392 Basic Medical Sciences and Clinics 2003123 (4) : 100126325 ( 2003) 0420392207 CK2 1 # 2, #, 1 1, 3 1, ( 11 ; 21, 524023) : PCR NIH 3T3 CK2 cdna ; CK2, CK2 cdna, CK2 cdna BL21 (DE3), 26kDa, 3117 %, Western blot : CK2 1 :1, CK2, CK2 CK2 CK2 : Π CK2Π ; ; DNA ; ; :Q555 + 17 ; Q78 :A CK2 111 Π, NIH 3T3 ( Π ) ( ) ( 2 2 2 [1,2 2 2 ), ], pt727 CK2 215, Tabor RPMI21640 Gibco 26kuCK2,,,dNTP, Hind Promega CK2, Nde MBI Pyrobest DNA [1 ] CK2 ( ) Sangon RNase A [1 ] CK2 N2(DEPC), (NC ) ATP Sigma, CK2 cdna T4 DNA, ( CIP), Roche Big Dye (TSR) 6 ( POP6) PE ABI, 1, DH5 BL21 (DE3) ( IPTG),, A, :2002-08 - 29 :2002-10 - 15 : (011766) ; (2002C30109) ; (ZK0006) (XK0002) # ; : 3 : E1mail :xgliu @gdmc1edu1cn
2003123 (4) Basic Medical Sciences and Clinics 393, TEMED Bio2 Rad, CK2 McAb Iss2 inger ECL PCR, : 96, 30s ;, Oxoid 50, 30s ; 60, 4min, 25 Π,[ 2 32 P]ATP, PCR, (TSR) 95, 4min, PE PRISM TM 310 DNA 112 ( POP 6 ), NIH 3T3, CK2, RNA cdna 113 CK2 cdna (648bp) [2,3 ] ( P1) :5, 5mL Amp LB CCTCTAGACATATGAGTAGCTCTGAGGAGGT 3,, IPTG 1mmolΠL CK2cDNA 20,5 4h, 4 000G,4 Nde ; ( P2) : 5AAGGATC2 CAAGCTTCAGCGAATAGTCTTGAC 3, CK2 cdna 18,5 Hind 114 RNA Chomczynski [4 ] 22 ( 4, 10s, 50 % 115 RT2PCR 5g RNA P2 RNase 100mmolΠL NaCl A,4 dntp 1 L (AMV2RT),30 000G,4 10min, ( P2 (10UΠ L), 20 L,37 60min ), (S2 ) CK2 cdna 3 L cdna,, dntp 1110 SDS2PAGE 015 L Pyrobest ( DNA, 10UΠ L), 100 L, : 94 4min, 94,30s ; 55,30s ; 72,1min, 30, 72 10min 116 PCR pt727 1111 Western blot [ 5] SDS2PAGE NC PCR CK2 McAb ECL PCR pt727 5g,NC BSA, Nde Hind,, CK2 McAb ( ), 117, X,,, [5,6 ] 1 L, 200ng DNA, 312pmol, 5 L,PE 9600 PCR 119 DNA ptmckb BL21 (DE3) 10min, 012 mmolπl PMSF, 400 L A ( 20mmolΠL Tris2HCl, ph715, 1mmolΠL EDTA, 015mmolΠL EGTA, 7mmolΠL 2, 0105molΠL NaCl, 012mmolΠL PMSF, 1mgΠL, 1 mgπl A), 4 ) DNase I 4 DNA 60min 30 000G,4 10min, (S2I), ( P2I) Laemmli, 0175mm 12 %, R2250, CK2 IgG( ) ECL 1112 CK2 [7 118 DNA ] min 2, P1 1pmol[ 2 32 P]ATP 32 P P2,PE ABI Big Dye 1
394 Basic Medical Sciences and Clinics 2003123 (4) 2 211 CK2 cdna PCR NIH3T3 RNA, RT2 PCR, 018 % 1 DNA, 564bp 831bp, 672bp 3065bp, Nde ΠHind 2416bp 649bp Hind Nde IΠHind, (3), bp 4 3 2 1 bp bp 2 1 2466 3530 2027 831 564 831 564 1 RT2PCR Fig 1 RT2PCR amplification products from agarose gel Lane 1. product of RT2PCR ; Lane 2. DNA/ EcoR + Hind marker 212 CK2 cdna Nde ΠHind PCR 214 CK2 cdna pt727 T4 DNA DNA (2) Π DNA (4) : [8] 12,,12 CK2cDNA, 100 %, PCR 213 [2,3] CK2cDNA ( 2 CK2 ), CK2cDNA 131 GCC,159 TTC, (1) CK2 cdna 131 159 (1) CK2, CK2 cdna, ptmckb 215 CK2 CK2 ptmckb BL21 (DE3) IPTG 26ku (5, 2), ( 6) CK2 3117 %, 5 ( P2I) (S2I) P2I (S2II) 2 ptmckb Fig 2 Construction of recombinant plasmid ptmckb 3 Fig 3 Restriction analysis of recombinant plasmid Lane 1. DNAΠEcoR + Hind marker ; Lane 2. recombinant plasmidπnde + Hind ; Lane 3. recom2 binant plasmid ΠHind ; Lane 4. pt727πhind CK2,
