ISSN 100727626 CN 1123870ΠQ 2005 2 Chinese Journal of Biochemistry and Molecular Biology 21 (1) :65 71,,,,, (, 430070) 3 (pseudorabies vires,prv) UL41 (VHS), PCR UL41 1174 bp, p GEX2KG GST, BL21 (DE3) GST2VHS VHS 4, 3 FEN21 (1A76) PROSPECT VHS 10 22, VHS (PRV), (VHS), UL41, Q51,Q71 Gene Cloning and Structural Analysis of Virion Host Shutoff protein of Pseudorabies Virus MA Xiang2Ru, HU Qin2Qin, XIAO Shao2Bo, FANGLiu2Rong, LIU Zheng2Fei, CHEN Huan2Chun 3 ( State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China) Abstract To study the structure and function of virion host shutoff protein(vhs) which was coded by UL41 gene of pseudorabies virus( PRV), a 1174 bp DNA fragment containing the complete coding sequence of UL41 gene was amplified by PCR technique and cloned into downstream of the GST of an expression vector,p GEX2 KG After induction by IPTG,a high expression of fusion protein was obtained The sequence analysis indicated that VHS protein had four conserved regions and the third conserved region was highly homologous with the FEN21 (1A76) domin of flap endonuclease 1 The three2dimensional structural prediction of VHS protein of PRV showed that the protein contained 10 2helix and 22 2sheet and was similar to the three2dimensional structure of VHS protein of human herpesvirus 1 by the software of PROSPECT Key words pseudorabies virus( PRV), virion host shutoff protein(vhs), UL41 gene, structural analysis 1984 Fenwick [1 ],, VPl6 ( UL48 ) VHS, VHS, VHS [3, ( ) ],VHS, ( HSV), IFN2 Π UL41 MHC [2 ], (virion host shutoff protein,vhs),, :2004204201, :2004206203 (No 2001AA213051) VHS mrna mrna ( ),VHS 3 Tel :027287282608,E2mail :hzauvet @public wh hb cn Received :April 1, 2004 ; Accepted : June 3,2004 Supported by The National High Technology Research and Development, mrna, ( [2 ) ] Program of China (No 2001AA213051) 3 Corresponding author Tel :86227287282608 E2mail :hzauvet @public wh hb cn
66 21, pmd2ul41 [4,5 ] HSV UL41 365,,TREEVIEW [6 VHS ] VHS : Ea (PRV),AAN77493 ; 1 (BHV21),NP - (Varicella2Zoster vires,vzv) 045317 ; 1 ( EHV21),NP - 041028 ; (bovine herpesvims,bhv21) 1 ( HSV21),AAC58446 ; (equine herpesvirus, EHV21) VHS 2 ( HSV22), AAC58447 ; 2 mrna (HVP22),AAG01880 ; 2 ( GHV22),, AAG14234 ; (VZV),NP - 040140 VHS 114 VHS Ea UL41, UL41, PRV VHS BLAST, PROSPECT HSV VHS, VHS PROSPECT [9 ] 1 VHS 3000 111 115 Ea Hind [7 ] Xba pmd2ul41, 112, DH5 BL21 (DE3), GST kb, Hind Xba p GEX2KG p GEX2KG, DH5, Taq pmdl82t Vector TaKaRa, DNA p GEX2UL41 112 UL41 PCR p GEX2UL41 p GEX2 Ka UL41 [6 ] KG BL, Primer 5 UL41 21 (DE 3 ),, 1174 bp 2 ml 75 gπml LB, P1 (18 mer) : 5 2CGGTGTGCGAGCGGAGAC23 P2 (24 mer) : 5 2GGGGGAGAGGGCGAGCATCACACG23 [8 ] PRV DNA, 4 5 000 rπmin, 1 SDS PRV 200, 3 min, 15 l 12 %SDS2 PCR PCR 96 4 min, 113 (pseudorabies virus, PRV) pmd2ul41, OMIGA 2 0 ClustalX 1 8 116 SDS2PAGE 37 A 600 016 110,4,, LB,37 3 h, IPTG 014 mmolπl, 1 h, PAGE [10 ], :94 1 min, 52 1 min, 2 72 1 min 30 s,40 72 10 min DNA 211 UL41 PCR PCR, pmd182t, PRV 200 DH5, X2gal IPTG LB, PCR,, 5 % PCR 018 %
