Increasing of Maize Amylose Content by Sense RNA Interference

2 0 1 0 2 5 4 9 2-9 6 RNAi 1 2 1 2 1 2 3 2 2 1. 100048 2. 100097 3. 100193 RNAi sbeⅡb RNAi pbac506 pbac508 35S Adh1-intron1 epsps bar Zea mays 44 PCR PCR-Southern 30 9 Southern-blotting 7 T 0 4 1 2 2 1 3 7 2 23. 22% 24. 60% RNAi S336 A 1000-7091 2010 04-0092 - 05 Increasing of Maize Amylose Content by Sense RNA Interference ZHANG Gui-tang 1 2 LU Dong-chang-cheng 1 2 SUN Chong-xia 1 2 LIANG Rong-qi 3 YANG Feng-ping 2 ZHANG Xiao-dong 2 1. College of Life Science Capital Normal University Beijing 100048 China 2. Beijing Agrobiotechnology Research Center Beijing Academy of Agriculture and Forestry Science Beijing 100097 China 3. Key Lab of Crop Genomics & Genetic Improvement Beijing Key Lab of Crop Genetic Improvement College of Agronomy and Biotechnology China Agricμltural University Beijing 100193 China Abstract In order to explore the effect of sense RNAi RNA interference on increase the amylose content of maize Zea mays two sense-rnai vectors pbac506 and pbac508 with the sense sbeⅡb and selection gene epsps or bar were constructed and transformed to maize callus induced from immature embryos of the elite inbred lines by biolistic PDS1000 / He. Forty-four T 0 transformed plantlets were regenerated and thirty plants were positive by analysis of PCR and PCR-Southern hybridization. Southern-blotting results of 9 strong PCR-positive plants showed that the RNAi constructs in 7 plants were successful integrated into their genomes 4 with one copy of transgene 2 with two copies and 1 with three copies. The amylose content of 2 T 2 transgenic lines were 23. 22% and 24. 60% respectively. The results suggested that a big transgenic population was necessary for screening the transgenic plants with multi-copy transgene and high amylose content. Key words Maize Starch branching enzyme Sense-RNAi Amylose 70% Amylose Amylopectin 1 3 2009-07 - 22 2006-16 1984-1970 -

4 RNAi 93 Re- sistant starch RS 1 ~ 3 1-3 Starch branching enzymes SBE 16 1 6 1. 1 4 α- 1 6 5 sense-rnai 3 sbei sbeiia sbeiib sbeiib sbeiib sense-rnai 17 501 478 178 07- ae 2 024 058 21 8 50% sense-rnai 50% 80 ae Zea mays 17 501 178 478 5 55% ~ 178 07-2 058 21 60% 6 60% ~ 70% 7 pgem-t easy Vector 70% ~ 80% 7 Promega Escherichia coli ae DH5α Promega Taq IPTG X-gal S1127ae / ae HZ32ae / ae T 4 DNA DNA ND-AE-0201 Promega Promega NEB TaKaRa RNaseA Promega 401 DIG Roche Diagnostics GmbH Sigma Promega BECKMAN CEQ2000XL DNA Analysis System Cosuppresion Accession No AF072725 SacII Sac Ⅰ 3'-UTR 8 9 3 sbeiib 2225 ~ 2660 RNA RNA dsrna Inverted repeat RNA in- terference IR-RNAi RNA RNA RNAi Sense RNA interference Sense-RNAi 10 1 sbeiib mrna GenBank 1 sense-rnai Fig 1 Schematic map of expression 11 sense-rnai vector pbac506 and pbac508 1 pbac506 pbac508

94 25 1. 2 1. 5 Southern-bloting 10 ~ 11 d 1 ~ 2 mm N6 Nos' + 10 mg / L AgNO 3 + 100 mg / L + 2 mg / L 2 4- D + 30 g / L + 7 g / L 26 1 12 TCGGTGATGACGGTGAAA -3' pbac506 PDS1000 / He 0. 1 mg / L 0. 2 mg / L Bialaphos N6 + 0. 5 mg / L AgNO 3 + 100 mg / L 2 ~ 3 0. 8% + 1. 5 mg / L KT + 30 g / L + 7 g / L + 0. 05 X 3 ~ 4 mg / L 0. 1 mg / L Bialaphos h PCR-Southern 1 /2 MS + 2 1. 6 mg / L + 100 mg / L + 0. 5 mg / L NAA + 30 g / L + 7 g / L 3 ~ 5 d Unicam UV-Visible Spectrometry Helios Alpha 1. 3 PCR CTAB DNA pbac506 GB7648. 87 DNA DNA sbeiib PCR sbeiib Nos' P5 2. 1 5'-CCGCGGGAGGAGGATAAGGT- GATTGTG -3' 5'- CTCATAAATAACGT- CATGCATTAC -3' DNA 1. 0 μl 10 PCR Reaction Buffer 2. 5 μl dntps 2. 5 mmol / L 2. 0 μl 5' 10 μmol / L 1. 0 μl 3' 10 μmol / L 1. 0 μl Taq DNA 2. 5 U / μl 0. 5 μl ddh 2 O 15 μl DNA 1. 0 μl 10 PCR Reaction Buffer 2. 5 μl dntps 2. 5 mmol / L 2. 0 μl 5' 10 μmol / L 1. 0 μl 3' 10 μmol / L 1. 0 μl Taq DNA 2. 5 U / μl 0. 5 μl ddh 2 O 15 μl T12 T13 T14 T15 T16 T20 T21 T22 T23 T25 95 3 min 94 50 s 54 50 T26 T27 T28 T29 T30 T32 T35 T36 T41 T43 s 72 50 s 35 72 10 min 0. 8% 1. 4 PCR-Southern Roche PCR DIG Probe Synthesis Kit 5'- ATGATTAGAGTCCCGCAATT -3' 5'- sbeiib DIG 600 bp sbeiib-nos3' DNA PCR 32 T 0 PCR- sbeiib Southern 3 1 785 Bio-Rad DNA 2 Roche DIG DNA labeling and Detection Kit Southern Southern PCR P6 Hind III 150 μg DNA 0. 25 mol / L HCl 15 min 3 2 PDS1000 / He 17 501 478 178 07-2 024 058 21 8 7 d 44 2. 2 PCR sbeiib Nos3' P5 sbeiib P5 32 PCR 30 600 bp 2 T1 T2 T3 T4 T5 T6 T7 T8 T10 T11 30 sbeiib 2. 3 sbeiib PCR-Southern 3 30

