Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 ΕΡΩΤΗΜΑ Μπορούν περιβαλλοντικοί παράγοντες όπως η διατροφή και η μητρική στοργή να προκαλέσουν επιγενετικές μεταβολές στο DNA και να αλλάξουν τη γονιδιακή έκφραση σε γενετικά δίδυμους οργανισμούς οδηγώντας τελικά σε διαφορετικό φαινότυπο;

3 Cell Division Parent Cell Prophase Chromosomes align at the equatorial (metaphase) plate Metaphase (Centromeres divide) Sister chromatids separate during anaphase, becoming chromosomes Two Daughter Cells



6 Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome

7 DNA Double Helix

8 DNA Structure Hydrogen Bonds Cytosine Adenine Thymine Guanine Deoxyribose (Sugar molecule) Phosphoric Acid (Phosphate molecule)

9 Deoxyribose and Phosphoric Acid Deoxyribose Phosphoric Acid

10 Adenine Guanine Cytosine Thymine

11 The Nucleotide Sequence Hydrogen Bonds Cytosine (C) Adenine (A) Thymine (T) Guanine (G) Guanine (G) Thymine (T) Adenine (A) Cytosine (C) Deoxyribose (Sugar molecule) Phosphoric Acid (Phosphate molecule)

12 5 to 3 Orientation of the Sugar - Phosphate Backbone 5 end 3 end

13 Bonding of Base, Sugar and Phosphate Groups Phosphate Molecule 5 Deoxyribose Sugar Molecule Bases Hydrogen Bonds Sugar-Phosphate Backbone

14 Μοριακές Τεχνικές Αντιγραφή του DNA

15 Μοριακές Τεχνικές Μεταγραφή και Μετάφραση του DNA

16 Μοριακές Τεχνικές 2000-: Αποκρυπτογράφηση ανθρώπινου γονιδιώματος : Επανάσταση στη μεθοδολογία : Εμφάνιση των πρώτων τεχνικών ανάλυσης του DNA : χαρακτηρισμός, απομόνωση και χειρισμός DNA, RNA και πρωτεΐνες

17 Μοριακές Τεχνικές Αλυσιδωτή αντίδραση πολυμεράσης (Polymerase chain reaction PCR) 1985 Kary Mullis Nobel Χημείας 1993


19 Όλα τα συστατικά της συνταγής ήταν γνωστά στην επιστημονική κοινότητα. Κανείς όμως μέχρι εκείνη τη στιγμή δεν τα είχε συνδυάσει όπως τα συνδύασε ο Mullis. Για 4 μήνες κανείς στην εταιρεία δεν αξιολόγησε σοβαρά τη σκέψη του και μάλιστα το περιοδικό Science με ευθύνη του εκδότη του Dan Koshland απέρριψε το πρώτο paper με τη τεχνική PCR που έστειλε ο Mullis προς δημοσίευση. Τρία χρόνια αργότερα όταν η PCR ανακηρύχτηκε «Molecule Of The Year» o Dan Koshland εξακολουθούσε να είναι ο εκδότης του περιοδικού Science.

20 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ 1. DNA DENATURATION (ΑΠΟΔΙΑΤΑΞΗ) 94 ο C. 30 sec Όταν το DNA θερμαίνεται η διπλή έλικα αρχίζει να «χωρίζει» και το φαινόμενο αυτό αναφέρεται ως τήξη (melting). Από τη στιγμή που το ζεύγος Α=Τ ενώνεται με δύο δεσμούς υδρογόνου, σε αντίθεση με το ζεύγος C G που ενώνεται με τρείς, περιοχές του DNA με μεγάλη συγκέντρωση Α και Τ θα διαχωριστούν πρώτες.

21 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ Η θερμοκρασία κατά την οποία το μισό DNA είναι πλέον μονόκλωνο ονομάζεται melting temperature (Tm).

22 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ H Tm των μορίων DNA δεν είναι ίδια και εξαρτάται 1) Από το μήκος της αλυσίδας DNA 2) Από την αναλογία βάσεων Α,Τ,C,G που περιέχει Tm = 16,5 (log [Na + ]) (%GC) + 81,5 ο C Για μικρά μόρια DNA (15-30) βάσεων η Τm = 2(A+T) + 4(G+C), Wallace rule Έτσι μια μονόκλωνη αλυσίδα DNA 20 βάσεων με 5Α, 6Τ, 3C και 6G θα έχει Τm: Τm = 2(5 Α + 6 Τ ) + 4(3 C + 6 G ) = 58 ο C.

23 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ 2. DNA ANNEALING (ΕΠΑΝΑΔΙΑΤΑΞΗ ΥΒΡΙΔΙΣΜΟΣ ΕΚΚΙΝΗΤΩΝ ΜΕ ΤΙΣ ΜΟΝΟΚΛΩΝΕΣ ΑΛΥΣΙΔΕΣ DNA) 45 ο - 60 ο C. Απαιτεί δύο εκκινητές (PRIMERS) μήκους βάσεων που μαρκάρουν (FLANK) τον στόχο DNA που θέλουμε να αντιγραφεί και των οποίων τα 3 άκρα πρέπει να είναι αντικρυστά.

24 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ 3.DNA EXTENSION (ΕΠΙΜΗΚΥΝΣΗ) 72 Ο C. Δράση της DNA πολυμεράσης σε περιβάλλον περίσσειας των τεσσάρων φωσφορικών δεοξυριβονουκλεοτιδίων έχει σαν αποτέλεσμα την επιμήκυνση των εκκινητών με κατεύθυνση 5 3 και σύνθεση συμπληρωματικής ως προς τη μητρική, νέας αλυσίδας DNA με ταχύτητα αύξησης αλυσίδας ζεύγη βάσεων ανά λεπτό.


