P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.
|
|
- Βάαλ Σαμαράς
- 9 χρόνια πριν
- Προβολές:
Transcript
1 [ ] (2009) P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., ; 2., ) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp, Mr P450, Western-blot Mr, P450 CYP4G19 CYP4G19, CYP4G19 ; P450; ; CYP4G19 ; :R384.9 :A Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody ZHAO Xia 1,2, ZHANG Ren-li 1,2*, GEN Yi-jie 2, HUANG Da-na 2, GAO Shi-tong 2, LI Xiao-hen 2, HU Zhang-li 1 (1. College of Life Science, Shenzhen University, Shenzhen ; 2.Shenzhen Center for Diseases Control and Prevention, Shenzhen , China) Abstract Objective To construct prokaryotic expression vector carrying a partial German cockroach cytochrome P450 CYP4G19 gene, and to express the recombinant protein in E. coil. Using the purified fusion protein for the production of polyclonal antibody. Method Part of the CYP4G19 gene was amplified by RT-PCR. PCR products were ligated to the cloning vector pgem T-easy. The positive clones were sequenced and then subcloned into prokaryotic expression vector pet-28a. The constructed pet-28a-cyp4g19 vetor was transformed to E.coil BL21 (DE3) and the recombinant P450 protein (rp450) was expressed. rp450 was then purified using Ni + affinity column chromatography. Balb / c mice were then immunized using the purified rp450 and the titer of the polyclonal antibody was determined by ELISA. The specificity of the antibody was confirmed by Western-blot. Result A hydrophilic fragment of 771bp was cloned from the German cockroach cdna. The recombinant protein with a relative molecular weight of Mr was expressed as inclusion bodies. The protein was then purified and renatured for immunization. The titer of the polyclonal antibody was greater than Western-blot analysis indicated that the antibody specifically reacted with rp450 and recognized the native German cockroach microsome P450. Conclusion The expressed CYP4G19 fusion protein was antigenic. The CYP4G19 polyclonal antibody may be used for further characterization of the German cockroach CYP4G19 protein, especially for the further studies of the development of pesticide resistance. Key words German cockroach; cytochrome P450; prokaryotic expression; CYP4G19 recombination protein; polyclonal antibody : (No ) : (1983-),,, * : (1963-),,,, renlizhang@tom.com
2 592 Journal of Tropical Medicine Vol.9 No.6 Jun. 2009,, GenBank CYP4G19, (AA )ExPASy ProtScale [1],,, 100~350 (mixed-function oxidase,mfo), 750bp P450(cytochrome P450,CYP450), CYP4G19 cds (AY ) P450 GATATTGAGTT 3,( Nhe );, MFO,CYP4G19 R:5 CGGGAATTCTTAGTCATGACCCTCA 3, P450 ( EcoRI ), cdna [2] P450, CYP4G19 F CYP4G19 R, 2 Taq, Platinum PCR Master Mix PCR,PCR, 94 5 min,94 1 min,55 1 min,72 1 min, P450, 30 ;72 10 min PCR 1%, Promega Wizard 誖 SV, P450 PCR pgem-t Easy 4 NCBI P450, Top10, 7, (100 μg / ml) LB, CYP4G Pridgeon [3 ] PCR, Invitrogen (selected subtractive hybridization,ssh) NCBI Blast P450, CYP4G