http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology T7Select10-3b MCS cdna 3' 6 cdna.

Σχετικά έγγραφα
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Shiraia sp. Slf14 III

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

30s 56 60s 72 60s dntp cm s s s 23

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

ER-Tree (Extended R*-Tree)

Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Digesting Plasmid DNA with Restriction Endonuclease s under the Condition of Microwave-heating

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

Identification of Fish Species using DNA Method

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

High mobility group 1 HMG1

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

College of Life Science, Dalian Nationalities University, Dalian , PR China.

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Supporting Information

Supporting Information

Quick algorithm f or computing core attribute

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Construction and Evaluation of Lentiviral Vector pita-hbp1

«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

TABLE OF CONTENTS Page

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

Science of Sericulture

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Angioarrestin( harp1) C FD

CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

Congruence Classes of Invertible Matrices of Order 3 over F 2

TGFp FSH INH INH

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

Πρόσκληση υποβολής προσφοράς

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

svari Real-time RT-PCR RSV

Supporting Information

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones

Acknowledgements... 3 Contents... I Figures... VII Tables... IX Abbreviations... X

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Introduction to Bioinformatics

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Z58 Taxus x media Z min M + Na +

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x orfh79

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

CorV CVAC. CorV TU317. 1

Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

Molecular Cloning of MUC1ΠY and Soluble Expression of Its

* /+* *,3- +**+ + ** , +1 - ect of a Dietary Education Program for Kindergarten Children and their Mothers

Nguyen Hien Trang* **

Reading Order Detection for Text Layout Excluded by Image

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

Advance in Nanorealgar Studies

Enantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes

Chinese Journal of Biochemistry and Molecular Biology RNA.

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

PrP C. PrP SC PrP. PrP. mrna

BL21 (D E3)2p E T28a ( + )2bgl 2

Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection

Electronic Supplementary Information

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT

Transcript:

ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 5 29 5 475 ~ 481 T7 cdna 1 1 2 * 1 1 1 071002 2 Western University of Health Sciences California 91766 USA C cdna ORF PCR T7Select10-3b MCS cdna 3' 6 cdna cdna ORF 6 % 70 % cdna T7 Q78 Construction of Lung Cancer cdna T7 Phage Library Using Modified Polyhistidine Tagged Expression Vector DONG Xiao-Min 1 1 ZHONG Li 2 * FAN Jiang-Ping 1 ZHANG Xu-Fei 1 1 Laboratory of Biochip School of Life Sciences Hebei University Baoding 2 Western University of Health Sciences California 91766 USA 071002 China Abstract The commercially available cdna T7 phage library is constructed using C-terminal display mechanism which contains inadequate open reading frame ORF expressed protein epitopes To improve the selection of ORF proteins we modified the existing phage vector T7Select10-3b by inserting 6 His-tag genes into the multiple cloning sites MCS at the 3' terminus by PCR The obtained phage clone expressing His-tag was used for construction of a display library The cdna was extracted from the human lung cancer tissues and inserted into the His-tag modified vector The packaged phages with ORF inserts were enriched by Ni-chelating affinity chromatography and then screened by chemiluminescence immunoassay The result showed that the 6 His-tag allowed the enrichment of expressed peptides with an increased from 6 % to 70 % as compared to unselected the library Our His-taged phage library provided a convenient and practical method to improve the ORF selection Key words His-tag T7 phage library open reading frame ORF cdna 1 160 2 2013-02-04 2013-04-03 T7 cdna No 81272444 No 81071795 * Tel 0312-5079364 E-mail lee_z@ yahoo com Received February 4 2013 Accepted April 3 2013 Supported by National Natural Science Foundation of China No 81272444 No 81071795 3 4 * Corresponding author E-mail lee_z@ yahoo com Tel 0312-5079364

476 29 cdna 5 DNA PCR Xho I Sac I C cdna 6 T7 cdna 1 3 10% open T7 E coli BLT5615 reading frame ORF PCR 7 8 T7 1 2 2 6 His T7Select10-3b His ORF DNA cdna ORF Sal I Xho I 3' His T7 ORF 1 1 T7Select10-3b 1 1 1 10 μl 990 μl LB 1 100 100 μl 900 E coli BLT5615 T7Select μl LB 10 11 10-3b Novagen 12 RNeasy Mini 5% TBST Kit Oligotex Direct mrna Mini Kit QIAGEN TBST 10 4 HRP Orient Express Random Primer cdna Synthesis Kit EcoR I / Hind III End Modification Kit DNA Ligation Kit T7Select10-3b Cloning Kit Novagen Taq DNA β-agarase IPTG TaKaRa MiniBEST Agarose Gel DNA 1 3 1 RNA mrna Extraction Kit TaKaRa DNA QIAGEN RNeasy Mini HRP His Kit RNA RNA 6 His-Tagged Protein Purification Kit Oligotex Direct mrna Mini Kit mrna 10 μl RNase-free Water 1 3 2 cdna Orient 1 2 6 His T7Select10-3b Express Random Primer cdna Synthesis Kit 1 2 1 6 His 10 cdna T7Select10-3b DNA Directional EcoR Ⅰ / Hind Ⅲ Linkers P1 5'-CCCGAGCTC AAGCTTCATCATCATCATCATCATGTCGACGAGATT CTACAAGC-3' P2 5'- CCGCTCGAGTACCGAAGG Hind Ⅲ EcoR Ⅰ Mini Column Fractionation Kit cdna AGTCGTGAATCAGT-3' PCR PCR 94 5 min 94 1 min 66 1 min 72 1 min 32 72 10 min His ECL 1 3 T7 cdna RNA RNA 500 μg 1 3 3 DNA EcoRⅠ / HindⅢ 1% EcoRⅠ End Modification Kit HindⅢ

5 T7 cdna 477 cdna 3 1 16 2 1 4 ORF ORF 2 1 6 His P1 P2 T7Select10-3b DNA PCR 0 75 kb 6 10 mmol / L His DNA T7Select10-3b DNA Sac I Xho I 20 44 500 mmol / L kb 15 78 kb DNA Fig 1 PCR cdna Novagen T7Select PCR 6 ORF His T7Select10-3b Fig 1 Electrophoresis analysis of the modified T7 vector A M1 DL2000 DNA marker 1 Inserts of His-tag synthesized by PCR appeared at the size of 0 75 kb B M2 DNA ladder 2 Liner T7Select10-3b DNA that was digested by Sac I and Xho I appeared at 20 44 kb and 15 78 kb 2 2 5 6 μg mrna A 260 / A 280 6 His 2 02 1% mrna T7Select10-3b cdna T7Select10-3b Fig 3B 2 4 cdna HRP 1 6 10 6 pfu / ml PCR 1% Fig 2 85% 90% 2 3 RNA mrna 300 bp Fig 4 RNeasy Mini 2 5 cdna ORF RNA A 260 / A 280 1 92RNA 1% ORF 28S 18S rrna Fig 3A 6% ORF 70% Fig 5

478 29 Fig 2 Expression identification of His-tag by immunoblotting A The modified phage vector with Histag right and the negative control without insert left side were plated on BLT5615 bacterial plates at a similar density B Plaques in two plates were lifted onto nitrocellulose membranes respectively The expression of the His-tag in individual phage clones was analyzed by immunoblotting using HRP-conjugated anti His-tag monoclonal antibody and chemiluminescence detection Positive signals indicated that the phage expressed His-tag Fig 3 Electrophoresis analysis of total RNA and mrna A 1 Total RNA was isolated from lung cancer tissue and the 28S and 18S ribosomal RNA appeared clearly B 2 mrna was purified from total RNA and appeared as a smear M DL2000 DNA marker Fig 4 PCR analysis of cdna inserts in lung cancer T7 phage library The library was plated in limiting dilution on LB-Agar / agarose plates A total of 100 plaques were randomly picked followed by PCR amplification using T7SelectUp and T7SelectDown primers The sizes of PCR products were analyzed on agarose gel More than 85% of the clones had cdna inserts approximately 90% of inserts were longer than 300 bp M DL2000 DNA marker 1 ~ 11 PCR products of randomly selected clones

5 T7 cdna 479 3 Fig 5 Analysis of ORF library by immunoblotting The packaged phage cdna library was selected by Nichelating affinity chromatography to generate ORF enriched cdna library The library showed here before A and after B the enrichment was plated on BLT5615 bacterial plates respectively The expression of the His-tag was analyzed by immunoblotting and chemiluminescence detection as before Positive signals indicated that the clones expressed the His-tag with ORF cdna inserts Approximately 70% of phage clones in the ORF library had ORF inserts whereas only < 6% of the clones had ORF inserts in the non-his-tagged library 3 1 ORF T7 1985 Smith ORF 13 cdna ORF 90% T7Select10-3b 14 λ MSC 3' T7 cdna ORF 15 T7 C ORF 16 17 ORF T7Select10-3b DNA 36 kb DNA DNA PCR EDTA PCR PCR 450 bp DNA 750 bp PCR 1 200 bp 470 bp PCR 6 His PCR PCR 3 2 cdna ORF cdna ORF 2004 Faix 8 pg3orf cdna ORF ORF pucmg4-198 ORF 6% 87% 2010 Caberoy 6 T7DNA ORF T7 cdna 10B C cdna cdna ORF ORF 18 ORF cdna ORF ORF 19

480 29 GenBank 200 bp ORF 96% cdna 1 300 bp ORF 99 2% 20 300 bp cdna ORF cdna frame selection J PCR cdna 90% 300 bp 21 ORF ORF ORF C HRP ECL HRP 70% use as markers of non-small cell lung cancer J cdna 2004 4 4 1216-1225 ORF 12 Zhong L Ge K Zu J C et al biomarkers for breast cancer J 3 R40 13 Smith G P that display cloned antigens on the virion surface J ORF 1985 228 4705 1315-1317 14 Fukunaga K Taki M ORF available phage display cloning systems J 2012 2012 295719 22 References 1 Ferlay J Shin H R Bray F et al Estimates of worldwide burden of cancer in 2008 GLOBOCAN 2008 J Int J Cancer 2010 127 12 2893-2917 2 Grunnet M Sorensen J B Carcinoembryonic antigen CEA as tumor marker in lung cancer J Lung Cancer 2012 76 2 138-143 3 Takakusagi Y Takakusagi K Sugawara F et al Use of phage display technology for the determination of the targets for smallmolecule therapeutics J Expert Opin Drug Discov 2010 5 4 361-389 4 12959 J Liu Shu-Qing Zong 19 Li W Caberoy N B New perspective for phage display as an Jun-Wei Guo Chun-Mei et al Lymphatic metastasis-associated biomarkers for cancers J Chin J Biochem Mol Biol 2012 efficient and versatile technology of functional proteomics J Appl Microbiol Biotechnol 2010 85 4 909-919 28 5 424-432 5 Paschke M Phage display systems and their applications J Appl Microbiol Biotechnol 2006 70 1 2-11 6 Caberoy N B Zhou Y Jiang X et al Efficient identification of tubby-binding proteins by an improved system of T7 phage display J J Mol Recognit 2010 23 1 74-83 7 Kalnina Z Silina K Meistere I et al Evaluation of T7 and lambda phage display systems for survey of autoantibody profiles in cancer patients J J Immunol Methods 2008 334 1-2 37-50 8 Faix P H Burg M A Gonzales M et al Phage display of cdna libraries enrichment of cdna expression using open reading Biotechniques 2004 36 6 1018-1022 9 Holz C Lueking A Bovekamp L et al A human cdna expression library in yeast enriched for open reading frames J Genome Res 2001 11 10 1730-1735 10 T7 J Ge Kun Zhong Li Zhao Long-Hua et al Vector preparation and optimization of ligation condition in the construction of T7 phage library J Sci Technol Inf 2008 6 1-3 11 Zhong L Peng X Hidalgo G E et al Identification of circulating antibodies to tumor-associated proteins for combined Proteomics Autoantibodies as potential Breast Cancer Res 2008 10 Filamentous fusion phage novel expression vectors Science Practical tips for construction of custom peptide libraries and affinity selection by using commercially J Nucleic Acids 15 Van Dorst B Mehta J Rouah-Martin E et al The identification of cellular targets of 17β estradiol using a lytic T7 cdna phage display approach J Toxicol In Vitro 2011 25 1 388-393 16 Dunn J J Studier F W Complete nucleotide sequence of bacteriophage T7 DNA and the locations of T7 genetic elements J J Mol Biol 1983 166 4 477-535 17 Dai M Temirov J Pesavento E et al Using T7 phage display to select GFP-based binders J Protein Eng Des Sel 2008 21 7 413-424 18 Danner S Belasco J G T7 phage display a novel genetic selection system for cloning RNA-binding proteins from cdna libraries J Proc Natl Acad Sci U S A 2001 98 23 12954-20 Garufi G Minenkova O Lo Passo C et al Display libraries on bacteriophage lambda capsid J Biotechnol Annu Rev 2005 11 153-190 21 cdna Arpc51 cdna J

5 T7 cdna 481 Wang Li-Xin Zheng Yao Ai Min et al Construction of cdna library of Andrias davidianus skin tissue with analyzing the cdna sequence and expression of Arpc51 gene J Chin J Biochem Mol Biol 2011 27 3 273-281 22 Caberoy N B Zhou Y Alvarado G et al Efficient identi cation of phosphatidylserine-binding proteins by ORF phage display J Biochem Biophys Res Commun 2009 386 1 197-201