1 : 67 1174 bp ( Fig 1), kinase phosphorylation site), 58 60 80 82, pmd2182t 276 278 C, pmd2ul41 (protein kinase C phosphorylation site),vhs (Fig 2) Fig 1 Amplification of UL41 gene M: DNA Marker (DL22000) ; 1 :Products of PCR ;2 :Control Fig 2 Identification of recombinant plasmid pmd2ul41 M: DNA marker (DL215000) ; 1 : pmd2ul41π Hind ;2 : pmd2ul41π Hind + Xba 212 pmd2ul41, PCR 1174 bp, PRV Ea UL41, UL41 365 VHS GenBank 3 ( ) VHS, (Accession Number) AY170125 Ka UL41, FEN21 RAD2 DNA DNA 9719 %, 25, ; 9718 %, 8 RPS2BLAST(reverse position specific BLAST) OMIGA 210 PRV Ea UL41 VHS VHS 40198 kd, 132 257 FEN21 (1A76) 8115 VHS Motif 9 [12 ], HhH2, XPG, 41 44 50, FEN21 53 147 150 170 173 177 180 354 357 2 ( casein binding site) 2 N2 ( glycosylation site), 54 57 327 330 ClustalX 1 8 a UL41 (Fig 3),VHS 4 : PRV VHS 1 42 ; 58 97 ; 126 232 ; 280 356 1993 Berthomme [6] VHS 4 3, 4 343 356, VHS,EHV21 (497 ),HSV21 (489),VZV (455), PRV(365), (98 125 232 279) HSV21, PRV VHS 40, 80 VHS TREEVIEW (Fig 4), PRV EHV21 BHV21, ; HSV21 HSV22 HVP22, ; GHV22 VZV 2002 Bigger [11 ], 213 VHS PSI2BLAST(position specific iterated BLAST) XPG( Xeroderma pigmentosum G), (metal
68 21 Fig 3 Alignment of amino acid sequences of UL41 gene Note :The positions of the BOX 1 4 regions are indicated The important region for VP16 binding in HSV21 (310 330) is underlied by a bar Identical residues are indicated by 3,similar residues are indicated by : or Fig 4 Phylogenetic analysis of alphaherpesvirus VHS homology The PRV VHS homolog is most closely related to VHS homology of EHV21 PROSPECT [9 ] PRV Ea HSV21 KOS VHS PRV, p GEX2KG, VHS 10 22, HSV21 VHS 13 25 ( Fig 5),VHS 4 ( Fig 3) IPTG 3 h, SDS2PAGE, PRV HSV21 VHS (Fig 7) :p GEX2UL41 66 kd, ; p GEX2 214 pgex2ul41 Hind Xba pmd2ul41, p GEX2UL41 (Fig 6) 215 UL41 p GEX2UL41 p GEX2KG BL 21 (DE 3 ), KG, 27 kd
1 : 69 Fig 5 Three2dimensional structure of VHS protein The positions of the BOX 1 4 regions are indicated The arrow indicates the important region for VP16 binding in HSV21 (310 330) Fig 6 Identification of the expression vector pgex2ul41 M:DNA marker (DL215000) ; 1 :p GEX2UL41ΠHind + Xba ; 2 :p GEX2UL41ΠHind Fig 7 Expression of p GEX2UL41 in BL21(DE3) M:Protein marker ; 1 :pgex2ul41(induced 3 hours) ; 2 :pgex2 KG(induced 3 hours), GST [10 ] 3, HSV VHS, VHS, eif4h mrna [13 ],VHS, VHS,,, VHS [5,14 ], PRV VHS, PRV VHS HSV, PRV VHS PRV VHS, PRV, VHS Ea UL41, VHS, 4, 3 FEN21 (1A76) [12 ] Everly [13 ],HSV21 PRV VHS 8 1 XPG FEN21 DNA, 9, HSV21KOS VHS, PROSPECT [9 ] PRV Ea HSV21KOS
70 21 VHS, VHS 4, PRV HSV2 1 VHS, PRV VHS, mrna Schmelter [15 ],HSV21 VHS VP16,VHS 310 330 21 VHS VP16, 321 VHS VP16, VHS,HSV21 VHS 310 330 alphaherpesvirus protein counterparts Virology, 1993, 193 : 1028 1032 7,,,,, A ( Chen Huan2Chun, Fang ( Fig 3 ), PRV VHS, HSV21 VHS, 310 330 3 ( Fig 5 ), PRV VHS ( HSV21 VHS 3 3 ), PRV VHS VPl6, evaluation, VHS 354, PRV EHV21 BHV21, PRV EHV21, BHV21,PRV EHV21 UL31, PRV EHV24 [16 PRV BHV21 ] PRV, UL23, [17 EHV24 ], PRV EHV21 EHV24 Orf BHV21 [18 ],, ( References) 1 Fenwick M L, McMenamin M M Early virion2associated suppression of cellular protein synthesis by herpes simplex virus is accompanied by inactivation of mrna J Gen Virol, 1984, 65 : 1225 1228 2 Read G S, Karr B M, Knight K Isolation of a herpes simplex virus type 1 mutant with a deletion in the virion host shutoff gene and identification of multiple forms of the VHS (UL41) polypeptide J Virol, 1993, 67 : 7149 7160 3 Lam Q, Smibert C A, Koop K E, Lavery C, Capone J P, Weinheimer S P, Smiley J R Herpes simplex virus VP16 rescues viral mrna from destruction by the virion host shutoff function EMBO J, 1996, 15 : 2575 2581 4 Murphy J A, Duerst R J, Smith T J, Morrison L A Herpes simplex virus type 2 virion host shutoff protein regulates AlphaΠBeta interferon but not adaptive immune responses during primary infection in vivo J Virol, 2003, 77 (17) : 9337 9345 5 Strelow L, Smith T, Leib D A The virion host shutoff function of herpes simplex virus type 1 plays a role in corneal invasion and functions independently of the cell cycle Virology, 1997, 231 : 28 34 6 Berthomme H, Jacquemont B, Epstein A The pseudorabies virus host2 shut2off homologue gene : Nucleotide sequence and comparison with Liu2Rong, He Qi2Gai, Jin Mei2Lin, Suo Xu2Feng, Wu Mei2Zhou Study on the isolation and identification of the Ea strain of pseudorabies virus Acta Veterin Zootech Sin), 1998, 29(2) : 156 161 8,,,, A TK - ΠgG - ΠLacZ + (Chen Huan2 chun, Zhou Fu2chun, Fang Liu2rong, He Qi2gai, Wu Bin, Hong Wen2 zhou Construction of TK - ΠgG - ΠLacZ + mutant of pseudorabies virus strain Ea Chin J Virol), 2001, 17(1) : 69 74 9 Xu Ying, Xu Dong Protein threading using PROSPECT: Design and Proteins2Structure Function and Genetics, 2000, 40 : 343 10,,, CK2 ( Chen Xiao2Wen,Liu Xin2Guang,Liang Jing2 Yao,Liang Nian2Ci Cloning,expression of human protein kinase CK2 subunit in E coli and purification and characterization of recombinant protein Chin J Biochem Mol Biol),2004,20(2) :176 182 11 Bigger J E, Martin D W Herpesvirus papio 2 encodes a virion host shutoff function Virology, 2002, 304 (1) : 33 43 12 Marchler B A, Anderson J B, DeWeese S C, Fedorova N D, Geer L Y, He S, Hurwitz D I, Jackson J D, Jacobs A R, Lanczycki C J, Liebert C A, Liu C, Madej T, Marchler G H, Mazumder R, Nikolskaya A N, Panchenko A R, Rao BS, Shoemaker BA, Simonyan V, Song J S, Thiessen P A, Vasudevan S, Wang Y, Yamashita R A, Yin J J, Bryant S H CDD : a curated Entrez database of conserved domain alignments Nucleic Acids Res, 2003, 31 : 383 387 13 Everly D N Jr, Feng P, Mian I S, Read G S mrna degradation by the virion host Shutoff (Vhs) protein of herpes simplex virus : genetic and biochemical evidence that Vhs is a nuclease J Virol, 2002, 76 : 8560 8571 14 Hinkley S, Ambagala A P N, Jones CJ, Srikumaran S A vhs2like activity of bovine herpesvirus21 Archives of Virology, 2000, 145 : 2027 2046 15 Schmelter J, Knez J, Smiley J R, Capone J P Identification and characterization of a small modular domain in the herpes simplex virus host shutoff protein sufficient for interaction with VP16 J Virol, 1996, 70 : 2124 2131
1 : 71 16,,,, Ea 17 Prieto J, Martin H A M, Tabares E Loss of pseudorabies virus UL (Ma Xiang2Ru, Hu Qin2Qin, Xiao Shao2Bo, Fang Liu2Rong, Chen Huan2Chun Cloning and sequence analysis of the genome unique long region of pseudorabies virus Ea strain Virol Sin),2004,19 (2) : 119 123 thymidine kinase activity due to a single base mutation and amino acid substitution J Gen Virol, 1991, 72 : 1435 1439 18 Telford E A, Watson M S, Perry J, Cullinane A A, Davison AJ The DNA sequence of equine herpesvirus24 J Gen Virol, 1998, 79 : 1197 1203 AH109 3,,, (, 100005) 2 2galactosidase ( ), BD AD, BD (Bait) AD,, LacZ, BD,, AH109 (2002 Clontech,Lot 3020041, REFS1643, - 80,2004 7 ) 2 2galactosidase 4 ( 2004 4 ), p GBKT7 (BD ) p GADT7 (AD ), (Fig 1,2,3) Fig 1 2Galactosidase 1 2 3 4 : 4 1 2 3 4 : 4 p GADT7 AH109 ; AH109 ;5 : p GBKT7 AH109 ; AH109 ;6 : p GADT7 AH109 ; - :CG1945 ; + : BD AD CG1945 Fig 2 2Galactosidase ( - ) :CG1945 Fig 3 2Galactosidase p GADT7 CG1945 4h,,,,,, AH109, 3 Tel : (8610) 652926407,Fax : (8610) 652122284,E2mail :gaoyouhe @pumc edu cn (No 30270657,No 3037030)