ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ REAL - TIME PCR MICROARRAYS PCR. Γιώργος Καπαρός Λέκτωρ Μικροβιολογίας ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΔΙΑΓΝΩΣΗΣ ΑΡΕΤΑΙΕΙΟ ΝΟΣΟΚΟΜΕΙΟ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ REAL - TIME PCR MICROARRAYS PCR. Γιώργος Καπαρός Λέκτωρ Μικροβιολογίας ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΔΙΑΓΝΩΣΗΣ ΑΡΕΤΑΙΕΙΟ ΝΟΣΟΚΟΜΕΙΟ"

Transcript

1 ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ REAL - TIME PCR PCR Γιώργος Καπαρός Λέκτωρ Μικροβιολογίας MICROARRAYS ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΔΙΑΓΝΩΣΗΣ ΑΡΕΤΑΙΕΙΟ ΝΟΣΟΚΟΜΕΙΟ

2 ΕΡΩΤΗΜΑ Μπορούν περιβαλλοντικοί παράγοντες όπως η διατροφή και η μητρική στοργή να προκαλέσουν επιγενετικές μεταβολές στο DNA και να αλλάξουν τη γονιδιακή έκφραση σε γενετικά δίδυμους οργανισμούς οδηγώντας τελικά σε διαφορετικό φαινότυπο;

3 Cell Division Parent Cell Prophase Chromosomes align at the equatorial (metaphase) plate Metaphase (Centromeres divide) Sister chromatids separate during anaphase, becoming chromosomes Two Daughter Cells

4 ΑΝΘΡΩΠΙΝΟ ΓΟΝΙΔΙΩΜΑ 3.6 X 10 9 ΖΕΥΓΗ ΒΑΣΕΩΝ DNA ΑΠΟΤΕΛΟΥΝ ΤΟ ΑΝΘΡΩΠΙΝΟ ΓΟΝΙΔΙΩΜΑ ΜΗΚΟΥΣ 2m ΓΟΝΙΔΙΑ :ΩΣ ΓΟΝΙΔΙΟ ΟΡΙΖΕΤΑΙ ΤΟ ΜΗ ΔΙΑΚΛΑΔΙΖΟΜΕΝΟ ΧΗΜΙΚΟ ΠΟΛΥΜΕΡΕΣ 4 ΑΖΩΤΟΥΧΩΝ ΒΑΣΕΩΝ (Α,Τ,G,C) ΠΟΥ ΠΕΡΙΕΧΕΙ ΠΟΛΥΤΙΜΗ ΒΙΟΛΟΓΙΚΗ ΠΛΗΡΟΦΟΡΙΑ ΕΝΏ ΣΥΓΧΡΟΝΩΣ ΔΥΝΑΤΑΙ ΠΑΡΟΥΣΙΑ ΚΑΤΑΛΛΗΛΟΥ ΕΝΖΥΜΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΝΑ ΑΝΑΠΑΡΑΓΑΓΕΙ ΤΟΝ ΕΑΥΤΟ ΤΟΥ ΤΟΣΟ IN VIVO ΟΣΟ KAI IN VITRO. TO 10% TOY ΣΥΝΟΛΙΚΟΥ DNA ΠΕΡΙΕΧΕΙ ΛΕΙΤΟΥΡΓΙΚΗ ΠΛΗΡΟΦΟΡΙΑ ΠΟΥ ΣΗΜΑΙΝΕΙ ΣΧΗΜΑΤΙΖΕΙ ΠΡΩΤΕΙΝΕΣ.

5 ΙΣΤΟΡΙΚΕΣ ΑΝΑΚΑΛΥΨΕΙΣ 1855:Ο ΜΕNDEL ΑΝΑΦΕΡΕΙ ΤΗΝ ΥΠΑΡΞΗ ΓΟΝΩΝ ΠΟΥ ΜΕΤΑΒΙΒΑΖΟΝΤΑΙ ΣΕ ΘΥΓΑΤΡΙΚΕΣ ΓΕΝΕΕΣ 1940: O BEADLE ΑΝΑΦΕΡΕΙ ΤΗΝ ONE GENE ONE ENZYME HYPOTHESIS. (ΝΟΒEL 1958) 1944: O AVERY ΑΠΟΔΕΙΚΝΥΕΙ ΌΤΙ ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΔΕΝ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΠΡΩΤΕΙΝΕΣ ΑΛΛΑ ΑΠΌ DNA. 1953: OI WATSON ΚΑΙ CRICK ΑΝΑΚΑΛΥΠΤΟΥΝ ΌΤΙ ΤΟ ΜΟΡΙΟ ΤΟΥ DNA ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΔΙΠΛΗ ΕΛΙΚΑ ΚΑΙ ΤΗΝ ΠΕΡΙΓΡΑΦΟΥΝ.(NOBEL 1962) 1956: Ο KORNBERG ΑΝΑΚΑΛΥΠΤΕΙ ΤΗΝ DNA ΠΟΛΥΜΕΡΑΣΗ ΠΟΥ ΕΊΝΑΙ ΑΠΑΡΑΙΤΗΤΗ ΓΙΑ ΤΗΝ ΑΝΤΙΓΡΑΦΗ ΤΟΥ DNA ΤΟΣΟ IN VIVO ΟΣΟ ΚΑΙ IN VITRO.(NOBEL 1959) 1975:Ο SANGER ΑΝΑΚΑΛΥΠΤΕΙ ΤΗΝ ΜΕΘΟΔΟ ΓΙΑ ΤΟ DNA SEQUENCING.(NOBEL 1980) 1985: Ο MULLIS ΠΑΡΟΥΣΙΑΖΕΙ ΤΗΝ ΜΕΘΟΔΟ PCR.(ΝOBEL 1993)

6 Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome

7 DNA Double Helix

8 DNA Structure Hydrogen Bonds Cytosine Adenine Thymine Guanine Deoxyribose (Sugar molecule) Phosphoric Acid (Phosphate molecule)

9 Deoxyribose and Phosphoric Acid Deoxyribose Phosphoric Acid

10 Adenine Guanine Cytosine Thymine

11 The Nucleotide Sequence Hydrogen Bonds Cytosine (C) Adenine (A) Thymine (T) Guanine (G) Guanine (G) Thymine (T) Adenine (A) Cytosine (C) Deoxyribose (Sugar molecule) Phosphoric Acid (Phosphate molecule)

12 5 to 3 Orientation of the Sugar - Phosphate Backbone 5 end 3 end

13 Bonding of Base, Sugar and Phosphate Groups Phosphate Molecule 5 Deoxyribose Sugar Molecule Bases Hydrogen Bonds Sugar-Phosphate Backbone

