Gene Cloning and Structural Analysis of Virion Host Shutoff protein of Pseudorabies Virus

Σχετικά έγγραφα
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Chinese Journal of Biochemistry and Molecular Biology CK2 252

Shiraia sp. Slf14 III

(bovine herpesvirus type 1, BHV1,. (infectious bovine rhinotracheitis, IBR) (infectious pustular vulvovaginitis, IPV) 3, 1.1, 1.2a 1.2b [5].

JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Science of Sericulture

Studies on purification and characteristics of glycosyltransferase from an engineering strain

30s 56 60s 72 60s dntp cm s s s 23

Angioarrestin( harp1) C FD

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

ER-Tree (Extended R*-Tree)

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Molecular Cloning of MUC1ΠY and Soluble Expression of Its

Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka

Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE

Chinese Journal of Biochemistry and Molecular Biology PRV PCR. Detection of Pseudorabies Virus D NA by PCR. (No. 2 KM03507N),

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

6 T-DNA PCR TAIL-PCR T-DNA. 69% 30% T-DNA left border LB right border RB T-DNA A T-DNA

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL

Introduction to Bioinformatics

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x orfh79

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

BL21 (D E3)2p E T28a ( + )2bgl 2

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Extraction, Amplification and Sequence Analysis of Xiajiadian Ancient Human Bone D NA

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

svari Real-time RT-PCR RSV

Design and Fabrication of Water Heater with Electromagnetic Induction Heating

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Comparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

Motion analysis and simulation of a stratospheric airship

CK2, Basic Medical Sciences and Clinics (4) ( Π ) pt727 ( CIP), (TSR) 6 ( POP6) ( IPTG),, A,

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Μέτρηση της Ρυθµικής Ικανότητας σε Μαθητές Γυµνασίου που Ασχολούνται µε Αθλητικές ραστηριότητες Συνοδευµένες ή Όχι από Μουσική

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

High mobility group 1 HMG1

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family

C.S. 430 Assignment 6, Sample Solutions

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

Développement de virus HSV-1 (virus de l herpes simplex de type 1) oncolytiques ciblés pour traiter les carcinomes hépatocellulaires

ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S

Biapenem BIPM Lot No g mg

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»

Chinese Journal of Biochemistry and Molecular Biology. ( OsSUT2) 6314 kd, E2mail : edu. cn

Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.

16 1 Vol. 16 No ELECTROCHEMISTRY Feb MnO 6 Bir-Co5% Bir-Co10% Bir-Co15% Bir-Co20%. 3 3 Li mol L - 1 MgCl 2.

NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS

Identification of Fish Species using DNA Method

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Assalamu `alaikum wr. wb.

Electronic Supplementary Information

Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn

Study of urban housing development projects: The general planning of Alexandria City

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

Chinese Journal of Biochemistry and Molecular Biology RNA.

China Academic Journal Electronic Publishing House. All rights reserved.

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

CorV CVAC. CorV TU317. 1

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances

Molecular evolutionary dynamics of respiratory syncytial virus group A in

LfcinB. Expression and Iden tif ica tion of Lfc inb Gene in P ich ia pastoris

Βιοπληροφορική. Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Advances in the study of to0in in halobios

Approximation Expressions for the Temperature Integral

Chinese Journal of Biochemistry and Molecular Biology. p38mapk

CRASH COURSE IN PRECALCULUS

(Vibrio anguillarum) (Cyclina sinensis) *

J. of Math. (PRC) 6 n (nt ) + n V = 0, (1.1) n t + div. div(n T ) = n τ (T L(x) T ), (1.2) n)xx (nt ) x + nv x = J 0, (1.4) n. 6 n

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

Nguyen Hien Trang* **

Transcript:

ISSN 100727626 CN 1123870ΠQ 2005 2 Chinese Journal of Biochemistry and Molecular Biology 21 (1) :65 71,,,,, (, 430070) 3 (pseudorabies vires,prv) UL41 (VHS), PCR UL41 1174 bp, p GEX2KG GST, BL21 (DE3) GST2VHS VHS 4, 3 FEN21 (1A76) PROSPECT VHS 10 22, VHS (PRV), (VHS), UL41, Q51,Q71 Gene Cloning and Structural Analysis of Virion Host Shutoff protein of Pseudorabies Virus MA Xiang2Ru, HU Qin2Qin, XIAO Shao2Bo, FANGLiu2Rong, LIU Zheng2Fei, CHEN Huan2Chun 3 ( State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China) Abstract To study the structure and function of virion host shutoff protein(vhs) which was coded by UL41 gene of pseudorabies virus( PRV), a 1174 bp DNA fragment containing the complete coding sequence of UL41 gene was amplified by PCR technique and cloned into downstream of the GST of an expression vector,p GEX2 KG After induction by IPTG,a high expression of fusion protein was obtained The sequence analysis indicated that VHS protein had four conserved regions and the third conserved region was highly homologous with the FEN21 (1A76) domin of flap endonuclease 1 The three2dimensional structural prediction of VHS protein of PRV showed that the protein contained 10 2helix and 22 2sheet and was similar to the three2dimensional structure of VHS protein of human herpesvirus 1 by the software of PROSPECT Key words pseudorabies virus( PRV), virion host shutoff protein(vhs), UL41 gene, structural analysis 1984 Fenwick [1 ],, VPl6 ( UL48 ) VHS, VHS, VHS [3, ( ) ],VHS, ( HSV), IFN2 Π UL41 MHC [2 ], (virion host shutoff protein,vhs),, :2004204201, :2004206203 (No 2001AA213051) VHS mrna mrna ( ),VHS 3 Tel :027287282608,E2mail :hzauvet @public wh hb cn Received :April 1, 2004 ; Accepted : June 3,2004 Supported by The National High Technology Research and Development, mrna, ( [2 ) ] Program of China (No 2001AA213051) 3 Corresponding author Tel :86227287282608 E2mail :hzauvet @public wh hb cn

66 21, pmd2ul41 [4,5 ] HSV UL41 365,,TREEVIEW [6 VHS ] VHS : Ea (PRV),AAN77493 ; 1 (BHV21),NP - (Varicella2Zoster vires,vzv) 045317 ; 1 ( EHV21),NP - 041028 ; (bovine herpesvims,bhv21) 1 ( HSV21),AAC58446 ; (equine herpesvirus, EHV21) VHS 2 ( HSV22), AAC58447 ; 2 mrna (HVP22),AAG01880 ; 2 ( GHV22),, AAG14234 ; (VZV),NP - 040140 VHS 114 VHS Ea UL41, UL41, PRV VHS BLAST, PROSPECT HSV VHS, VHS PROSPECT [9 ] 1 VHS 3000 111 115 Ea Hind [7 ] Xba pmd2ul41, 112, DH5 BL21 (DE3), GST kb, Hind Xba p GEX2KG p GEX2KG, DH5, Taq pmdl82t Vector TaKaRa, DNA p GEX2UL41 112 UL41 PCR p GEX2UL41 p GEX2 Ka UL41 [6 ] KG BL, Primer 5 UL41 21 (DE 3 ),, 1174 bp 2 ml 75 gπml LB, P1 (18 mer) : 5 2CGGTGTGCGAGCGGAGAC23 P2 (24 mer) : 5 2GGGGGAGAGGGCGAGCATCACACG23 [8 ] PRV DNA, 4 5 000 rπmin, 1 SDS PRV 200, 3 min, 15 l 12 %SDS2 PCR PCR 96 4 min, 113 (pseudorabies virus, PRV) pmd2ul41, OMIGA 2 0 ClustalX 1 8 116 SDS2PAGE 37 A 600 016 110,4,, LB,37 3 h, IPTG 014 mmolπl, 1 h, PAGE [10 ], :94 1 min, 52 1 min, 2 72 1 min 30 s,40 72 10 min DNA 211 UL41 PCR PCR, pmd182t, PRV 200 DH5, X2gal IPTG LB, PCR,, 5 % PCR 018 %

1 : 67 1174 bp ( Fig 1), kinase phosphorylation site), 58 60 80 82, pmd2182t 276 278 C, pmd2ul41 (protein kinase C phosphorylation site),vhs (Fig 2) Fig 1 Amplification of UL41 gene M: DNA Marker (DL22000) ; 1 :Products of PCR ;2 :Control Fig 2 Identification of recombinant plasmid pmd2ul41 M: DNA marker (DL215000) ; 1 : pmd2ul41π Hind ;2 : pmd2ul41π Hind + Xba 212 pmd2ul41, PCR 1174 bp, PRV Ea UL41, UL41 365 VHS GenBank 3 ( ) VHS, (Accession Number) AY170125 Ka UL41, FEN21 RAD2 DNA DNA 9719 %, 25, ; 9718 %, 8 RPS2BLAST(reverse position specific BLAST) OMIGA 210 PRV Ea UL41 VHS VHS 40198 kd, 132 257 FEN21 (1A76) 8115 VHS Motif 9 [12 ], HhH2, XPG, 41 44 50, FEN21 53 147 150 170 173 177 180 354 357 2 ( casein binding site) 2 N2 ( glycosylation site), 54 57 327 330 ClustalX 1 8 a UL41 (Fig 3),VHS 4 : PRV VHS 1 42 ; 58 97 ; 126 232 ; 280 356 1993 Berthomme [6] VHS 4 3, 4 343 356, VHS,EHV21 (497 ),HSV21 (489),VZV (455), PRV(365), (98 125 232 279) HSV21, PRV VHS 40, 80 VHS TREEVIEW (Fig 4), PRV EHV21 BHV21, ; HSV21 HSV22 HVP22, ; GHV22 VZV 2002 Bigger [11 ], 213 VHS PSI2BLAST(position specific iterated BLAST) XPG( Xeroderma pigmentosum G), (metal

68 21 Fig 3 Alignment of amino acid sequences of UL41 gene Note :The positions of the BOX 1 4 regions are indicated The important region for VP16 binding in HSV21 (310 330) is underlied by a bar Identical residues are indicated by 3,similar residues are indicated by : or Fig 4 Phylogenetic analysis of alphaherpesvirus VHS homology The PRV VHS homolog is most closely related to VHS homology of EHV21 PROSPECT [9 ] PRV Ea HSV21 KOS VHS PRV, p GEX2KG, VHS 10 22, HSV21 VHS 13 25 ( Fig 5),VHS 4 ( Fig 3) IPTG 3 h, SDS2PAGE, PRV HSV21 VHS (Fig 7) :p GEX2UL41 66 kd, ; p GEX2 214 pgex2ul41 Hind Xba pmd2ul41, p GEX2UL41 (Fig 6) 215 UL41 p GEX2UL41 p GEX2KG BL 21 (DE 3 ), KG, 27 kd

1 : 69 Fig 5 Three2dimensional structure of VHS protein The positions of the BOX 1 4 regions are indicated The arrow indicates the important region for VP16 binding in HSV21 (310 330) Fig 6 Identification of the expression vector pgex2ul41 M:DNA marker (DL215000) ; 1 :p GEX2UL41ΠHind + Xba ; 2 :p GEX2UL41ΠHind Fig 7 Expression of p GEX2UL41 in BL21(DE3) M:Protein marker ; 1 :pgex2ul41(induced 3 hours) ; 2 :pgex2 KG(induced 3 hours), GST [10 ] 3, HSV VHS, VHS, eif4h mrna [13 ],VHS, VHS,,, VHS [5,14 ], PRV VHS, PRV VHS HSV, PRV VHS PRV VHS, PRV, VHS Ea UL41, VHS, 4, 3 FEN21 (1A76) [12 ] Everly [13 ],HSV21 PRV VHS 8 1 XPG FEN21 DNA, 9, HSV21KOS VHS, PROSPECT [9 ] PRV Ea HSV21KOS

70 21 VHS, VHS 4, PRV HSV2 1 VHS, PRV VHS, mrna Schmelter [15 ],HSV21 VHS VP16,VHS 310 330 21 VHS VP16, 321 VHS VP16, VHS,HSV21 VHS 310 330 alphaherpesvirus protein counterparts Virology, 1993, 193 : 1028 1032 7,,,,, A ( Chen Huan2Chun, Fang ( Fig 3 ), PRV VHS, HSV21 VHS, 310 330 3 ( Fig 5 ), PRV VHS ( HSV21 VHS 3 3 ), PRV VHS VPl6, evaluation, VHS 354, PRV EHV21 BHV21, PRV EHV21, BHV21,PRV EHV21 UL31, PRV EHV24 [16 PRV BHV21 ] PRV, UL23, [17 EHV24 ], PRV EHV21 EHV24 Orf BHV21 [18 ],, ( References) 1 Fenwick M L, McMenamin M M Early virion2associated suppression of cellular protein synthesis by herpes simplex virus is accompanied by inactivation of mrna J Gen Virol, 1984, 65 : 1225 1228 2 Read G S, Karr B M, Knight K Isolation of a herpes simplex virus type 1 mutant with a deletion in the virion host shutoff gene and identification of multiple forms of the VHS (UL41) polypeptide J Virol, 1993, 67 : 7149 7160 3 Lam Q, Smibert C A, Koop K E, Lavery C, Capone J P, Weinheimer S P, Smiley J R Herpes simplex virus VP16 rescues viral mrna from destruction by the virion host shutoff function EMBO J, 1996, 15 : 2575 2581 4 Murphy J A, Duerst R J, Smith T J, Morrison L A Herpes simplex virus type 2 virion host shutoff protein regulates AlphaΠBeta interferon but not adaptive immune responses during primary infection in vivo J Virol, 2003, 77 (17) : 9337 9345 5 Strelow L, Smith T, Leib D A The virion host shutoff function of herpes simplex virus type 1 plays a role in corneal invasion and functions independently of the cell cycle Virology, 1997, 231 : 28 34 6 Berthomme H, Jacquemont B, Epstein A The pseudorabies virus host2 shut2off homologue gene : Nucleotide sequence and comparison with Liu2Rong, He Qi2Gai, Jin Mei2Lin, Suo Xu2Feng, Wu Mei2Zhou Study on the isolation and identification of the Ea strain of pseudorabies virus Acta Veterin Zootech Sin), 1998, 29(2) : 156 161 8,,,, A TK - ΠgG - ΠLacZ + (Chen Huan2 chun, Zhou Fu2chun, Fang Liu2rong, He Qi2gai, Wu Bin, Hong Wen2 zhou Construction of TK - ΠgG - ΠLacZ + mutant of pseudorabies virus strain Ea Chin J Virol), 2001, 17(1) : 69 74 9 Xu Ying, Xu Dong Protein threading using PROSPECT: Design and Proteins2Structure Function and Genetics, 2000, 40 : 343 10,,, CK2 ( Chen Xiao2Wen,Liu Xin2Guang,Liang Jing2 Yao,Liang Nian2Ci Cloning,expression of human protein kinase CK2 subunit in E coli and purification and characterization of recombinant protein Chin J Biochem Mol Biol),2004,20(2) :176 182 11 Bigger J E, Martin D W Herpesvirus papio 2 encodes a virion host shutoff function Virology, 2002, 304 (1) : 33 43 12 Marchler B A, Anderson J B, DeWeese S C, Fedorova N D, Geer L Y, He S, Hurwitz D I, Jackson J D, Jacobs A R, Lanczycki C J, Liebert C A, Liu C, Madej T, Marchler G H, Mazumder R, Nikolskaya A N, Panchenko A R, Rao BS, Shoemaker BA, Simonyan V, Song J S, Thiessen P A, Vasudevan S, Wang Y, Yamashita R A, Yin J J, Bryant S H CDD : a curated Entrez database of conserved domain alignments Nucleic Acids Res, 2003, 31 : 383 387 13 Everly D N Jr, Feng P, Mian I S, Read G S mrna degradation by the virion host Shutoff (Vhs) protein of herpes simplex virus : genetic and biochemical evidence that Vhs is a nuclease J Virol, 2002, 76 : 8560 8571 14 Hinkley S, Ambagala A P N, Jones CJ, Srikumaran S A vhs2like activity of bovine herpesvirus21 Archives of Virology, 2000, 145 : 2027 2046 15 Schmelter J, Knez J, Smiley J R, Capone J P Identification and characterization of a small modular domain in the herpes simplex virus host shutoff protein sufficient for interaction with VP16 J Virol, 1996, 70 : 2124 2131

1 : 71 16,,,, Ea 17 Prieto J, Martin H A M, Tabares E Loss of pseudorabies virus UL (Ma Xiang2Ru, Hu Qin2Qin, Xiao Shao2Bo, Fang Liu2Rong, Chen Huan2Chun Cloning and sequence analysis of the genome unique long region of pseudorabies virus Ea strain Virol Sin),2004,19 (2) : 119 123 thymidine kinase activity due to a single base mutation and amino acid substitution J Gen Virol, 1991, 72 : 1435 1439 18 Telford E A, Watson M S, Perry J, Cullinane A A, Davison AJ The DNA sequence of equine herpesvirus24 J Gen Virol, 1998, 79 : 1197 1203 AH109 3,,, (, 100005) 2 2galactosidase ( ), BD AD, BD (Bait) AD,, LacZ, BD,, AH109 (2002 Clontech,Lot 3020041, REFS1643, - 80,2004 7 ) 2 2galactosidase 4 ( 2004 4 ), p GBKT7 (BD ) p GADT7 (AD ), (Fig 1,2,3) Fig 1 2Galactosidase 1 2 3 4 : 4 1 2 3 4 : 4 p GADT7 AH109 ; AH109 ;5 : p GBKT7 AH109 ; AH109 ;6 : p GADT7 AH109 ; - :CG1945 ; + : BD AD CG1945 Fig 2 2Galactosidase ( - ) :CG1945 Fig 3 2Galactosidase p GADT7 CG1945 4h,,,,,, AH109, 3 Tel : (8610) 652926407,Fax : (8610) 652122284,E2mail :gaoyouhe @pumc edu cn (No 30270657,No 3037030)