Elucidation of fine-scale genetic structure of sandfish (Holothuria scabra) populations in Papua New Guinea and northern Australia

Σχετικά έγγραφα
Supporting Information for. Update of spectroscopic data for 4-hydroxyldictyolactone and dictyol E isolated from a Halimeda stuposa - Dictyota

Dietary success of a new key fish in an overfished ecosystem: evidence from fatty acid and stable isotope signatures

Supporting Information for. A New Diketopiperazine, Cyclo-(4-S-Hydroxy-R-Proline-R-Isoleucine), from an Australian Specimen of the Sponge

A life-table metamodel to support management of data deficient species, exemplified in sturgeons and shads. Electronic Supplementary Material

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

,,, (, ) , ;,,, ; -

SUPPORTING INFORMATION

Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου

Electronic Supplementary Information (ESI)

Aquinas College. Edexcel Mathematical formulae and statistics tables DO NOT WRITE ON THIS BOOKLET

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

Molecular evolutionary dynamics of respiratory syncytial virus group A in

Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and

College of Life Science, Dalian Nationalities University, Dalian , PR China.

A summation formula ramified with hypergeometric function and involving recurrence relation

An experimental and theoretical study of the gas phase kinetics of atomic chlorine reactions with CH 3 NH 2, (CH 3 ) 2 NH, and (CH 3 ) 3 N

Supplementary Appendix

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

H επίδραση της γονικής παρουσίας και του παιχνιδιού σε επώδυνες διαδικασίες στα παιδιά

Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones

J. Dairy Sci. 93: doi: /jds American Dairy Science Association, 2010.

Supporting Information. Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid

New Cytotoxic Constituents from the Red Sea Soft Coral Nephthea sp.

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

Supporting Information

Electronic Supplementary Information

Supporting information. Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene

ΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY

Si + Al Mg Fe + Mn +Ni Ca rim Ca p.f.u

Isotopic and Geochemical Study of Travertine and Hot Springs Occurring Along the Yumoto Fault at North Coast of the Oga Peninsula, Akita Prefecture

Identification of Fish Species using DNA Method

ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ

Divergent synthesis of various iminocyclitols from D-ribose

Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

ΚΕΡΚΙΔΙΚΗ ΚΑΙ ΜΗΡΙΑΙΑ ΠΡΟΣΠΕΛΑΣΗ ΣΕ ΣΤΕΦΑΝΙΟΓΡΑΦΙΕΣ ΚΑΙ ΑΓΓΕΙΟΠΛΑΣΤΙΚΕΣ. ΜΙΑ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ

Electronic Supplementary Information (ESI)

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΕΠΟΧΙΑΚΗΣ ΠΑΡΑΚΤΙΑΣ ΑΝΑΒΛΥΣΗΣ ΣΤΟ Β.Α. ΑΙΓΑΙΟ. Τμήμα Επιστημών της Θάλασσας, Πανεπιστήμιο Αιγαίου 2

Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka

ΣΤΟΙΧΕΙΑ ΠΟΙΚΙΛΟΤΗΤΑΣ ΚΑΙ ΚΑΤΑ ΜΗΚΟΣ ΣΥΝΘΕΣΕΙΣ 4 ΕΙΔΩΝ ΨΑΡΙΩΝ ΑΝΑ ΑΛΙΕΥΤΙΚΟ ΕΡΓΑΛΕΙΟ ΣΤΟΝ ΚΕΡΚΥΡΑΪΚΟ

SUPPLEMENTARY MATERIAL

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

ΜΔΛΔΣΖ ΔΝΓΟΣΡΑΥΤΝΖ Δ ΥΑΛΤΒΔ ΘΔΡΜΖ ΔΛΑΖ

Cable Systems - Postive/Negative Seq Impedance

Study of urban housing development projects: The general planning of Alexandria City

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Sample BKC-10 Mn. Sample BKC-23 Mn. BKC-10 grt Path A Path B Path C. garnet resorption. garnet resorption. BKC-23 grt Path A Path B Path C

2. Η Βαρύτητα Διαφόρων Γλυκαιμικών Δεικτών Νοσηλείας στην Λειτουργική Έκβαση του ΑΕΕ των Διαβητικών Ασθενών

Zebra reaction or the recipe for heterodimeric zinc complexes synthesis

Electronic Supplementary Information

Enantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes

difluoroboranyls derived from amides carrying donor group Supporting Information

Σχέση µεταξύ της Μεθόδου των ερµατοπτυχών και της Βιοηλεκτρικής Αντίστασης στον Υπολογισµό του Ποσοστού Σωµατικού Λίπους

Supplementary Table 1. Construct List with key Biophysical Properties of the expression

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

SUPPLEMENTAL INFORMATION. Fully Automated Total Metals and Chromium Speciation Single Platform Introduction System for ICP-MS

Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues

UDZ Swirl diffuser. Product facts. Quick-selection. Swirl diffuser UDZ. Product code example:

Medicago marina 2012

Supplementary Material for The Cusp Catastrophe Model as Cross-Sectional and Longitudinal Mixture Structural Equation Models

ΑΓΓΛΙΚΑ Ι. Ενότητα 7α: Impact of the Internet on Economic Education. Ζωή Κανταρίδου Τμήμα Εφαρμοσμένης Πληροφορικής

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

[2] T.S.G. Peiris and R.O. Thattil, An Alternative Model to Estimate Solar Radiation

Summary of the model specified

Cycloaddition of Homochiral Dihydroimidazoles: A 1,3-Dipolar Cycloaddition Route to Optically Active Pyrrolo[1,2-a]imidazoles

Fused Bis-Benzothiadiazoles as Electron Acceptors

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

Na/K (mole) A/CNK

Kostas Tsigaridis.

Παρακολούθηση του περιβάλλοντος του νομού Καστοριάς με τη χρήση δεικτών υγείας τοπίου.

(1) A lecturer at the University College of Applied Sciences in Gaza. Gaza, Palestine, P.O. Box (1514).

«-» - ( ), ( ) ,. - ( ),, - ( ). - /, -.

Supporting Information

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Bayesian statistics. DS GA 1002 Probability and Statistics for Data Science.

Supplementary Materials for Evolutionary Multiobjective Optimization Based Multimodal Optimization: Fitness Landscape Approximation and Peak Detection

svari Real-time RT-PCR RSV

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates

Fe II aq Fe III oxide electron transfer and Fe exchange: effect of organic carbon

SUPPORTING INFORMATION

The effect of curcumin on the stability of Aβ. dimers

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Web-based supplementary materials for Bayesian Quantile Regression for Ordinal Longitudinal Data

9 th Symposium on Oceanography & Fisheries, Proceedings, Volume ΙΙ

Global energy use: Decoupling or convergence?

Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions

CorV CVAC. CorV TU317. 1

Selective mono reduction of bisphosphine

stability and aromaticity in the benzonitrile H 2 O complex with Na+ or Cl

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Heavier chalcogenone complexes of bismuth(iii)trihalides: Potential catalysts for acylative cleavage of cyclic ethers. Supporting Information

Research on Economics and Management

IV. ANHANG 179. Anhang 178

Introduction to Bioinformatics

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

Transcript:

Marine and Freshwater Research, 2017, 68, 1901 1911 CSIRO 2017 Supplementary material Elucidation of fine-scale genetic structure of sandfish (Holothuria scabra) populations in Papua New Guinea and northern Australia Samantha J. Nowland A,C, Paul C. Southgate A,B, Rose K. Basiita A and Dean R. Jerry A A Centre for Sustainable Tropical Fisheries and Aquaculture, College of Science and Engineering, James Cook University, Townsville, Qld 4811, Australia. B Present address: Australian Centre for Pacific Islands Research and Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Maroochydore, Qld 4558, Australia. C Corresponding author. Email: samantha.nowland@hotmail.com Page 1 of 6

Table S1. Summary of microsatellite marker suites, associated primers, relevant polymerase chain reaction (PCR) conditions, final primer concentrations and fluorescent labels utilised in the present study Markers with an asterisk were dropped from the analysis. Original source of primer sequences is Fitch et al. (2012) Locus Repeat motif Marker suite Final primer concentration (μm) Observed allele size range (bp) Primer sequence (5 3 ) and fluorescent tag used Lca1* (GT) 8 M2 0.15 76 113 F: NED CTTAGTCTGGTACGGTTGTCC R: GTTTACTAAGCAAGTGTCACAAAC Lca4 (GT) 11 M4 0.2 110 133 F: FAM AGAGCATGTATGTATCATCGAAACC R: AAACGGAACGGAACAAGCC Lca17 (AC) 11 M4 0.2 182 206 F: PET AGATTCATTTGGGAACTTTGGC R: AGGGTTGATGTAAGCTGCG Lca20 (AC) 12 M2 0.15 184 230 F: FAM TGCGTGTGGTGATTTTGAC R: ACCATTCTACAGCTCGTCCC Lca24 (AC) 18 M4 0.2 193 225 F: VIC TCCTTCGTCGCAGCATGAC R: TTCTTGTATTCCTTTGCAGGC Lca28* (GAT) 15 M5 0.3 190 381 F: PET TTCTGGTCTCGACTGGCAC R: TCAGTATCGGCTCCACAGG Lca31* (ATGT) 11 M5 0.3 163 185 F: VET TGTAGGTAGGTAGGTAGGTATGTATG R: CAGCAGTGGGTTTGGACAC Lca40 (ATGT) 13 M3 0.35 235 351 F: PET GCATTGATCATGTGGAATTTGCG R: CACCATAGACCTGGCTTGC Lca44 (AAAC) 9 M5 0.3 165 202 F: FAM GACGGTACGTCACCAGAGG R: TTCTTCGTCTTTTGGCGGG Lca48 (GT) 8 M4 0.15 145 167 F: VIC ACAATGCGGACGACAATGG R: ATCGTGTTTACAAGCGGGC Lca49 (ACAG) 8 M2 0.2 157 241 F: PET TGAGCACGGTGTATTGTCC R: TGATGTGAGCCACTGCG Lca54 (CTGT) 8 M3 0.2 186 222 F: FAM AGACAGTTGTGGGAAGGGC R: TGGATGGAATAACAATAGGTGTCC Lca59 (AC) 8 M3 0.25 234 262 F: FAM AGAGCACACGTATCCCCAC R: GGGGCAGGATAGAGCACATAG Lca42* (AC) 18 M5 0.25 188 211 F: NED TCCTTCGTCGCAGCATGAC R: TTCTTGTATTCCTTTGCAGGC Lca62* (AT) 8 M2 0.2 245 255 F: VIC AGCTAGCAGGGAAAAGAAGAAAG R: AGAGGCGGATGCTCTTACC Page 2 of 6

Table S2. Population by locus Oosterhout estimate of null alleles (Van Oosterhout et al. 2004) BE, Belifu; SI, Sivasat; UN, Ungakum; BA, Bangatang; LN, Limanak North; MB, Milne ; KB, Kimbe ; LS, Limanak South; MR, Manus Island Rambutyo; ML, Manus Island Loi; DW, Darwin (Australia); CY, Cape York (Australia) Locus BE SI UN BA LN MB KB LS MR ML DW CY Lca20A 0.0045 0.0659 0.1229 0.0485 0.0202 0.0515 0.0204 0.0351 0.0624 0.0757 0.0827 0.0038 Lca49A 0.2536 0.1626 0.1114 0.0967 0.0108 0.117 0.0571 0.0532 0.0672 0.0781 0.1164 0.2438 Lca54A 0.0781 0.068 0.0591 0.1096 0.1285 0.0539 0.0617 0.1003 0.095 0.0658 0.1526 0.0749 Lca59A 0.0948 0.1606 0.0998 0.1542 0.1457 0.0869 0.0956 0.0725 0.1037 0.1203 0.0167 0.1098 Lca40A 0.0871 0.007 0.1106 0.0641 0.1347 0.0876 0.0213 0.1162 0.0278 0.0674 0.0649 0.0845 Lca4A 0.1442 0.2001 0.2015 0.4028 0.2545 0.2709 0.3011 0.2273 0.2148 0.2949 0.3438 0.137 Lca48A 0.2615 0.1329 0.1735 0.1947 0.3336 0.1743 0.3684 0.2281 0.2075 0.1743 0.0149 0.2707 Lca24A 0.0372 0.0452 0.0028 0.084 0.0178 0.0706 0.0577 0.0636 0.095 0.0702 0.006 0.0427 Lca17A 0.1764 0.3192 0.2035 0.3199 0.2762 0.2154 0.1377 0.3368 0.2174 0.1678 0.4178 0.1788 Lca44A 0.0511 0.0054 0.036 0.0052 0.0083 0.0813 0.097 0.0605 0.0771 0.0502 0.0299 0.0614 Page 3 of 6

Table S3. Genetic-diversity summary statistics of sandfish (Holothuria scabra) populations, showing number of alleles (Na), allelic richness (Ar), observed heterozygosity (Ho), expected heterozygosity (He) and inbreeding coefficient (F IS) Departures from Hardy Weinberg expectations of heterozygosity (HWE) is indicated: sig, significant, P < 0.05; n.s., not significant. Underlined text indicates a different microsatellite locus Parameter Belifu Sivasat Ungakum Bangatan North Milne Kimbe South Rambutyo Loi Darwin Cape York Global n 30 45 29 15 39 19 29 37 50 50 32 38 375 Lca17 Na 5 5 4 6 7 3 7 5 6 5 7 4 5.3 ± 0.4 Ar 3.6 3.7 3.2 5.6 4.8 2.9 4.4 4.1 4.2 3.7 5.4 4.0 4.1 ± 0.2 Ho 0.30 0.17 0.29 0.21 0.26 0.05 0.31 0.10 0.36 0.35 0.12 0.11 0.22 ± 0.03 He 0.50 0.57 0.51 0.68 0.66 0.32 0.52 0.54 0.61 0.55 0.74 0.74 0.58 ± 0.03 FIS 0.41 0.71 0.44 0.70 0.60 0.84 0.41 0.82 0.42 0.38 0.85 0.85 0.62 ± 0.05 HWE n.s. sig sig n.s. sig sig sig sig sig sig sig sig Lca20 Na 13 15 14 15 16 14 18 17 15 18 16 8 14.9 ± 0.7 Ar 10.7 10.3 10.5 12.4 11.3 10.7 11.1 11.8 10.2 11.5 11.4 5.9 10.7 ± 0.5 Ho 0.90 0.77 0.72 0.87 0.87 0.83 0.86 0.95 0.80 0.77 0.78 0.44 0.80 ± 0.04 He 0.90 0.89 0.90 0.88 0.91 0.88 0.89 0.91 0.89 0.91 0.90 0.79 0.89 ± 0.01 FIS 0.01 0.14 0.22 0.05 0.05 0.08 0.05 0.02 0.12 0.17 0.15 0.46 0.12 ± 0.04 HWE n.s. n.s. sig n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. sig Lca24 Na 7 12 7 5 10 8 8 9 9 10 8 9 8.5 ± 0.5 Ar 5.3 7.4 5.1 4.4 7.7 6.6 6.8 6.9 5.7 6.1 5.6 5.72 6.1 ± 0.3 Ho 0.46 0.59 0.48 0.29 0.75 0.63 0.74 0.61 0.63 0.47 0.63 0.63 0.58 ± 0.04 He 0.48 0.63 0.47 0.37 0.74 0.61 0.69 0.67 0.56 0.55 0.60 0.61 0.58 ± 0.03 FIS 0.05 0.08-0.00 0.26 0.00 0.00 0.05 0.10 0.12 0.16 0.03 0.01 0.04 ± 0.03 HWE n.s. sig n.s. n.s. n.s. n.s. n.s. n.s. n.s. sig n.s. n.s. Lca4 Na 12 12 7 6 10 8 12 13 10 10 7 12 9.9 ± 0.7 Ar 9.2 8.5 5.7 6.0 8.0 6.6 9.9 8.8 6.8 7.6 6.3 7.52 7.6 ± 0.4 Ho 0.63 0.50 0.45 0.09 0.38 0.28 0.33 0.44 0.43 0.33 0.18 0.60 0.39 ± 0.04 He 0.87 0.86 0.77 0.73 0.84 0.63 0.88 0.81 0.81 0.82 0.78 0.80 0.80 ± 0.02 FIS 0.30 0.43 0.43 0.89 0.57 0.58 0.63 0.47 0.48 0.61 0.78 0.27 0.54 ± 0.05 HWE sig sig sig sig sig sig sig n.s. sig sig sig n.s. Page 4 of 6