14 Μοριακές Τεχνικές Αντιγραφή του DNA

15 Μοριακές Τεχνικές Μεταγραφή και Μετάφραση του DNA

16 Μοριακές Τεχνικές 2000-: Αποκρυπτογράφηση ανθρώπινου γονιδιώματος : Επανάσταση στη μεθοδολογία : Εμφάνιση των πρώτων τεχνικών ανάλυσης του DNA : χαρακτηρισμός, απομόνωση και χειρισμός DNA, RNA και πρωτεΐνες

17 Μοριακές Τεχνικές Αλυσιδωτή αντίδραση πολυμεράσης (Polymerase chain reaction PCR) 1985 Kary Mullis Nobel Χημείας 1993

18

19 Όλα τα συστατικά της συνταγής ήταν γνωστά στην επιστημονική κοινότητα. Κανείς όμως μέχρι εκείνη τη στιγμή δεν τα είχε συνδυάσει όπως τα συνδύασε ο Mullis. Για 4 μήνες κανείς στην εταιρεία δεν αξιολόγησε σοβαρά τη σκέψη του και μάλιστα το περιοδικό Science με ευθύνη του εκδότη του Dan Koshland απέρριψε το πρώτο paper με τη τεχνική PCR που έστειλε ο Mullis προς δημοσίευση. Τρία χρόνια αργότερα όταν η PCR ανακηρύχτηκε «Molecule Of The Year» o Dan Koshland εξακολουθούσε να είναι ο εκδότης του περιοδικού Science.

20 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ 1. DNA DENATURATION (ΑΠΟΔΙΑΤΑΞΗ) 94 ο C. 30 sec Όταν το DNA θερμαίνεται η διπλή έλικα αρχίζει να «χωρίζει» και το φαινόμενο αυτό αναφέρεται ως τήξη (melting). Από τη στιγμή που το ζεύγος Α=Τ ενώνεται με δύο δεσμούς υδρογόνου, σε αντίθεση με το ζεύγος C G που ενώνεται με τρείς, περιοχές του DNA με μεγάλη συγκέντρωση Α και Τ θα διαχωριστούν πρώτες.

21 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ Η θερμοκρασία κατά την οποία το μισό DNA είναι πλέον μονόκλωνο ονομάζεται melting temperature (Tm).

22 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ H Tm των μορίων DNA δεν είναι ίδια και εξαρτάται 1) Από το μήκος της αλυσίδας DNA 2) Από την αναλογία βάσεων Α,Τ,C,G που περιέχει Tm = 16,5 (log [Na + ]) (%GC) + 81,5 ο C Για μικρά μόρια DNA (15-30) βάσεων η Τm = 2(A+T) + 4(G+C), Wallace rule Έτσι μια μονόκλωνη αλυσίδα DNA 20 βάσεων με 5Α, 6Τ, 3C και 6G θα έχει Τm: Τm = 2(5 Α + 6 Τ ) + 4(3 C + 6 G ) = 58 ο C.

23 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ 2. DNA ANNEALING (ΕΠΑΝΑΔΙΑΤΑΞΗ ΥΒΡΙΔΙΣΜΟΣ ΕΚΚΙΝΗΤΩΝ ΜΕ ΤΙΣ ΜΟΝΟΚΛΩΝΕΣ ΑΛΥΣΙΔΕΣ DNA) 45 ο - 60 ο C. Απαιτεί δύο εκκινητές (PRIMERS) μήκους βάσεων που μαρκάρουν (FLANK) τον στόχο DNA που θέλουμε να αντιγραφεί και των οποίων τα 3 άκρα πρέπει να είναι αντικρυστά.

24 PCR 3 ΣΤΑΔΙΩΝ ΠΕΡΙΓΡΑΦΗ 3.DNA EXTENSION (ΕΠΙΜΗΚΥΝΣΗ) 72 Ο C. Δράση της DNA πολυμεράσης σε περιβάλλον περίσσειας των τεσσάρων φωσφορικών δεοξυριβονουκλεοτιδίων έχει σαν αποτέλεσμα την επιμήκυνση των εκκινητών με κατεύθυνση 5 3 και σύνθεση συμπληρωματικής ως προς τη μητρική, νέας αλυσίδας DNA με ταχύτητα αύξησης αλυσίδας ζεύγη βάσεων ανά λεπτό.

25 ΑΠΟΤΕΛΕΣΜΑ 1 ου ΚΥΚΛΟΥ 2 ΔΙΚΛΩΝΑ ΜΟΡΙΑ DNA

26 ΕΝΙΣΧΥΣΗ ΑΛΛΗΛΟΥΧΙΑΣ - ΣΤΟΧΟΥ 1 cycle = 2 Amplicon 2 cycle = 4 Amplicon 3 cycle = 8 Amplicon 4 cycle = 16 Amplicon 5 cycle = 32 Amplicon 6 cycle = 64 Amplicon 7 cycle = 128 Amplicon ΚΥΚΛΟΙ PCR ΠΛΗΘΟΣ ΑΝΤΙΓΡΑΦΩΝ ΑΛΛΗΛΟΧΙΑΣ ΣΤΟΧΟΥ

27 ΣΥΝΘΗΚΕΣ ΑΝΤΙΔΡΑΣΗΣ PCR Ένα τυπικό πείραμα PCR περιέχει τα ακόλουθα συστατικά: DNA (0,01 0,1 μg) PRIMER 1-FORWARD (20 pmol) PRIMER 2-REVERSE (20 pmol) Tris HCL (20mM, ph 8) MgCl 2 (2 mm) 50μM datp, dctp, dgtp, dttp. ΘΕΡΜΟΑΝΘΕΚΤΙΚΗ DNA ΠΟΛΥΜΕΡΑΣΗ (2 IU) dh 2 O ΕΩΣ μl ΣΥΝΟΛΙΚΟΥ ΟΓΚΟΥ. Mg ΕΛΛΑΤΩΜΕΝΗ ΔΡΑΣΤΙΚΟΤΗΤΑ ΠΟΛΥΜΕΡΑΣΗΣ Mg ΧΑΜΗΛΗ ΕΙΔΙΚΟΤΗΤΑ ΠΟΛΥΜΕΡΑΣΗΣ ΟΡΓΑΝΟ ΕΚΤΕΛΕΣΗΣ : ΘΕΡΜΟΚΥΚΛΟΠΟΙΗΤΗΣ (THERMOCYCLER)

