Chinese Journal of Biochemistry and Molecular Biology MMP

Σχετικά έγγραφα
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

High mobility group 1 HMG1

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Identification of Fish Species using DNA Method

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

Supporting Information

Science of Sericulture

Cellular Physiology and Biochemistry

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL

H επίδραση της γονικής παρουσίας και του παιχνιδιού σε επώδυνες διαδικασίες στα παιδιά

Η ΑΝΑΖΗΤΗΣΗ ΤΟΥ ΌΡΟΥ "ΝΟΣΗΛΕΥΤΙΚΗ" ΣΤΑ ΠΡΑΚΤΙΚΑ ΤΩΝ ΣΥΝΕΔΡΙΑΣΕΩΝ ΤΟΥ ΔΙΟΙΚΗΤΙΚΟΥ ΣΥΜΒΟΥΛΙΟΥ ΤΟΥ ΘΕΡΑΠΕΥΤΗΡΙΟΥ ΕΥΑΓΓΕΛΙΣΜΟΣ

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

; +302 ; +313; +320,.

Effect of Trx1 Overexpression on Expression Level of MMP9 under High Glucose Condition in HBZY21

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ

TGFp FSH INH INH

MSM Men who have Sex with Men HIV -

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver

,,, (, ) , ;,,, ; -

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Supporting Information

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών

Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ. Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή. Αζαλαζηάδνπ Βαξβάξα

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

ΚΒΑΝΤΙΚΟΙ ΥΠΟΛΟΓΙΣΤΕΣ

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

BGP TRACP-5b BGP TRACP-5b P 0.05

ER-Tree (Extended R*-Tree)

) ; GSP ) ;PXD g, 100 ml

ΕΠΑΝΑΛΗΨΗ ΨΕΥΔΟΛΕΞΕΩΝ ΑΠΟ ΠΑΙΔΙΑ ΜΕ ΕΙΔΙΚΗ ΓΛΩΣΣΙΚΗ ΔΙΑΤΑΡΑΧΗ ΚΑΙ ΠΑΙΔΙΑ ΤΥΠΙΚΗΣ ΑΝΑΠΤΥΞΗΣ

NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS

Διερεύνηση και αξιολόγηση μεθόδων ομογενοποίησης υδροκλιματικών δεδομένων ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Electronic Supplementary Information (ESI)

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

College of Life Science, Dalian Nationalities University, Dalian , PR China.

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

Εξοικονόμηση Ενέργειας σε Εγκαταστάσεις Δρόμων, με Ρύθμιση (Dimming) ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Σχέση µεταξύ της Μεθόδου των ερµατοπτυχών και της Βιοηλεκτρικής Αντίστασης στον Υπολογισµό του Ποσοστού Σωµατικού Λίπους

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΕΡΙΒΑΛΛΟΝΤΟΣ

Design and Fabrication of Water Heater with Electromagnetic Induction Heating

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

Supporting Information

Quantitative chemical analyses of rocks with X-ray fluorescence analyzer: major and trace elements in ultrabasic rocks

ΣΤΥΛΙΑΝΟΥ ΣΟΦΙΑ

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Το κοινωνικό στίγμα της ψυχικής ασθένειας

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF

SUPPLEMENTARY INFORMATION

Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction

Τεχνικές παρασκευής ζεόλιθου ZSM-5 από τέφρα φλοιού ρυζιού με χρήση φούρνου μικροκυμάτων και τεχνικής sol-gel

ΔΙΑΜΟΡΦΩΣΗ ΣΧΟΛΙΚΩΝ ΧΩΡΩΝ: ΒΑΖΟΥΜΕ ΤΟ ΠΡΑΣΙΝΟ ΣΤΗ ΖΩΗ ΜΑΣ!

stability and aromaticity in the benzonitrile H 2 O complex with Na+ or Cl

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Τα γνωστικά επίπεδα των επαγγελματιών υγείας Στην ανοσοποίηση κατά του ιού της γρίπης Σε δομές του νομού Λάρισας

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS

Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Electronic Supplementary Information

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Δυσκολίες που συναντούν οι μαθητές της Στ Δημοτικού στην κατανόηση της λειτουργίας του Συγκεντρωτικού Φακού

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης

ΧΩΡΙΚΑ ΟΙΚΟΝΟΜΕΤΡΙΚΑ ΥΠΟΔΕΙΓΜΑΤΑ ΣΤΗΝ ΕΚΤΙΜΗΣΗ ΤΩΝ ΤΙΜΩΝ ΤΩΝ ΑΚΙΝΗΤΩΝ SPATIAL ECONOMETRIC MODELS FOR VALUATION OF THE PROPERTY PRICES