NheI EcoRI, CYP4G19 pgem-t / CYP4G19 pet-28a, pet-28a / CYP4G Taq Platinum PCR Master Mix TIANGEN ;T 4 DNA Nhe EcoRI ( ) ;AxyPrep Multisource Total RNA Miniprep Kit Axygen ;Super Script TM First- Strand Synthesis System for RT-PCR Invitrogen ; Wizard 誖 SV Gel and PCR Clean-Up System Promega ; Plasmid Miniprep Kit Omega ; His, SDS-PAGE Sigma ;IgG Pierce ; pet-28a Top10 BL21(DE3) TIANGEN ;pgem-t easy,, 8 Promega ; pet-28a mmol / L (50 mmol / L Tris-HCl, 200 mmol / L, CYP4G19 F:5 GTTGCTAGCCCAAGG PCR CYP4G19 16, Top10, (50 μg / ml) LB, PCR BL21(DE3), (50 μg / ml) LB,37 1% LB, r / min (OD ~1.0), 1 ml, IPTG 0.5 mmol / L, r / min,,50 mmol / L Tris-HCl, His 6 NaCl, ph 8.0), mmol / L, ~5, 500 mmol / L AxyPrep Multi-source Total RNA, Washing Miniprep Kit RNA 1 μg RNA 10 μl Buffer Elution Buffer,Invitrogen cdna 1.2.7
3 (2 mol / L,50 mmol / L Tris-HCl,1 mmol / L EDTA,20 mmol / L β-me,ph7.4),4 3 h, (20 mmol / L Tris-HC1,1 mmol / L EDTA,pH7.4),, Western-blot SDS- (CYP4G19 CDS 1025 ) PAGE PVDF, 5%,G A(2), His ( ),, HRP IgG ( ),,DAB P450 8 Balb / c 10 P450 3, 50 μg /,,2,,2, PBS 2,,,, ELISA rcyp4g19, 5 μg / ml 1 PCR, 100 μl,, PBST Fig.1 Amplification of goal gene from German cockroach cdna, M: DL2000 DNA marker; 1: PCR product of goal gene., HRP IgG (5000 ), ELISA (HRP-TMB),2.2,, Nhe I EcoRI, 1% 450 / 630nm OD, OD 450, 771bp OD , OD 450 / OD 450 >2.1 pet-28a (3) ~2 IPTG, 12% SDS-PAGE,,,2 ml /,32000 Mr, (0.1 mol / L,pH7.5),4 (4),, 30 min 4,11000 g, 10 min,, 4, g, 60 min, Ni 2+ -NTA, 0.6 ml (30% ) (5), 10 ml, 2.4 Western-blot Western-blot rp450, Mr (6) 10%SDS,, 2.5 CYP4G19 ( ) 2, ELISA HRP ( ), , rp450 DAB 2.6 rp450 Western-blot, CYP4G19, rp450, Mr cdna, PCR, 771bp DNA ( 1) Invtrogen,GenBank ( AY ) 99%, 5000bp, His, (7), 2.7 Western-blot
4 594 Journal of Tropical Medicine Vol.9 No.6 Jun Fig.2 2 CYP4G19 Blast Blast analysis between the CYP4G19 clone gene and the GenBank report Fig.3 3 Nhe I EcoRI Identification of positive clone with goal gene by double enzyme digestion M: DL2000 DNA marker; 1: Goal gene; 2:pET-28a plasimid; 3, 4: Result of double enzyme digestion of positive clone. 4 DS-PAGE (rp450) Fig.4 Expression analysis of rp450 induced by IPTG CYP4G19 M:Prestained protein ladder; 1: Inducation of pet-28a without, Mr P450 gene; 2: Noninducation of pet-28a with P450 gene; 3,4:, Mr Inducation of pet-28a with P450 gene for 4 h,6 h; 5:Inducation, (8) of pet-28a with P450 gene overnight.
5 Fig.5 5 rp450 SDS-PAGE DS-PAGE analysis of rp450 purification M: Unstained protein molecular weight marker ; 1: Total protein; 2: Flow-through; 3: Wash; 4: Elution; 5: Renaturation. 8 CYP4G19 Western-blot Fig.8 Western-blot analysis of German cockroach CYP4G19 polyclonal antibody and microsome protein reactive specificity M: Prestained protein ladder ; 1: Microsome protein of German cockroaches;2: Western-blot analysis of microsome protein with nonimmune serum as first antibody ;3: Western-blot anaysis of microsome protein with ployclonal antibody as first antibody. 3 6 Fig.6 rp450 Western-blot Western-blot analysis of purified rp450 M: Prestained protein ladder ; 1: Inducation of pet-28a without P450 gene; 2: Purified rp Fig.7 CYP4G19 Western-blot Western-blot analysis of German cockroach CYP4G19 polyclonal antibody specificity M: Prestained protein ladder ; 1: Purified rp450; 2: Total protein of pet-28a;a: Western-blot analysis with ployclonal antibody as first antibody;b: Western-blot anaysis with nonimmune serum as first antibody. A B P450, P450 8 (CYP4,CYP6,CYP9, CYP12, CYP15, CYP18, CYP28, CYP48),, P450 P450 P450 CYP4G19 Pridgeon [3] SSH P450, 1638bp, 546 Northern blot [3] mrna, CYP4G19, RNA CYP4G19, P450,, P ,Scharf [4] - (immobilized artificial membrane high performance liquid chro-matography,iam-hplc) Munsyana (MA) P450, P450 MA
6 596 Journal of Tropical Medicine Vol.9 No.6 Jun. 2009,, DAB, CYP4G19, 62000,, Mr, CYP4G19, ExPAsy CYP4G19, Mr CYP4G19 P450, P450, Mr CYP4G19,,,, CYP4G19, [5], CYP4G19 CYP4G19, CYP4G19 ExPASy ProtScale, 750bp T-A [ ], GenBank CYP4G19 cds 99%,, 1997, 8(3): CYP4G19 [2] Scott JG. Cytochromes P450 and insecticide resistance [J]., Insect Biochem Mol Biol, 1999, 29(9): [3] Pridgeon JW, Zhang L, Liu N. Overexpression of CYP4G19 6 His pet-28a, 6 His associated with a pyrethroid-resistant strain resistant strain of, N the German cockroach, Blattella germanica (L.) [J]. Gene, 2003, 314: His, Ni 2+ [4] Scharf ME, Neal JJ, Marcus CB, et al. Cytochrome P450, purification and immunological detection in an insecticide CYP4G19 pet-28a resistant strain of German cockroach (Blattella germanica,l.), [J]. Insect Biochem Mol Biol, 1998, 28(1):1-9.,, [5],,,. P450 3A4 ELISA, 2007, 23(1):79-81., , [6],,. PBS OD 32.8, 2.1, ,, 2004, 15(3): [7] Western-blot,,,. P450 [J]., CYP4G19 P450 CYP4G , 27(12): DAB Mr [8] Scharf ME, Lee CY, Neal JJ, et al. Cytochrome P450 MA, expression in insecticide-resistant German cockroaches (Dictyoptera:Blattellidae) [J]. J Econ Entomol,1999,92 (4): DAB, : P450, ;2 [9],. sige P450 ; 3 [J]., 2007,7(8): [4,6-8] P450, [10],,,.,P450, [J]., 2007,7(9): P450 [1],. [J]. [J]. P450 [J]. ( : ; : )
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
6 2011 5 31 3 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * 430070 PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp 6 801 bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»
ΦΟΡΕΑΣ ΔΙΑΧΕΙΡΙΣΗΣ ΕΘΝΙΚΟΥ ΘΑΛΑΣΣΙΟΥ ΠΑΡΚΟΥ ΖΑΚΥΝΘΟΥ ΤΕΥΧΟΣ ΠΡΟΚΗΡΥΞΗΣ ΑΝΟΙΚΤΟΥ ΙΑΓΩΝΙΣΜΟΥ ΓΙΑ ΤΟ ΕΡΓΟ «ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ» Για τις ανάγκες της Πράξης ΟΡΓΑΝΩΣΗ ΤΗΣ ΠΡΟΣΤΑΣΙΑΣ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ
(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5
42 5 2002 10 Acta Microbiologica Sinica Vol. 42 October No. 5 2002 Ea ge 3 33 ( 430070) : ge,, ge, GS115, G418, ge, Western blotting 33kD ELISA, ge, : ge,,, :Q93914 :A :000126209 (2002) 0520543207 (Pseudorabies,PR),
CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...