28

29 PCR HIGHLIGHTS DNA ΠΟΛΥΜΕΡΑΣΗ Στα πρώτα πειράματα PCR χρησιμοποιήθηκε DNA pol I (Klenow fragment) μη θερμοανθεκτική ανάγκη προσθήκης νέου ενζύμου σε κάθε κύκλο PCR. Με τη χρήση Taq DNA πολυμεράσης, προερχόμενη από το θερμόφιλο βακτήριο Thermus aquaticus (Lawyer et al 1989) η PCR αυτοματοποιείται αφού η Taq πολυμεράση αντέχει έως και 94 ο C ενώ παρουσιάζει βέλτιστη λειτουργικότητα στους 72 o C. Η υψηλή θερμοκρασία στην οποία γίνεται η αντίδραση της επιμήκυνσης των νεοσυντιθέμενων αλυσίδων εξασφαλίζει ότι η ειδικότητα κατά τον υβριδισμό των primers δεν υπόκειται σε συμβιβασμό. Η Taq πολυμεράση έχει βέλτιστη δράση στους 74 ο C και παραμένει λειτουργική έως και τους 95 ο C. Το ένζυμο έχει δράση 5 3 πολυμεράσης Το ένζυμο έχει δράση 5 3 εξωνουκλεάσης ΣΤΕΡΕΙΤΑΙ δράσης 3 5 εξωνουκλεάσης ΣΤΕΡΕΙΤΑΙ proofreading activity

30 PCR HIGHLIGHTS Proofreading activity Αν μια βάση εισαχθεί λάθος κατά την επιμήκυνση της πολυνουκλεοτιδικής αλυσίδας δεν μπορεί να απομακρυνθεί. Αυτό ευνοεί την εισαγωγή σημειακών μεταλλάξεων στο PCR προϊόν. Η συχνότητα λάθους είναι 1 βάση κάθε βάσεις. Εάν ένα μόριο DNA μήκους 1 kb πολλαπλασιασθεί με PCR 25 κύκλων το 10% του προϊόντος περιέχει μεταλλάξεις. Εάν η PCR πραγματοποιείται για τον έλεγχο της παρουσίας ή απουσίας ενός τμήματος γονιδίου πρακτικά η επιτυχία της αντίδρασης δεν επηρεάζεται. Η Taq πολυμεράση προσθέτει συνήθως ένα παραπάνω μόριο (συνήθως A) στο 3 άκρο της νεοσυντιθέμενης αλυσίδας (ελεύθερο κατάλοιπο). Χρήση άλλων πολυμερασών όπως η Pfu πολυμεράση με δραστικότητα 3 5 εξωνουκλεάσης θα περιορίσει το λανθασμένο προϊόν PCR για DNA 1kb σε 0,1% περίπου. Η δραστικότητα 5 3 πολυμεράσης μπορεί να οδηγήσει σε σχηματισμό primer dimmer και πολλαπλασιασμό τους κατά την άνοδο της θερμοκρασίας στη φάση που οδηγεί στο Denaturation.

31 PCR HIGHLIGHTS DNA ΠΟΛΥΜΕΡΑΣΗ ΛΥΣΕΙΣ 1. Τοποθέτηση της πολυμεράσης στην αντίδραση όχι εξ αρχής αλλά στη θερμοκρασία των 94 ο C. (HotStart Polymerase). 2. Ένωση της πολυμεράσης με αντίσωμα που καθιστά το ένζυμο ανενεργό σε χαμηλές θερμοκρασίες. Σε υψηλή θερμοκρασία (94ο C) το αντίσωμα καταστρέφεται η Taq απελευθερώνεται και καθίσταται ενεργή. 3. Κάλυψη των primers με πρωτεΐνη/ες που θα καταστραφεί/ούν στην υψηλή θερμοκρασία.

32 PCR HIGHLIGHTS Ολιγονουκλεοτιδικοί εκκινητές (primers) Η επιτυχία ενός πειράματος PCR εξαρτάται κυρίως από τη σχεδίαση των εκκινητών.

33 PCR HIGHLIGHTS Ολιγονουκλεοτιδικοί εκκινητές (primers) 1.Μήκος νουκλεοτίδια εξασφαλίζει μοναδικότητα υβριδισμού με μονή αλληλουχία DNA μέσα στο γένωμα ( ) συνδυασμοί βάσεων. 2. Περιεκτικότητα σε C,G κατα 50%. 3. Η θερμοκρασία υβριδισμού των 2 primers πρέπει να είναι παραπλήσια. 4. Αλληλουχίες επαναλαμβανόμενου νουκλεοτιδίου αποφεύγονται γιατί οδηγούν σε υβριδισμό μη ειδικό σε άλλες περιοχές του DNA. 5.Το κάθε primer δεν πρέπει να περιέχει αλληλουχίες συμπληρωματικές στα άκρα του διότι μπορεί να υβριδισθούν (hair pin structure) π.χ. 5 GAGATCGATGCATCGAATCTC 3

34 PCR HIGHLIGHTS Ολιγονουκλεοτιδικοί εκκινητές (primers) 6. Δεν πρέπει να υπάρχει συμπληρωματικότητα μεταξύ των 2 primers διότι οδηγούμαστε σε primer dimmer που θα πολλαπλασιασθούν στους κύκλους της PCR. Primer A Primer B Τα primers που χρησιμοποιούνται δεν χρειάζεται κατ ανάγκη να είναι απόλυτα συμπληρωματικά με την αλυσίδα στόχο. Η μόνη βάση σε μια αλληλουχία βάσεων του primer που υποχρεωτικά πρέπει να είναι συμπληρωματικά με τη βάση της μητρικής αλυσίδας είναι αυτή στο 3 άκρο του primer. Εάν αυτό δεν επιτευχθεί η πολυμεράση δεν θα επιμηκύνει την αλυσίδα.

35 RT - PCR RT PCR Το ένζυμο αντίστροφη μεταγραφάση χρησιμοποιεί ένα συμπληρωματικό ολιγονουκλεοτίδιο για να ξεκινήσει την σύνθεση DNA από ένα μόριο RNA. Η μονόκλωνη αλυσίδα του DNA που παράγεται χρησιμοποιείται σαν «μητρική» για την σύνθεση και μιας δεύτερης αλυσίδας DNA και μετά για ενίσχυση χρησιμοποιώντας την PCR.

36 Τα προϊόντα PCR αναλύονται σε μια ξεχωριστή διαδικασία που πραγματοποιείται μετά το τέλος της PCR. Ονομάζουμε αυτό το είδος της ανάλυσης «end-point analysis» (διότι συνήθως πραγματοποιείται μετά από κύκλους PCR). Η end-point analysis χρησιμοποιείται συνήθως για ποιοτική ανάλυση και σπανίως για ημιποσοτική. Ηλεκτροφόρηση σε πήκτωμα αγαρόζης (gel electrophoresis) χρησιμοποιείται συνήθως για να τεκμηριώσει την ύπαρξη ή την απουσία συγκεκριμένου προϊόντος, του μεγέθους του και της καθαρότητας του. Το αιθίδιο του βρωμίου (ethidium bromide) είναι η φθορίζουσα χρωστική που χρησιμοποιούμε συνήθως για την ανίχνευση του προϊόντος στο gel. Εάν έχουμε χρησιμοποιήσει στην PCR primers σημασμένους π.χ. με βιοτίνη τότε μπορούμε να υβριδίσουμε το προϊόν της PCR με καθηλωμένους συμπληρωματικά της DNA αλληλουχίας probes (ανιχνευτές) και με τη χρήση στρεπταβιδίνης να οπτικοποιήσουμε την παραγωγή ή όχι σήματος.

37 ΟΠΤΙΚΟΠΟΙΗΣΗ ΑΠΟΤΕΛΕΣΜΑΤΩΝ PCR ΜΕΘΟΔΟΛΟΓΙΑΣ ΠΑΡΑΔΕΙΓΜΑΤΑ Κλινική Μικροβιολογία : Ανίχνευση ιού HPV.

38 HPV 16 HPV 31 high -globin low -globin HPV 11 LINEAR ARRAY HPV Genotyping Test Overview globin NaOH denaturant HPV genome PCR dntps, MgCl 2, AmpliTaq Gold biotin-labeled PGMY primers biotin-labeled B_PC04/B_GH20 primers Add denatured PCR product to probe strip in hybridization buffer HPV positive sample result wash enzyme conjugate wash color development reference line BSA-conjugated oligonucleotide probes (Gravitt, et al. J. Clin. Micro. 36: )

39 LINEAR ARRAY HPV Genotyping Test ΥΒΡΙΔΙΣΜΟΣ Biotin Linear Array + Amplicon Υβριδισμός του βιοτινυλιωμένου κωδικονίου (amplicon) με τα ακινητοποιημένα ειδικά ολιγονουκλεοτίδια (probes) Probe

40 LINEAR ARRAY HPV Genotyping Test ΑΝΙΧΝΕΥΣΗ Προσθήκη Streptavidin- Horseradish Peroxidase Conjugate + Horseradish Peroxidase Streptavidin Χρωματισμός με καθίζηση ΤΜΒ + Υπεροξείδιο TMB + H 2 O 2 Θετικό σήμα: μπλέ γραμμή TMB

41 LINEAR ARRAY HPV Genotyping Test ΕΡΜΗΝΕΙΑ ΑΠΟΤΕΛΕΣΜΑΤΩΝ HPV Strip Reference Guide Reference Line Reference Line GT 16 GT 18 GT 31 GT 45 Numerical order of genotypes Low beta Globin Control High beta Globin Control Low Globin Control High Globin Control

42 Selective Amplification using AmpErase Specimen/Target DNA Unmodified Specimen/Target DNA AmpErase Carry-Over Amplicon DNA Inactivated Amplicon DNA Unmodified Specimen/Target DNA Heat, Alkaline ph Inactivated AmpErase enzyme Inactivated Amplicon DNA

43 ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΗΣ ΛΟΓΩ DELETION ΣΥΝΔΡΟΜΟ WAARDENBURG

44 Real Time PCR Η end-point αναλυση δεν προσφέρεται για ποσοτική PCR διότι παρέχει πληροφορία στην φάση «plateau» όπου πλέον η αντίδραση δεν μπορεί να περιγραφεί με μαθηματική φόρμουλα. Δεν μπορούμε να συσχετίσουμε άμεσα το σήμα της end-point ανάλυσης με τη συνολική ποσότητα του DNA στόχου που είχαμε αρχικά στην αντίδραση. Κινητική της αντίδρασης PCR Τελική φάση της αντίδρασης (plateau) Φάση της εκθετικής αύξησης (log phase) Σημείο έναρξης της εκθετικής αύξησης Αρχική φάση αύξησης (background)

45 Αρχή της Real-time PCR Είναι η διαδικασία ενίσχυσης μιας DNA αλληλουχίας με τη μέθοδο της Αλυσιδωτής Αντίδρασης της Πολυμεράσης (PCR) και ταυτόχρονα της ανίχνευσης του παραγόμενου προϊόντος σε πραγματικό χρόνο καθ όλη τη διάρκεια της αντίδρασης (Real-time PCR), μέσω της χρήσης ειδικών φθοριζόντων χρωστικών που ενσωματώνονται στην αλληλουχία που ενισχύεται.

46 ΦΘΟΡΙΖΟΥΣΕΣ ΧΡΩΣΤΙΚΕΣ Ετεροκυκλικοί ή πολυαρωματικοί υδρογονάνθρακες. Fluorescein Hex

47 ΦΑΣΜΑ ΕΚΠΟΜΠΗΣ ΦΘΟΡΙΖΟΥΣΩΝ ΧΡΩΣΤΙΚΩΝ

48 LightCycler, PCR πραγματικού χρόνου Βασικές εφαρμογές Ποσοτικοποίηση και ποιοτική ανίχνευση Ανίχνευση μεταλλάξεων Χαρακτηρισμός προϊόντων

49 Real Time PCR Ανίχνευση του σήματος φθορισμού Το σημείο κατά το οποίο το κάθε δείγμα εισέρχεται στην εκθετική φάση της αντίδρασης, ορίζεται ως το «κατώφλι» μεταβολής του ρυθμού αύξησης της συγκέντρωσης του παραγόμενου προϊόντος (Threshold Cycle ή CT), είναι στατιστικά σημαντική και ανιχνεύεται ως σήμα φθορισμού. Η μεταβολή αυτή της συγκέντρωσης γίνεται σε συγκεκριμένο κύκλο και εξαρτάται απόλυτα από την αρχική συγκέντρωση του κάθε δείγματος.

50 Norm Fluorescence Growth Curve Variation 35,0 30,0 25,0 20,0 15,0 10,0 5,0 0,0 Quenching Efficiency Quantum Yield Ct Cycles Competition Primer Dimer Run out Probes Probe Concentration Target Concentratio n Run out Primer Target Concentration Run out Enzyme Quantum Yield Roche Molecular Diagnostics Version 2.0 September 2006

51 Έννοια της καμπύλης αναφοράς με βάση την κινητική της αντίδρασης της PCR Παράδειγμα Ενισχύουμε με την PCR τρία δείγματα συγκεντρώσεων, 10 6, 10 5 και 10 4 αντιγράφων. Όπως αναμένεται, όσο λιγότερα αντίγραφα περιέχονται στο δείγμα, τόσο περισσότεροι κύκλοι απαιτούνται για να εισέλθει η αντίδραση στην εκθετική της φάση και να ανιχνευθεί το παραγόμενο σήμα που αντιστοιχεί στην μεταβολή του ρυθμού αύξησης της συγκέντρωσης του παραγόμενου

52 Crossing Point (Cycles) Βασική Αρχή Ποσοτικοποίησης στο LightCycler Άγνωστο δείγμα N (copy number) Target N Cp Cp Cycles Καμπύλη αναφοράς (standard curve) N Cp Αγνωστο δείγμα! Cycles log (copy number)

53 Real Time PCR Όλα τα συστήματα real time που ανιχνεύουν και αξιολογούν τα προϊόντα της PCR βασίζονται στην ανίχνευση φθοριζουσών χρωστικών και στη συσχέτιση της έντασης του παραγόμενου σήματος φθορισμού με την ποσότητα του προϊόντος της PCR στην αντίδραση. Οι πλέον διαδεδομένες μέθοδοι real time χωρίζονται σε δύο κατηγορίες: 1) Sequence independent detection assays 2) Sequence specific probe binding assays

54 1. Sequence independent detection assay (2 primers 1 φθορίζουσα ελεύθερη ουσία) Αποδιάταξη Επανασύνδεση Επιμήκυνση Τέλος επιμήκυνσης Βασίζεται στη χρήση μιας φθορίζουσας ουσίας (συνήθως SYBR Green I) που ενσωματώνεται σε όλα τα δίκλωνα μόρια DNA ανεξαρτήτων αλληλουχίας βάσεων. Η φθορίζουσα ουσία φθορίζει κατεξοχήν όταν ενσωματώνεται στο DNA ενώ πρακτικά δεν φθορίζει όταν είναι ελεύθερη στο διάλυμα της PCR.

55 2. Sequence Specific Probe Binding Assays Οι μεθοδολογίες βασίζονται στη χρήση ολιγονουκλεοτιδικών ανιχνευτών που υβριδίζονται λόγω συμπληρωματικότητας των βάσεών τους με τον στόχο DNA, συνεπώς ανιχνεύουν μόνο το συγκεκριμένο προϊόν. Οι ανιχνευτές είναι σημασμένοι με φθοριοχρώματα που μας παρέχουν το σήμα της ανίχνευσης. Οι τεχνικές με χρήση σημασμένων ανιχνευτών υβριδισμού έχουν μεγάλη ειδικότητα Κύριοι αντιπρόσωποι α) Hybridization probe assay (HybProbe probes) β) Hydrolysis probe assay (TaqMan)

56 HYBRIDIZATION PROBE ASSAY Βασίζονται στην αρχή FRET (Fluorescence Resonance Energy Transfer) Τα μόρια Donor και Acceptor πρέπει να είναι σε κοντινές θέσεις (απόσταση 1-5 βάσεις) Το φάσμα απορρόφηση του Acceptor πρέπει να επικαλύπτει το φάσμα εκπομπής του Donor

57 Η μεθοδολογία με Hybridization probes είναι κατάλληλη για ποσοτική και ποιοτική PCR καθώς και για ανίχνευση σημειακών μεταλλάξεων (SNP s).

58 Ανίχνευση μεταλλάξεων, σχεδιασμός ανιχνευτών Απόλυτη ομολογία (perfect match) (mismatch) 3 1) Το σημασμένο στο 5 άκρο probe πρέπει να είναι φωσφορυλιωμένο στο 3 άκρο για να μην γίνει επέκταση με την πολυμεράση. Anchor Probe Mutation Probe 2) Tm mut.probe < Tm anchor probe 3) Tm anchor probe > Tm primers

59 Mismatch Perfect Match Temperature Low Medium High Υβριδισμός των ειδικών probe στον DNA στόχο. Ο φθορισμός ελαττώνεται όταν τα probe λόγω αύξησης της θερμοκρασίας απομακρύνονται από τη μήτρα DNA. Εάν υπάρχει αλλαγή σε μία βάση θα οδηγηθούμε σε θερμική αστάθεια του συμπλέγματος probe target. Οι θερμοκρασίες αποδιάταξης των ανιχνευτών με τη μήτρα DNA θα είναι διαφορετικές εφόσον υπάρχει σημειακή μετάλλαξη.

60 Χαρακτηρισμός Βάσει Τm Wild Type Mutant - Heterozygous

61 Relative fluorescence from HCV ΜΕΤΡΗΣΗ ΙΙΚΟΥ ΦΟΡΤΙΟΥ HCV HCV signal from 0 to 10 8 HCV-RNA copies/ml Cycle threshold (Ct) for 10 8 copies/pcr HCV-RNAlog copies/pcr Threshold None 0 Cycle Number

62 ΕΦΑΡΜΟΓΕΣ PCR Ποσοτική μέτρηση RNA ή DNA Κλινική Μικροβιολογία Γενετική Διαγνωστική Ανάλυση Πληθυσμών Αρχαιολογία Ιατροδικαστική Κλωνοποίηση Χαρακτηρισμός αγνώστων μεταλλάξεων Πολλαπλασιασμός αγνώστων αλληλουχιών DNA sequencing Ανάλυση γενώματος

63 Μειονεκτήματα Μοριακών Τεχνικών Πως η επιδημιολογία και το καλά οργανωμένο σύστημα υγείας δίνουν λύσεις σε κλινικά προβλήματα? ΣΟΥΗΔΙΑ Από το 1995 έως και το 2005 (10 έτη) οι στατιστικές ανά έτος εμφάνιζαν σταθερή αύξηση του ποσοστού χλαμυδιακών λοιμώξεων Τα έτη καταγράφεται αισθητή μείωση των χλαμυδιακών λοιμώξεων και μάλιστα στην πόλη Halland ( κάτοικοι) η μείωση της συχνότητος έφτασε το 25% Η πόλις Halland ήταν η πρώτη που υιοθέτησε μοριακές τεχνικές για ανίχνευση του Chlamydia trachomatis στο Νοσοκομείο της από το 1995 οι οποίες έως το 2006 συγκεκριμένη αλληλουχία DNA του κρυπτικού πλασμιδίου των Ct. (Abbott LCx Roche Amplicor PCR Abbott m200 real-time) ΕΡΩΤΗΣΗ: ΓΙΑΤΙ ΕΠΕΛΕΞΑΝ ΤΟ ΚΡΥΠΤΙΚΟ ΠΛΑΣΜΙΔΙΟ ΩΣ ΣΤΟΧΟ?

64 Η μείωση του επιπολασμού της χλαμυδιακής λοίμωξης θα μπορούσε να οφείλεται: 1.Πρόβλημα στην ποιότητα των αντιδραστηρίων 2.Αλλαγή σεξουαλικών συνηθειών 3.Αλλαγή στον στόχο DNA του μικροβίου.