4 RNAi 95 30 sbeiib M. 1 kb ladder 1 20. pbac506 2 21. 3 22. ck1 4 ~ 19 23 ~ 38. 4 M. 1 kb ladder 1 20. Plasmid pbac506 2 21. Blank 3 22. Negative maize ck1 4-19 23-38. Different transgenic plants. The same as below. 2 Fig. 2 sbeiib PCR PCR analysis result of sbeiib in transgenic plants 3 Fig. 3 2. 4 Southern-blotting sbeiib-nos3' PCR-Southern PCR-Southern analysis result of sbeiib-nos3' in transgenic plants T30 T29 2 T43 3 1. pbac505 2. 3. 4. T20 5. T17 6. T35 7. T21 8. T30 9. T36 10. T43 11. T37 12. T29 1. Plasmid pbac506 2. Negative maize CK1 3. Blank 4. T20 5. T17 6. T35 7. T21 8. T30 9. T36 10. T43 11. T37 12. T29. 4 Fig. 4 Southern-blotting analysis of vector in transgenic plants 23. 22% Nos' Southern 24. 60% PCR P6 30 1 T 0 9 Tab. 1 The content of amylose of transgenic maize seeds / % / % DNA Southern 4 Serial number Amylose Frenquency increment 1 501 CK 23. 87 ± 0. 06 - ae CK 44. 10 ± 0. 12-2 7 T20 24. 22 ± 0. 13 1. 26 T17 T10 T30 T36 T21 24. 60 ± 0. 14 3. 06 T37 T43 T29 Southern-blotting ae. 501. T20 T17 T10 T36 T37 1 T21. Note ae. High amylase maize line 501. CK T20 T21. Positive transgenic lines. 3 RNAi RNAi RNAi 3' 3'-UTR mrna poly A 3'- UTR mrna mrna mrna Southern 13 3'-UTR mrna poly A 2. 5 5' 7 Southern 5' 3' RNA 3' 5' T20 T21 1 mrna 14 mrna 3'-UTR

96 25 Ohnishi 15 3'-UTR RISCs 5 Smith A M Denyer K Martin C. The synthesis of the- RNAi starch granule J. Annu Rev Plant Physiol Plant Mol Biol 1997 48 67-87. RISCs 6 Fergason V. High amylose and waxy corns C / / Hallauer A R. Specialty corn. Boca Rotan 1994 CRC Press. 7. J. 2002 18 3 32-40. 8 Napoli C Lemicux C Jorgensen R. Introduction of a chalcone synthasa gene into Petunia results in reversibe co- WO9722703A2 sbeiib cdna suppression of homologous gene in trans J. Plant Cell zein 1990 2 279. 9 Van der Krol A P Mur L A Beld M et al. Flavonoid sbeiib 3' 5' sbeiib cdna sbe 2 16 17 sbeiib sirna 11 Que Q Wang H Y English J J et al The frequency and degree of cosuppression by sense chalcone synthase transgenes are dependent on transgene promoter strength and are reduced by premature nonsense cordons in the 50% 18 sbeiib transgene coding cequence J. Plant Cell 1997 9 8 1357-1368. sbeiib 12 ZHANG Xiaodong LIANG Rongqi CHEN xuqing et al. T 1 Transgene inheritance and quality improvement by expressing novel HMW glutenin subunit HMW-GS genes in winter wheat J. Chinese Science Bulletin 1 2003 48 8 771-776. 26. 7% 23. 1% 15. 6% 13 Pesole G Liuni S Grillo G et al. UTRdb and UTRsite specialize databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic 24. 22% 24. 6% mrnas J. Nucleic Acids Research 2002 30 335-3. 06% 340. 2 sense-rnai 14. M. 3. 2002. 15 Ohnishi Y Tokunaga K Hohjoh H. Influence of assembly of sirna elements into RNA-induced silencing complex by fork-sirna duplex carrying nucleotide mismatches at the 3'- or 5'-end of the sense-stranded sirna element J. Biochemical and Biophysical Research Communications 2005 329 516-521. 16. J. 2000 1 11-19. 1. 2005 31 6 625-630. J. 2002 10 3 90-92. 2. J. 2005 2 4 232-235. 3. J. 2005 13 4 29-31. 9 ~ 4 Visser R G FJacobsen E. Towards modifying plants foraltered starch content and composition J. Trends Biotech- 11nt 95% nol 1993 11 63-68. genes in petunia Addition of a limited number of gene copies may lead to a suppression of gene expression J. Plant Cell 1990 2 291-299. 10 Jorgensen R A Ma C L Doetsch N. Functional genomics by sense-rnai a forward genetic approach for cell-typetargeted mutagenesis C. Plant Genomics in China Ⅵ 2005 1. 17. RNA J. 18. RNAi J. 2008 16 4 658-661.