26 ΕΝΙΣΧΥΣΗ ΑΛΛΗΛΟΥΧΙΑΣ - ΣΤΟΧΟΥ 1 cycle = 2 Amplicon 2 cycle = 4 Amplicon 3 cycle = 8 Amplicon 4 cycle = 16 Amplicon 5 cycle = 32 Amplicon 6 cycle = 64 Amplicon 7 cycle = 128 Amplicon ΚΥΚΛΟΙ PCR ΠΛΗΘΟΣ ΑΝΤΙΓΡΑΦΩΝ ΑΛΛΗΛΟΧΙΑΣ ΣΤΟΧΟΥ



29 PCR HIGHLIGHTS DNA ΠΟΛΥΜΕΡΑΣΗ Στα πρώτα πειράματα PCR χρησιμοποιήθηκε DNA pol I (Klenow fragment) μη θερμοανθεκτική ανάγκη προσθήκης νέου ενζύμου σε κάθε κύκλο PCR. Με τη χρήση Taq DNA πολυμεράσης, προερχόμενη από το θερμόφιλο βακτήριο Thermus aquaticus (Lawyer et al 1989) η PCR αυτοματοποιείται αφού η Taq πολυμεράση αντέχει έως και 94 ο C ενώ παρουσιάζει βέλτιστη λειτουργικότητα στους 72 o C. Η υψηλή θερμοκρασία στην οποία γίνεται η αντίδραση της επιμήκυνσης των νεοσυντιθέμενων αλυσίδων εξασφαλίζει ότι η ειδικότητα κατά τον υβριδισμό των primers δεν υπόκειται σε συμβιβασμό. Η Taq πολυμεράση έχει βέλτιστη δράση στους 74 ο C και παραμένει λειτουργική έως και τους 95 ο C. Το ένζυμο έχει δράση 5 3 πολυμεράσης Το ένζυμο έχει δράση 5 3 εξωνουκλεάσης ΣΤΕΡΕΙΤΑΙ δράσης 3 5 εξωνουκλεάσης ΣΤΕΡΕΙΤΑΙ proofreading activity

30 PCR HIGHLIGHTS Proofreading activity Αν μια βάση εισαχθεί λάθος κατά την επιμήκυνση της πολυνουκλεοτιδικής αλυσίδας δεν μπορεί να απομακρυνθεί. Αυτό ευνοεί την εισαγωγή σημειακών μεταλλάξεων στο PCR προϊόν. Η συχνότητα λάθους είναι 1 βάση κάθε βάσεις. Εάν ένα μόριο DNA μήκους 1 kb πολλαπλασιασθεί με PCR 25 κύκλων το 10% του προϊόντος περιέχει μεταλλάξεις. Εάν η PCR πραγματοποιείται για τον έλεγχο της παρουσίας ή απουσίας ενός τμήματος γονιδίου πρακτικά η επιτυχία της αντίδρασης δεν επηρεάζεται. Η Taq πολυμεράση προσθέτει συνήθως ένα παραπάνω μόριο (συνήθως A) στο 3 άκρο της νεοσυντιθέμενης αλυσίδας (ελεύθερο κατάλοιπο). Χρήση άλλων πολυμερασών όπως η Pfu πολυμεράση με δραστικότητα 3 5 εξωνουκλεάσης θα περιορίσει το λανθασμένο προϊόν PCR για DNA 1kb σε 0,1% περίπου. Η δραστικότητα 5 3 πολυμεράσης μπορεί να οδηγήσει σε σχηματισμό primer dimmer και πολλαπλασιασμό τους κατά την άνοδο της θερμοκρασίας στη φάση που οδηγεί στο Denaturation.

31 PCR HIGHLIGHTS DNA ΠΟΛΥΜΕΡΑΣΗ ΛΥΣΕΙΣ 1. Τοποθέτηση της πολυμεράσης στην αντίδραση όχι εξ αρχής αλλά στη θερμοκρασία των 94 ο C. (HotStart Polymerase). 2. Ένωση της πολυμεράσης με αντίσωμα που καθιστά το ένζυμο ανενεργό σε χαμηλές θερμοκρασίες. Σε υψηλή θερμοκρασία (94ο C) το αντίσωμα καταστρέφεται η Taq απελευθερώνεται και καθίσταται ενεργή. 3. Κάλυψη των primers με πρωτεΐνη/ες που θα καταστραφεί/ούν στην υψηλή θερμοκρασία.

32 PCR HIGHLIGHTS Ολιγονουκλεοτιδικοί εκκινητές (primers) Η επιτυχία ενός πειράματος PCR εξαρτάται κυρίως από τη σχεδίαση των εκκινητών.

33 PCR HIGHLIGHTS Ολιγονουκλεοτιδικοί εκκινητές (primers) 1.Μήκος νουκλεοτίδια εξασφαλίζει μοναδικότητα υβριδισμού με μονή αλληλουχία DNA μέσα στο γένωμα ( ) συνδυασμοί βάσεων. 2. Περιεκτικότητα σε C,G κατα 50%. 3. Η θερμοκρασία υβριδισμού των 2 primers πρέπει να είναι παραπλήσια. 4. Αλληλουχίες επαναλαμβανόμενου νουκλεοτιδίου αποφεύγονται γιατί οδηγούν σε υβριδισμό μη ειδικό σε άλλες περιοχές του DNA. 5.Το κάθε primer δεν πρέπει να περιέχει αλληλουχίες συμπληρωματικές στα άκρα του διότι μπορεί να υβριδισθούν (hair pin structure) π.χ. 5 GAGATCGATGCATCGAATCTC 3

34 PCR HIGHLIGHTS Ολιγονουκλεοτιδικοί εκκινητές (primers) 6. Δεν πρέπει να υπάρχει συμπληρωματικότητα μεταξύ των 2 primers διότι οδηγούμαστε σε primer dimmer που θα πολλαπλασιασθούν στους κύκλους της PCR. Primer A Primer B Τα primers που χρησιμοποιούνται δεν χρειάζεται κατ ανάγκη να είναι απόλυτα συμπληρωματικά με την αλυσίδα στόχο. Η μόνη βάση σε μια αλληλουχία βάσεων του primer που υποχρεωτικά πρέπει να είναι συμπληρωματικά με τη βάση της μητρικής αλυσίδας είναι αυτή στο 3 άκρο του primer. Εάν αυτό δεν επιτευχθεί η πολυμεράση δεν θα επιμηκύνει την αλυσίδα.

35 RT - PCR RT PCR Το ένζυμο αντίστροφη μεταγραφάση χρησιμοποιεί ένα συμπληρωματικό ολιγονουκλεοτίδιο για να ξεκινήσει την σύνθεση DNA από ένα μόριο RNA. Η μονόκλωνη αλυσίδα του DNA που παράγεται χρησιμοποιείται σαν «μητρική» για την σύνθεση και μιας δεύτερης αλυσίδας DNA και μετά για ενίσχυση χρησιμοποιώντας την PCR.

36 Τα προϊόντα PCR αναλύονται σε μια ξεχωριστή διαδικασία που πραγματοποιείται μετά το τέλος της PCR. Ονομάζουμε αυτό το είδος της ανάλυσης «end-point analysis» (διότι συνήθως πραγματοποιείται μετά από κύκλους PCR). Η end-point analysis χρησιμοποιείται συνήθως για ποιοτική ανάλυση και σπανίως για ημιποσοτική. Ηλεκτροφόρηση σε πήκτωμα αγαρόζης (gel electrophoresis) χρησιμοποιείται συνήθως για να τεκμηριώσει την ύπαρξη ή την απουσία συγκεκριμένου προϊόντος, του μεγέθους του και της καθαρότητας του. Το αιθίδιο του βρωμίου (ethidium bromide) είναι η φθορίζουσα χρωστική που χρησιμοποιούμε συνήθως για την ανίχνευση του προϊόντος στο gel. Εάν έχουμε χρησιμοποιήσει στην PCR primers σημασμένους π.χ. με βιοτίνη τότε μπορούμε να υβριδίσουμε το προϊόν της PCR με καθηλωμένους συμπληρωματικά της DNA αλληλουχίας probes (ανιχνευτές) και με τη χρήση στρεπταβιδίνης να οπτικοποιήσουμε την παραγωγή ή όχι σήματος.


38 HPV 16 HPV 31 high -globin low -globin HPV 11 LINEAR ARRAY HPV Genotyping Test Overview globin NaOH denaturant HPV genome PCR dntps, MgCl 2, AmpliTaq Gold biotin-labeled PGMY primers biotin-labeled B_PC04/B_GH20 primers Add denatured PCR product to probe strip in hybridization buffer HPV positive sample result wash enzyme conjugate wash color development reference line BSA-conjugated oligonucleotide probes (Gravitt, et al. J. Clin. Micro. 36: )

39 LINEAR ARRAY HPV Genotyping Test ΥΒΡΙΔΙΣΜΟΣ Biotin Linear Array + Amplicon Υβριδισμός του βιοτινυλιωμένου κωδικονίου (amplicon) με τα ακινητοποιημένα ειδικά ολιγονουκλεοτίδια (probes) Probe

40 LINEAR ARRAY HPV Genotyping Test ΑΝΙΧΝΕΥΣΗ Προσθήκη Streptavidin- Horseradish Peroxidase Conjugate + Horseradish Peroxidase Streptavidin Χρωματισμός με καθίζηση ΤΜΒ + Υπεροξείδιο TMB + H 2 O 2 Θετικό σήμα: μπλέ γραμμή TMB

41 LINEAR ARRAY HPV Genotyping Test ΕΡΜΗΝΕΙΑ ΑΠΟΤΕΛΕΣΜΑΤΩΝ HPV Strip Reference Guide Reference Line Reference Line GT 16 GT 18 GT 31 GT 45 Numerical order of genotypes Low beta Globin Control High beta Globin Control Low Globin Control High Globin Control

42 Selective Amplification using AmpErase Specimen/Target DNA Unmodified Specimen/Target DNA AmpErase Carry-Over Amplicon DNA Inactivated Amplicon DNA Unmodified Specimen/Target DNA Heat, Alkaline ph Inactivated AmpErase enzyme Inactivated Amplicon DNA


44 Real Time PCR Η end-point αναλυση δεν προσφέρεται για ποσοτική PCR διότι παρέχει πληροφορία στην φάση «plateau» όπου πλέον η αντίδραση δεν μπορεί να περιγραφεί με μαθηματική φόρμουλα. Δεν μπορούμε να συσχετίσουμε άμεσα το σήμα της end-point ανάλυσης με τη συνολική ποσότητα του DNA στόχου που είχαμε αρχικά στην αντίδραση. Κινητική της αντίδρασης PCR Τελική φάση της αντίδρασης (plateau) Φάση της εκθετικής αύξησης (log phase) Σημείο έναρξης της εκθετικής αύξησης Αρχική φάση αύξησης (background)

45 Αρχή της Real-time PCR Είναι η διαδικασία ενίσχυσης μιας DNA αλληλουχίας με τη μέθοδο της Αλυσιδωτής Αντίδρασης της Πολυμεράσης (PCR) και ταυτόχρονα της ανίχνευσης του παραγόμενου προϊόντος σε πραγματικό χρόνο καθ όλη τη διάρκεια της αντίδρασης (Real-time PCR), μέσω της χρήσης ειδικών φθοριζόντων χρωστικών που ενσωματώνονται στην αλληλουχία που ενισχύεται.

46 ΦΘΟΡΙΖΟΥΣΕΣ ΧΡΩΣΤΙΚΕΣ Ετεροκυκλικοί ή πολυαρωματικοί υδρογονάνθρακες. Fluorescein Hex


48 LightCycler, PCR πραγματικού χρόνου Βασικές εφαρμογές Ποσοτικοποίηση και ποιοτική ανίχνευση Ανίχνευση μεταλλάξεων Χαρακτηρισμός προϊόντων

49 Real Time PCR Ανίχνευση του σήματος φθορισμού Το σημείο κατά το οποίο το κάθε δείγμα εισέρχεται στην εκθετική φάση της αντίδρασης, ορίζεται ως το «κατώφλι» μεταβολής του ρυθμού αύξησης της συγκέντρωσης του παραγόμενου προϊόντος (Threshold Cycle ή CT), είναι στατιστικά σημαντική και ανιχνεύεται ως σήμα φθορισμού. Η μεταβολή αυτή της συγκέντρωσης γίνεται σε συγκεκριμένο κύκλο και εξαρτάται απόλυτα από την αρχική συγκέντρωση του κάθε δείγματος.

50 Norm Fluorescence Growth Curve Variation 35,0 30,0 25,0 20,0 15,0 10,0 5,0 0,0 Quenching Efficiency Quantum Yield Ct Cycles Competition Primer Dimer Run out Probes Probe Concentration Target Concentratio n Run out Primer Target Concentration Run out Enzyme Quantum Yield Roche Molecular Diagnostics Version 2.0 September 2006

51 Έννοια της καμπύλης αναφοράς με βάση την κινητική της αντίδρασης της PCR Παράδειγμα Ενισχύουμε με την PCR τρία δείγματα συγκεντρώσεων, 10 6, 10 5 και 10 4 αντιγράφων. Όπως αναμένεται, όσο λιγότερα αντίγραφα περιέχονται στο δείγμα, τόσο περισσότεροι κύκλοι απαιτούνται για να εισέλθει η αντίδραση στην εκθετική της φάση και να ανιχνευθεί το παραγόμενο σήμα που αντιστοιχεί στην μεταβολή του ρυθμού αύξησης της συγκέντρωσης του παραγόμενου

52 Crossing Point (Cycles) Βασική Αρχή Ποσοτικοποίησης στο LightCycler Άγνωστο δείγμα N (copy number) Target N Cp Cp Cycles Καμπύλη αναφοράς (standard curve) N Cp Αγνωστο δείγμα! Cycles log (copy number)

53 Real Time PCR Όλα τα συστήματα real time που ανιχνεύουν και αξιολογούν τα προϊόντα της PCR βασίζονται στην ανίχνευση φθοριζουσών χρωστικών και στη συσχέτιση της έντασης του παραγόμενου σήματος φθορισμού με την ποσότητα του προϊόντος της PCR στην αντίδραση. Οι πλέον διαδεδομένες μέθοδοι real time χωρίζονται σε δύο κατηγορίες: 1) Sequence independent detection assays 2) Sequence specific probe binding assays

54 1. Sequence independent detection assay (2 primers 1 φθορίζουσα ελεύθερη ουσία) Αποδιάταξη Επανασύνδεση Επιμήκυνση Τέλος επιμήκυνσης Βασίζεται στη χρήση μιας φθορίζουσας ουσίας (συνήθως SYBR Green I) που ενσωματώνεται σε όλα τα δίκλωνα μόρια DNA ανεξαρτήτων αλληλουχίας βάσεων. Η φθορίζουσα ουσία φθορίζει κατεξοχήν όταν ενσωματώνεται στο DNA ενώ πρακτικά δεν φθορίζει όταν είναι ελεύθερη στο διάλυμα της PCR.

55 2. Sequence Specific Probe Binding Assays Οι μεθοδολογίες βασίζονται στη χρήση ολιγονουκλεοτιδικών ανιχνευτών που υβριδίζονται λόγω συμπληρωματικότητας των βάσεών τους με τον στόχο DNA, συνεπώς ανιχνεύουν μόνο το συγκεκριμένο προϊόν. Οι ανιχνευτές είναι σημασμένοι με φθοριοχρώματα που μας παρέχουν το σήμα της ανίχνευσης. Οι τεχνικές με χρήση σημασμένων ανιχνευτών υβριδισμού έχουν μεγάλη ειδικότητα Κύριοι αντιπρόσωποι α) Hybridization probe assay (HybProbe probes) β) Hydrolysis probe assay (TaqMan)

56 HYBRIDIZATION PROBE ASSAY Βασίζονται στην αρχή FRET (Fluorescence Resonance Energy Transfer) Τα μόρια Donor και Acceptor πρέπει να είναι σε κοντινές θέσεις (απόσταση 1-5 βάσεις) Το φάσμα απορρόφηση του Acceptor πρέπει να επικαλύπτει το φάσμα εκπομπής του Donor

57 Η μεθοδολογία με Hybridization probes είναι κατάλληλη για ποσοτική και ποιοτική PCR καθώς και για ανίχνευση σημειακών μεταλλάξεων (SNP s).

58 Ανίχνευση μεταλλάξεων, σχεδιασμός ανιχνευτών Απόλυτη ομολογία (perfect match) (mismatch) 3 1) Το σημασμένο στο 5 άκρο probe πρέπει να είναι φωσφορυλιωμένο στο 3 άκρο για να μην γίνει επέκταση με την πολυμεράση. Anchor Probe Mutation Probe 2) Tm mut.probe < Tm anchor probe 3) Tm anchor probe > Tm primers

59 Mismatch Perfect Match Temperature Low Medium High Υβριδισμός των ειδικών probe στον DNA στόχο. Ο φθορισμός ελαττώνεται όταν τα probe λόγω αύξησης της θερμοκρασίας απομακρύνονται από τη μήτρα DNA. Εάν υπάρχει αλλαγή σε μία βάση θα οδηγηθούμε σε θερμική αστάθεια του συμπλέγματος probe target. Οι θερμοκρασίες αποδιάταξης των ανιχνευτών με τη μήτρα DNA θα είναι διαφορετικές εφόσον υπάρχει σημειακή μετάλλαξη.

60 Χαρακτηρισμός Βάσει Τm Wild Type Mutant - Heterozygous

61 Relative fluorescence from HCV ΜΕΤΡΗΣΗ ΙΙΚΟΥ ΦΟΡΤΙΟΥ HCV HCV signal from 0 to 10 8 HCV-RNA copies/ml Cycle threshold (Ct) for 10 8 copies/pcr HCV-RNAlog copies/pcr Threshold None 0 Cycle Number

62 ΕΦΑΡΜΟΓΕΣ PCR Ποσοτική μέτρηση RNA ή DNA Κλινική Μικροβιολογία Γενετική Διαγνωστική Ανάλυση Πληθυσμών Αρχαιολογία Ιατροδικαστική Κλωνοποίηση Χαρακτηρισμός αγνώστων μεταλλάξεων Πολλαπλασιασμός αγνώστων αλληλουχιών DNA sequencing Ανάλυση γενώματος

63 Μειονεκτήματα Μοριακών Τεχνικών Πως η επιδημιολογία και το καλά οργανωμένο σύστημα υγείας δίνουν λύσεις σε κλινικά προβλήματα? ΣΟΥΗΔΙΑ Από το 1995 έως και το 2005 (10 έτη) οι στατιστικές ανά έτος εμφάνιζαν σταθερή αύξηση του ποσοστού χλαμυδιακών λοιμώξεων Τα έτη καταγράφεται αισθητή μείωση των χλαμυδιακών λοιμώξεων και μάλιστα στην πόλη Halland ( κάτοικοι) η μείωση της συχνότητος έφτασε το 25% Η πόλις Halland ήταν η πρώτη που υιοθέτησε μοριακές τεχνικές για ανίχνευση του Chlamydia trachomatis στο Νοσοκομείο της από το 1995 οι οποίες έως το 2006 συγκεκριμένη αλληλουχία DNA του κρυπτικού πλασμιδίου των Ct. (Abbott LCx Roche Amplicor PCR Abbott m200 real-time) ΕΡΩΤΗΣΗ: ΓΙΑΤΙ ΕΠΕΛΕΞΑΝ ΤΟ ΚΡΥΠΤΙΚΟ ΠΛΑΣΜΙΔΙΟ ΩΣ ΣΤΟΧΟ?

64 Η μείωση του επιπολασμού της χλαμυδιακής λοίμωξης θα μπορούσε να οφείλεται: 1.Πρόβλημα στην ποιότητα των αντιδραστηρίων 2.Αλλαγή σεξουαλικών συνηθειών 3.Αλλαγή στον στόχο DNA του μικροβίου.

65 Η έρευνα αποκάλυψε μια απαλοιφή (deletion) 377bp στο κρυπτικό πλασμίδιο των χλαμυδίων με αποτέλεσμα θετικά δείγματα να χαρακτηρίζονται μέσω του μοριακού ελέγχου Αρνητικά (False negative) Από το 2009 οι εταιρείες Roche Abbott χρησιμοποιούν multiplex PCR (2 στόχων)


67 MICROARRAYS Η χαρτογράφηση του ανθρώπινου γονιδιώματος (3,6 x 10 9 ζευγών βάσεων DNA) αποτελεί ένα τεράστιο επιστημονικό επίτευγμα. Ο αριθμός των υπαρχόντων γονιδίων πριν την ολοκλήρωση του προγράμματος υπολογιζόταν σε ενώ οι τελευταίες εκτιμήσεις κάνουν λόγο για γονίδια. Το λεγόμενο «άχρηστο» DNA που έχει εξελικτικά συντηρηθεί πάρα πολύ καλά τι ρόλο διαδραματίζει; (ENCODE PROJECT) Από τα υπάρχοντα γονίδια ποια εκφράζονται σε κάθε κύτταρο, πότε θα εκφραστούν και κάτω από ποιες συνθήκες και προϋποθέσεις είναι ερωτήσεις προς απάντηση στο άμεσο μέλλον. Είναι γνωστό ότι ορισμένα γονίδια ενέχονται σε μια σειρά σοβαρών ασθενειών, όπως διάφοροι τύποι καρκίνου, διαβήτης, καρδιοπάθειες, σχιζοφρένεια. Ο τρόπος όμως έκφρασης και λειτουργίας αυτών με την έννοια της κατανόησης της βιολογίας και λειτουργίας των κυττάρων σε φυσιολογικές και παθολογικές καταστάσεις παραμένει άγνωστος

68 MICROARRAYS Η συνεργασία επιστημονικών κλάδων όπως της Ιατρικής Χημείας Βιοχημείας Βιολογίας Φυσικής και Βιοπληροφορικής ανοίγει νέες προοπτικές για τη: Γενομική: (Genomics κλάδος επιστήμης που μελετά το γονιδίωμα ως σύνολο) και την Πρωτεομική: (Proteomics κλάδος επιστήμης που μελετά το σύνολο των πρωτεϊνών). Η σύζευξη γενετικής γενομικής πρωτεομικής θα βοηθήσει στη διαλεύκανση των βασικών μηχανισμών λειτουργίας του κυττάρου και των οργάνων, στη διερεύνηση της παθογένεσης των νόσων, κυρίως των πολυγονιδιακών, στην εξατομικευμένη θεραπευτική προσέγγιση τους αλλά και στη διαλεύκανση των μηχανισμών που οδηγούν στο γήρας. Η χρήση των DNA microarrays που επιτρέπει την ταυτόχρονη άντληση πληροφοριών από εκατοντάδες έως χιλιάδες γονίδια σε ένα μόνο πείραμα είναι ένα σημαντικό εργαλείο για την επίτευξη των ανωτέρω στόχων.

69 MICROARRAYS Καθορισμένη συστοιχία νουκλεϊκών οξέων, πρωτεϊνών, μικρών μορίων, που επιτρέπει παράλληλη ανάλυση πολύπλοκων βιοχημικών δειγμάτων. (Schena et. al., Science 270, ; 1995). 1. Laboratory Patrick Brown Stanford University Yeast microchip 2. Μέθοδος Affymetrix

70 MICROARRAYS 1. Laboratory Patrick Brown Stanford University Yeast microchip Πραγματοποίηση PCR αντιδράσεων για πολλαπλασιασμό όλων των γονιδίων. Ρομποτική εγκατάσταση θραυσμάτων DNA, προϊόντων της PCR, χαρακτηριστικών κάθε γονιδίου σε υάλινη επιφάνεια 2cm 2 σε συγκεκριμένες θέσεις. Μήκος θραύσματος μονόκλωνου DNA bp.

71 MICROARRAYS 2. Affymetrix Προσκόλληση χημικά παρασκευαζομένων ολιγονουκλεοτιδίων (25bp) με φωτολιθογραφική τεχνική σε συγκεκριμένες θέσεις σε chip σιλικόνης μεγέθους 1,28 cm 2

72 Κατασκευή microarrays με φωτολιθογραφική μέθοδο

73 Διαδικασία Κατασκευής: Ευαισθητοποίηση της περιοχής όπου μια νέα βάση προστίθεται AmpliChip Microarray Different masks are applied and a different base is added



































108 Scientists rely on a technique called protein expression analysis to tell them if the mrna is being translated into protein


110 MICROARRAY EXPRESSION CHIP 25 mer probes, γονίδια, probes.


112 Απρίλιος 2010 Περιοδικό Cancer Research ΔΕΔΟΜΕΝΑ Οι όγκοι ανταποκρίνονται διαφορετικά στην ακτινοθεραπεία Η ακτινοθεραπεία συνεισφέρει σε ποσοστό 40% των περιπτώσεων όπου ο όγκος εξαλείφεται. ΖΗΤΟΥΜΕΝΟ Εύρεση στόχων που θα βελτιώσουν το αποτέλεσμα της ακτινοθεραπείας.

113 Απρίλιος 2010 Περιοδικό Cancer Research ΠΡΟΣΕΓΓΙΣΗ ΕΡΕΥΝΗΤΩΝ 1. Συγκριτική μελέτη έκφρασης 200 γονιδίων που ενέχονται στην επισκευή του DNA σε όγκους και υγιείς ιστούς. 2. Διαπίστωση ότι το γονίδιο POLQ εκφράζεται έντονα σε καρκινικά κύτταρα σε αντίθεση με υγιή. 3. Έλεγχος knockdown του γονιδίου με χρήση small interfering RNA (sirna)* = Επιτυχής. 4. α) Μελέτη της συμπεριφοράς καρκινικών κυτταρικών σειρών με αρχική αντίσταση στην ακτινοβολία και knockdown του γονιδίου POLQ. ΕΥΡΗΜΑ Τα καρκινικά κύτταρα αποδεικνύονται ευπαθή στην ακτινοβολία. * Nobel 2006

114 Απρίλιος 2010 Περιοδικό Cancer Research 4. β) Μελέτη υγιών κυττάρων που έχουν υποστεί knockdown του γονιδίου στην ανταπόκριση τους στην ακτινοβολία ΕΥΡΗΜΑ Δεν επηρεάζονται από την ακτινοβολία. ΣΥΜΠΕΡΑΣΜΑ Η ΑΝΑΣΤΟΛΗ ΤΗΣ ΕΚΦΡΑΣΗΣ ΤΟΥ ΓΟΝΙΔΙΟΥ POLQ ΜΠΟΡΕΙ ΝΑ ΧΡΗΣΙΜΟΠΟΙΗΘΕΙ ΚΛΙΝΙΚΑ ΓΙΑ ΕΥΑΙΣΘΗΤΟΠΟΙΗΣΗ ΟΓΚΩΝ ΣΤΗΝ ΑΚΤΙΝΟΘΕΡΑΠΕΙΑ

115 MICROARRAY SNP CHIP Ανίχνευση (SNPs) και copy number variation (CNV) σε ένα πείραμα. Εφαρμογή: Συσχέτιση SNPs προτύπου με συγκεκριμένες ασθένειες, Εξατομικευμένη φαρμακευτική προσέγγιση. Π.χ. Roche Amplichip. Μεταβολισμός φαρμάκων CYP450

116 AmpliChip CYP450 Test Intended Use Performs genotyping of two Cytochrome P450 genes: 2D6 and 2C19 Distinguishes 29 polymorphisms in the 2D6 gene, including gene duplication and deletion Distinguishes 2 major polymorphisms in the 2C19 gene Provides predictive phenotype of the associated enzymatic activities

117 4 Types of Metabolizers (II) Metabolizer Status Genotype Response to average daily dose Ultrarapid Conc. Time = Adverse Events = Therapeutic Window = Ineffective Extensive normal activity Intermediate Poor reduced activity no activity

118 Examples: Dose recommendations for antidepressants Drug Usual Dose (mg) Dose Adjustment (based on metabolizer type) Poor Intermediate Extensive Ultra-rapid Tricyclics Amitriptyline 150 (50-150) 50 % (90 %) 120 % Clomipramine 150 ( ) 60 % (90 %) 120 % Desipramine 150 (10-100) 30 % 30 % 130 % 260 %* Fluvoxamine 100 (100) 90 % (100 %) 110 % Imipramine 150 (25-100) 30 % (80 %) 130 % Nortriptyline* 50 (25-150) 50 % 70 % 140 % 230 % SSRI Fluoxetine* 20 (20-60) 70 % (90 %) 110 % Paroxetine 20 (30) 70 % (90 %) 110 % Mixed-Function Venlafaxine 150 (20-225) 20 % (80 %) 130 % * single dose recommendations; recommendations in brackets are estimations and require clinical confirmation Kirchheiner et al, (2001) Acta Psychiat. Scand. 104: 173

119 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Α) Αλληλεπίδραση Ξενιστή Παθογόνου 1) Επίδραση ξενιστή στη έκφραση του παθογόνου Pseudomonas aeruginosa Genome assay: Ανακάλυψη γονιδίων που απενεργοποιούνται και τα οποία επάγουν την βιοσύνθεση μαστιγίων στη Ψευδομονάδα. Τα μαστίγια προκαλούν ανοσολογική ανταπόκριση από τον ξενιστή εξαφάνιση μαστιγίων = αποφυγή αμυντικού μηχανισμού ξενιστή. 2) Επίδραση παθογόνου στην έκφραση του ξενιστή


121 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ Β) Ανίχνευση παθογόνων ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Wilson et.al.: Multi-Pathogen Identification microarray (MPID), Ανίχνευση 18 παθογόνων προκαρυωτικών ευκαρυωτικών - μυκήτων

122 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ Β) Ανίχνευση παθογόνων ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Ανίχνευση και τυποποίηση 34 τύπων ιού HPV με microarrays (Genomedica)

123 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ Β) Ανίχνευση παθογόνων ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Τυποποίηση στελεχών: Microarray Bacillus anthracis για να διαχωρισθεί αν το στέλεχος είναι προϊόν γενετικής μηχανικής ή όχι

124 21 ος ΑΙΩΝΑΣ Φθορίζοντα αντισώματα ή φθορίζοντα ολιγονουκλεοτίδια



127 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Γ) Έλεγχος ευαισθησίας σε λοιμώξεις Με τη χρήση microarray για SNPs ικανές για ταυτόχρονη μελέτη πολυμορφισμών και άλλων τύπων microarray μπορούν να εξαχθούν συμπεράσματα για ομάδες γονιδίων που συνδέονται με αντοχή ή ευπάθεια σε λοιμώξεις. π.χ 1) Μεταλλάξεις στο CKR5 human co-recoptor για τον ιό HIV οδηγούν σε αυξημένη αντίσταση στη λοίμωξη. 2) Ομόζυγοι φορείς του γονιδίου που εκφράζει την ανενεργή caspase 12 (ωρίμανση κυτοκινών από μίτωση) κινδυνεύουν 8 φορές λιγότερο να εμφανίσουν βακτηριαιμία και 8 φορές λιγότερο να πεθάνουν από σηψαιμία, σε σχέση με τους ομόζυγους φορείς της ενεργούς μορφής. ΣΙΩΠΗΣΗ ΓΟΝΙΔΙΟΥ = ΕΞΕΛΙΚΤΙΚΟ ΠΛΕΟΝΕΚΤΗΜΑ Συχνότητα γονιδίου 28% στην Υποσαχάρια - Αφρική. Στις γυναίκες τα οιστρογόνα μπλοκάρουν την έκφραση του γονιδίου.

128 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Δ) Γενετική ποικιλομορφία Ξενιστή και θεραπευτική προσέγγιση Μελετήθηκαν 143 ασθενείς με φλεγμονή από Helicobacter pylori Όλοι έλαβαν τριπλό θεραπευτικό σχήμα 1 εβδομάδος. Οι 50 που μετά τη θεραπεία συνέχιζαν να είναι θετικοί ήσαν ομόζυγοι ή ετερόζυγοι για τον γονότυπο CYP2C19 που χαρακτηρίζει τους ταχείς μεταβολιστές του φαρμάκου.


130 ΕΡΩΤΗΜΑ Μπορούν περιβαλλοντικοί παράγοντες όπως η διατροφή και η μητρική στοργή να προκαλέσουν επιγενετικές μεταβολές στο DNA και να αλλάξουν τη γονιδιακή έκφραση σε γενετικά δίδυμους οργανισμούς οδηγώντας τελικά σε διαφορετικό φαινότυπο;

131 Το κύκλωμα του stress HPA Axis Στρεσσογόνα σήματα ακολουθούν την πορεία Υποθάλαμος - Υπόφυση - Επινεφρίδια κατευναστικό σήμα για να κλείσει το κύκλωμα Κορτιζόλη (+ αδρεναλίνη) Ιππόκαμπος Cortisol + GR

132 ΦΡΟΝΤΙΔΑ & ΣΤΟΡΓΗ Αμέσως μετά τη γέννηση, μεθυλομάδες προκαλούν σίγηση του γονιδίου GR receptor στα εγκεφαλικά κύτταρα όλων των αρουραίων Κατά τη διάρκεια της πρώτης εβδομάδος η ανελλιπής μητρική φροντίδα προκαλεί απελευθέρωση χημικών ουσιών στον εγκέφαλο του νεογέννητου αρουραίου. Οι χημικές αυτές ουσίες ενεργοποιούν μονοπάτια μοριακής σηματοδότησης τα οποία αφαιρούν από το DNA τις μεθυλομάδες Αποτέλεσμα: Ενεργοποίηση του γονιδίου GR receptor και παραγωγή της πρωτεΐνης GR (Glucocorticoid receptor) ΟΣΟ ΜΕΓΑΛΥΤΕΡΗ ΦΡΟΝΤΙΔΑ ΤΟΣΟ ΜΕΓΑΛΥΤΕΡΗ ΠΑΡΑΓΩΓΗ ΠΡΩΤΕΪΝΗΣ GR

133 ΔΙΑΤΡΟΦΗ Στην κοινωνία των μελισσών η βασίλισσα και οι εργάτριες μοιράζονται το ίδιο ακριβώς γενετικό υλικό ωστόσο ο φαινότυπος ως προς τη συμπεριφορά, το μέγεθος, τη φυσιολογία, την εμφάνιση και το χρόνο ζωής διαφέρουν δραματικά. Η γονιδιακή ανάλυση αποκάλυψε ότι η διαφορά έγκειται στην μεθυλίωση πολλών γονιδίων στις εργάτριες με αποτέλεσμα την μη έκφρασή τους. Σε επίπεδο λάρβας το φαινόμενο της μεθυλίωσης είναι αντιστρεπτό και εξαρτάται πλήρως από την τροφή. Ο βασιλικός πολτός περιέχει ουσία που αναστέλλει το ένζυμο cytosine methyltransferase το οποίο είναι υπεύθυνο για τη μεθυλίωση του DNA των μελισσών

134 ΛΑΡΒΑ Νέκταρ Βασιλικός πολτός Εργάτρια μέλλισα Βασίλισσα μέλλισα

135 Χαρτογράφηση γονιδιακής έκφρασης του ανθρώπινου εγκεφάλου Allen Brain Atlas Project gene probes αναλυση όλων των γνωστών γονιδίων 1000 τομές / εγκέφαλο (500 τομές / ημισφαίριο) $ κόστος Τα αποτελέσματα της γονιδιακής έκφρασης αποδίδονται σε συνδυασμό με ιστολογική μελέτη σε 3D απεικόνιση βασισμένη σε MRI


137 Πόσο βέβαιοι μπορεί να είμαστε για τις νέες θεωρίες που περιγράφουν βιολογικά συστήματα; «Οσες αναφέρονται στην πραγματικότητα δεν είναι βέβαιες και όταν είναι βέβαιες δεν αναφέρονται στην πραγματικότητα» Albert Einstein



Διαβάστε περισσότερα

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc

Εισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc Εισαγωγή στη Real Time PCR Καραπέτσας Θανάσης PhD, MSc Μειονεκτήματα της κλασικής PCR Ανάλυση ύστερα από ηλεκτροφόρηση(συνήθως αγαρόζης) Τεχνική τελικού σημείου(end-point detection), Σύγκριση της έντασης

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

PCR Εφαρμογές-2. RACE Site directed mutagenesis

PCR Εφαρμογές-2. RACE Site directed mutagenesis PCR Εφαρμογές-2 RACE Site directed mutagenesis Σκοπός της αντίδρασης PCR (Polymerase Chain Reaction) είναι το να φτιάξει ένα μεγάλο αριθμό αντιγράφων. BHMATA 1. ΑΠΟΔΙΑΤΑΞΗ 2. ΥΒΡΙΔΙΣΜΟΣ 3. ΕΠΙΜΗΚΥΝΣΗ Επειδή

Διαβάστε περισσότερα


ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα


ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ - - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Χρήστος Κρούπης, MSc, PhD Επίκουρος Καθηγητής Κλινικής Βιοχημείας Ιατρική Σχολή Πανεπιστημίου Αθηνών Αττικόν Πανεπιστημιακό Νοσοκομείο Lehninger

Διαβάστε περισσότερα

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Γενετική Βακτηρίων Κατανόηση μηχανισμών λειτουργίας ευκαρυωτικών κυττάρων Ταξινόμηση βακτηρίων Διάγνωση λοιμωδών νοσημάτων Επιδημιολογική μελέτη

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

Άσκηση Φαρμακευτικής Βιοτεχνολογίας

Άσκηση Φαρμακευτικής Βιοτεχνολογίας Άσκηση Φαρμακευτικής Βιοτεχνολογίας Χαρακτηρισμός Φαρμακογενετικών δεικτών με PCR-ARMS Θεωρητικό μέρος 1. Αλυσιδωτή αντίδραση Πολυμεράσης (PCR) Η αλυσιδωτή αντίδραση πολυμεράσης (polymerase chain reaction,

Διαβάστε περισσότερα


ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ ΔΟΜΗ ΚΑΙ ΑΝΑΛΥΣΗ ΒΙΟΜΟΡΙΩΝ Διδάσκοντες: Δ.Δ. Λεωνίδας, Α.-Μ. Ψαρρά Κωδικός e-class: SEYC194 28/9/2015 Δ.Δ. Λεωνίδας 28/9/2015 Δ.Δ. Λεωνίδας Βιοχημεία είναι η Χημεία που εμφανίζεται μέσα στους ζώντες οργανισμούς

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα


DNA MICROARRAYS. Σελίδα 1 ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Τ. Θηραίου DNA MICROARRAYS Σελίδα 1 Μελέτη του γονιδιώματος Ποια είναι τα γονίδια και που βρίσκονται; Ποιοι μηχανισμοί ρυθμίζουν την έκφραση κάθε γονιδίου; Σε τι επίπεδα εκφράζονται τα γονίδια υπό διαφορετικές συνθήκες;

Διαβάστε περισσότερα


ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα


Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ ΕΡΩΤΗΣΕΙΣ 4 Ο, 7 Ο, 8 Ο, 9 Ο ΚΕΦΑΛΑΙΩΝ 1. Η μεταφορά ανθρώπινου γονιδίου σε βακτήριο δίνει διαφορετικό προϊόν μεταγραφής και μετάφρασης, ενώ σε μύκητες μεταγράφεται κανονικά αλλά το προϊόν μετάφρασης εμφανίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

PCR quantitative PCR (qpcr)

PCR quantitative PCR (qpcr) PCR quantitative PCR (qpcr) Ε. Λιανίδου, Ph.D. Καθηγήτρια Εργαστήριο Αναλυτικής Χημείας, Τμήμα Χημείας, Πανεπιστήμιο Αθηνών lianidou@chem.uoa.gr DNA A:T (2 δεσμοί Η), C:G (3δεσμοί Η) Αλυσιδωτή αντίδραση

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα


Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA

Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA Aνάλυση SNP που επηρεάζουν θέσεις περιορισμού, με στύπωμα Southern. Ένα χρωμοσωμικό τμήμα μεγέθους 7 kb φέρει θέσεις BamHI σε κάθε άκρο του. Το αλληλόμορφο

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa. Αρχές PCR και υβριδισμού Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.gr Ιστορικά στοιχεία Πρώτη αναφορά in vitro ενζυματικής αντίδρασης

Διαβάστε περισσότερα


Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ DNA ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Τεχνολογία ανασυνδυαζόμενου DNA ή Γενετική Μηχανική Κατασκευή τεχνητών μορίων DNA (ανασυνδυασμένο DNA) Τροποποίηση γονιδιωμάτων Μεταφορά γονιδίου/ων

Διαβάστε περισσότερα

Βιοπληροφορική II. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015

Βιοπληροφορική II. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 Βιοπληροφορική II Παντελής Μπάγκος Αναπληρωτής Καθηγητής Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 Μικροσυστοιχίες Γυάλινο πλακίδιο που αποτελείται από συγκεκριμένες αλληλουχίες οι οποίες είναι ειδικές για συγκεκριμένα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας

ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ. Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ Ιατρική Σχολή Πανεπιστημίου Θεσσαλίας Ε. ΠΕΤΕΙΝΑΚΗ Aναπληρώτρια Καθηγήτρια Μικροβιολογίας Διευθύντρια Εργαστηρίου Μικροβιολογίας ΜΙΚΡΟΒΙΟΛΟΓΙΑ φάση της κλινικής ιατρικής Η μικροβιολογία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑΤΑ ΜΟΡΙΑΚΗΣ ΙΑΤΡΙΚΗΣ 3 ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΙΑΤΡΙΚΗΣ ΧΗΜΕΙΑΣ ΜΑΘΗΜΑΤΑ ΜΟΡΙΑΚΗΣ ΙΑΤΡΙΚΗΣ 3 ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΙΑΤΡΙΚΗΣ ΧΗΜΕΙΑΣ Αργυρώ Σγουρού, Assistant Prof. Laboratory of Biology School of Science and Technology Hellenic Open University 2016-2017 Μονογονιδιακά

Διαβάστε περισσότερα

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Οι περιοριστικές ενδονουκλεάσες

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA Microarrays Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA όμως του οργανισμού είναι μια στατική πληροφορία

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (2/2), 2ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση

Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση Κεφάλαιο 15 (Ιατρική Γενετική) Προγεννητική διάγνωση Η προγεννητική διάγνωση Ενδείξεις: -Προχωρημένη ηλικία μητέρας (πιο συχνό: σύνδρομο Down) -Προγενέστερο παιδί με de novo χρωμοσωμική ανωμαλία -Ύπαρξη

Διαβάστε περισσότερα