65 Η έρευνα αποκάλυψε μια απαλοιφή (deletion) 377bp στο κρυπτικό πλασμίδιο των χλαμυδίων με αποτέλεσμα θετικά δείγματα να χαρακτηρίζονται μέσω του μοριακού ελέγχου Αρνητικά (False negative) Από το 2009 οι εταιρείες Roche Abbott χρησιμοποιούν multiplex PCR (2 στόχων)

66

67 MICROARRAYS Η χαρτογράφηση του ανθρώπινου γονιδιώματος (3,6 x 10 9 ζευγών βάσεων DNA) αποτελεί ένα τεράστιο επιστημονικό επίτευγμα. Ο αριθμός των υπαρχόντων γονιδίων πριν την ολοκλήρωση του προγράμματος υπολογιζόταν σε ενώ οι τελευταίες εκτιμήσεις κάνουν λόγο για γονίδια. Το λεγόμενο «άχρηστο» DNA που έχει εξελικτικά συντηρηθεί πάρα πολύ καλά τι ρόλο διαδραματίζει; (ENCODE PROJECT) Από τα υπάρχοντα γονίδια ποια εκφράζονται σε κάθε κύτταρο, πότε θα εκφραστούν και κάτω από ποιες συνθήκες και προϋποθέσεις είναι ερωτήσεις προς απάντηση στο άμεσο μέλλον. Είναι γνωστό ότι ορισμένα γονίδια ενέχονται σε μια σειρά σοβαρών ασθενειών, όπως διάφοροι τύποι καρκίνου, διαβήτης, καρδιοπάθειες, σχιζοφρένεια. Ο τρόπος όμως έκφρασης και λειτουργίας αυτών με την έννοια της κατανόησης της βιολογίας και λειτουργίας των κυττάρων σε φυσιολογικές και παθολογικές καταστάσεις παραμένει άγνωστος

68 MICROARRAYS Η συνεργασία επιστημονικών κλάδων όπως της Ιατρικής Χημείας Βιοχημείας Βιολογίας Φυσικής και Βιοπληροφορικής ανοίγει νέες προοπτικές για τη: Γενομική: (Genomics κλάδος επιστήμης που μελετά το γονιδίωμα ως σύνολο) και την Πρωτεομική: (Proteomics κλάδος επιστήμης που μελετά το σύνολο των πρωτεϊνών). Η σύζευξη γενετικής γενομικής πρωτεομικής θα βοηθήσει στη διαλεύκανση των βασικών μηχανισμών λειτουργίας του κυττάρου και των οργάνων, στη διερεύνηση της παθογένεσης των νόσων, κυρίως των πολυγονιδιακών, στην εξατομικευμένη θεραπευτική προσέγγιση τους αλλά και στη διαλεύκανση των μηχανισμών που οδηγούν στο γήρας. Η χρήση των DNA microarrays που επιτρέπει την ταυτόχρονη άντληση πληροφοριών από εκατοντάδες έως χιλιάδες γονίδια σε ένα μόνο πείραμα είναι ένα σημαντικό εργαλείο για την επίτευξη των ανωτέρω στόχων.

69 MICROARRAYS Καθορισμένη συστοιχία νουκλεϊκών οξέων, πρωτεϊνών, μικρών μορίων, που επιτρέπει παράλληλη ανάλυση πολύπλοκων βιοχημικών δειγμάτων. (Schena et. al., Science 270, ; 1995). 1. Laboratory Patrick Brown Stanford University Yeast microchip 2. Μέθοδος Affymetrix

70 MICROARRAYS 1. Laboratory Patrick Brown Stanford University Yeast microchip Πραγματοποίηση PCR αντιδράσεων για πολλαπλασιασμό όλων των γονιδίων. Ρομποτική εγκατάσταση θραυσμάτων DNA, προϊόντων της PCR, χαρακτηριστικών κάθε γονιδίου σε υάλινη επιφάνεια 2cm 2 σε συγκεκριμένες θέσεις. Μήκος θραύσματος μονόκλωνου DNA bp.

71 MICROARRAYS 2. Affymetrix Προσκόλληση χημικά παρασκευαζομένων ολιγονουκλεοτιδίων (25bp) με φωτολιθογραφική τεχνική σε συγκεκριμένες θέσεις σε chip σιλικόνης μεγέθους 1,28 cm 2

72 Κατασκευή microarrays με φωτολιθογραφική μέθοδο

73 Διαδικασία Κατασκευής: Ευαισθητοποίηση της περιοχής όπου μια νέα βάση προστίθεται AmpliChip Microarray Different masks are applied and a different base is added

74

75

76

77

78

79

80

81

82

83

84

85

86

87

88

89

90

91

92

93

94

95

96

97

98

99

100

101

102

103

104

105

106

107

108 Scientists rely on a technique called protein expression analysis to tell them if the mrna is being translated into protein

109 ΚΑΤΗΓΟΡΙΕΣ DNA MICROARRAYS 1. MICROARRAY EXPRESSION CHIP 2. MICROARRAY SNP CHIP

110 MICROARRAY EXPRESSION CHIP 25 mer probes, γονίδια, probes.

111 MICROARRAY EXPRESSION CHIP

112 Απρίλιος 2010 Περιοδικό Cancer Research ΔΕΔΟΜΕΝΑ Οι όγκοι ανταποκρίνονται διαφορετικά στην ακτινοθεραπεία Η ακτινοθεραπεία συνεισφέρει σε ποσοστό 40% των περιπτώσεων όπου ο όγκος εξαλείφεται. ΖΗΤΟΥΜΕΝΟ Εύρεση στόχων που θα βελτιώσουν το αποτέλεσμα της ακτινοθεραπείας.

113 Απρίλιος 2010 Περιοδικό Cancer Research ΠΡΟΣΕΓΓΙΣΗ ΕΡΕΥΝΗΤΩΝ 1. Συγκριτική μελέτη έκφρασης 200 γονιδίων που ενέχονται στην επισκευή του DNA σε όγκους και υγιείς ιστούς. 2. Διαπίστωση ότι το γονίδιο POLQ εκφράζεται έντονα σε καρκινικά κύτταρα σε αντίθεση με υγιή. 3. Έλεγχος knockdown του γονιδίου με χρήση small interfering RNA (sirna)* = Επιτυχής. 4. α) Μελέτη της συμπεριφοράς καρκινικών κυτταρικών σειρών με αρχική αντίσταση στην ακτινοβολία και knockdown του γονιδίου POLQ. ΕΥΡΗΜΑ Τα καρκινικά κύτταρα αποδεικνύονται ευπαθή στην ακτινοβολία. * Nobel 2006

114 Απρίλιος 2010 Περιοδικό Cancer Research 4. β) Μελέτη υγιών κυττάρων που έχουν υποστεί knockdown του γονιδίου στην ανταπόκριση τους στην ακτινοβολία ΕΥΡΗΜΑ Δεν επηρεάζονται από την ακτινοβολία. ΣΥΜΠΕΡΑΣΜΑ Η ΑΝΑΣΤΟΛΗ ΤΗΣ ΕΚΦΡΑΣΗΣ ΤΟΥ ΓΟΝΙΔΙΟΥ POLQ ΜΠΟΡΕΙ ΝΑ ΧΡΗΣΙΜΟΠΟΙΗΘΕΙ ΚΛΙΝΙΚΑ ΓΙΑ ΕΥΑΙΣΘΗΤΟΠΟΙΗΣΗ ΟΓΚΩΝ ΣΤΗΝ ΑΚΤΙΝΟΘΕΡΑΠΕΙΑ

115 MICROARRAY SNP CHIP Ανίχνευση (SNPs) και copy number variation (CNV) σε ένα πείραμα. Εφαρμογή: Συσχέτιση SNPs προτύπου με συγκεκριμένες ασθένειες, Εξατομικευμένη φαρμακευτική προσέγγιση. Π.χ. Roche Amplichip. Μεταβολισμός φαρμάκων CYP450

116 AmpliChip CYP450 Test Intended Use Performs genotyping of two Cytochrome P450 genes: 2D6 and 2C19 Distinguishes 29 polymorphisms in the 2D6 gene, including gene duplication and deletion Distinguishes 2 major polymorphisms in the 2C19 gene Provides predictive phenotype of the associated enzymatic activities

117 4 Types of Metabolizers (II) Metabolizer Status Genotype Response to average daily dose Ultrarapid Conc. Time = Adverse Events = Therapeutic Window = Ineffective Extensive normal activity Intermediate Poor reduced activity no activity

118 Examples: Dose recommendations for antidepressants Drug Usual Dose (mg) Dose Adjustment (based on metabolizer type) Poor Intermediate Extensive Ultra-rapid Tricyclics Amitriptyline 150 (50-150) 50 % (90 %) 120 % Clomipramine 150 ( ) 60 % (90 %) 120 % Desipramine 150 (10-100) 30 % 30 % 130 % 260 %* Fluvoxamine 100 (100) 90 % (100 %) 110 % Imipramine 150 (25-100) 30 % (80 %) 130 % Nortriptyline* 50 (25-150) 50 % 70 % 140 % 230 % SSRI Fluoxetine* 20 (20-60) 70 % (90 %) 110 % Paroxetine 20 (30) 70 % (90 %) 110 % Mixed-Function Venlafaxine 150 (20-225) 20 % (80 %) 130 % * single dose recommendations; recommendations in brackets are estimations and require clinical confirmation Kirchheiner et al, (2001) Acta Psychiat. Scand. 104: 173

119 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Α) Αλληλεπίδραση Ξενιστή Παθογόνου 1) Επίδραση ξενιστή στη έκφραση του παθογόνου Pseudomonas aeruginosa Genome assay: Ανακάλυψη γονιδίων που απενεργοποιούνται και τα οποία επάγουν την βιοσύνθεση μαστιγίων στη Ψευδομονάδα. Τα μαστίγια προκαλούν ανοσολογική ανταπόκριση από τον ξενιστή εξαφάνιση μαστιγίων = αποφυγή αμυντικού μηχανισμού ξενιστή. 2) Επίδραση παθογόνου στην έκφραση του ξενιστή

120

121 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ Β) Ανίχνευση παθογόνων ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Wilson et.al.: Multi-Pathogen Identification microarray (MPID), Ανίχνευση 18 παθογόνων προκαρυωτικών ευκαρυωτικών - μυκήτων

122 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ Β) Ανίχνευση παθογόνων ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Ανίχνευση και τυποποίηση 34 τύπων ιού HPV με microarrays (Genomedica)

123 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ Β) Ανίχνευση παθογόνων ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Τυποποίηση στελεχών: Microarray Bacillus anthracis για να διαχωρισθεί αν το στέλεχος είναι προϊόν γενετικής μηχανικής ή όχι

124 21 ος ΑΙΩΝΑΣ Φθορίζοντα αντισώματα ή φθορίζοντα ολιγονουκλεοτίδια

125

126

127 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Γ) Έλεγχος ευαισθησίας σε λοιμώξεις Με τη χρήση microarray για SNPs ικανές για ταυτόχρονη μελέτη πολυμορφισμών και άλλων τύπων microarray μπορούν να εξαχθούν συμπεράσματα για ομάδες γονιδίων που συνδέονται με αντοχή ή ευπάθεια σε λοιμώξεις. π.χ 1) Μεταλλάξεις στο CKR5 human co-recoptor για τον ιό HIV οδηγούν σε αυξημένη αντίσταση στη λοίμωξη. 2) Ομόζυγοι φορείς του γονιδίου που εκφράζει την ανενεργή caspase 12 (ωρίμανση κυτοκινών από μίτωση) κινδυνεύουν 8 φορές λιγότερο να εμφανίσουν βακτηριαιμία και 8 φορές λιγότερο να πεθάνουν από σηψαιμία, σε σχέση με τους ομόζυγους φορείς της ενεργούς μορφής. ΣΙΩΠΗΣΗ ΓΟΝΙΔΙΟΥ = ΕΞΕΛΙΚΤΙΚΟ ΠΛΕΟΝΕΚΤΗΜΑ Συχνότητα γονιδίου 28% στην Υποσαχάρια - Αφρική. Στις γυναίκες τα οιστρογόνα μπλοκάρουν την έκφραση του γονιδίου.

128 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Δ) Γενετική ποικιλομορφία Ξενιστή και θεραπευτική προσέγγιση Μελετήθηκαν 143 ασθενείς με φλεγμονή από Helicobacter pylori Όλοι έλαβαν τριπλό θεραπευτικό σχήμα 1 εβδομάδος. Οι 50 που μετά τη θεραπεία συνέχιζαν να είναι θετικοί ήσαν ομόζυγοι ή ετερόζυγοι για τον γονότυπο CYP2C19 που χαρακτηρίζει τους ταχείς μεταβολιστές του φαρμάκου.

129 ΕΦΑΡΜΟΓΕΣ MICROARRAYS ΣΕ ΛΟΙΜΩΔΗ ΝΟΣΗΜΑΤΑ Ε) Σχεδιασμός Εμβολίων

130 ΕΡΩΤΗΜΑ Μπορούν περιβαλλοντικοί παράγοντες όπως η διατροφή και η μητρική στοργή να προκαλέσουν επιγενετικές μεταβολές στο DNA και να αλλάξουν τη γονιδιακή έκφραση σε γενετικά δίδυμους οργανισμούς οδηγώντας τελικά σε διαφορετικό φαινότυπο;

131 Το κύκλωμα του stress HPA Axis Στρεσσογόνα σήματα ακολουθούν την πορεία Υποθάλαμος - Υπόφυση - Επινεφρίδια κατευναστικό σήμα για να κλείσει το κύκλωμα Κορτιζόλη (+ αδρεναλίνη) Ιππόκαμπος Cortisol + GR

132 ΦΡΟΝΤΙΔΑ & ΣΤΟΡΓΗ Αμέσως μετά τη γέννηση, μεθυλομάδες προκαλούν σίγηση του γονιδίου GR receptor στα εγκεφαλικά κύτταρα όλων των αρουραίων Κατά τη διάρκεια της πρώτης εβδομάδος η ανελλιπής μητρική φροντίδα προκαλεί απελευθέρωση χημικών ουσιών στον εγκέφαλο του νεογέννητου αρουραίου. Οι χημικές αυτές ουσίες ενεργοποιούν μονοπάτια μοριακής σηματοδότησης τα οποία αφαιρούν από το DNA τις μεθυλομάδες Αποτέλεσμα: Ενεργοποίηση του γονιδίου GR receptor και παραγωγή της πρωτεΐνης GR (Glucocorticoid receptor) ΟΣΟ ΜΕΓΑΛΥΤΕΡΗ ΦΡΟΝΤΙΔΑ ΤΟΣΟ ΜΕΓΑΛΥΤΕΡΗ ΠΑΡΑΓΩΓΗ ΠΡΩΤΕΪΝΗΣ GR

133 ΔΙΑΤΡΟΦΗ Στην κοινωνία των μελισσών η βασίλισσα και οι εργάτριες μοιράζονται το ίδιο ακριβώς γενετικό υλικό ωστόσο ο φαινότυπος ως προς τη συμπεριφορά, το μέγεθος, τη φυσιολογία, την εμφάνιση και το χρόνο ζωής διαφέρουν δραματικά. Η γονιδιακή ανάλυση αποκάλυψε ότι η διαφορά έγκειται στην μεθυλίωση πολλών γονιδίων στις εργάτριες με αποτέλεσμα την μη έκφρασή τους. Σε επίπεδο λάρβας το φαινόμενο της μεθυλίωσης είναι αντιστρεπτό και εξαρτάται πλήρως από την τροφή. Ο βασιλικός πολτός περιέχει ουσία που αναστέλλει το ένζυμο cytosine methyltransferase το οποίο είναι υπεύθυνο για τη μεθυλίωση του DNA των μελισσών

134 ΛΑΡΒΑ Νέκταρ Βασιλικός πολτός Εργάτρια μέλλισα Βασίλισσα μέλλισα

135 Χαρτογράφηση γονιδιακής έκφρασης του ανθρώπινου εγκεφάλου Allen Brain Atlas Project gene probes αναλυση όλων των γνωστών γονιδίων 1000 τομές / εγκέφαλο (500 τομές / ημισφαίριο) $ κόστος Τα αποτελέσματα της γονιδιακής έκφρασης αποδίδονται σε συνδυασμό με ιστολογική μελέτη σε 3D απεικόνιση βασισμένη σε MRI

136

137 Πόσο βέβαιοι μπορεί να είμαστε για τις νέες θεωρίες που περιγράφουν βιολογικά συστήματα; «Οσες αναφέρονται στην πραγματικότητα δεν είναι βέβαιες και όταν είναι βέβαιες δεν αναφέρονται στην πραγματικότητα» Albert Einstein

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ - - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

PCR quantitative PCR (qpcr)

PCR quantitative PCR (qpcr) PCR quantitative PCR (qpcr) Ε. Λιανίδου, Ph.D. Καθηγήτρια Εργαστήριο Αναλυτικής Χημείας, Τμήμα Χημείας, Πανεπιστήμιο Αθηνών lianidou@chem.uoa.gr DNA A:T (2 δεσμοί Η), C:G (3δεσμοί Η) Αλυσιδωτή αντίδραση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ

Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΖΟΜΕΝΟΥ DNA ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Τεχνολογία ανασυνδυαζόμενου DNA ή Γενετική Μηχανική Κατασκευή τεχνητών μορίων DNA (ανασυνδυασμένο DNA) Τροποποίηση γονιδιωμάτων Μεταφορά γονιδίου/ων

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ:

ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ: ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ: Ανάλυση γονιδιακών πολυμορφισμών Σταυροπούλου Χρύσα,PhD Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας Ινστιτούτο Πυρηνικής

Διαβάστε περισσότερα

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.

Αρχές PCR και υβριδισμού. Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa. Αρχές PCR και υβριδισμού Ιωσήφ Παπαπαρασκευάς Βιοπαθολόγος, Λέκτορας ΕΚΠΑ Εργαστήριο Μικροβιολογίας, Ιατρική Σχολή Αθηνών ipapapar@med.uoa.gr Ιστορικά στοιχεία Πρώτη αναφορά in vitro ενζυματικής αντίδρασης

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Η ΧΡΗΣΗ ΤΗΣ REAL TIME PCR (RT- PCR) ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΩΝ ΣΤΕΛΕΧΩΝ ΒΑΚΤΗΡΙΟΥ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΜΕΡΟΣ ΠΡΩΤΟ - ΠΕΡΙΓΡΑΜΜΑ 5.1 ΈΝΑ ΝΟΥΚΛΕΙΝΙΚΟ ΟΞΥ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΤΕΣΣΕΡΑ ΕΙΔΗ ΒΑΣΕΩΝ, ΠΟΥ ΠΡΟΣΔΕΝΟΝΤΑΙ ΣΕ ΈΝΑ ΚΟΡΜΟ ΣΑΚΧΑΡΩΝ ΦΩΣΦΟΡΙΚΩΝ 5.2 ΈΝΑ ΖΕΥΓΟΣ

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA Microarrays Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA όμως του οργανισμού είναι μια στατική πληροφορία

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Γενική Μικροβιολογία Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ

ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΤΕΥΘΥΝΣΗ: ΖΩΪΚΗΣ ΠΑΡΑΓΩΓΗΣ Η ΤΕΧΝΙΚΗ ΤΗΣ PCR ΣΤΗ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Το γονιδίωμα περιλαμβάνει τόσο τα γονίδια όσο και τις μη κωδικοποιούσες ακολουθίες DNA. Ο όρος προτάθηκε το 1920 από τον καθηγητή Hans

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

Μετάλλαξη και Ανασυνδυασμός

Μετάλλαξη και Ανασυνδυασμός BIOΛOΓIA TΩN MIKPOOPΓANIΣMΩN ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Μετάλλαξη και Ανασυνδυασμός Μετάλλαξη ή μεταλλαγή είναι οποιαδήποτε κληρονομήσιμη αλλαγή της αλληλουχίας των βάσεων του νουκλεϊκού οξέος, που

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο E M E D N L C SCIENCES BIOMEDICAL E N T E R Kέντρο Μέντελ για Βιοιατρικές Επιστήμες Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο Βασίλειος Τάνος MD PhD www.mendelcenter.org Picture taken from leaflet

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Σ. Κυρτόπουλος Ινστιτούτο Βιολογικών Ερευνών & Βιοτεχνολογίας Εθνικό Ίδρυμα Ερευνών Συμβολή περιβαλλοντικών

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα