2010, 37 (1) : 47-52 Acta Horticulturae Sinica NO m RNA 1, 1, 13, 1, 1, 2 ( 1,,, 271018; 2, 650204) : (NO ) Cu mrna, 015 mmol L - 1 Cu 2 +,, 013 mmol L - 1 SNP (NO ) Cu 2 +, ( POD ) (APX) ( SOD ) (CAT) mrna, 011 mmol L - 1 L2NAME [N 2nitro2L2arginine methyl ester, (NOS) ] Cu,, NO Cu : Cu ; ; RT2PCR : S 64112 : A : 05132353X (2010) 0120047206 Effects of Exogenous N itr ic O x ide on Growth and Tran scr iptiona l Expression of An tiox idan t Enzym e m RNA in Toma to Seedlings under Copper Stress WANG L i2na 1, YANG Feng2juan 1, WANG Xiu2feng 13, SH IQ ing2hua 1, W E IM in 1, and HU Xiang2yang 2 ( 1 College of Horticulture Science and Engineering, Shandong A gricultural U niversity, S tate Key Laboratory of C rop B iology, The Key and O pen Laboratory of Horticultural C rop B iology, M inistry of A griculture, Taiπan, Shandong 271018, China; 2 Kunm ing Institute of B otany, Chinese A cadem y of Sciences, Kunm ing 650204, China) Abstract: Heavy metal stress badly affect the crop grow th and development, assuaging heavy metal stress to crop show important for crop yield. Here we investigated the effect of SNP ( sodium nitropp russide, an exogenous nitric oxide donor) on alleviating copper stress and regulating antioxidant gene transcrip tional level in liquid2culture tomato seedlings. Our results showed that copper at 015 mmol L - 1 significantly supp ressed the tomato seedlings grow th including p lant height, stem thickness, p lant fresh weight and p lant dry weight, as well as imp roved the transcrip tional levels of antioxidant genes encoding peroxidase ( POD ), ascorbate peroxi2 dase (APX), superoxide dismutase ( SOD) and catalase (CAT). Exogenous app lication of 013 mmol L - 1 SNP rem arkably alleviated copper2inhibition to tomato grow th and further enhanced these antioxidant genes transcrip tion, however, additional L2NAME (N 2nitro2L2arginine methyl ester), the special inhibitor of nitric oxide synthase (NOS) obviously aggravated copper2induced inhibitory effect on tomato grow th and reduced an2 tioxidant enzyme gene transcrip tional level. Basing on these results we p ropose that tomato NOS enzym e2medi2 ated NO is necessary for tomato responding to copper stress and NO app lication lessen copper stress to tom ato grow th via enhancing antioxidant enzyme gene transcrip tional levels. Key words: copper stress; tom ato; RT2PCR : 2009-07 - 09; : 2009-12 - 17 : (30871705, 30871704) ; 3 Author for correspondence ( E2mail: xfwang@ sdau1edu1cn)
48 37,,, Cu, Cu, NO, ( reactive nitrogen species, RNS), NO,, (Magdalena & Lorenzo, 2007) NO (, 2008), NO Cu,,, NO Cu mrna, NO Cu 1 111 2008 2 5 (L ycopersicon esculentum M ill. ) 4, 3 1 8 L, 6, 4 d 2, 2 h 6 7 : (1) 015 mmol L - 1 Cu 2 + ; (2) 015 mmol L - 1 Cu 2 + + 013 mmol L - 1 SNP; (3) 015 mmol L - 1 Cu 2 + + 011 mmol L - 1 L2NAME; 6, 3 6 12 24 48 72 96 120 h 2, - 70,, 3,, 110 5 m in, 80, SPSS Duncanπs 112 RNA cd NA RNA (Han et al., 1987) ( ) RNA PCR Kit (AMV ) Ver1310, 500 ng RNA cdna, RT2 PCR 113 NCB I GenBank ( 1), Magdalena Lorenzo (2007) Actin2F : AAGAGYTAYGARYTNCCW GATGG; Actin2R:, 114 RT2PCR TTRATCTTCATGCTRCTW GGAGC 25 L PCR cdna 1 L, (10 mol L - 1 ) 1 L, MgCl 2 (25 mmol L - 1 ) 2 L, (10 ) 215 L, dntp (2 mmol L - 1 ) 2 L, Taq ( 1 U L - 1 ) 1 L ( TAKARA ) : 94 2 m in, 94 20 s, 30 s, 72 30 s, 30 ; 72 10 m in 10 L,
1 : NO mrna 49 1 Table 1 Pr im er sequences used for iden tif ica tion of spec ia l expression of m RNA NCB I Primers Sequence (5-3 ) /bp Product size X7159311 L i2pod2f GGTCCAACATGGCAAGTTCT 250 5115 L i2pod2r ACATCTTGCCCTTCCAAATG DQ09942011 APX12F GGCTCTCCTTTGTGATCCTG 250 5110 APX12R CAGCAAAAACAACAGCTCCA AF527880 SOD2F AATTCATCATTGTGGCAGCA 250 5115 SOD2R GCCCTTAAGGACAGCAACAG X1404111 Cu, Zn2SOD2F CTGGACTTCACGGGTTTCAT 250 5210 Cu, Zn2SOD2R TTTGGACCGGTCAATGGTAT M9371911 CAT12F AGAAGCTCGCGACATTTGAT 250 5018 CAT12R CTTGACAGCAAAACCACGAA AF11236811 CAT22F TGCTCCAAAGTGTGCTCATC 250 5310 CAT22R AGCGGTACCTTTCTCCTGGT / Annealing temperature 2 211 NO Cu 2, 015 mmol L - 1 Cu 2 + 5 d, 12110% 9198% 9119% 9106%, Cu Cu 013 mmol L - 1 SNP Cu, Cu L2NAME Cu 12190% 16106% 6152% 5143% 2 NO SNP NO S L 2NAM E Cu Table 2 Effects of exogenous n itr ic ox ide and L 2NAM E on the plan t growth of toma to seedlings under Cu stress / (mmol L - 1 ) Treatment Cu 2 + SNP L2NAME /cm Plant height 0 0 0 41183 0175a 015 0 0 36177 0197c 015 013 0 39199 0185b 015 0 011 32103 0178d /mm Stem thickness 4191 0109a 4142 0114c 4171 0117b 3171 0113d : ( P < 0105) Note: The different small letters indicated significant difference at 0105 level /g Plant fresh weight 68142 1104a 62112 1144c 66103 1132b 58107 1119d / g Plant dry weight 4186 0108a 4142 0114c 4170 0111b 4118 0115d 212 NO Cu POD m RNA 1, Cu, L i2pod ( lignin peroxidase) mrna,,, SNP, L2NAME, 1 lign in POD RT2PCR F ig. 1 RT2PCR am plif ied products for the detection of lign in POD in toma to leaves
50 37 213 NO Cu APX1 m RNA 2, Cu APX1 mrna,, 72 h SNP Cu, 12 h, L2NAME Cu, 24 h, 48 h, 96 h 2 APX1 RT2PCR F ig. 2 RT2PCR am plif ied products for the detection of APX1 in tomato leaves 214 NO Cu SOD m RNA 3, SOD Cu, Zn2SOD mrna, Cu SOD 12 h, Cu, Zn2SOD 48 h SNP Cu SOD Cu, Zn2SOD mrna, SOD 6 h ; Cu, Zn2SOD 72 h L2NAME F ig. 3 SOD RT2PCR 3 RT2PCR am plif ied products for the detection of SOD in toma to leaves 215 NO Cu CAT m RNA 4, CAT1 CAT2, Cu + F ig. 4 CAT RT2PCR 4 RT2PCR am plif ied products for the detection of CAT in toma to leaves
1 : NO mrna 51 SNP > Cu > Cu +L2NAME > SNP 6 h, CAT1 48 h, CAT2 96 h Cu CAT1 24 h, CAT2 48 h L2NAME 48 h 72 h, 3 Cu, (, 2006) Cu,, NO Cu, Cu, Cu NO (, 2007) (, 2009) NO,,,, (Leshem & Haramaty, 1996),, (L idon & Teixeira, 2000) Lombardi Sebastiani (2005), Cu,,,, NO, NO, ROS, (Lamattina et al., 2001) ; SOD POD CAT APX, H 2 O 2 (2007) NO POD SOD Bartosz (1997) NO CAT APX GR,, NO Cu POD SOD CAT APX mrna, Cu, Zn2SOD CAT1 CAT2, Cu (2009) Zhang (2009) NO NaCl SOD POD CAT APX,, (, 2008) NO, Clark (2000), NO Fe CAT APX POD NO L2NAME NOS, NO (V ito et al., 2002) Massimo (1998) L2NAME NO, NADPH2d, L2NAME NO,, Cu NO,, NO, References Bartosz G. 1997. Oxidative stress in plants. Acta Physiol Plant, 19: 47-64. Chen Shi2jun, ZhangM ing2sheng, W eimei2yu. 2009. Physiological response of Capsicum frutescens L. var. longum bailey seedling with SNP to Cd 2 + stress. Plant Physiology Communications, 45 (3) : 229-232. ( in Chinese),,. 2009. SNP Cd 2 +., 45 (3) : 229-232. Clark D, Durner J, Navarre D A. 2000. N itric oxide inhibition of tobacco catalase and ascorbate poroxidase. Mol Plant2M icrobe Interact, 13 (12) : 1380-1384. Duan Kai2xuan, Yang Hong2qiang, Ran Kun, Jiang Q ian2qian, You Shu2zhen. 2007. Effect of nitric oxide on reactive oxygen metabolism ofm alus
52 37 hupehensis Rehd. seedlings under copper and cadmium stress. Chinese Agricultural Science Bulletin, 23 (10) : 104-109. ( in Chinese),,,,. 2007.., 23 (10) : 104-109. Fan Huai2fu, Guo Shi2rong, Duan Jiu2ju, Du Chang2xia, Sun Jin. 2008. Effects of nitric oxide on the growth and glutathione dependent an tioxi2 dative system in cucumber (Cucum is sativus L. ) seedlings under NaCl stress. Acta Ecologica Sinica, 28 (6) : 2511-2517. ( in Chinese),,,,. 2008. NO NaCl ( Cucum is sativus L. )., 28 (6) : 2511-2517. Han J H, Stratowa C, RutterW J. 1987. Isolation of full2length putative rat lysophosphipase cdna using improved methods for mrna isolation and cdna cloning. B iochem isty, 26: 1617-1625. Han Xiao2jiao, Yang Hong2qiang, You Shu2zhen, Duan Kai2xuan, Zhang Xin2rong, Zhao Hai2zhou. 2008. Adventitious shoot regeneration from leaves of M alus hupehensis and effects of nitric oxide. Acta Horticulturae Sinica, 35 (3) : 419-422. ( in Chinese),,,,,. 2008. NO., 35 (3) : 419-422. Lamattina L, BeligniM V, GarciaM C. 2001. Method of enhancing the metabolic function and the growing conditions of p lants and seeds. United State Patent, 6: 242-384. Leshem Y Y, Haramaty E. 1996. The characterization and contrasting effects of the nitric oxide free radical in vegetative stress and senescence of Pisun sativun L inn foliage. Plant Physiol, 148: 258-263. L idon F C, Teixeira M G. 2000. Oxy radicals production and control in the chlorop last ofmn2treated rice. Plant Science, 152: 7-15. Lombardi L, Sebastiani L. 2005. Copper toxicity in Prunus cerasifera: Growth and antioxidant enzymes responses of in vitro grown p lants. Plant Sci, 168: 797-802. Magdalena Graziano, Lorenzo Lamattina. 2007. N itric oxide accumulation is required formolecular and physiological responses to iron deficiency in tomato roots. The Plant Journal, 52: 949-960. Massimo D, Xia Y, D ixon R A, Chris L. 1998. N itric oxide functions as a signal in p lant disease resistance. Nature, 394: 585-588. V ito De G C, Giuseppe R, Antonello E R, Sara B, Barbara M, Ferruccio B, Eugenio E M. 2002. Enalapril and quinap ril improve endothelial vasodilator function and aortice NOS gene exp ression in L2NAME2treated rats. European Journal of Pharmacolog, 450: 61-66. W ang Song2hua, Zhou Zheng2yi, He Q ing2yuan, W ang Xiao2peng, SongL i2hong, Lu Xiao2m ing. 2007. N itric oxide alleviates the nickel toxicity in wheat seedlings. Acta Botanica Yunnanica, 29 (1) : 115-121. ( in Chinese),,,,,. 2007.., 29 ( 1) : 115-121. W u Xue2xia, Chen Jian2lin, Zha D ing2shi, Zhu W ei2m in. 2009. Effects of exogenous nitric oxide on reactive oxygen metabolism in tomato seed2 lings under NaCl stress. Plant Nutrition and Fertilizer Science, 15 (2) : 422-428. ( in Chinese),,,. 2009. NaCl., 15 (2) : 422-428. Zhang Yi2kai, Han Xiao2jiao, Chen Xiu2ling, Jin Hong, Cui Xiu2m in. 2009. Exogenous nitric oxide on antioxidative system and ATPase activities from tomato seedlings under copper stress. Scientia Horticulturae, 123 (2) : 217-223. Zhen Quan, Yan M i, Yang Hong2fei, L iu Deng2yi, W ang You2bao. 2006. Coercion and damage of Cu pollution on A rtem isia lavandulaefolia growth. Chinese Journal of Applied Ecology, 17 (8) : 1505-1510. ( in Chinese),,,,. 2006.., 17 ( 8) : 1505-1510.