43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232 a/ b, 9 11 C, 27 52, 55 58 (CK2) : cab2bo1 DNA cab 85 % 89 %, cab : ; a/ b ( cab) ; ; :S718146 ; Q94312 :A :1001-7488(2007) 03-0034 - 05 Cloning and Characterization of a Full2Length Gene Encoding the Light Harvesting Chlorophyll a/ b2binding Protein in Bamboo Gao Zhimin 1 Li Xueping 1 Peng Zhenhua 2 Yue Yongde 1 (11 Key Laboratory of Bamboo and Rattan Science and Technology of State Forestry Administration International Center for Bamboo and Rattan Beijing 100102 ; 21 Research Institute of Forestry, CAF Beijing 100091) Abstract : A full2length cdna of cab gene was cloned from the first strand of bamboo( Bambusa oldhamii) cdna through RT2 PCR and RACE methods, named as cab2bo1 ( cab gene from B. oldhamii). The length of cab2bo1 ( GenBank accession number :EF061137) is 1 102 bp,which contains an open reading frame encoding 265 amino acids from 64 th to 861 th position. The bioinformatics analysis indicated that the protein encoded by cab2bo1 has a chlorophyll a/ b binding domain ( 64 th 232 th position),a protein kinase C phosphorylation site (9 th 11 th position), a ubiquitin domain signature (27 th 52 th position),and a casein kinase II phosphorylation site(55 th 58 th position). The DNA sequence and encoding amino acid sequence of cab2bo1 showed high similarity with the cab genes of Triticum aestivum, Musa acuminata, Zea mays and Oryza sativa, more than 85 % and 89 % repectively. The result indicates a clue that cdna of cab family genes are conserved. Key words : bamoo ( Bambusa oldhamii ) ; light harvesting chlorophyll a/ b2binding protein ( cab ) ; gene cloning ; characterization, ( Phyllostachys edulis) 1181 10 4 2100 10 4 mg CO 2 dm - 2 a - 1 (,2000) 9 1 2, 1 5, 2 570 913 lx (,2001) ( Phyllostachys praecox f. prevernalis) ( Bambusa oldhamii), (,2001 ;,2003) :2006-11 - 10 : 948 (2005-4 - 38 ; 2004-4 - 58 ; 2004-4 - 60) 3
3 : a/ b 35 (Raghvendra, 1998), (,2000) 1 111 RNA cdna Invitrogen Trizol reagent ( ) RNA( Gao et al.,2006), Promega cdna Clontech SMART TM RACE 3 cdna 112 a/ b PCR, 1 : 5 2AGCATCTGGTATGGACCTGAC23 ; 2 : 5 2CCTGGACGAAGAATCCGAACA23 ; 3 : 5 2GCATCGCCCTCGTTAGAAC23 ; 4 : 5 2GTCGTGCGTGGCTACTACAAG23 ; 5 : 5 2CGTGCTCTACCTCGGTCCGCTCTCC23 ; 6 : 5 2TGACCCCGAGACCTTCGCTAAGAACCGC23 cdna, PCR 1 2 :94 5 min ; 94 1 min,55 65 1 min,72 115 min,39 ; 72 10 min 1 4 :94 5 min ; 94 1 min,55 65 1 min,72 2 min,39 ; 72 10 min 2 3 :94 5 min ; 94 1 min,55 60 1 min,72 2 min,39 ; 72 10 min 3 4 :94 5 min ; 94 1 min,55 60 1 min,72 115 min,39 ; 72 10 min 5 6 3 2RACE 1 : 94 30 s,72 3 min, 5 ; 94 30 s,70 30 s,72 3 min, 5 ; 94 30 s,68 30 s,72 3 min,25 5 6 3 2RACE 2 :94 30 s,68 30 s,72 3 min,39 PCR, Promega p GEM2T easy, DNA ( Esherichia coli) DH5, 113 DNASTAR SMART Clustl W cdna, blast 2 211 Promega cdna, 1 2 1 4 3 2 3 4 PCR, 1 %,EB 1, 1 2 500 bp, 1 4 3 2 700 bp, 3 4 ( ) PCR, p GEM2T easy : 1 2 PCR 553 bp, 1 4 PCR 718 bp, 3 2 PCR 754 bp, DNASTAR Blast,, 1 4 PCR 3 2 PCR cab, 3 2 PCR 5
36 43 212 3 2RACE, 3 2RACE 5 6, SMART TM RACE (UPM), 2 5 UPM PCR 1 RT2PCR 800 bp, 6 Fig. 1 RT2PCR products checked by UPM PCR 500 bp 700 electrophoresis bp, PCR 1 : 1 4 Primer 1 & 4 product ; 2 : 2 3 Primer 2 & 3 product ; p GEM2T easy 3 : 3 4 Primer 3 & 4 product ;, 2 M1 :150 bp 150 bp ladder., 809 bp 767 bp, Poly(A), 99 % 3 213 cdna cdna 1 102 bp ( GenBank : EF061137 ) EF061137 64 bp 861 bp 1 (open reading frame,orf) 1, 265 ( 3) EF061137 64 bp 1 AUG 3 ( G), ( G), AUG Kozak GNNAUGG ( Kozak, 1999), EF061137 5 63 bp, 3 213 bp (untranslated region,utr) Poly(A) 28 bp 1 G/ AATAA ( 3 ) a/ b, cab2bo1 ( cab gene from B. oldhamii) SMART http :ΠΠwww. expasy. orgπprositeπ MOTIFSCAN, cab2bo1 64 232 a/ b (chlorophyll a/ b binding domain), 9 11 C (protein kinase C phosphorylation site), 27 52 (ubiquitin 2 3 2RACE PCR Fig. 2 3 2RACE products checked by electrophoresis 1 : 5 UPM Product of primer 5 & UPM;2 : 6 UPM Product of primer 6 & UPM; M2 : 1 kb 1 kb ladder. 3 cab2bo1 ( EF061137) Fig. 3 Sequence and open reading frame of cab2bo1 ( EF061137)
3 : a/ b 37 domain signature), 55 58 (CK2) (casein kinase II phosphorylation site), DNASTAR, cab2bo1 51248 28 121125 Da Mapdraw, 3 2 PCR 5 UPM PCR Sac, 3 2 PCR EcoR Sac, 440 bp pbi101, A ; 5 UPM PCR Pst Sac, 690 bp puc19, B ; Hind Sac A GUS, B Hind Sac 690 bp (1 102 bp) 4 cab2bo1 ( EF061137) cab Fig. 4 Multiple sequence alignments of amino acids encoded by cab2bo1 ( EF061137) blast with amino acids encoded by the different cab family genes 2. 4 cab2bo1 cab blast, NCBI, cab2bo1 cab 66 ( Zea mays) ( Musa acuminata) ( Triticum aestivum) ( Oryza sativa) ( Hordeum vulgare) ( Pinus) ( Nicotiana sylvestris) ( Arabidopsis
38 43 thaliana) Blast Score 228 965, cab2bo1 Y00379 ( Golden Cross Bantam),Score 965, (identity) 90 %(728Π804) NCBI, cab2bo1 500,Score 450 31 ( P27497), 92 %(248/ 267) 4 cab2bo1 5 Clustal W 3 3 blast, cab2bo1 (X55892) (P27497) a/ b (Viret et al., 1990), cab2bo1 64 232 a/ b ; 9 11 C, 27 52, 55 58 (CK2) (Allen et al., 1997) cab, cdna (,2005) cab ( Sorghum bicolor) (Clark et al., 1995) ( Embaye,2001) a/ b cab2bo1 cab,,,. 20011., 37(6) :15-19,,. 20001., 20(5) : 14-16,46. 20031.,30 (3) :50-53,72,,,. 20001., 17 (4) :289-301,,. 20051 ( Oryza sativa L. ) a/ b cdna., 31 (9) :1227-1232,,,. 20011., 21 (4) : 359-362 Allen J F, Nilsson A. 1997. Redox signaling and the structural basis of regulation of photosynthesis by protein phosphorylation. Physiol Plant, 100 :863-868 Clark L G, Zhang W, Wendel J. 19951 A phylogeny of the grass family (Poaceae) based on ndhf sequence data. Syst Bot, 20 :436-460 Embaye K. 20011 The potential of bamboo as an interceptor and converter of solar energy into essential goods and services : focus on Ethiopia. International Journal of Sustainable Development and World Ecology, 8 (4) : 346-355 Gao Zhimin,Li Xueping,Li Lubin, et al. 20061 An effective method for total RNA isolation from bamboo. Chinese Forestry Science and Technology, 5 (3) :52-54 Kozak M. 1999. Initiation of translation in prokaryotes and eukaryotes. Gene,234 (2) :187-208 Raghvendra A S. 19981 Photosynthesis : a comprehensive treatise. Cambridge :Cambridge Univ Press, 72-86 Viret J F, Schantz M L, Schantz R. 1990. Nucleotide sequence of a maize cdna coding for a light2harvesting chlorophyll aπb binding protein of photosystem. Journal Nucleic Acids Res, 18 : 71-79 ( )