2003123 (4) Basic Medical Sciences and Clinics 395 4 ( ) Fig 4 Sequencing chart of recombinant plasmid( partial) A1 partial result of positive sequencing of clone 1 ;B1partial result of reverse sequencing of clone 2 1 CK2cDNA 131 159 Table 1 The comparison of Code 131 and Code 159 of the cdna encoding CK2 beta subunit of mammalias reported to date species accession number of GenBank sequence of Code 131 sequence of Code 159 resource of literatrue Mouse X52959 GCT TTC [2 ] Mouse X56502 GCC TTT [3 ] Mouse - - GCC TTC This paper Rat L15619 GCC TTC [8 ] Rabbit S56242 GCC TTC [9 ] Porcine X56503 GCC TTC [3 ] Human X16312 GCC TTC [10 ] Human - - GCC TTC [5 ] 1 2 3 4 5 6 ku MCK2 6 ptmckb IPTG SDS2PAGE( 5 2) Fig 6 The scanning graph of SDS2PAGE ( Lane 2 in Fig 5) of crude extract of IPTG2induced bacteria transformed by ptmckb MCK2 in the transformed bacteria - 66-45 - 36-29 - 25-20 - 1412 Lane 1. crude extract of bacteria transformed by ptmckb that wasnπt induced by IPTG; Lane 2. crude extract of IPTG2induced bacteria transformed by ptmckb ;Lane 3. S2I fraction of B ; Lane 4. P2I fraction of A ;Lane 5. S2 fraction of A ; Lane 6. protein molecular weight standard 216 Western blot Western blot : CK2 McAb, NC 26ku (7), CK2 217 CK2 5 CK2 CK2 ( ) Fig 5 Expression of recombinant mouse CK2subunit (14pmol), CK2 (2) CK2, CK2 CK 514, CK2 CK2 CK2 CK2
396 Basic Medical Sciences and Clinics 2003123 (4), [10 ] [3 ] [6,11 ] CK2 cd2 MCK2 7 CK2 Western blot Fig 7 Western blot of recombinant mouse CK2subunit Anti2human protein kinase CK2monoclonal antibody was used as primary antibody in this experiment ; The blotting was detected by using Luminol Reagent for enhanced chemiluminescence( ECL) : 2 CK2 CK2 Table 2 Activation of the CK2subunit by CK2subunit : PCR pt727 RatioΠ (molπmol) CK2 activity (mu, x s) of CK2activity ( %), Π ; 1 0 173814 7915 100 1 012 230713 3217 133 3 1 014 277415 12011 160 3 1 016 546810 9813 315 3 1 110 944017 10017 543 3 1 114 950813 10813 547 3 1 210 954612 11818 549 3 3 P < 0101 vs 1 0 group 3 CK2 [2 ] cdna : Kopatz, Pyrobest 3 5, PCR GenBank X52959 ; Boldyreff, [3 ],GenBank X56502, 131 159 (1), ptmckb, 131 GCC BL21 (DE3),,SDS2PAGE Boldyreff, Kopatz, 159 TTC 3117 %, Kopatz, Boldyreff CK2 NA, 131 GCC, 159 TTC, CK2 cdna, CK2 cdna CK2 cdna,,, CIP pt727 5,, 100 %, CK2 [6 72 % ] DNA Pyrobest, PCR Taq DNA 3 5, PCR, DNA, [1 ], CK2, CK2 cdna CK2 Western cdna? blot, CK2, CK2 cdna CK2, [1,2 (cdna CK2 ] CK2 [9 ) ] CK2 CK2
2003123 (4) Basic Medical Sciences and Clinics 397 CK2, ;, PCR CK2cDNA, CK2, CK2 DNA ptmckb : CK2 BL21 (DE3), CK2 CK2,, ; CK2, CK2 : [1 ] Pinna LA. Protein kinase CK2 : a challenge to canons[j ]. J Cell Sci, 2002, 115(Pt 20) :3873-3878. [2 ] Kopatz I, Naiman T, Eli D, et al. The nucleotide sequence of the mouse cdna encoding the beta subunit of casein kinase II [J ]. Nucleic Acid Res, 1990, 18(2) : 3639. [3 ] Boldyreff B, Piontek K, Schmidt - Spaniol I, et al. The beta subunit of casein kinase II: cloning of cdnas from murine and porcine origin and expression of the porcine sequence as a fusion protein [J ]. Biochim Biophys Acta, 1991, 1088 (3) : 439-441. [4 ] Chomczynski P, Sacchi N. Single - step method of RNA isola2 tion by acid guanidinium thiocyanate2phenol2chloroform extrac2 tion [J ]. Anal Biochem, 1987, 162(1) :156-159. [ 5 ] Sabmrook J, Russell DW. Molecular Cloning : A Laboratory Manual, third eds[m]. New York : Cold Spring Harbor Labo2 ratory Press, 2001 : 1. 1-1. 132. [6 ],,,. CK2, 1999,15(2) :228-231. cdna [J ]. 227-233. [7 ],,. CK2 [J ]., 2000, 27 (2) :201-205. [8 ],,. DNA [J ].,1998,18(5) :396. [9 ] Ahmed K, Davis A, Hanten J, et al. Cloning of cdnas en2 coding the alpha and beta subunits of rat casein kinase 2 (CK2 2) : investigation of molecular regulation of CK22 by androgens in rat ventral prostate [J ]. Cell Mol Biol Res, 1993,39(5) : 451-462. [ 10 ] Gupta SK, Singh JP. PCR cloning and sequence of two cdnas encoding the alpha and beta subunits of rabbit casein kinase2ii [J ]. Gene 1993,124(2) :287-290. [11 ] Jakobi R, Voss H, Pyerin W. Human phosvitinπcasein kinase type II. Molecular cloning and sequencing of full2length cdna encoding subunit beta [J ]. Eur J Biochem, 1989,183(1) : Cloning, expression and activity of recombinant mouse protein kinase CK2subunit CHEN Xiao2wen, ZHEN Ke2qin, LIANGJing2yao, et al. ( Institute of Biochemistry and Molecular Biology, Guangdong Medical College, Zhanjiang 524023, China) Abstract : The cdna encoding murine protein kinase CK2subunit was extracted from NIH 3T3 murine fibroblast cells by RT2PCR. The expression plasmid was constructed, then confirmed to encode mouse protein kinase CK2subunit by DNA sequencing. The sequencing results showed that the sequence of the inserted fragment of two recombinant mouse CK2clones were differed in the reported two cdna sequences encoding mouse protein kinase CK2subunit for one dis2 crepant base respectively, but the difference bases were consistent with the corresponding position of cdna sequences en2 coding protein kinase CK2subunit in rat, rabbit, porcine and human. When the plasmid was induced to express in E. coli BL21 (DE3), one protein with molecular mass of 26ku was overexpressed, comprising about 31. 7 % the total of bac2
398 Basic Medical Sciences and Clinics 2003123 (4) terium protein indicated by scanning. However most of the expressed CK2proteins were insoluble. Western blot results confirmed that the overexpressed product could specially react with antibody against human CK2subunit. When recom2 binant CK2andsubunits were mixed at an 1 :1 molar ratio, the constituted CK2 holoenzyme displayed the maximum activity, which directly illustrated the activation effect ofonsubunit. These results strongly demonstrated that the cloned, expressed recombinant protein was murine protein kinase CK2subunit. Key words : regulatory subunitπprotein kinase CK2Πmouse ; expression ; molecular cloning ; DNA sequence ; western blot corresponding author :LIU Xin2guang ( 378 ) SARS? HIV,,, SARS 14 SARS : SARS,,, 10 000, HIV,,,,,,, :1984,, :,, SARS, SARS SARS,, Michael Lai : SARS,, SARS? SARS,,, 300 000,, Robert Baker, ( ) SARS :, C, Prakash Chandra, SARS, : Catholic Erik De Clercq, :, l beck Rolf Hilgenfeld SARS,, Hilgenfeld ( ), ( 410 )