Table of Content CHAPTER-1... 1 1 INTRODUCTION... 1 CHAPTER-2... 4 2 REVIEW OF LITERATURE... 4 2.1 History of Filariasis... 4 2.1.1 Discovery of Symptoms (1588-1592)... 4 2.1.2 Discovery of Microfilariae
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Studies on purification and characteristics of glycosyltransferase from an engineering strain
DOI:10.16774/j.cnki.issn.1674-2214.2015.02.001 2015 2 4 44 2,, (, 310014) : pet28b-valg BL21(DE3), 10~40 C ph 5~11,, ph 30 C 8.0 1 mmol/l Ca 2+ Mg 2+ Mn 2+ Co 2+, Cu 2+ Zn 2+, 8 μmol/l 2 μmol/l A, K mb
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Angioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
Vol. 39 No Journal of Jiangxi Normal University Natural Science Jan Western blot %. 40 kda
39 1 Vol 39 No 1 2015 1 Journal of Jiangxi Normal University Natural Science Jan 2015 1000-5862 2015 01-0101-05 1 2 1 1 1 1* 1 518060 2 330006 R 392 11 A DOI 10 16357 /j cnki issn1000-5862 2015 01 19 pet-28a
Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE
2011 33 5 0993-0998 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Ara h 2 1 2 3 4 5 6 2 4* 2 4* 1. 518060 2. 518060 3. 830000 4. 518060 5. 518045
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Chinese Journal of Biochemistry and Molecular Biology CK2 252
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 9 24 (9) :826 832 CK2 252 1) 3 3, 1),2) 3 3, 1),2) 3, 1) ( 1), 524023 ; 2), 523808) CK2 Π. CK2, pact2 cdna CK2. CK2,
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 2016 1 32 1 93 ~ 98 DOI 10. 13865 /j. cnki. cjbmb. 2016. 01. 14 HdeA 1 3 2 3 3 3 * 1 422000
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Molecular Cloning of MUC1ΠY and Soluble Expression of Its
ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :579 584 MUC1ΠY, 3, ( 100039) MUC1ΠY cdna, RT2PCR HeLa MUC1ΠY cdna ;PCR, p GEX22T DH5a ; ; GST N ; MUC1ΠY
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x - 2 - orfh79
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com orfh79 1 2 1 1 2 1 2 2 1. / 330031 2. / 430072 orfh79 orfh79 pet - 28a - orfh79
CK2, Basic Medical Sciences and Clinics (4) ( Π ) pt727 ( CIP), (TSR) 6 ( POP6) ( IPTG),, A,
392 Basic Medical Sciences and Clinics 2003123 (4) : 100126325 ( 2003) 0420392207 CK2 1 # 2, #, 1 1, 3 1, ( 11 ; 21, 524023) : PCR NIH 3T3 CK2 cdna ; CK2, CK2 cdna, CK2 cdna BL21 (DE3), 26kDa, 3117 %,
A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp
2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM
Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening
21 2 212126-130 2006 3 VIROLOGICA SINICA March 2006 HIV-1 * 1,3 1,3 1 2 2 1,** (1 650223; 2 650231; 3 100039) Expression and Purification of HIV-1 Protease and the Establishment of a Method for Protease
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
BL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΓΕΝΙΚΗ ΓΡΑΜΜΑΤΕΙΑ ΕΡΕΥΝΑΣ & ΤΕΧΝΟΛΟΓΙΑΣ Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988 Θέμα: Έγκριση πρόσκλησης εκδήλωσης ενδιαφέροντος με απευθείας ανάθεση
Πρόσκληση υποβολής προσφοράς
Αθήνα, 5 Μαρτίου 2014 Πρόσκληση υποβολής προσφοράς από φυσικά ή νομικά πρόσωπα για την προμήθεια υλικών στην Πράξη «ΘΑΛΗΣ Εθνικό Ίδρυμα Ερευνών Βιοσύνθεση και Γενετική Επιλογή Κυκλικών Πεπτιδίων με Εν
Supplementary Table 1. Construct List with key Biophysical Properties of the expression
SPINE Benchmark Target ID Well Code Tag (N or C) Fusion MW (kda) Fusion pi Cleavage site Prot MW (Da) Prot pi 1 A1 OPPF 2585 N-His6 21.75 6.41 Protease 3C 19.77 5.43 2 B1 OPPF 2586 N-His6 15.6 6.27 Protease
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Resistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province
Chinese Journal of Applied Entomology 2011 48 1 48 53 * Q 1 2 1 1 2 1 1. 225009 2. 100081 3 Q Bemisia tabaci Gennadius 5 Q RCR 287 bp 184 bp ace1 para- Q F331W L925I T929V Resistance monitoring and target
, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha 410004)
44 3 2 0 0 8 3 SCIENTIA SILVAE SINICAE Vol144,No13 Mar.,2 0 0 8 FAD2 cdna ( 410004) : FAD2, EST, 5 RACE PCR FAD2 cdna 1 682 bp, 1 149 bp, 382, FAD2, FAD2 FAD2 : ; EST ; FAD2 ; RACE; PCR ; :S718146 ;Q94312
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Humanization of Ovarian Carcinoma Anti2idiotype Single2chain
ISSN 100727626 CN 1123870ΠQ 2002 8 Chinese Journal of Biochemistry and Molecular Biology 18 (4) :490 494 3,,,, (, 100044),, PCR, 6B11 ScFv, 6B11V L 2V H IgG1 CH3 (V L 2V H 2CH3), E coli BL21 (DE3) IPTG
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family
HEREDITAS (Beijing) 2007 4, 29(4): 433 437 ISSN 0253-9772 www.chinagene.cn DOI: 10.1360/yc-007-0433 2 DNA G7444A,,,,,,,, 350005 : PCR-RFLP 2 DNA G7444A,, 27, 11 DNA G7444A, 11 2 5, 1,, DNA G7444A, 2 :
(bovine herpesvirus type 1, BHV1,. (infectious bovine rhinotracheitis, IBR) (infectious pustular vulvovaginitis, IPV) 3, 1.1, 1.2a 1.2b [5].
2009 54 24 : 3823 ~ 3829 www.scichina.com csb.scichina.com SCIENCE IN CHINA PRESS gn,,,,,,, 310021;, 712100 E-mail: cunzh2004@yahoo.com.cn 2009-07-16, 2009-08-02 pha2 ZJ UL15 UL18, rbhv1-ha; DNA, DH10B,
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Chinese Journal of Biochemistry and Molecular Biology. ( OsSUT2) 6314 kd, E2mail : edu. cn
ISSN 100727626 CN 1123870ΠQ 2005 12 Chinese Journal of Biochemistry and Molecular Biology 21 (6) :846 851 ( OsSUT2),,,,, (, 100875) Expression of a Fusion Protein Containing Non2transmembrane Region for
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1044 ~ 1050 AKT2 * 350025 AKT2 H 2 RT-PCR AKT2 cdna pcdna3 1 / myc-his - A AKT2
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
BD OptEIA ELISA Sets ELISA
BD OptEIA ELISA Sets ELISA BD OptEIA ELISA Sets ELISA CaptureDetection Detection 9620 170,000 ELISAEnzymed-Linked ImmunoSorbent Assay CaptureDetection BD OptEIA ELISA Set 2 BD OptEIA ELISA Set BD OptEIA
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
LfcinB. Expression and Iden tif ica tion of Lfc inb Gene in P ich ia pastoris
265 ( LfcinB) 3 ( 518057) : ( Pichia pastors) ( bovine lactoferricin, Lf2 cinb), LfcinB pp IC9K, pp IC9K2LfcinB Sal, SMD1168 G418,, PCR LfcinB LfcinB, : (LfcinB),,, : Q782, Q784, Q786 : A : 025322654 (2007)
Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes
1 Mandelamide-Zinc Catalyzed Alkyne Addition to Heteroaromatic Aldehydes Gonzalo Blay, Isabel Fernández, Alícia Marco-Aleixandre, and José R. Pedro Departament de Química Orgànica, Facultat de Química,
Supplementary Material
Supplementary Material Control experiments S2 Characterization data for the products S2-S7 References S8 MR spectra for the products S9-S28 S1 Control experiments 2a (99.5 mg, 0.5 mmol), I 2 (50.8 mg,
*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
A/A Είδος Προδιαγραφές
A/A Είδος Προδιαγραφές 1 Κιτ για απομόνωση γενομικού DNA από διάφορους τύπους αρχικών δειγμάτων, όπως ιστούς, κύτταρα, βακτήρια, αίμα, buffy coat & ιούς. Κιτ για απομόνωση γενομικού DNA από διάφορους τύπους
Preparation and Characterization of a Novel Recombinant Imaging Agent Directing Thrombus
ISSN 100727626 CN 1123870ΠQ 2001 12 Chinese Journal of Biochemistry and Molecular Biology 17 (6) :781 785,,,, (, 100871) 3 2 GMP2140 SZ51, 1 SZ51 (ScFv2SZ51) 1 (MT2 ) cdna, BL21 (DE3) plyss, HLMT 40 mgπl
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
NOVEL INTEGRAL MEMBRANE PROTEINS OF THE INNER NUCLEAR MEMBRANE
NOVEL INTEGRAL MEMBRANE PROTEINS OF THE INNER NUCLEAR MEMBRANE CHARACTERIZATION OF LUMA NATIVE LAP 2β COMPLEXES Inauguraldissertation zur Erlangung der Doktorwürde des Fachbereichs Biologie Chemie Pharmazie
1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]
212 2 ( 4 252 ) No.2 in 212 (Total No.252 Vol.4) doi 1.3969/j.issn.1673-7237.212.2.16 STANDARD & TESTING 1 2 2 (1. 2184 2. 2184) CensusX12 ARMA ARMA TU111.19 A 1673-7237(212)2-55-5 Time Series Analysis
ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,
24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).
ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING. Sample Requirements
ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING Η εταιρία Macrogen χρησιμοποιεί την τελευταία λέξη της τεχνολογίας για την καλύτερη δυνατή παροχή Υπηρεσιών Sequencing. Μέσα από την 10ετη της εμπειρία, συγκέντρωσε
Escherichia coli (LFD1).
38-46 /1391 / 4 14 / (Lethal Factor) Escherichia coli * ( ) 91/4/14: 91/3/16: 90/11/30 : :. ( ) : (LFD1) (PA) Escherichia coli (LFD1).. PCR pxo1 LFD1 : (pgem-t easy) Xho I BamH I.. pet28a(+) -I- D- β-
M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna
2010 32 4 0797-0801 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com DX01 1 2 2* 1. 337000 2. 310058 DX01 Methanothermobacter marburgensis DX01 DX01
* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
PrP C. PrP SC PrP. PrP. mrna
PrP C PrP SC PrP C PrP C PrP SC PrP C PrP SC PrP C PrP SC PrP PrP SC PrP SC PrP PrP SC PCR PCR mrna PrP PrP C RT-PCR PrP mrna PrP E-mail:zhaodm@ cau.edu.cn 1 SPF Ecoli DH 5α TRIZOL RNA Gibco dntpstakara
Οδηγίες χρήσης Elucigene TRP
Οδηγίες χρήσης Elucigene TRP Κωδικός καταλόγου: TH003B2 50 εξετάσεις Για in vitro διαγνωστική χρήση Κατασκευάζεται από την: Elucigene Diagnostics Greenheys House Pencroft Way Manchester Science Park Manchester
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Divergent synthesis of various iminocyclitols from D-ribose
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 205 Divergent synthesis of various iminocyclitols from D-ribose Ramu Petakamsetty,
Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ
Εθνικό Μετσόβιο Πολυτεχνείο Σχολή Μηχανολόγων Μηχανικών ΕΡΓΑΣΤΗΡΙΟ ΕΜΒΙΟΜΗΧΑΝΙΚΗΣ ΚΑΙ ΣΥΣΤΗΜΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΜΗΧΑΝΟΛΟΓΙΚΩΝ ΚΑΤΑΣΚΕΥΩΝ ΚΑΙ ΑΥΤΟΜΑΤΟΥ ΕΛΕΓΧΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ
Supporting Information
Supporting Information Wiley-VC 007 9 Weinheim, Germany ew ear Infrared Dyes and Fluorophores Based on Diketopyrrolopyrroles Dipl.-Chem. Georg M. Fischer, Dipl.-Chem. Andreas P. Ehlers, Prof. Dr. Andreas
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ ΠΡΟΜΗΘΕΙΑ ΑΝΤΙΔΡΑΣΤΗΡΙΩΝ ΕΡΓΑΣΤΗΡΙΟΥ (CPV: )
Αθήνα, 26 Νοεμβρίου 2014 Αρ. Πρωτ.: 3450 ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Το Ελληνικό Ινστιτούτο Παστέρ, στο πλαίσιο υλοποίησης του έργου με τίτλο: «Ανάπτυξη Βιοαισθητήρων Τύπου Ταινίας Ξηρών Αντιδραστηρίων
Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1
ISSN 100727626 CN 1123870ΠQ 2005 10 Chinese Journal of Biochemistry and Molecular Biology 21 (5) :656 660 I2 ERR 1,,,,, (, 400038) 3 1 ( ERR 1) I2 (TNNI2) TNNI2 ERR 1, GST2TNNI2, 35 S ERR 1, GST,TNNI2
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology T7Select10-3b MCS cdna 3' 6 cdna.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 5 29 5 475 ~ 481 T7 cdna 1 1 2 * 1 1 1 071002 2 Western University of Health Sciences
Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)
«Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.29 Έκθεση παρουσίασης των αποτελεσμάτων της οροεπιδημιολογικής μελέτης