Congruence Classes of Invertible Matrices of Order 3 over F 2

ΕΘΝΙΚΗ ΣΧΟΛΗ ΔΗΜΟΣΙΑΣ ΔΙΟΙΚΗΣΗΣ ΙΓ' ΕΚΠΑΙΔΕΥΤΙΚΗ ΣΕΙΡΑ

Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates

Μέτρηση της Ρυθµικής Ικανότητας σε Μαθητές Γυµνασίου που Ασχολούνται µε Αθλητικές ραστηριότητες Συνοδευµένες ή Όχι από Μουσική

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Angioarrestin( harp1) C FD

Introduction to Bioinformatics

Transcript:

ISSN 100727626 CN 1123870ΠQ 2007 7 Chinese Journal of Biochemistry and Molecular Biology 23 (7) :574 580 22 1),2) 1),2) 1) 1) 1) 2) 1) 3,,,,,, ( 1), 215006 ; 2), 215123) (memberane2type matrix metalloproteinases, MT2 MMPs) 22 (matrix metalloproteinase22,mmp22), RT2PCR 13 MT2MMPs MMP22 mrna MMP22, MT12MMP, SPSS 1010, MT2MMPs MMP22 13, MT22 MT42 MT12MMP MMP22, MT32 MT52 MT62 MMP,MT2MMPs MMP22 ( P > 011), MT12MMP MMP22 ( P < 0105),MT32MMP MT52MMP ( P < 0105) MT2MMPs,,MT12MMP MMP22,MT32MMP MT52 MMP, MT2MMPs ; MMP22 ; ; Q55 Expression and Correlation of Membrane2type Matrix Metalloproteinases Subfamily and Matrix Metalloproteinase22 in Human Malignant Hematopoietic Cell Lines 2) J IANGJu2Xiang 1),2), MA Zhen2Ni 1),2), HU Xiao2Hui 1), DONG Ning2Zheng 1), BAI Xia 1), WU Shi2Liang 2),RUAN Chang2Geng 1) 3 ( 1) Jiangsu Institute of Hemotology, First Hospital Affiliated to Soochow University, Suzhou 215006, China ; Department of Biochemistry and Molecular Biology, Institute of Biochemical Engineering, Medical School, Soochow University, Suzhou 215123, China) Abstract To explore the differential expression of membrane2type matrix metalloproteinases (MT2MMPs) and matrix metalloproteinase22 (MMP22) in varied malignant hematopoietic cell lines, the expression of MT2MMPs mrna and MMP22 mrna in 13 hematopoietic cell lines were semi2quantified by RT2PCR Gelatinolytic activity of MMP22 was visualized on gelatin zymograms and the expression of MT12MMP protein was detected by flow cytometry Correlation of the expression of all detected genes from different cell origins as well as correlation between expressions of MT2MMPs and MMP22 was analyzed with statistic software SPSS10 0 The results showed that the expression pattern of the MT2MMPs and MMP22 were different in 13 hematopoietic cell lines MT22,MT42,MT12MMP and MMP22 were expressed in most of the cell lines, while MT32 MT52 and : 2006212211, : 2007203221 (No EE122522) 3 Tel : 862512265113556,E2mail : uujihsmc @publicl sz js cn Received : December 11,2006 ;Accepted : March 21,2007 Supported by Medical Development Fund of Soochow University(No EE122522) 3 Corresponding author Tel : 862512265113556,E2mail : uujihsmc @public1 sz js cn 1994-2007 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