Parameter Belifu Sivasat Ungakum Bangatan North Milne Kimbe South Rambutyo Loi Darwin Cape York Global Lca40 Na 22 28 27 15 26 18 22 25 26 28 25 26 24.0 ± 1.1 Ar 13.2 14.5 16.3 13.4 13.6 13.9 13.6 14.2 13.7 15.0 14.5 14.79 14.2 ± 0.2 Ho 0.77 0.93 0.70 0.86 0.68 0.71 0.89 0.72 0.88 0.82 0.78 0.86 0.80 ± 0.02 He 0.92 0.94 0.95 0.92 0.93 0.92 0.93 0.94 0.93 0.95 0.94 0.95 0.94 ± 0.00 FIS 0.18 0.03 0.28 0.10 0.28 0.26 0.06 0.24 0.07 0.15 0.18 0.11 0.16 ± 0.02 HWE n.s. n.s. n.s. n.s. sig n.s. n.s. n.s. n.s. sig sig sig Lca44 Na 8 11 7 7 10 7 7 10 9 7 7 9 8.3 ± 0.4 Ar 5.5 6.5 5.4 6.3 6.2 5.8 6.2 6.2 6.2 5.4 5.9 6.4 6.0 ± 0.1 Ho 0.80 0.76 0.74 0.64 0.72 0.76 0.64 0.64 0.67 0.68 0.78 0.81 0.72 ± 0.02 He 0.72 0.76 0.70 0.72 0.74 0.69 0.78 0.76 0.76 0.74 0.80 0.81 0.75 ± 0.01 FIS 0.09 0.01 0.04 0.15 0.04 0.08 0.19 0.17 0.12 0.10 0.04 0.01 0.05 ± 0.03 HWE n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. sig n.s. Lca48 Na 8 7 9 5 3 5 4 11 9 7 5 5 6.5 ± 0.7 Ar 5.6 5.0 7.5 4.8 2.7 4.8 3.7 6.8 4.3 4.7 4.7 3.6 4.9 ± 0.4 Ho 0.30 0.44 0.50 0.33 0.12 0.41 0.11 0.38 0.28 0.36 0.69 0.29 0.35 ± 0.04 He 0.72 0.64 0.77 0.54 0.51 0.69 0.59 0.69 0.53 0.60 0.70 0.56 0.63 ± 0.02 FIS 0.59 0.33 0.38 0.42 0.78 0.43 0.83 0.46 0.48 0.41 0.04 0.50 0.47 ± 0.06 HWE n.s. sig n.s. n.s. sig n.s. sig sig sig sig n.s. sig Lca49 Na 13 15 12 11 17 10 11 14 15 20 17 12 13.9 ± 0.8 Ar 9.2 10.0 8.6 10.4 10.0 8.8 8.4 9.2 10.2 11.3 11.6 8.6 9.7 ± 0.3 Ho 0.43 0.57 0.63 0.71 0.85 0.63 0.71 0.75 0.78 0.72 0.69 0.69 0.68 ± 0.03 He 0.85 0.88 0.82 0.89 0.88 0.85 0.83 0.86 0.88 0.90 0.90 0.83 0.86 ± 0.01 FIS 0.51 0.36 0.25 0.23 0.05 0.30 0.15 0.14 0.12 0.20 0.25 0.18 0.23 ± 0.03 HWE sig sig n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. Lca54 Na 8 7 7 7 7 6 10 8 7 7 4 5 6.9 ± 0.4 Ar 6.8 5.2 5.4 6.2 5.4 5.7 7.4 5.6 5.5 5.8 2.6 4.3 5.5 ± 0.3 Ho 0.70 0.63 0.68 0.60 0.56 0.68 0.72 0.61 0.65 0.69 0.26 0.50 0.61 ± 0.03 He 0.82 0.76 0.76 0.78 0.77 0.79 0.82 0.76 0.79 0.80 0.23 0.69 0.73 ± 0.04 FIS 0.17 0.19 0.13 0.26 0.28 0.16 0.14 0.21 0.18 0.14 0.10 0.29 0.17 ± 0.03 HWE n.s. n.s. n.s. n.s. n.s. n.s. sig n.s. n.s. n.s. n.s. n.s. Page 5 of 6

Parameter Belifu Sivasat Ungakum Bangatan North Milne Kimbe South Rambutyo Loi Darwin Cape York Global Lca59 Na 11 11 12 8 10 9 10 9 8 12 13 8 10.1 ± 0.5 Ar 7.9 7.1 8.0 7.4 6.9 7.9 6.2 6.3 5.7 6.5 9.3 6.2 7.1 ± 0.3 Ho 0.60 0.55 0.64 0.46 0.54 0.59 0.64 0.65 0.57 0.55 0.81 0.72 0.61 ± 0.03 He 0.79 0.79 0.79 0.79 0.77 0.80 0.74 0.77 0.76 0.74 0.84 0.74 0.78 ± 0.01 FIS 0.26 0.32 0.20 0.45 0.31 0.30 0.15 0.17 0.25 0.27 0.05 0.04 0.23 ± 0.03 HWE n.s. n.s. n.s. n.s. sig n.s. sig n.s. n.s. n.s. n.s. n.s. Pop. mean Na 10.7 ± 1.5 12.3 ± 2.0 10.6 ± 2.1 8.5 ± 1.2 11.6 ± 2.1 8.8 ± 1.4 10.9 ± 1.7 12.1 ± 1.8 11.4 ± 1.9 12.4 ± 2.3 10.9 ± 2.1 9.8 ± 2.0 10.8 ± 0.6 Ar 7.7 ± 0.9 7.8 ± 1.0 7.6 ± 1.2 7.7 ± 1.0 7.7 ± 1.0 7.4 ± 1.0 7.8 ± 1.0 8.0 ± 1.0 7.3 ± 1.0 7.8 ± 1.2 7.7 ± 1.2 6.7 ± 1.0 7.6 ± 0.3 Ho 0.59 ± 0.07 0.59 ± 0.07 0.58 ± 0.05 0.51 ± 0.09 0.57 ± 0.08 0.56 ± 0.08 0.60 ± 0.08 0.59 ± 0.07 0.60 ± 0.06 0.57 ± 0.06 0.57 ± 0.09 0.57 ± 0.07 0.57 ± 0.03 He 0.75 ± 0.05 0.77 ± 0.04 0.74 ± 0.05 0.73 ± 0.05 0.77 ± 0.04 0.72 ± 0.06 0.77 ± 0.04 0.77 ± 0.04 0.75 ± 0.04 0.76 ± 0.05 0.74 ± 0.07 0.75 ± 0.04 0.75 ± 0.02 FIS 0.24 ± 0.07 0.26 ± 0.06 0.23 ± 0.05 0.35 ± 0.08 0.30 ± 0.08 0.29 ± 0.08 0.26 ± 0.08 0.28 ± 0.07 0.21 ± 0.06 0.26 ± 0.05 0.22 ± 0.10 0.27 ± 0.08 0.26 ± 0.04 References Fitch, A. J., Leeworthy, G., Li, X., Bowman, W., Turner, L., and Gardner, M. G. (2012). Isolation and characterisation of eighteen microsatellite markers from the sea cucumber Holothuria scabra (Echinodermata: Holothuriidae). Australian Journal of Zoology 60, 368 371. doi:10.1071/zo12114 Van Oosterhout, C., Hutchinson, W. F., Wills, D. P. M., and Shipley, P. (2004). Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4(3), 535 538. doi:10.1111/j.1471-8286.2004.00684.x Page 6 of 6