remarkable Reaction Condition Controlled
Supporting Information for: Room Temperature Highly Diastereoselective Zn-Mediated Allylation of Chiral N-tert-Butanesulfinyl Imines: Remarkable Reaction Condition Controlled Stereoselectivity Reversal
Depsidomycins B and C: New Cyclic Peptides from a Ginseng Farm Soil-derived Actinomycete.
Supporting Information Depsidomycins B and C: ew Cyclic Peptides from a Ginseng Farm Soil-derived Actinomycete. Yun Kwon 1, Woong Sub Byun 1, Byung-Yong Kim 2, Myoung Chong Song 3, Munhyung Bae 1, Yeo
Enantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Enantioselective Organocatalytic Michael Addition of Isorhodanines to α,
Phenylpropanoids, Sesquiterpenoids and Flavonoids from Pimpinella tragium Vill. subsp. lithophila (Schischkin) Tutin
Supporting Information Rec. Nat. Prod. 10:2 (2016) 207-213 Phenylpropanoids, Sesquiterpenoids and Flavonoids from Pimpinella tragium Vill. subsp. lithophila (Schischkin) Tutin Hilal Özbek 1, Zühal Güvenalp
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Supporting Information. Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 16 Supporting Information Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Synthesis, structural studies and stability of the model, cysteine containing DNA-protein cross-links
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2017 ELECTRONIC SUPPLEMENTARY INFORMATION
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Electronic Supporting Information. 3-Aminothiophenecarboxylic acid (3-Atc)-induced folding in peptides
Electronic Supplementary Material (ESI for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2016 Electronic Supporting Information
Supporting information
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 204 Supporting information Palladium nanoparticles supported on triazine functionalised mesoporous
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Electronic Supplementary Information
Electronic Supplementary Information NbCl 3 -catalyzed [2+2+2] intermolecular cycloaddition of alkynes and alkenes to 1,3-cyclohexadiene derivatives Yasushi Obora,* Keisuke Takeshita and Yasutaka Ishii*
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Syntheses and structures of copper complexes of
and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol
FeCl 3 6H 2 O-Catalyzed Disproportionation of Allylic Alcohols and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol Jialiang Wang, Wen Huang, Zhengxing Zhang, Xu
The effect of curcumin on the stability of Aβ. dimers
The effect of curcumin on the stability of Aβ dimers Li Na Zhao, See-Wing Chiu, Jérôme Benoit, Lock Yue Chew,, and Yuguang Mu, School of Physical and Mathematical Sciences, Nanyang Technological University,
Heterobimetallic Pd-Sn Catalysis: Michael Addition. Reaction with C-, N-, O-, S- Nucleophiles and In-situ. Diagnostics
Supporting Information (SI) Heterobimetallic Pd-Sn Catalysis: Michael Addition Reaction with C-, N-, -, S- Nucleophiles and In-situ Diagnostics Debjit Das, a Sanjay Pratihar a,b and Sujit Roy c * a rganometallics
Structure-Metabolism-Relationships in the microsomal clearance of. piperazin-1-ylpyridazines
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2017 Structure-Metabolism-Relationships in the microsomal clearance of piperazin-1-ylpyridazines
Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran
1 Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran Munawar Hussain, a Rasheed Ahmad Khera, a Nguyen Thai Hung, a Peter Langer* a,b a Institut für Chemie, Universität Rostock,
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
Electronic Supplementary Information. Carbon dioxide as a reversible amine-protecting
Electronic Supplementary Information Carbon dioxide as a reversible amine-protecting agent in selective Michael additions and acylations Annelies Peeters, Rob Ameloot and Dirk E. De Vos * Centre for Surface
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
C H Activation of Cp* Ligand Coordinated to Ruthenium. Center: Synthesis and Reactivity of a Thiolate-Bridged
Supporting Information C H Activation of Cp* Ligand Coordinated to Ruthenium Center: Synthesis and Reactivity of a Thiolate-Bridged Diruthenium Complex Featuring Fulvene-like Cp* Ligand Xiaoxiao Ji, Dawei
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions
This journal is The Royal Society of Chemistry 213 Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions Wenjing Cui, a Bao Zhaorigetu,* a Meilin Jia, a and Wulan
Supporting Information. Experimental section
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information Experimental section General. Proton nuclear magnetic resonance ( 1
Electronic Supplementary Information
Electronic Supplementary Information Cucurbit[7]uril host-guest complexes of the histamine H 2 -receptor antagonist ranitidine Ruibing Wang and Donal H. Macartney* Department of Chemistry, Queen s University,
Supporting Information
Supporting Information Molecular Cage Impregnated Palladium Nanoparticles: Efficient, Additive-Free Heterogeneous Catalysts for Cyanation of Aryl Halides. Bijnaneswar Mondal, Koushik Acharyya, Prodip Howlader
Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based
Supporting Information. Route to benzo- and pyrido-fused 1,2,4-triazinyl radicals via N'-(het)aryl- N'-[2-nitro(het)aryl]hydrazides
![Supporting Information. Route to benzo- and pyrido-fused 1,2,4-triazinyl radicals via N'-(het)aryl- N'-[2-nitro(het)aryl]hydrazides](/thumbs/93/112488784.jpg "Supporting Information. Route to benzo- and pyrido-fused 1,2,4-triazinyl radicals via N'-(het)aryl- N'-[2-nitro(het)aryl]hydrazides")
Supporting Information Route to benzo- and pyrido-fused 1,2,4-triazinyl radicals via N'-(het)aryl- N'-[2-nitro(het)aryl]hydrazides Andrey A. Berezin, Georgia Zissimou, Christos P. Constantinides, Yassine
The Sponge-Derived Fijianolide Polyketide Class: Further Evaluation of Their Structural and Cytotoxicity Properties
The Sponge-Derived Fijianolide Polyketide Class: Further Evaluation of Their Structural and Cytotoxicity Properties Tyler A. Johnson, Karen Tenney, Robert H. Cichewicz, Brandon I. Morinaka, Kimberly N.
Supplementary Materials: Development of Amyloseand β-cyclodextrin-based Chiral Fluorescent Sensors Bearing Terthienyl Pendants
S1 of S12 Supplementary Materials: Development of Amyloseand β-cyclodextrin-based Chiral Fluorescent Sensors Bearing Terthienyl Pendants Tomoyuki Ikai, Changsik Yun, Yutaka Kojima, Daisuke Suzuki, Katsuhiro
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3
Supplementary Information Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3 Lewis Pairs: Structures of Intermediates, Kinetics, and Mechanism Qianyi Wang, Wuchao Zhao,
Rudi Hendra 1, Paul A. Keller 1* Telephone: Fax:
Supporting Information for Phytochemical Studies on Two Australian Anigozanthos Plant Species Rudi Hendra 1, Paul A. Keller 1* 1 School of Chemistry, University of Wollongong, NSW 2522, Australia Telephone:
Phosphorus Oxychloride as an Efficient Coupling Reagent for the Synthesis of Ester, Amide and Peptide under Mild Conditions
Supplementary Information for Phosphorus xychloride as an Efficient Coupling Reagent for the Synthesis of Ester, Amide and Peptide under Mild Conditions u Chen,* a,b Xunfu Xu, a Liu Liu, a Guo Tang,* a
Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes
1 Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes Gonzalo Blay, Isabel Fernández, Alícia Marco-Aleixandre, and José R. Pedro Departament de Química Orgànica, Facultat de Química,
Selective mono reduction of bisphosphine
Griffith Research Online https://research-repository.griffith.edu.au Selective mono reduction of bisphosphine oxides under mild conditions Author etersson, Maria, Loughlin, Wendy, Jenkins, Ian ublished
Design and Solid Phase Synthesis of New DOTA Conjugated (+)-Biotin Dimers Planned to Develop Molecular Weight-Tuned Avidin Oligomers
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2015 Supplementary Information Design and Solid Phase Synthesis of New DTA Conjugated
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Synthesis of novel 1,2,3-triazolyl derivatives of pregnane, androstane and D-homoandrostane. Tandem Click reaction/cu-catalyzed D-homo rearrangement
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting Information Synthesis of novel 1,2,3-triazolyl derivatives of
Supporting Information for
Supporting Information for An atom-economic route to densely functionalized thiophenes via base-catalyzed rearrangement of 5-propargyl-2H-thiopyran-4(3H)-ones Chunlin Tang a, Jian Qin b, Xingqi Li *a a
Supporting Information
Supporting Information Copper/Silver Cocatalyzed Oxidative Coupling of Vinylarenes with ICH 2 CF 3 or ICH 2 CHF 2 Leading to β-cf 3 /CHF 2 -Substituted Ketones Niannian Yi, Hao Zhang, Chonghui Xu, Wei
Supporting information. Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene
Supporting information Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene M. N. Chan 1, J. D. Surratt 2,*, A. W. H. Chan 2,**, K. Schilling 2, J.
Table of Contents 1 Supplementary Data MCD
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2017 Supporting Information for Magnetic circular dichroism and density functional theory
The Free Internet Journal for Organic Chemistry
The Free Internet Journal for Organic Chemistry Paper Archive for Organic Chemistry Arkivoc 2018, part iii, S1-S6 Synthesis of dihydropyranones and dihydropyrano[2,3- d][1,3]dioxine-diones by cyclization
Chemical Constituents and Antioxidant Activity of Teucrium barbeyanum Aschers.
Supporting Information Rec. Nat. Prod. 9:1 (2015) 159-163 Chemical Constituents and Antioxidant Activity of Teucrium barbeyanum Aschers. Mohamed Ali A. Alwahsh, Melati Khairuddean * and Wong Keng Chong
Supporting Information
Supporting Information Ceric Ammonium Nitrate (CAN) catalyzed efficient one-pot three component aza-diels-alder reactions for a facile synthesis of tetrahydropyranoquinoline derivatives Ravinder Goud Puligoundla
Supporting Information. Microwave-assisted construction of triazole-linked amino acid - glucoside conjugates as novel PTP1B inhibitors
Supporting Information Microwave-assisted construction of triazole-linked amino acid - glucoside conjugates as novel PTP1B inhibitors Xiao-Peng He, abd Cui Li, d Xiao-Ping Jin, b Zhuo Song, b Hai-Lin Zhang,
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Silver or Cerium-Promoted Free Radical Cascade Difunctionalization
Divergent synthesis of various iminocyclitols from D-ribose
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 205 Divergent synthesis of various iminocyclitols from D-ribose Ramu Petakamsetty,
Characteristic Fluctuations in Glycosidically Bound Volatiles during Tea Processing and
Characteristic Fluctuations in Glycosidically Bound Volatiles during Tea Processing and Identification of Their Unstable Derivatives Jilai Cui a,b, Tsuyoshi Katsuno c, Kojiro Totsuka d, Toshiyuki Ohnishi
phase: synthesis of biaryls, terphenyls and polyaryls
Supporting Information for Studies on Pd/NiFe 2 O 4 catalyzed ligand-free Suzuki reaction in aqueous phase: synthesis of biaryls, terphenyls and polyaryls Sanjay R. Borhade and Suresh B. Waghmode* Address:
Patrycja Miszczyk, Dorota Wieczorek, Joanna Gałęzowska, Błażej Dziuk, Joanna Wietrzyk and Ewa Chmielewska. 1. Spectroscopic Data.