7 : 22 575 MT62MMP were rarely expressed Statistic analysis revealed that there was little correlation between the expression of MT2MMPs and MMP22 in the cell lines ( P > 011), but the expression of MT12MMP showed a relationship with MMP22 ( P < 0105) as well as MT32MMP with MT52MMP ( P < 0105) The differential expression profiles of MT2MMPs in these hematopoietic cell lines suggest that each MT2MMP plays a specific role in the progression of different hemotoligic cancers Furthermore, the correlation between expression of MT12MMP and MMP22, MT32MMP and MT52MMP suggest the relationship of their functions Key words MT2MMPs ; MMP22 ; human hematopoietic cell lines ; expression ( memberane2type matrix metalloproteinases, MT2MMPs) U266 SHI21 10 % 6 MT2MMPs1MT2MMPs 20 % RMPI1640 MMPs :, 112 RNA cdna, Trizol,1 ml Trizol 1 10 7 MMPs C RNA, RNA, MT2MMPs, oligot12, RNA 1 5 g C,MT2MMPs 2 : (1) MT12 cdna MT22 MT32 MT52MMP ; ( 2) 113 PCR RT2PCR (glycosylphos2phatidylinositol,gpi) cdna 2 l, 13 MT42 MT62MMP MT2MMPs 6 MT2MMPs MMP22,, 2 2microglobin ( 22MG) [1,2 ],6 MT2 GenBank cdna Primer3 MMPs MMP22, MT42MMP [3 ] MT62MMP MMP22, MMP22, 94 3 min,94 30 s,55 40 s,72 MT2MMPs, 50 s, 72 5 min, 22MG 30, 13 7 34, PCR 115 %, MT2MMPs MMP22 (Bio2, MT2MMPs MMP22, Rad, Gel Doc TM XR) (Quantity MT2MMPs One2416), 1 111 RNA Invitrogen PCR Promega Sigma MT12MMP PAGE, R&D HL260 ; 215 %Triton X2100 SDS,1 h, NB 4 MR 2 ; Tirs2HCl (50 mmolπl,ph 715),CaCl 2 (5 mmolπl) ZnCl 2 K562 ; TF21 (1 molπl) 37, HEL ; SHI21 THP21 115 MT12MMP U937 ; T Jurkat ;Burkitt Raji ; RPMI8226 (matrix metalloproteinases,mmps), IMDM, MMPs,MT2,, Promega ( http :ΠΠwww genome wi mit edu), Table 1 PCR :, Excel, 114 (115 10 4 Π100 l), 20 l 1 mgπml 10 %SDS2 1994-2007 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

576 23 Table 1 Sequences of primers used for RT2PCR Gene Accession No Primer Sequence 5 23 Product size(bp) MT12MMP NM - 004995 Sense gctccgaggggagatgtttg 235 cagctccttaatgtgcttggg MT22MMP NM - 002428 Sense cgtgtcctgctttactgcaa 430 ctccaactgggcaaagagag MT32MMP D85511 Sense tggcgagtgagaaacaacag 420 ccttgaggatggatcttgga MT42MMP NM - 016155 Sense acggtgcctcctacttcttc 232 gtgcatgagcagacctcgtaa MT52MMP AB021227 Sense gatcgagcagttctggaagg 410 cgctcagtttctggttgtca MT62MMP AJ272137 Sense gatcgatgtgagggcaattt 344 taggtcttcccgttctgtgg MMP22 NM - 004530 Sense ggatccgcaagtggtccgtgtgaagtat 547 aagcttgctgtacccttggtcagggcagaa 22MG NM - 004048 Sense ctcgcgctactctctctttc 330 catgtctcgatcccacttaac 1 10 6 PBS, 2 l clustalw) 6 MT2MMPs, MT12MMP ( 015 gπ l ) 31 % 65 %, 30 min, PBS 2 FITC MT12 MT22 MT32 MT52MMP IgG ( Beckman Counter ), 53 % 65 %, MT32 MT52MMP 30 min, ( FC500,, 65 %, Beckman coulter ) MT12MMP 2 211 6 MT2MMPs HEXGHAXGLXH [6 ] Alignment ( http :ΠΠwww ebi ac ukπ MT42 MT62MMP, 46 %1 MT2MMPs 3 : [4 YGYL, ] ;furin [5 RRKR, MT2MMPs ] ; Fig 1 Fig 1 The phylogram tree of the 6 proteins analyzed by Clustal w1 8 program The sequences used for alignment include : MT12MMP ( P50281), MT22MMP (NP2002419), MT32MMP (BAA23742), MT42MMP (Q9UL29), MT52MMP (Q9Y5R2), MT62MMP(CAC03490) 212 RT2PCR 6 MT2MMPs MMP22 mrna RT2PCR ( Fig12),NB 4 MR 2 TF21 SHI2 1 Jurkat Raji 6 MT12MMP, NB 4 MR 2 SHI21 13 NB 4 SHI21 Raji MT22MMP, Jurkat RPMI8226 MR 2 THP21 MT42 K562 TF21 HEL SHI21 U937 THP21 9 72 kd MMP,MT32MMP MT52MMP HEL, THP21,Jurkat RPMI8226 MT32MMP NB 4,U937 THP21 MT62MMP, THP2 1,NB 4 MR 2 TF21 SHI21 U937 5 MMP22, NB 4 MR 2 213 MMP22 13 HL260 NB 4 MR 2, MMP22, 1994-2007 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

7 : 22 577 NB 4 MR 2 HL260 K562 HEL THP21 4 MMP22, RT2PCR MMP22, RT2PCR Fig 2 Electrophoresis of RT2PCR products of 6 MT2MMPs and MMP22 in 13 human hematopoietic cells The specific PCR products were run in 1 5 % agarose gel staining with ethidium bromide1 The figure is representive of three independent experiments Fig 3 The gelatin zymogram was examined in serum2free supernatant of human hematopoietic cells Serum2free supernatants from 13 cells were studied by gelatin zymography in a 715 % acrylamide gel containing 1 mgπml gelatin under nonreduced conditions Gelatinolytic activity at 72 kd was visualized, indicating the presence of prommp2 The figure is representive of three independent experiments 214 MT12MMP RT2PCR 13 1, TF21, Jurkat Raji MT12MMP (Fig14), MT12MMP MT12 Table 2, MMP RT2PCR (myelocytic leukemia), (erythroleukemia) 3, (monocytic leukemia), (lymphocytic leukemia),, (multiple myeloma) SPSS 1010 for windows MMPs,,, MT2MMPs [1 ( P > 011), ] MT2MMPs, MT12MMP MMP22 MT2MMPs,MT32MMP MT52MMP ( P,, 0105) MT2MMPs, MMP22 MT2MMPs, MT12MMP MMP22 ( P < 0105),NB 4 MR 2, SHI2 215 MT12MMP MT12MMP 1994-2007 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

578 23 Table 2 Relative expression of 6 MT2MMPs and MMP22 in human hematopoietic cells analyzed by semi2quantified RT2 PCR and quantitative result of enzyme activity of MMP22 MT22MMP Myelocytic leukemia Erythrol eukemia HL60 NB4 MR2 K562 TF21 HEL 0100 1106 0105 1157 0103 0115 0105 0177 0106 0100 0120 0103 0100 0141 0104 0158 0104 0145 0104 0133 0105 MT32MMP 0100 0100 0100 0100 0100 0149 0105 MT42MMP 0136 0103 0145 0105 0100 0169 0102 0140 0103 0153 0104 MT52MMP 0100 0100 0100 0100 0100 0159 0104 MT62MMP 0100 0118 0105 0100 0100 0100 0100 MMP22 0100 1111 0105 1132 0105 0100 0142 0106 0100 MMP22 activity MT12MMP 100 53 1195 2 388 02 17182 2 080 35 93159 350 88 6158 752147 33122 301145 8107 Morocytic leukemia Iymphocytic leukemia Multiple myeloma SHI21 U937 THP21 Jurkat Raji RPHI8226 U266 1138 0106 0100 0100 0160 0106 0168 0103 0100 0100 MT22MMP 0100 0132 0104 0108 0103 0178 0102 0100 0198 0104 0130 0105 MT32MMP 0100 0100 0118 0104 0129 0102 0100 0126 0104 0100 MT42MMP 0146 0103 0154 0105 0100 0183 0104 0142 0105 0181 0104 0166 0104 MT52MMP 0100 0100 0100 0100 0100 0100 0100 MT62MMP 0100 0125 0105 0153 0104 0100 0100 0100 0100 HHP22 MMP22 activity 0141 0102 0148 0105 0100 0100 0100 0100 0100 950190 6110 930176 27144 97154 5152 0100 0100 0100 0100 The relative gene expressions level was normalized to the house keeping gene expression of 22MG Data represent means SD derived from three independent experiments No significant correlation was found between the cell oringin and the expression levels of MT2MMPs and MMP22 ( General Linear Model test) The expression of MT12MMP showed correlation with the expression of MMP22 as well as the enzyme activity of MMP22 ( P < 0105, Nonparametric Test) The expression of MT32MMP also showed correlation with MT52MMP ( P < 0105, Nonparametric Test) [7 ],MT12MMP MMP22 65 %, HEL, [8 ],MT12MMP TIMP22 MMP22 MT52MMP Jung [13 ] MMP22,,MT12MMP MT2MMPs [9 Src2 VEGF2A ] (3) RT2PCR, MT22MMP,,6 MT12MMP [1 ],, MMP22 [10 ] MT32MMP, MT12MMP MMP22 MT52MMP MT62MMP [11,12 ], MT42MMP MMP22 13,,,, MT2MMPs MMP22, MMP22, : (1) 6 MT2MMPs 13 MMP22 (4) MT22, MT12 MMP MT12MMP MT22 MT42MMP, MT32 MT52 MT62 MMP, MT2, MT12MMP MT22MMP COS21 MMPs (2) 6 MT2MMPs MT32, MT32MMP,MT32MMP MT52MMP,, Velasco2Loyden [14 ] CHO, MT22MMP,MT12MMP MMP MT52MMP,, MT22MMP MT12 1994-2007 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

7 : 22 579 Fig 4 Flow cytometry analysis of MT12MMP on the membrane surface of 13 human hematopoietic cell lines (i) Nonspecific fluorescence intensity when cells were pretreated with mouse IgG (control isotype) (ii ) Fluorescence intensities when the cells were pretreated with specific MT12MMP monoclonal antibodies, respectively Results are representative of 3 separate experiments MMP, MT12MMP MT22MMP, MT2MMPs, MT2MMPs, MMPs, ( References) [ 1 ] Sounni N E, Noel A Membrane type2matrix metalloproteinases and tumor progression [J ] Biochimie, 2005, 87 (324) :3292342 [ 2 ],, 21 [ 8 ] Itoh Y, Takamura A, Ito N, et al Homophilic complex formation of [J ] (Jiang Ju2Xiang, Ruan Chang2Geng, Wu Shi2Liang The structure,function and regulation of memberane2 type matrix metalloproteinase21[j ] Chem Life),2005,25 (6) :4682 471 [ 3 ] English W R, Holtz B, Vogt G, et al Characterization of the role of the MT2loop : an eight2amino acid insertion specific to progelatinase A (MMP2) activating membrane2type matrix metalloproteinases [J ] J Biol Chem,2001, 276(45) :42018242026 [ 4 ] Pavlaki M,Cao J, Hymowitz M, et al A conserved sequence within the propeptide domain of membrane type 1 matrix metalloproteinase is critical for function as an intramolecular chaperone [J ] J Biol Chem, 2002, 277 (4) :274022749 [ 5 ] Yana I, Weiss S J Regulation of membrane type21 matrix metalloproteinase activation by proprotein convertases [J ] Mol Biol Cell,2000,11 (7) :238722401 [ 6 ] Lang R, Braun M, Sounni N E, et al Crystal structure of the catalytic domain of MMP216ΠMT32MMP : Characterization of MT2 MMP specific features[j ] J Mol Biol,2004,336 (1) : 2132225 [ 7 ] Seiki M Membrane2type matrix metalloproteinases [ J ] APMIS, 1999,107 (1) :1372143 MT12MMP facilitates prommp22 activation on the cell surface and promotes tumor cell invasion [J ] EMBO J, 2001, 20 (17) :47822 4793 [ 9 ] Sounni N E, Roghi C, Chabottaux V, et al Up2regulation of vascular endothelial growth factor2a by active membrane2type 1 matrix metalloproteinase through activation of src2tyrosine kinases[j ] J Biol 1994-2007 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

580 23 Chem, 2004, 279 (14) :13564213574 [10 ] Nakada M, Nakamura H, Ikeda E, et al Expression and tissue localization of membrane2type 1, 2, and 3 matrix metalloproteinases in human astrocytic tumors[j ] Am J Pathol,1999,154(9) :4172428 [11 ] Llano E, Pendas A M, Freije J P, et al Identification and characterization of human MT52MMP, a new membrane2bound activator of progelatinase A overexpressed in brain tumors[j ] Cancer Res,1999, 59 (11) :257022576 [12 ] Velasco G, Cal S, Merlos2Suarez A, et al Human MT62matrix metalloproteinase : identification, progelatinase A activation, and expression in brain tumors[j ] Cancer Res,2000, 60(4) :8772882 [13 ] Jung M, Romer A, Keyszer G, et al mrna expression of the five membrane2type matrix metalloproteinases MT12MT5 in human prostatic cell lines and their down2regulation in human malignant prostatic tissue [J ] Prostate, 2003,55(2) :89298 [14 ] Velasco2Loyden G, Arribas J, Lopez2Casillas F The shedding of beta glycan is regulated by pervanadate and mediated by membrane type matrix metalloprotease21 [J ] J Biol Chem, 2004, 279 (9) : 77212 7733 MDR1,, DNA, A T C G 3 1, 1, 1 20,,,,, P2,, P2, MDR1, P2 MDR1,, C3435T,,, MDR1, 2006 12 21 Science, P2,, ( C Brownlee :Science News Doc 23 9 30,2006,Vol 170,p 404) 1994-2007 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet