Barriers to HIV Cure 5/2/2016. Janet M. Siliciano, PhD Associate Professor of Medicine Johns Hopkins University School of Medicine Baltimore, Maryland

Transcript

1 5/2/206 Barriers to HIV Cure Janet M. Siliciano, PhD Associate Professor of Medicine Johns Hopkins University School of Medicine Baltimore, Maryland FINAL: Washington, DC: April 5, 206 Financial Relationships With Commercial Entities Dr Siliciano has no relevant financial affiliations to disclose. (Updated 04/4/6) Slide 2 of 54 Learning Objectives After attending this presentation, participants will be able to: Describe how the latent reservoir for HIV arises List current approaches to curing HIV infection Describe how these approaches will be evaluated clinically Slide 3 of 54

2 5/2/206 How does early ART affect likelihood of cure? 69%. Smaller latent reservoir 8% 3% 2. More rapid reservoir decay 3. No effect Slide 4 of 54 How is the latent reservoir best measured? 52%. Viral outgrowth assay 27% 8% 3% 2. DNA PCR assays 3. Plasma HIV RNA 4. Western blot Slide 5 of 54 Viral dynamics in patients on ART Slide 6 of Start ART v + t /2 = day Limit of Detection (50 copies/ml) t /2 = 4 days Time on ART (d) Activated CD4 + T cells Eradication in 2-3 years 2

3 5/2/206 Physiology of resting and activated CD4 + T cells Slide 7 of 54 Establishment of immunologic memory Slide 8 of 54 HIV infection of activated and resting CD4 + T cells Slide 9 of 54 HIV HIV HIV 3

4 5/2/206 Establishment of the latent reservoir in resting CD4 + T cells Slide 0 of 54 HIV NFκB sites in the HIV LTR Slide of 54 U 3 R U 5 Modulatory region Enhancer Core Cell DNA AP NFAT USF Ets LEF NF B NFAT Sp TBP LBP Nabel G, et al. Nature. 987;326:7-73. Tong-Starksen SE, et al. PNAS. 987;84:6845:6849. Bohnlein E, et al. Cell. 988;53: Duh EJ, et al. PNAS. 989;86: Reactivation of latent HIV Slide 2 of 54 HIV 4

5 Frequency (per 0 6 cells) - 5/2/206 An assay for latently infected cells ml blood Slide 3 of 54 Purified resting CD4 + T cells PHA + irradiated allogeneic PBMC /,000,000 p24 d2: add CD4 + lymphoblasts from HIVdonors d7: add CD4 + lymphoblasts from HIVdonors Chun et al., Nature, 997 Finzi et al., Science, 997 Slow decay of latently infected CD4 + T cells Slide 4 of Time to eradication > 73.4 years Time on ART (years) Finzi et al., Nature Med., 999 Siliciano et al., Nature Med., 2003 Slow decay of the reservoir Slide 5 of 54 t /2 = 44 months Siliciano et al., Nature Med., 2003 t /2 = 43 months Crook et al, JID 205 5

6 5/2/206 Latency results from infection of memory precursor cells Slide 6 of 54 Deng et al., submitted Start Therapy Limit of Detection (50 copies/ml) Residual viremia copy/ml HAART years Time on HAART (days/years) Slide 7 of 54 Sensitive to current regimen Archival Non-evolving Hermankova et al, JAMA, 200 Persaud et al, J Virol, 2003 Kieffer et al, J Infect Dis, 2004 Nettles et al, JAMA, 2005 Bailey et al, J Virol, 2006 Brennan et al, J Virol, Start Therapy Limit of Detection (50 copies/ml) Residual viremia cannot be reduced by treatment intensification Residual viremia copy/ml HAART Add 4 th drug years Time on HAART (days/years) Dinoso et al, PNAS, 2009 Many later raltegravir intensification studies Slide 8 of 54 6

7 5/2/206 The first cure Host immune system, including latently infected cells, largely eliminated by condition regimen (chemo + irradiation and by graft vs host disease. Donor cells protected from HIV infection due to absence of CCR5 Slide 9 of 54 Boston Patient B Below limit of detection Slide 20 of 54 0,000,000,000000,000 0,000 0 Matched allogeneic HSCT TDF FTC RAL Stop ART Time after Rx interruption (months) Henrich et al, JID, 203,000000,000 0, The Mississippi baby ART discontinued Below limit of detection AZT 3TC These LPV/r delayed rebound cases prove that HIV can persist in a latent form for years and then begin >2 years to replicate Months after Birth Slide 2 of 54 Persaud D et al., NEJM 203 7

8 5/2/206 Approaches to HIV cure Slide 22 of 54 pathway agonists Gene Rx LRAs (HDACi) Shock and kill Prevent reactivation Induce elite control Other approaches to HIV cure Slide 23 of 54 Gene Editing Strategies used in Cure Research: target integrated provirus with engineered nucleases (ZFN,TALENS,) or CRISPR/Cas9 xx Problems No way to deliver enzymes into every infected cell in vivo Off target effects Other approaches to HIV cure Slide 24 of 54 Gene Rx ZFN targeting CCR5 gene in patient CD4+ T cells or HSC. Reinfuse engineered, HIV-resistant cells back into patients xx Problems HIV can still replicate in non-engineered cells. (In Berlin patient, CCR5+ host cells eliminated by conditioning regimen and graft vs. host effects) 8

9 5/2/206 Fundamental approach to HIV cure Slide 25 of 54 pathway agonists How do we identify latency reversing agents? LRAs (HDACi) Will cells be eliminated following reversal of latency? How do we measure the reservoir in eradication trials? pathway agonists LRAs (HDACi) Current status of LRA trials Numerous LRAs identified in studies with transformed cell lines and primary T cell model systems Few shown to work ex vivo with cells from patients In clinical trials, no reduction in the reservoir yet demonstrated In clinical trials, evidence for increases in cell-associated HIV RNA (Archin et al.) Some evidence for slight transient increases in plasma HIV RNA after LRA treatment (romidepsin, panobinostat, TLR7 agonist) Slide 26 of 54 Assay for reversal of latency using patient resting CD4 + T cells Slide 27 of x0 6 resting CD4 + T cells +Test compound LRA Positive control agonist 5 x 0 6 cells/well Measure intracellular HIV RNA and virion release Shan et al, J Virol, 203 Laird et al, PLOS Pathogens, 203 Bullen et al., Nature Med, 204 9

10 Percent PMA + ionomycin % Percent of PMA/ionomycin + 5/2/206 Induction of HIV RNAs by LRAs Slide 28 of 54 Total RNA polya primers 8 hrs DMSO Control Vorinostat Romidepsin Panobinostat Disulfiram JQ Bryostatin- PMA + Ionomycin Bullen et al, Nat Med 204 Induction of HIV RNAs by combinations of LRAs Slide 29 of 54 Single Single LRA LRA + Bryostatin- + Bryostatin- + Prostratin + Prostratin Single LRA + Bryostatin- + Disulfiram Dis ram JQ Dis ram JQ Panobinostat Romidepsin Panobinostat Vorinostat Romidepsin Vorinostat Bryostatin- Prostratin Bryostatin- Prostratin Dis ram JQ Dis ram JQ Panobinostat Romidepsin Panobinostat Vorinostat Romidepsin Vorinostat Panobinostat Romidepsin Panobinostat Vorinostat Romidepsin Laird et al, in preparation Vorinostat Romidepsin Romidepsin Fundamental approach to HIV cure Slide 30 of 54 pathway agonists How do we identify latency reversing agents? LRAs (HDACi) Will cells be eliminated following reversal of latency? How do we measure the reservoir in eradication trials? 0

11 Surviving infected cells (%) Surviving infected cells (%) Residual GFP+ cells (%) 5/2/206 Fate of infected CD4 cells after latency reversal in vivo is unknown Slide 3 of 54 pathway agonists HDACi 20 HDACi αcd3+αcd Days after reactivation Shan et al, Immunity, 202 CTL killing of latently infected cells treated with SAHA Normal donor Normal donor 2 Normal donor 3 Slide 32 of Elite suppressor Elite suppressor 2 Elite suppressor Time of coculture (days) E:T = : Shan et al, Immunity, 202 CTL killing of latently infected cells treated with SAHA Normal donor Normal donor 2 Normal donor 3 Slide 33 of Time of coculture (days) E:T = : Elite suppressor Elite suppressor 2 Elite suppressor 3 HAART patient HAART patient 2 HAART patient 3 HAART patient 4 HAART patient 5 HAART patient 6 Shan et al, Immunity, 202

12 Frequency of variants (%) 5/2/206 CTL escape variants dominate in the latent reservoir of chronic patients GK9 EV9 SL9 TV9 EI8GLY9 DL9 FK0 WF9 SL9 TV9 TL9 HA9 PY9 VI9 FK0 0 KK9 RK9 SV9 TL9 HA9 GL KK9 RK9 LY9 SV9 TL9 HA9 GL RY VL8 TW0 YL9 QW9 LY9 IW9 KF TW0 QW9 Acute Pt0 A*02:0 Chronic Pt 8 A*02:0 Acute Pt 2 A*03:0 Chronic Pt 39 A*03:0 Acute Pt07 B*58:0 Chronic Pt2 B*57:0 Slide 34 of 54 CTL epitopes in HIV- Gag Documented Escape Diminished Response MutationType Not Determined Deng et al, Nature, 205 Fundamental approach to HIV cure Slide 35 of 54 pathway agonists How do we identify latency reversing agents? LRAs (HDACi) Will cells be eliminated following reversal of latency? How do we measure the reservoir in eradication trials? An assay for latently infected cells ml blood Slide 36 of 54 Purified resting CD4 + T cells PHA + irradiated allogeneic PBMC /,000,000 p24 d2: add CD4 + lymphoblasts from HIVdonors d7: add CD4 + lymphoblasts from HIVdonors Chun et al., Nature, 997 Finzi et al., Science, 997 2

13 Infected cell frequency (per 0 6 ) 5/2/206 Assays for latent HIV Slide 37 of 54 Viral outgrowth assay (VOA) agonist DNA PCR PCR for proviral DNA Induction of HIV RNA Induction of virion production agonist agonist Measure intracellular HIV RNA Measure virion release Viral outgrowth vs PCR assays Slide 38 of 54 Viral Total HIV 2 LTR Residual Assay outgrowth Total HIV DNA Integrated HIV DNA DNA circles viremia Cell/tissue 0,000, PBMC Plasma Resting CD4 PBMC Resting CD4 PBMC Resting CD4 Rectal CD4 300x r = 0.38 r = 0.70 r = 0.4 r = 0.05 p = 0.28 p < 0.0 p = 0.3 p = 0.86 rho = 0.9 p = 0.3 0,000 rho = 0.07,000 p = Plasmas HIV RNA (copies/ml) Cohort Chronic Acute Chronic Acute Chronic Acute Chronic Acute Chronic Acute Chronic Acute Chronic Acute Chronic Acute Eriksson et al, PLOS Pathogens, 203 Non-induced proviruses Slide 39 of 54 Resting CD4 + T cells Non-induced proviruses PHA + irradiated allogeneic PBMC full length, single genome analysis Are they inducible? d2: add CD4 + lymphoblasts from HIVdonors d7: add CD4 + lymphoblasts from HIVdonors Ho et al, Cell, 203 p24 3

14 5/2/206 Non-induced proviral clones (n=23) Slide 40 of 54 NH2 N O N O HN O N TGG Trp TAG Stop Hypermutated 32.4% Ho et al, Cell, 203 Slide 4 of % of non-induced proviruses have lethal 0 G A hypermutation B.FR.83.HXB2_LAI_IIIB_BRU_K034 9CC3_3E5_gag_hypermut Pt 09 clone 3E05 9CC3_3E_gag_hypermut Pt 09 clone 3E 20CB4_36D2_gag_hypermut Pt clone 36D2 20TB_33C3_gag_hypermut Pt clone 33C03 20TB_33C9_gag_hypermut Pt clone 33C09 20TB3_33G0_gag_hypermut Pt clone 33G0 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACAT..A...A...A...A...A...C...A...C.....AA...A...A.A...A...AA...A...C...AAA...C.....A...C...A...A...G...A...C...GG.....A...C...A...A...G...A...C...GG.....A...C...A...A...G...A...C...GG.....A...A.A...C...A...A...AA...C...GG ATG ATA B.FR.83.HXB2_LAI_IIIB_BRU_K034 TAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCAT B.FR.83.HXB2_LAI_IIIB_BRU_K034 MGARASVLSGGELDRWEKIRLRPGGKKKYKLKHIVWASRELERFAVNPGLLETSEGCRQILGQLQPSLQTGSEE M I 9CC3_3E5_gag_hypermut...G...A...T...A...CT...A..G...G... 9CC3_3E5_gag_hypermut Pt 09 clone 3E05 I...I..E...*...L...G...A... start codon mutation 9CC3_3E_gag_hypermut...A...G...AA..A...T...A...A...CT...AA.G...G... 9CC3_3E_gag_hypermut Pt 09 clone 3E IS...I..R...*...Q...K...L.*.GK...S...A...R...R... 20CB4_36D2_gag_hypermut...A...G...G...A...G 20CB4_36D2_gag_hypermut Pt clone 36D2 I...Q...*.R...N.R...AG...E...A.K... 20TB_33C3_gag_hypermut...A...G...G...A...G TGG TAA, TAG, TGA 20TB_33C3_gag_hypermut Pt clone 33C03 I...Q...*.R...N.R...AG...E...A.K... 20TB_33C9_gag_hypermut...A...G...G...A...G Tryptophan stop codon 20TB_33C9_gag_hypermut Pt clone 33C09 I...Q...*.R...N.R...AG...E...A.K... 20TB3_33G0_gag_hypermut...A...A...G...G...A.A...G nonsense mutation 20TB3_33G0_gag_hypermut Pt clone 33G0 I...R.Q...*...E.N.R...K...AG...E...A.K Ho et 260 al, Cell, % of non-induced proviruses have large internal deletions Slide 42 of 54 NH2 N O N O HN O N TGG Trp TAG Stop Large internal deletion 45.5% Hypermutated 32.4% Ho et al, Cell, 203 4

15 p24 (ng/ml) 5/2/206 Deletions and hypermutation Slide 43 of 54 LTR gag tat vif LTR vpu rev nef gag pol env vpr Pt. KB7 Pt. KB6 Pt. KB5 Pt. KB3 Pt. KB8 Bruner et al, submitted Non-induced Non-induced proviral proviruses clones (n=23) Nonsense mutations/ INDELS 3.8% Deletion in ψ/ MSD site 6.5%.7% Intact genome O N NH2 N TGG Trp O HN O N TAG Stop Slide 44 of 54 Large internal deletion 45.5% Hypermutated 32.4% Ho et al, Cell, 203 Replication Replication capacity of of intact intact non- non-induced proviruses Patient 0 Patient Patient 6 Patient Time post infection (days) NL4-3 Rep-Comp Intact noninduced Slide 45 of 54 5

16 5/2/206 Size of latent reservoir Slide 46 of 54 HIV DNA 62 fold VOA Intact Scale=/0 6 Ho et al, Cell, 203 Can intact non-induced proviruses be induced? ml blood Slide 47 of 54 Purified resting CD4 + T cells PHA + irradiated allogeneic PBMC Recover cells from negative wells p24 d2: add CD4 + lymphoblasts from HIVdonors d7: add CD4 + lymphoblasts from HIVdonors Ho et al, Cell, 203 Can intact non-induced proviruses be induced? Slide 48 of 54 Resting CD4 + T cells + 47% 53% + PHA+ allo PBMC - 39% 6% + PHA+ allo PBMC - 39% 6% PHA+ allo PBMC - Ho et al, Cell, 203 Nina Hosmane 6

17 Log reduction in latent reservoir 5/2/206 Take home points There is no clinical assay for the latent reservoir Slide 49 of 54 DNA PCR assays widely used for reservoir analysis mainly defect grossly defective proviruses The quantitative viral outgrowth assay remains the best available assay for the latent reservoir, but better assays are urgently needed. Other approaches: transient blips following LRA administration, time to rebound after ART interruption Predicting time to rebound after reservoir reductions Slide 50 of 54 Hill et al, PNAS Time to rebound Boston Boston pt. A pt. B Miss. baby Berlin pt. Slide 5 of Chun et al. 2 wk mo 3 mo yr 0 yr Lifetime Time to rebound Hill et al, PNAS 204 7

18 Plasma HIV RNA (copies/ml) 5/2/206 What will cure look like? Slide 52 of 54,000,000,000 Therapeutic vaccination cart 0,000 clras 0 (weeks) (years) Time Post Infection Slide 53 of 54 Ya-Chi Ho Robert Siliciano Korin Bullen Liang Shan Kai Deng Greg Laird Thanks Slide 54 of 54 Collaborators Steve Deeks Richard Flavell Dave Margolis Joel Gallant Joe Cofrancesco Doug Richman Martin Nowak Matt Strain Sarah Palmer Una O Doherty Steve Yukl John Mellors Funding NIH: Martin Delaney Collaboratories CARE and DARE Howard Hughes Medical Institute Foundation for AIDS Research (amfar): ARCHE Johns Hopkins Center for AIDS Research Bill and Melinda Gates Foundation 8