Gene Cloning and Structural Analysis of Virion Host Shutoff protein of Pseudorabies Virus

Transcript

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (1) :65 71,,,,, (, ) 3 (pseudorabies vires,prv) UL41 (VHS), PCR UL bp, p GEX2KG GST, BL21 (DE3) GST2VHS VHS 4, 3 FEN21 (1A76) PROSPECT VHS 10 22, VHS (PRV), (VHS), UL41, Q51,Q71 Gene Cloning and Structural Analysis of Virion Host Shutoff protein of Pseudorabies Virus MA Xiang2Ru, HU Qin2Qin, XIAO Shao2Bo, FANGLiu2Rong, LIU Zheng2Fei, CHEN Huan2Chun 3 ( State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan , China) Abstract To study the structure and function of virion host shutoff protein(vhs) which was coded by UL41 gene of pseudorabies virus( PRV), a 1174 bp DNA fragment containing the complete coding sequence of UL41 gene was amplified by PCR technique and cloned into downstream of the GST of an expression vector,p GEX2 KG After induction by IPTG,a high expression of fusion protein was obtained The sequence analysis indicated that VHS protein had four conserved regions and the third conserved region was highly homologous with the FEN21 (1A76) domin of flap endonuclease 1 The three2dimensional structural prediction of VHS protein of PRV showed that the protein contained 10 2helix and 22 2sheet and was similar to the three2dimensional structure of VHS protein of human herpesvirus 1 by the software of PROSPECT Key words pseudorabies virus( PRV), virion host shutoff protein(vhs), UL41 gene, structural analysis 1984 Fenwick [1 ],, VPl6 ( UL48 ) VHS, VHS, VHS [3, ( ) ],VHS, ( HSV), IFN2 Π UL41 MHC [2 ], (virion host shutoff protein,vhs),, : , : (No 2001AA213051) VHS mrna mrna ( ),VHS 3 Tel : ,E2mail wh hb cn Received :April 1, 2004 ; Accepted : June 3,2004 Supported by The National High Technology Research and Development, mrna, ( [2 ) ] Program of China (No 2001AA213051) 3 Corresponding author Tel : E2mail wh hb cn

2 66 21, pmd2ul41 [4,5 ] HSV UL41 365,,TREEVIEW [6 VHS ] VHS : Ea (PRV),AAN77493 ; 1 (BHV21),NP - (Varicella2Zoster vires,vzv) ; 1 ( EHV21),NP ; (bovine herpesvims,bhv21) 1 ( HSV21),AAC58446 ; (equine herpesvirus, EHV21) VHS 2 ( HSV22), AAC58447 ; 2 mrna (HVP22),AAG01880 ; 2 ( GHV22),, AAG14234 ; (VZV),NP VHS 114 VHS Ea UL41, UL41, PRV VHS BLAST, PROSPECT HSV VHS, VHS PROSPECT [9 ] 1 VHS Ea Hind [7 ] Xba pmd2ul41, 112, DH5 BL21 (DE3), GST kb, Hind Xba p GEX2KG p GEX2KG, DH5, Taq pmdl82t Vector TaKaRa, DNA p GEX2UL UL41 PCR p GEX2UL41 p GEX2 Ka UL41 [6 ] KG BL, Primer 5 UL41 21 (DE 3 ),, 1174 bp 2 ml 75 gπml LB, P1 (18 mer) : 5 2CGGTGTGCGAGCGGAGAC23 P2 (24 mer) : 5 2GGGGGAGAGGGCGAGCATCACACG23 [8 ] PRV DNA, rπmin, 1 SDS PRV 200, 3 min, 15 l 12 %SDS2 PCR PCR 96 4 min, 113 (pseudorabies virus, PRV) pmd2ul41, OMIGA 2 0 ClustalX SDS2PAGE 37 A ,4,, LB,37 3 h, IPTG 014 mmolπl, 1 h, PAGE [10 ], :94 1 min, 52 1 min, min 30 s, min DNA 211 UL41 PCR PCR, pmd182t, PRV 200 DH5, X2gal IPTG LB, PCR,, 5 % PCR 018 %

3 1 : bp ( Fig 1), kinase phosphorylation site), , pmd2182t C, pmd2ul41 (protein kinase C phosphorylation site),vhs (Fig 2) Fig 1 Amplification of UL41 gene M: DNA Marker (DL22000) ; 1 :Products of PCR ;2 :Control Fig 2 Identification of recombinant plasmid pmd2ul41 M: DNA marker (DL215000) ; 1 : pmd2ul41π Hind ;2 : pmd2ul41π Hind + Xba 212 pmd2ul41, PCR 1174 bp, PRV Ea UL41, UL VHS GenBank 3 ( ) VHS, (Accession Number) AY Ka UL41, FEN21 RAD2 DNA DNA 9719 %, 25, ; 9718 %, 8 RPS2BLAST(reverse position specific BLAST) OMIGA 210 PRV Ea UL41 VHS VHS kd, FEN21 (1A76) 8115 VHS Motif 9 [12 ], HhH2, XPG, , FEN ( casein binding site) 2 N2 ( glycosylation site), ClustalX 1 8 a UL41 (Fig 3),VHS 4 : PRV VHS 1 42 ; ; ; Berthomme [6] VHS 4 3, , VHS,EHV21 (497 ),HSV21 (489),VZV (455), PRV(365), ( ) HSV21, PRV VHS 40, 80 VHS TREEVIEW (Fig 4), PRV EHV21 BHV21, ; HSV21 HSV22 HVP22, ; GHV22 VZV 2002 Bigger [11 ], 213 VHS PSI2BLAST(position specific iterated BLAST) XPG( Xeroderma pigmentosum G), (metal

4 68 21 Fig 3 Alignment of amino acid sequences of UL41 gene Note :The positions of the BOX 1 4 regions are indicated The important region for VP16 binding in HSV21 ( ) is underlied by a bar Identical residues are indicated by 3,similar residues are indicated by : or Fig 4 Phylogenetic analysis of alphaherpesvirus VHS homology The PRV VHS homolog is most closely related to VHS homology of EHV21 PROSPECT [9 ] PRV Ea HSV21 KOS VHS PRV, p GEX2KG, VHS 10 22, HSV21 VHS ( Fig 5),VHS 4 ( Fig 3) IPTG 3 h, SDS2PAGE, PRV HSV21 VHS (Fig 7) :p GEX2UL41 66 kd, ; p GEX2 214 pgex2ul41 Hind Xba pmd2ul41, p GEX2UL41 (Fig 6) 215 UL41 p GEX2UL41 p GEX2KG BL 21 (DE 3 ), KG, 27 kd

5 1 : 69 Fig 5 Three2dimensional structure of VHS protein The positions of the BOX 1 4 regions are indicated The arrow indicates the important region for VP16 binding in HSV21 ( ) Fig 6 Identification of the expression vector pgex2ul41 M:DNA marker (DL215000) ; 1 :p GEX2UL41ΠHind + Xba ; 2 :p GEX2UL41ΠHind Fig 7 Expression of p GEX2UL41 in BL21(DE3) M:Protein marker ; 1 :pgex2ul41(induced 3 hours) ; 2 :pgex2 KG(induced 3 hours), GST [10 ] 3, HSV VHS, VHS, eif4h mrna [13 ],VHS, VHS,,, VHS [5,14 ], PRV VHS, PRV VHS HSV, PRV VHS PRV VHS, PRV, VHS Ea UL41, VHS, 4, 3 FEN21 (1A76) [12 ] Everly [13 ],HSV21 PRV VHS 8 1 XPG FEN21 DNA, 9, HSV21KOS VHS, PROSPECT [9 ] PRV Ea HSV21KOS

6 70 21 VHS, VHS 4, PRV HSV2 1 VHS, PRV VHS, mrna Schmelter [15 ],HSV21 VHS VP16,VHS VHS VP16, 321 VHS VP16, VHS,HSV21 VHS alphaherpesvirus protein counterparts Virology, 1993, 193 : ,,,,, A ( Chen Huan2Chun, Fang ( Fig 3 ), PRV VHS, HSV21 VHS, ( Fig 5 ), PRV VHS ( HSV21 VHS 3 3 ), PRV VHS VPl6, evaluation, VHS 354, PRV EHV21 BHV21, PRV EHV21, BHV21,PRV EHV21 UL31, PRV EHV24 [16 PRV BHV21 ] PRV, UL23, [17 EHV24 ], PRV EHV21 EHV24 Orf BHV21 [18 ],, ( References) 1 Fenwick M L, McMenamin M M Early virion2associated suppression of cellular protein synthesis by herpes simplex virus is accompanied by inactivation of mrna J Gen Virol, 1984, 65 : Read G S, Karr B M, Knight K Isolation of a herpes simplex virus type 1 mutant with a deletion in the virion host shutoff gene and identification of multiple forms of the VHS (UL41) polypeptide J Virol, 1993, 67 : Lam Q, Smibert C A, Koop K E, Lavery C, Capone J P, Weinheimer S P, Smiley J R Herpes simplex virus VP16 rescues viral mrna from destruction by the virion host shutoff function EMBO J, 1996, 15 : Murphy J A, Duerst R J, Smith T J, Morrison L A Herpes simplex virus type 2 virion host shutoff protein regulates AlphaΠBeta interferon but not adaptive immune responses during primary infection in vivo J Virol, 2003, 77 (17) : Strelow L, Smith T, Leib D A The virion host shutoff function of herpes simplex virus type 1 plays a role in corneal invasion and functions independently of the cell cycle Virology, 1997, 231 : Berthomme H, Jacquemont B, Epstein A The pseudorabies virus host2 shut2off homologue gene : Nucleotide sequence and comparison with Liu2Rong, He Qi2Gai, Jin Mei2Lin, Suo Xu2Feng, Wu Mei2Zhou Study on the isolation and identification of the Ea strain of pseudorabies virus Acta Veterin Zootech Sin), 1998, 29(2) : ,,,, A TK - ΠgG - ΠLacZ + (Chen Huan2 chun, Zhou Fu2chun, Fang Liu2rong, He Qi2gai, Wu Bin, Hong Wen2 zhou Construction of TK - ΠgG - ΠLacZ + mutant of pseudorabies virus strain Ea Chin J Virol), 2001, 17(1) : Xu Ying, Xu Dong Protein threading using PROSPECT: Design and Proteins2Structure Function and Genetics, 2000, 40 : ,,, CK2 ( Chen Xiao2Wen,Liu Xin2Guang,Liang Jing2 Yao,Liang Nian2Ci Cloning,expression of human protein kinase CK2 subunit in E coli and purification and characterization of recombinant protein Chin J Biochem Mol Biol),2004,20(2) : Bigger J E, Martin D W Herpesvirus papio 2 encodes a virion host shutoff function Virology, 2002, 304 (1) : Marchler B A, Anderson J B, DeWeese S C, Fedorova N D, Geer L Y, He S, Hurwitz D I, Jackson J D, Jacobs A R, Lanczycki C J, Liebert C A, Liu C, Madej T, Marchler G H, Mazumder R, Nikolskaya A N, Panchenko A R, Rao BS, Shoemaker BA, Simonyan V, Song J S, Thiessen P A, Vasudevan S, Wang Y, Yamashita R A, Yin J J, Bryant S H CDD : a curated Entrez database of conserved domain alignments Nucleic Acids Res, 2003, 31 : Everly D N Jr, Feng P, Mian I S, Read G S mrna degradation by the virion host Shutoff (Vhs) protein of herpes simplex virus : genetic and biochemical evidence that Vhs is a nuclease J Virol, 2002, 76 : Hinkley S, Ambagala A P N, Jones CJ, Srikumaran S A vhs2like activity of bovine herpesvirus21 Archives of Virology, 2000, 145 : Schmelter J, Knez J, Smiley J R, Capone J P Identification and characterization of a small modular domain in the herpes simplex virus host shutoff protein sufficient for interaction with VP16 J Virol, 1996, 70 :

7 1 : 71 16,,,, Ea 17 Prieto J, Martin H A M, Tabares E Loss of pseudorabies virus UL (Ma Xiang2Ru, Hu Qin2Qin, Xiao Shao2Bo, Fang Liu2Rong, Chen Huan2Chun Cloning and sequence analysis of the genome unique long region of pseudorabies virus Ea strain Virol Sin),2004,19 (2) : thymidine kinase activity due to a single base mutation and amino acid substitution J Gen Virol, 1991, 72 : Telford E A, Watson M S, Perry J, Cullinane A A, Davison AJ The DNA sequence of equine herpesvirus24 J Gen Virol, 1998, 79 : AH109 3,,, (, ) 2 2galactosidase ( ), BD AD, BD (Bait) AD,, LacZ, BD,, AH109 (2002 Clontech,Lot , REFS1643, - 80, ) 2 2galactosidase 4 ( ), p GBKT7 (BD ) p GADT7 (AD ), (Fig 1,2,3) Fig 1 2Galactosidase : : 4 p GADT7 AH109 ; AH109 ;5 : p GBKT7 AH109 ; AH109 ;6 : p GADT7 AH109 ; - :CG1945 ; + : BD AD CG1945 Fig 2 2Galactosidase ( - ) :CG1945 Fig 3 2Galactosidase p GADT7 CG1945 4h,,,,,, AH109, 3 Tel : (8610) ,Fax : (8610) ,E2mail edu cn (No ,No )