Gene Cloning and Structural Analysis of Virion Host Shutoff protein of Pseudorabies Virus
|
|
- Μνήμη Θεοδωρίδης
- 5 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (1) :65 71,,,,, (, ) 3 (pseudorabies vires,prv) UL41 (VHS), PCR UL bp, p GEX2KG GST, BL21 (DE3) GST2VHS VHS 4, 3 FEN21 (1A76) PROSPECT VHS 10 22, VHS (PRV), (VHS), UL41, Q51,Q71 Gene Cloning and Structural Analysis of Virion Host Shutoff protein of Pseudorabies Virus MA Xiang2Ru, HU Qin2Qin, XIAO Shao2Bo, FANGLiu2Rong, LIU Zheng2Fei, CHEN Huan2Chun 3 ( State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan , China) Abstract To study the structure and function of virion host shutoff protein(vhs) which was coded by UL41 gene of pseudorabies virus( PRV), a 1174 bp DNA fragment containing the complete coding sequence of UL41 gene was amplified by PCR technique and cloned into downstream of the GST of an expression vector,p GEX2 KG After induction by IPTG,a high expression of fusion protein was obtained The sequence analysis indicated that VHS protein had four conserved regions and the third conserved region was highly homologous with the FEN21 (1A76) domin of flap endonuclease 1 The three2dimensional structural prediction of VHS protein of PRV showed that the protein contained 10 2helix and 22 2sheet and was similar to the three2dimensional structure of VHS protein of human herpesvirus 1 by the software of PROSPECT Key words pseudorabies virus( PRV), virion host shutoff protein(vhs), UL41 gene, structural analysis 1984 Fenwick [1 ],, VPl6 ( UL48 ) VHS, VHS, VHS [3, ( ) ],VHS, ( HSV), IFN2 Π UL41 MHC [2 ], (virion host shutoff protein,vhs),, : , : (No 2001AA213051) VHS mrna mrna ( ),VHS 3 Tel : ,E2mail wh hb cn Received :April 1, 2004 ; Accepted : June 3,2004 Supported by The National High Technology Research and Development, mrna, ( [2 ) ] Program of China (No 2001AA213051) 3 Corresponding author Tel : E2mail wh hb cn
2 66 21, pmd2ul41 [4,5 ] HSV UL41 365,,TREEVIEW [6 VHS ] VHS : Ea (PRV),AAN77493 ; 1 (BHV21),NP - (Varicella2Zoster vires,vzv) ; 1 ( EHV21),NP ; (bovine herpesvims,bhv21) 1 ( HSV21),AAC58446 ; (equine herpesvirus, EHV21) VHS 2 ( HSV22), AAC58447 ; 2 mrna (HVP22),AAG01880 ; 2 ( GHV22),, AAG14234 ; (VZV),NP VHS 114 VHS Ea UL41, UL41, PRV VHS BLAST, PROSPECT HSV VHS, VHS PROSPECT [9 ] 1 VHS Ea Hind [7 ] Xba pmd2ul41, 112, DH5 BL21 (DE3), GST kb, Hind Xba p GEX2KG p GEX2KG, DH5, Taq pmdl82t Vector TaKaRa, DNA p GEX2UL UL41 PCR p GEX2UL41 p GEX2 Ka UL41 [6 ] KG BL, Primer 5 UL41 21 (DE 3 ),, 1174 bp 2 ml 75 gπml LB, P1 (18 mer) : 5 2CGGTGTGCGAGCGGAGAC23 P2 (24 mer) : 5 2GGGGGAGAGGGCGAGCATCACACG23 [8 ] PRV DNA, rπmin, 1 SDS PRV 200, 3 min, 15 l 12 %SDS2 PCR PCR 96 4 min, 113 (pseudorabies virus, PRV) pmd2ul41, OMIGA 2 0 ClustalX SDS2PAGE 37 A ,4,, LB,37 3 h, IPTG 014 mmolπl, 1 h, PAGE [10 ], :94 1 min, 52 1 min, min 30 s, min DNA 211 UL41 PCR PCR, pmd182t, PRV 200 DH5, X2gal IPTG LB, PCR,, 5 % PCR 018 %
3 1 : bp ( Fig 1), kinase phosphorylation site), , pmd2182t C, pmd2ul41 (protein kinase C phosphorylation site),vhs (Fig 2) Fig 1 Amplification of UL41 gene M: DNA Marker (DL22000) ; 1 :Products of PCR ;2 :Control Fig 2 Identification of recombinant plasmid pmd2ul41 M: DNA marker (DL215000) ; 1 : pmd2ul41π Hind ;2 : pmd2ul41π Hind + Xba 212 pmd2ul41, PCR 1174 bp, PRV Ea UL41, UL VHS GenBank 3 ( ) VHS, (Accession Number) AY Ka UL41, FEN21 RAD2 DNA DNA 9719 %, 25, ; 9718 %, 8 RPS2BLAST(reverse position specific BLAST) OMIGA 210 PRV Ea UL41 VHS VHS kd, FEN21 (1A76) 8115 VHS Motif 9 [12 ], HhH2, XPG, , FEN ( casein binding site) 2 N2 ( glycosylation site), ClustalX 1 8 a UL41 (Fig 3),VHS 4 : PRV VHS 1 42 ; ; ; Berthomme [6] VHS 4 3, , VHS,EHV21 (497 ),HSV21 (489),VZV (455), PRV(365), ( ) HSV21, PRV VHS 40, 80 VHS TREEVIEW (Fig 4), PRV EHV21 BHV21, ; HSV21 HSV22 HVP22, ; GHV22 VZV 2002 Bigger [11 ], 213 VHS PSI2BLAST(position specific iterated BLAST) XPG( Xeroderma pigmentosum G), (metal
4 68 21 Fig 3 Alignment of amino acid sequences of UL41 gene Note :The positions of the BOX 1 4 regions are indicated The important region for VP16 binding in HSV21 ( ) is underlied by a bar Identical residues are indicated by 3,similar residues are indicated by : or Fig 4 Phylogenetic analysis of alphaherpesvirus VHS homology The PRV VHS homolog is most closely related to VHS homology of EHV21 PROSPECT [9 ] PRV Ea HSV21 KOS VHS PRV, p GEX2KG, VHS 10 22, HSV21 VHS ( Fig 5),VHS 4 ( Fig 3) IPTG 3 h, SDS2PAGE, PRV HSV21 VHS (Fig 7) :p GEX2UL41 66 kd, ; p GEX2 214 pgex2ul41 Hind Xba pmd2ul41, p GEX2UL41 (Fig 6) 215 UL41 p GEX2UL41 p GEX2KG BL 21 (DE 3 ), KG, 27 kd
5 1 : 69 Fig 5 Three2dimensional structure of VHS protein The positions of the BOX 1 4 regions are indicated The arrow indicates the important region for VP16 binding in HSV21 ( ) Fig 6 Identification of the expression vector pgex2ul41 M:DNA marker (DL215000) ; 1 :p GEX2UL41ΠHind + Xba ; 2 :p GEX2UL41ΠHind Fig 7 Expression of p GEX2UL41 in BL21(DE3) M:Protein marker ; 1 :pgex2ul41(induced 3 hours) ; 2 :pgex2 KG(induced 3 hours), GST [10 ] 3, HSV VHS, VHS, eif4h mrna [13 ],VHS, VHS,,, VHS [5,14 ], PRV VHS, PRV VHS HSV, PRV VHS PRV VHS, PRV, VHS Ea UL41, VHS, 4, 3 FEN21 (1A76) [12 ] Everly [13 ],HSV21 PRV VHS 8 1 XPG FEN21 DNA, 9, HSV21KOS VHS, PROSPECT [9 ] PRV Ea HSV21KOS
6 70 21 VHS, VHS 4, PRV HSV2 1 VHS, PRV VHS, mrna Schmelter [15 ],HSV21 VHS VP16,VHS VHS VP16, 321 VHS VP16, VHS,HSV21 VHS alphaherpesvirus protein counterparts Virology, 1993, 193 : ,,,,, A ( Chen Huan2Chun, Fang ( Fig 3 ), PRV VHS, HSV21 VHS, ( Fig 5 ), PRV VHS ( HSV21 VHS 3 3 ), PRV VHS VPl6, evaluation, VHS 354, PRV EHV21 BHV21, PRV EHV21, BHV21,PRV EHV21 UL31, PRV EHV24 [16 PRV BHV21 ] PRV, UL23, [17 EHV24 ], PRV EHV21 EHV24 Orf BHV21 [18 ],, ( References) 1 Fenwick M L, McMenamin M M Early virion2associated suppression of cellular protein synthesis by herpes simplex virus is accompanied by inactivation of mrna J Gen Virol, 1984, 65 : Read G S, Karr B M, Knight K Isolation of a herpes simplex virus type 1 mutant with a deletion in the virion host shutoff gene and identification of multiple forms of the VHS (UL41) polypeptide J Virol, 1993, 67 : Lam Q, Smibert C A, Koop K E, Lavery C, Capone J P, Weinheimer S P, Smiley J R Herpes simplex virus VP16 rescues viral mrna from destruction by the virion host shutoff function EMBO J, 1996, 15 : Murphy J A, Duerst R J, Smith T J, Morrison L A Herpes simplex virus type 2 virion host shutoff protein regulates AlphaΠBeta interferon but not adaptive immune responses during primary infection in vivo J Virol, 2003, 77 (17) : Strelow L, Smith T, Leib D A The virion host shutoff function of herpes simplex virus type 1 plays a role in corneal invasion and functions independently of the cell cycle Virology, 1997, 231 : Berthomme H, Jacquemont B, Epstein A The pseudorabies virus host2 shut2off homologue gene : Nucleotide sequence and comparison with Liu2Rong, He Qi2Gai, Jin Mei2Lin, Suo Xu2Feng, Wu Mei2Zhou Study on the isolation and identification of the Ea strain of pseudorabies virus Acta Veterin Zootech Sin), 1998, 29(2) : ,,,, A TK - ΠgG - ΠLacZ + (Chen Huan2 chun, Zhou Fu2chun, Fang Liu2rong, He Qi2gai, Wu Bin, Hong Wen2 zhou Construction of TK - ΠgG - ΠLacZ + mutant of pseudorabies virus strain Ea Chin J Virol), 2001, 17(1) : Xu Ying, Xu Dong Protein threading using PROSPECT: Design and Proteins2Structure Function and Genetics, 2000, 40 : ,,, CK2 ( Chen Xiao2Wen,Liu Xin2Guang,Liang Jing2 Yao,Liang Nian2Ci Cloning,expression of human protein kinase CK2 subunit in E coli and purification and characterization of recombinant protein Chin J Biochem Mol Biol),2004,20(2) : Bigger J E, Martin D W Herpesvirus papio 2 encodes a virion host shutoff function Virology, 2002, 304 (1) : Marchler B A, Anderson J B, DeWeese S C, Fedorova N D, Geer L Y, He S, Hurwitz D I, Jackson J D, Jacobs A R, Lanczycki C J, Liebert C A, Liu C, Madej T, Marchler G H, Mazumder R, Nikolskaya A N, Panchenko A R, Rao BS, Shoemaker BA, Simonyan V, Song J S, Thiessen P A, Vasudevan S, Wang Y, Yamashita R A, Yin J J, Bryant S H CDD : a curated Entrez database of conserved domain alignments Nucleic Acids Res, 2003, 31 : Everly D N Jr, Feng P, Mian I S, Read G S mrna degradation by the virion host Shutoff (Vhs) protein of herpes simplex virus : genetic and biochemical evidence that Vhs is a nuclease J Virol, 2002, 76 : Hinkley S, Ambagala A P N, Jones CJ, Srikumaran S A vhs2like activity of bovine herpesvirus21 Archives of Virology, 2000, 145 : Schmelter J, Knez J, Smiley J R, Capone J P Identification and characterization of a small modular domain in the herpes simplex virus host shutoff protein sufficient for interaction with VP16 J Virol, 1996, 70 :
7 1 : 71 16,,,, Ea 17 Prieto J, Martin H A M, Tabares E Loss of pseudorabies virus UL (Ma Xiang2Ru, Hu Qin2Qin, Xiao Shao2Bo, Fang Liu2Rong, Chen Huan2Chun Cloning and sequence analysis of the genome unique long region of pseudorabies virus Ea strain Virol Sin),2004,19 (2) : thymidine kinase activity due to a single base mutation and amino acid substitution J Gen Virol, 1991, 72 : Telford E A, Watson M S, Perry J, Cullinane A A, Davison AJ The DNA sequence of equine herpesvirus24 J Gen Virol, 1998, 79 : AH109 3,,, (, ) 2 2galactosidase ( ), BD AD, BD (Bait) AD,, LacZ, BD,, AH109 (2002 Clontech,Lot , REFS1643, - 80, ) 2 2galactosidase 4 ( ), p GBKT7 (BD ) p GADT7 (AD ), (Fig 1,2,3) Fig 1 2Galactosidase : : 4 p GADT7 AH109 ; AH109 ;5 : p GBKT7 AH109 ; AH109 ;6 : p GADT7 AH109 ; - :CG1945 ; + : BD AD CG1945 Fig 2 2Galactosidase ( - ) :CG1945 Fig 3 2Galactosidase p GADT7 CG1945 4h,,,,,, AH109, 3 Tel : (8610) ,Fax : (8610) ,E2mail edu cn (No ,No )
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Διαβάστε περισσότερα(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5
42 5 2002 10 Acta Microbiologica Sinica Vol. 42 October No. 5 2002 Ea ge 3 33 ( 430070) : ge,, ge, GS115, G418, ge, Western blotting 33kD ELISA, ge, : ge,,, :Q93914 :A :000126209 (2002) 0520543207 (Pseudorabies,PR),
Διαβάστε περισσότεραSCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
Διαβάστε περισσότεραNucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Διαβάστε περισσότεραChinese Journal of Biochemistry and Molecular Biology CK2 252
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 9 24 (9) :826 832 CK2 252 1) 3 3, 1),2) 3 3, 1),2) 3, 1) ( 1), 524023 ; 2), 523808) CK2 Π. CK2, pact2 cdna CK2. CK2,
Διαβάστε περισσότεραShiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Διαβάστε περισσότερα(bovine herpesvirus type 1, BHV1,. (infectious bovine rhinotracheitis, IBR) (infectious pustular vulvovaginitis, IPV) 3, 1.1, 1.2a 1.2b [5].
2009 54 24 : 3823 ~ 3829 www.scichina.com csb.scichina.com SCIENCE IN CHINA PRESS gn,,,,,,, 310021;, 712100 E-mail: cunzh2004@yahoo.com.cn 2009-07-16, 2009-08-02 pha2 ZJ UL15 UL18, rbhv1-ha; DNA, DH10B,
Διαβάστε περισσότεραJEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
Διαβάστε περισσότεραStudy on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Διαβάστε περισσότεραScience of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Διαβάστε περισσότεραStudies on purification and characteristics of glycosyltransferase from an engineering strain
DOI:10.16774/j.cnki.issn.1674-2214.2015.02.001 2015 2 4 44 2,, (, 310014) : pet28b-valg BL21(DE3), 10~40 C ph 5~11,, ph 30 C 8.0 1 mmol/l Ca 2+ Mg 2+ Mn 2+ Co 2+, Cu 2+ Zn 2+, 8 μmol/l 2 μmol/l A, K mb
Διαβάστε περισσότερα30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Διαβάστε περισσότεραAngioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
Διαβάστε περισσότεραSalmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Διαβάστε περισσότεραJOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
6 2011 5 31 3 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * 430070 PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp 6 801 bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC
Διαβάστε περισσότεραER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Διαβάστε περισσότεραRapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Διαβάστε περισσότερα( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Διαβάστε περισσότεραSOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
Διαβάστε περισσότεραP450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Διαβάστε περισσότερα,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
Διαβάστε περισσότερα1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Διαβάστε περισσότεραChinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1
ISSN 100727626 CN 1123870ΠQ 2005 10 Chinese Journal of Biochemistry and Molecular Biology 21 (5) :656 660 I2 ERR 1,,,,, (, 400038) 3 1 ( ERR 1) I2 (TNNI2) TNNI2 ERR 1, GST2TNNI2, 35 S ERR 1, GST,TNNI2
Διαβάστε περισσότεραAbstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Διαβάστε περισσότεραMolecular Cloning of MUC1ΠY and Soluble Expression of Its
ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :579 584 MUC1ΠY, 3, ( 100039) MUC1ΠY cdna, RT2PCR HeLa MUC1ΠY cdna ;PCR, p GEX22T DH5a ; ; GST N ; MUC1ΠY
Διαβάστε περισσότεραSupporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka
Supporting Information Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka after A Life-Cycle Exposure to Perfluorobutane Sulfonate (PFBS) Lianguo Chen,, Chenyan Hu #, Mirabelle M.
Διαβάστε περισσότεραAra h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE
2011 33 5 0993-0998 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Ara h 2 1 2 3 4 5 6 2 4* 2 4* 1. 518060 2. 518060 3. 830000 4. 518060 5. 518045
Διαβάστε περισσότεραChinese Journal of Biochemistry and Molecular Biology PRV PCR. Detection of Pseudorabies Virus D NA by PCR. (No. 2 KM03507N),
ISSN 00727626 CN 23870ΠQ 200 8 Chinese Journal of Biochemistry and Molecular Biology 7 (4) :59523 PCR 3 ( 50640) (PRV) gb A PRV PCR Fb Bartha BJ GD V2F4 S S3 SR Buk Shope Norden Mink HB F8 F9 F2 28 bp
Διαβάστε περισσότεραStudy on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Διαβάστε περισσότεραPCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Διαβάστε περισσότερα6 T-DNA PCR TAIL-PCR T-DNA. 69% 30% T-DNA left border LB right border RB T-DNA A T-DNA
Research Paper Acta Microbiologica Sinica 51 2 203-207 4 February 2011 ISSN 0001-6209 CN 11-1995 / Q http / / journals. im. ac. cn / actamicrocn Botrytis cinerea T-DNA * 310014 Botrytis cinerea T-DNA Agrobactirium
Διαβάστε περισσότεραencouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
Διαβάστε περισσότεραIntroduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers
Διαβάστε περισσότεραDistribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
Διαβάστε περισσότερα2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x - 2 - orfh79
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com orfh79 1 2 1 1 2 1 2 2 1. / 330031 2. / 430072 orfh79 orfh79 pet - 28a - orfh79
Διαβάστε περισσότεραExtract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Διαβάστε περισσότεραBL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
Διαβάστε περισσότερα8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Διαβάστε περισσότεραExtraction, Amplification and Sequence Analysis of Xiajiadian Ancient Human Bone D NA
ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :636 641 DNA,,, 3,, ( DNA, 130023) DNA 2 000 5 000 ( :M89, M11, M12 AM4), DNA MTND 4 11 210 11 414 (205
Διαβάστε περισσότεραTan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha 410004)
44 3 2 0 0 8 3 SCIENTIA SILVAE SINICAE Vol144,No13 Mar.,2 0 0 8 FAD2 cdna ( 410004) : FAD2, EST, 5 RACE PCR FAD2 cdna 1 682 bp, 1 149 bp, 382, FAD2, FAD2 FAD2 : ; EST ; FAD2 ; RACE; PCR ; :S718146 ;Q94312
Διαβάστε περισσότεραsvari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Διαβάστε περισσότεραDesign and Fabrication of Water Heater with Electromagnetic Induction Heating
U Kamphaengsean Acad. J. Vol. 7, No. 2, 2009, Pages 48-60 ก 7 2 2552 ก ก กก ก Design and Fabrication of Water Heater with Electromagnetic Induction Heating 1* Geerapong Srivichai 1* ABSTRACT The purpose
Διαβάστε περισσότεραThe toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Διαβάστε περισσότεραComparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Διαβάστε περισσότερα, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
Διαβάστε περισσότεραResurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Διαβάστε περισσότεραStudies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Διαβάστε περισσότεραComparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 2 1* 1 3 2 1 100101 2 430070 3 100089 3 95 2% ~ 98 2% 99 2% ~ 101 3% 60 mg / kg 12 6% ~ 37 6% X508 A 0250-3301 2011 03-0842-07 Comparative Study
Διαβάστε περισσότεραAffinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
Διαβάστε περισσότεραMotion analysis and simulation of a stratospheric airship
32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric
Διαβάστε περισσότεραCK2, Basic Medical Sciences and Clinics (4) ( Π ) pt727 ( CIP), (TSR) 6 ( POP6) ( IPTG),, A,
392 Basic Medical Sciences and Clinics 2003123 (4) : 100126325 ( 2003) 0420392207 CK2 1 # 2, #, 1 1, 3 1, ( 11 ; 21, 524023) : PCR NIH 3T3 CK2 cdna ; CK2, CK2 cdna, CK2 cdna BL21 (DE3), 26kDa, 3117 %,
Διαβάστε περισσότεραAntimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Διαβάστε περισσότεραΜέτρηση της Ρυθµικής Ικανότητας σε Μαθητές Γυµνασίου που Ασχολούνται µε Αθλητικές ραστηριότητες Συνοδευµένες ή Όχι από Μουσική
Ερευνητική Αναζητήσεις στη Φυσική Αγωγή & τον Αθλητισµό τόµος 3 (1), 22 28 ηµοσιεύτηκε: 11 Φεβρουαρίου 2005 Inquiries in Sport & Physical Education Volume 3 (1), 22-28 Released: February 11, 2005 www.hape.gr/emag.asp
Διαβάστε περισσότερα2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Διαβάστε περισσότεραHigh mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Διαβάστε περισσότεραOptimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Διαβάστε περισσότεραA strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Διαβάστε περισσότεραDNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family
HEREDITAS (Beijing) 2007 4, 29(4): 433 437 ISSN 0253-9772 www.chinagene.cn DOI: 10.1360/yc-007-0433 2 DNA G7444A,,,,,,,, 350005 : PCR-RFLP 2 DNA G7444A,, 27, 11 DNA G7444A, 11 2 5, 1,, DNA G7444A, 2 :
Διαβάστε περισσότεραC.S. 430 Assignment 6, Sample Solutions
C.S. 430 Assignment 6, Sample Solutions Paul Liu November 15, 2007 Note that these are sample solutions only; in many cases there were many acceptable answers. 1 Reynolds Problem 10.1 1.1 Normal-order
Διαβάστε περισσότεραD-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Διαβάστε περισσότεραDevelopment of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Διαβάστε περισσότεραDéveloppement de virus HSV-1 (virus de l herpes simplex de type 1) oncolytiques ciblés pour traiter les carcinomes hépatocellulaires
Développement de virus HSV-1 (virus de l herpes simplex de type 1) oncolytiques ciblés pour traiter les carcinomes hépatocellulaires Aldo Decio Pourchet To cite this version: Aldo Decio Pourchet. Développement
Διαβάστε περισσότεραACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,
24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).
Διαβάστε περισσότερα( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S
16S23S rrna 197 16S23S rrna (, 100050) : 16S23S rrna,, 2, 16S23S rrna,3 3 (ATCC10248 NCPPB 947 NCPPB3580) 1 B. phenazinium (LMG2247) 8 ( HN2y Co14 Co8 Co36 Sx8801 90-3 56 (2) 56 (2) ) 16S 23S rrna,( GenBank)
Διαβάστε περισσότεραBiapenem BIPM Lot No g mg
MexAB-OprM 1 1 1 1 16 4 9 16 5 11 BIPM imipenemcilastatinipmcs MEPM 3 MexAB-OprM BIPM IPMCS MEPM MexAB-OprM MexCD-OprJ BIPM MEPM IPMCS BIPM IPMCS MEPM 10 5 order CFUlung BIPMIPM CS MEPM 10 6 order CFUlung
Διαβάστε περισσότεραVBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)
J. Comput. Chem. Jpn., Vol. 5, No. 1, pp. 29 38 (2006) Microsoft Excel, 184-8588 2-24-16 e-mail: yosimura@cc.tuat.ac.jp (Received: July 28, 2005; Accepted for publication: October 24, 2005; Published on
Διαβάστε περισσότεραCHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...
Table of Content CHAPTER-1... 1 1 INTRODUCTION... 1 CHAPTER-2... 4 2 REVIEW OF LITERATURE... 4 2.1 History of Filariasis... 4 2.1.1 Discovery of Symptoms (1588-1592)... 4 2.1.2 Discovery of Microfilariae
Διαβάστε περισσότερα2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Διαβάστε περισσότεραFENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
Διαβάστε περισσότεραIL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Διαβάστε περισσότερα«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»
I ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΝΟΜΙΚΩΝ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΠΟΛΙΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ «ΔΙΟΙΚΗΣΗ ΚΑΙ ΟΙΚΟΝΟΜΙΑ» ΚΑΤΕΥΘΥΝΣΗ: ΟΙΚΟΝΟΜΙΚΗ
Διαβάστε περισσότεραChinese Journal of Biochemistry and Molecular Biology. ( OsSUT2) 6314 kd, E2mail : edu. cn
ISSN 100727626 CN 1123870ΠQ 2005 12 Chinese Journal of Biochemistry and Molecular Biology 21 (6) :846 851 ( OsSUT2),,,,, (, 100875) Expression of a Fusion Protein Containing Non2transmembrane Region for
Διαβάστε περισσότεραTable S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.
Supporting Information [NH 3 CH 3 ] [In SbS 9 SH]: A novel methylamine-directed indium thioantimonate with Rb + ion-exchange property Kai-Yao Wang a,b, Mei-Ling Feng a, Jian-Rong Li a and Xiao-Ying Huang
Διαβάστε περισσότερα16 1 Vol. 16 No ELECTROCHEMISTRY Feb MnO 6 Bir-Co5% Bir-Co10% Bir-Co15% Bir-Co20%. 3 3 Li mol L - 1 MgCl 2.
16 1 Vol 16 No 1 2010 2 ELECTROCHEMISTRY Feb 2010 1006-3471 2010 01-0090-06 * 430070 X- XRD TG Mg x Co y MnO z nh 2 O 0 18 x 0 22 0 y 0 24 2 10 z 2 53 0 35 n 0 73 Tod-Co10% 10% Co Mg 0 18 Co 0 12 MnO 2
Διαβάστε περισσότεραNATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS
NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS INTERDICIPLINARY POSTGRADUATE PROGRAMME "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY"
Διαβάστε περισσότεραIdentification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Διαβάστε περισσότεραΜελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Διαβάστε περισσότεραAssalamu `alaikum wr. wb.
LUMP SUM Assalamu `alaikum wr. wb. LUMP SUM Wassalamu alaikum wr. wb. Assalamu `alaikum wr. wb. LUMP SUM Wassalamu alaikum wr. wb. LUMP SUM Lump sum lump sum lump sum. lump sum fixed price lump sum lump
Διαβάστε περισσότεραElectronic Supplementary Information
Electronic Supplementary Information The preferred all-gauche conformations in 3-fluoro-1,2-propanediol Laize A. F. Andrade, a Josué M. Silla, a Claudimar J. Duarte, b Roberto Rittner, b Matheus P. Freitas*,a
Διαβάστε περισσότεραNov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn
2015 11 Nov 2015 36 6 Journal of Zhengzhou University Engineering Science Vol 36 No 6 1671-6833 2015 06-0056 - 05 C 1 1 2 2 1 450001 2 461000 C FCM FCM MIA MDC MDC MIA I FCM c FCM m FCM C TP18 A doi 10
Διαβάστε περισσότεραStudy of urban housing development projects: The general planning of Alexandria City
Paper published at Alexandria Engineering Journal, vol, No, July, Study of urban housing development projects: The general planning of Alexandria City Hisham El Shimy Architecture Department, Faculty of
Διαβάστε περισσότεραA Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Διαβάστε περισσότεραChinese Journal of Biochemistry and Molecular Biology RNA.
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 8 25 (8) :759 763 RNA 1), 2), 1) 3, 1) 1),2), ( 1), 400014 ; 2), 400014) RNA, (CTGF) RNA. EcoR Hind, ptm12 CTGF PCR
Διαβάστε περισσότεραChina Academic Journal Electronic Publishing House. All rights reserved.
7 H9N2 HA NA H9N2 HA NA PCR,P GEM2T Easy Vector 4, DH210,,,, H9N2 HA 226 L,H9N2,, R2L2S2R,R2S2S2R ;NA 6264, AΠShaoguanΠ408Π 98, AΠSwineΠHong KongΠ9Π98 AΠDuckΠHong Kong Πy 280Π97 (H9N2) ;HA NA,H9N2 HA AΠChickenΠHong
Διαβάστε περισσότεραΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Νόσος Pompe: Νεότερα κλινικά, γενετικά, διαγνωστικά και θεραπευτικά
Διαβάστε περισσότεραCorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Διαβάστε περισσότεραScreening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances
3 3 Vol3 No3 3 9 Life Science Research June 9 *,,, 535 :, 3, 5- (TTC), 3,, T,, ; (5~5 μ 375~5 μ),, 5% (W/V), 55,, 55% 9% : ; ; ; ; :Q39 + :A :7-77(9)3-99-5 Screening of Respiration-deficient Saccharomyces
Διαβάστε περισσότεραMolecular evolutionary dynamics of respiratory syncytial virus group A in
Molecular evolutionary dynamics of respiratory syncytial virus group A in recurrent epidemics in coastal Kenya James R. Otieno 1#, Charles N. Agoti 1, 2, Caroline W. Gitahi 1, Ann Bett 1, Mwanajuma Ngama
Διαβάστε περισσότεραLfcinB. Expression and Iden tif ica tion of Lfc inb Gene in P ich ia pastoris
265 ( LfcinB) 3 ( 518057) : ( Pichia pastors) ( bovine lactoferricin, Lf2 cinb), LfcinB pp IC9K, pp IC9K2LfcinB Sal, SMD1168 G418,, PCR LfcinB LfcinB, : (LfcinB),,, : Q782, Q784, Q786 : A : 025322654 (2007)
Διαβάστε περισσότεραΒιοπληροφορική. Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου
Βιοπληροφορική Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι Αναφορά στη χρησιμότητα των βιολογικών ΒΔ. Κατανόηση των χαρακτηριστικών, των ιδιαιτεροτήτων
Διαβάστε περισσότεραrp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1
rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna
Διαβάστε περισσότερα, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Διαβάστε περισσότεραAdvances in the study of to0in in halobios
11 3 Vol.11 No.3 2002 9 J0URNAL 0F SHANGHAI FISHERIES UNIVERSITY Sep. 2002!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 1004-7271 2002 03-0283 - 06 Advances in the study of to0in in halobios
Διαβάστε περισσότεραApproximation Expressions for the Temperature Integral
20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang
Διαβάστε περισσότεραChinese Journal of Biochemistry and Molecular Biology. p38mapk
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :537 542 Grx1 HEK293T H 2 O 2 p38mapk 1), 2), 1), 1), 3), 1), 1) 3 ( 1), 150081 ; 2), 150081 ; 3), 161042)
Διαβάστε περισσότεραCRASH COURSE IN PRECALCULUS
CRASH COURSE IN PRECALCULUS Shiah-Sen Wang The graphs are prepared by Chien-Lun Lai Based on : Precalculus: Mathematics for Calculus by J. Stuwart, L. Redin & S. Watson, 6th edition, 01, Brooks/Cole Chapter
Διαβάστε περισσότερα(Vibrio anguillarum) (Cyclina sinensis) *
43 4 Vol.43, No.4 2012 7 OCEANOLOGIA ET LIMNOLOGIA SINICA July, 2012 (Vibrio anguillarum) (Cyclina sinensis) * ( 300387) (GSTs), SMART cdna, σ (CsGSTS) PCR CsGSTS, CsGSTS cdna 793bp, 206, GST-N GST-C GSTs
Διαβάστε περισσότεραJ. of Math. (PRC) 6 n (nt ) + n V = 0, (1.1) n t + div. div(n T ) = n τ (T L(x) T ), (1.2) n)xx (nt ) x + nv x = J 0, (1.4) n. 6 n
Vol. 35 ( 215 ) No. 5 J. of Math. (PRC) a, b, a ( a. ; b., 4515) :., [3]. : ; ; MR(21) : 35Q4 : O175. : A : 255-7797(215)5-15-7 1 [1] : [ ( ) ] ε 2 n n t + div 6 n (nt ) + n V =, (1.1) n div(n T ) = n
Διαβάστε περισσότεραMetal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
Διαβάστε περισσότεραNguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
Διαβάστε περισσότερα