; doi:10.3390/molecules22020254 S1 of S23 Supplementary Materials: Reaction of 3-Amino-1,2,4-Triazole with Diethyl Phosphite and Triethyl Orthoformate: Acid-Base Properties and Antiosteoporotic Activities
Supporting information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting information Copper-catalysed intramolecular O-arylation: a simple
Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information
![Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information](/thumbs/64/50937700.jpg "Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information")
Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans Liang Yun, Shi Tang, Xu-Dong Zhang, Li-Qiu Mao, Ye-Xiang Xie and Jin-Heng Li* Key Laboratory
Direct Palladium-Catalyzed Arylations of Aryl Bromides. with 2/9-Substituted Pyrimido[5,4-b]indolizines
![Direct Palladium-Catalyzed Arylations of Aryl Bromides. with 2/9-Substituted Pyrimido[5,4-b]indolizines](/thumbs/87/95187440.jpg "Direct Palladium-Catalyzed Arylations of Aryl Bromides. with 2/9-Substituted Pyrimido[5,4-b]indolizines")
Direct Palladium-Catalyzed Arylations of Aryl Bromides with 2/9-Substituted Pyrimido[5,4-b]indolizines Min Jiang, Ting Li, Linghua Meng, Chunhao Yang,* Yuyuan Xie*, and Jian Ding State Key Laboratory of
Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2007
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2007 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for High-Throughput Substrate
Pyrrolo[2,3-d:5,4-d']bisthiazoles: Alternate Synthetic Routes and a Comparative Study to Analogous Fused-ring Bithiophenes
![Pyrrolo[2,3-d:5,4-d']bisthiazoles: Alternate Synthetic Routes and a Comparative Study to Analogous Fused-ring Bithiophenes](/thumbs/92/108867714.jpg "Pyrrolo[2,3-d:5,4-d']bisthiazoles: Alternate Synthetic Routes and a Comparative Study to Analogous Fused-ring Bithiophenes")
SUPPORTING INFORMATION Pyrrolo[2,3-d:5,4-d']bisthiazoles: Alternate Synthetic Routes and a Comparative Study to Analogous Fused-ring Bithiophenes Eric J. Uzelac, Casey B. McCausland, and Seth C. Rasmussen*
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
Supporting Information
Chloromethylhalicyclamine B, a Marine-Derived Protein Kinase CK1δ/ε Inhibitor Germana Esposito, Marie-Lise Bourguet-Kondracki, * Linh H. Mai, Arlette Longeon, Roberta Teta, Laurent Meijer, Rob Van Soest,
Supporting Information
Supporting Information Aluminum Complexes of N 2 O 2 3 Formazanate Ligands Supported by Phosphine Oxide Donors Ryan R. Maar, Amir Rabiee Kenaree, Ruizhong Zhang, Yichen Tao, Benjamin D. Katzman, Viktor
Discovery of multi-target receptor tyrosine kinase inhibitors as novel anti-angiogenesis agents
Discovery of multi-target receptor tyrosine kinase inhibitors as novel anti-angiogenesis agents Jinfeng Wang, Lin Zhang, Xiaoyan Pan, Bingling Dai, Ying Sun, Chuansheng Li, Jie Zhang School of Pharmacy,
Regioselectivity in the Stille coupling reactions of 3,5- dibromo-2-pyrone.
Regioselectivity in the Stille coupling reactions of 3,5- dibromo-2-pyrone. Won-Suk Kim, Hyung-Jin Kim and Cheon-Gyu Cho Department of Chemistry, Hanyang University, Seoul 133-791, Korea Experimental Section
Supporting Information. Partial thioamide scan on the lipopeptaibiotic trichogin GA IV. Effects on
Supporting Information for Partial thioamide scan on the lipopeptaibiotic trichogin GA IV. Effects on folding and bioactivity Marta De Zotti 1, Barbara Biondi 1, Cristina Peggion 1, Matteo De Poli 1, Haleh
Molecular evolutionary dynamics of respiratory syncytial virus group A in
Molecular evolutionary dynamics of respiratory syncytial virus group A in recurrent epidemics in coastal Kenya James R. Otieno 1#, Charles N. Agoti 1, 2, Caroline W. Gitahi 1, Ann Bett 1, Mwanajuma Ngama
Photo-Induced Self-Assembly of Pt(II)-Linked Rings and Cages via the Photolabilization of a Pt(II) Pyridine Bond
Photo-Induced Self-Assembly of Pt(II)-Linked Rings and Cages via the Photolabilization of a Pt(II) Pyridine Bond Ken-ichi Yamashita, Kei-ichi Sato, Masaki Kawano and Makoto Fujita* Contents; Figure S1.
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Supporting Information
Supporting Information Montmorillonite KSF-Catalyzed One-pot, Three-component, Aza-Diels- Alder Reactions of Methylenecyclopropanes With Arylaldehydes and Aromatic Amines Li-Xiong Shao and Min Shi* General
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo