Molecular Cloning of MUC1ΠY and Soluble Expression of Its
|
|
- Ξένων Παπακωνσταντίνου
- 7 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 17 (5) : MUC1ΠY, 3, ( ) MUC1ΠY cdna, RT2PCR HeLa MUC1ΠY cdna ;PCR, p GEX22T DH5a ; ; GST N ; MUC1ΠY cdna 759 bp, GenBank (AF125525) 9 bp 331 G2A 40 kd GST2Yex, 25 % 30 % 70 % 80 % > 90 %,GST 0121 UΠ g N ELISA , MUC1ΠY cdna MUC1ΠY MUC1ΠY Q78,Q513 Molecular Cloning of MUC1ΠY and Soluble Expression of Its : : (No ) 3 Tel : ,Fax : ,E2mail bmi ac cn, Received :November 29, 2000 ;Accepted :January 19,2001 Supported by National Natural Science Fundation of China,No Extra2cellular Fragment in E coli ZHANGLi2xin, LI Chun2hai 3 3 Correspondence author Tel : ,Fax : ,E2mail bmi ac cn, SUN Li2ya ( Department of Tumor Molecular Biology, Beijing North Taiping Hospital and Beijing Institute of Basic Medical Sciences, Beijing , China) Abstract To clone MUC1ΠYfull length cdna and express and purify its extra2cellular fragment protein from E coli for further functional and tumor therapeutic research purposes MUC1ΠY cdna was amplified by RT2 PCR from HeLa cells and cloned into p GEM2T for sequence analysis MUC1ΠY extra2celluar fragment (MUC1Π Yex) was then amplified by PCR and cloned into p GEX22T fusion expression vector E coli DH5 was trans2 formed with the new constructed expression vector p GEX2Yex and induced by IPTG The fusion protein GST2 Yex was purified by affinity column and identified by thrombin digestion, GST activity and N2terminal protein sequencing Polyclonal antibody was prepared by immunizing rabbits The results showed that the open reading frame (ORF) of MUC1ΠY cdna from HeLa cells consisted of 759 bp with a 9 bp deletion in its signal peptide2 coding region and a G to A transition at the site of 331 bp which caused a V to M amino acid mutation ( Gen2 Bank access number AF125525) The expressed fusion protein GST2Tex was about 40 kd which was 25 % - 30 % of total host proteins 70 % - 80 % of the GST2Yex proteins existed as soluble ones and after one2step af2 finity purification the purity of GST2Yex was over 90 % with 0121 UΠ g GST activity MUC1ΠYex protein can be
2 cleaved from GST2Yex and N2terminal protein sequencing confirmed that is was consistent with the sequence published The titer of polyserum generated was by ELISA In conclusion,muc1πy full length cd2 NA was cloned MUC1ΠYex protein and its polyclonal antibody were obtained for further research purposes Key words MUC1ΠY, clone, expression,purification MUC1 ( MUC1) ( > GGCGACGTGCCCCTACAAGT 3 P3 :5 CG2 205 kd) : GATCCACAGGTTCTGGTCAT 3, P4 : 5 1) (variable GAATTCTTACCCAGCCCCAGACTG 3 P12P2 numbers of tandem repeats,vntrs) VNTR 20 Pro,Ser Thr ;2) P3 5 BamH,P4 50 % O VN2 5 Eco R HeLa TRs SerΠThr,MUC1 RNA :3 l (114 gπ l) RNA,1 [1 3, ] l P2,70,10 min 5 min 4 l 5, MUC1ΠY MUC1 MUC1 VNTRs [4 ] 60 min,95,5min P12P2 PCR,MUC1ΠY : 94 5 min ; 94,1 min,63,1 min, [4,5 ] MUC1ΠY 72,2 min 30 p GEM2T [6,7 ] ras, P32P4 MUC1ΠY, (MUC1ΠYex) cdna : 94,5 min ; 94,30 s ; 68,30 MUC1ΠY s ;72,45 s ; 25 [8 ],MUC1ΠY PCR P1 - P2, p GEM2T MUC1ΠY, JM109, LB 37 TaKaRa ( ) MUC1ΠYex P3 - P HeLa Eco R DH5 JM109 ; GST p GEX2 p GEX22T 2T Pharmacia ;p GEM2T Promega p GEX2Yex ( Fig 1), DH Trizol RNA GIBCOL, Ex Taq TaKaRa,DNA PCR AMV RNasin UP 200s Dr Hielscher GmbH,Photometer 4010 Boehringer Mannheim 5 10 min,15 %SDS2PAGE RT2PCR MUC1ΠY cdna, PCGENE : P1 :5 CTC2 CCCACCCATTTCACCAG 3, P2 : 5 MUC1ΠY cdna,p32p4 MUC1ΠY 5 l dntp,1 l AMV,1 l RNasin,5 l,42, p GEM2T, Bam H TaKaRa ( ) MUC1ΠYex p GEX2Yex DH5 LB Promega,PCR markers (100 mgπl ), ,IPTG X2gal Sigma LB (100 mgπl ), Gene Amp PCR System 2400 PE 37 A IPTG mmolπl 1 5 h 100 l 20 l MUC1ΠY
3 5 : MUC1ΠY 581 GST2Yex ELISA GST GST MUC1ΠY cdna P12P2 HeLa RNA DNA ( Fig 2) 795 bp 759 bp (Fig 3) 3 9 bp ; 331 G A (V) (M) MUC1ΠY cdna GenBank(AF125525) Fig 2 RT2PCR of MUC1ΠY cdna from HeLa cell 1 DNA markers ; 2 MUC1ΠY Fig 1 Construction of MUC1ΠYex fusion expression vector p GEX2 Yex PBS ( 16 mmolπl Na 2 HPO 4, 4 mmolπl NaH 2 PO 4, 150 mmolπl NaCl,pH 714) 2, p GEX22T, p GEX2 Triton X % g,4 40 min Glutathione Sepharose 4B GST2Yex GST : 10 l GST2Yex 2199 ml (214 ml mmolπl K 2 HPO 4,pH 615,0139 ml H 2 O,011 ml 30 mmolπl GSH,011 ml 30 mmolπl CDNB),25 40 kd 1 min, 2 min 3 min A 340, ; p GEX22T 26 kd GST : GST (UΠ g) = ( Fig 4) IPTG ( ( - ) 10Π ( g) mmolπl) GST2Yex,SDS2PAGE N 212 MUC1ΠY MUC1ΠY cdna P32P4 418 bp MUC1ΠY cdna p GEM2T, Bam H Eco R, Yex DNA,p GEX2Yex 213 GST2Yex p GEX22T p GEX2Yex DH5 012 mmolπl IPTG h SDS2PAGE,p GEX2Yex MUC1ΠY 100 gπml SDS2PAGE
4 Fig 3 Nucleotide sequence of cloned HeLa MUC1ΠY cdna Signal peptide is underlined and transmembrane region is marked by shadowed area,potential N2glycocylate site is indicated by asterisk, 30 kd ( GST) 15 kd( Yex) (Fig 6A) 25,012 mmolπl IPTG 30 GST(Fig 6B) MUC1ΠY ; 15 (70 % 80 %) ( Fig 5) kd N, GSTGS2 25 % 30 % GHASS, G S Bam H 8 MUC1ΠY N Fig 4 Induction of protein expression of p GEX2YexΠDH5 1 Protein markers ; 2 p GEX2YexΠDH5 without induction ; 3 7 Induced p GEX2YexΠDH5 ; 8 Induced p GEX22TΠDH5 214 GST2Yex Fig 5 Effect of induction temperature on the solubility of GST2Yex 1 Soluble proteins ; 2 Inclusion body Glutathione2 215 MUC1ΠY Sepharose 4B, 40 kd, > % GST 0121 UΠ g ; GST GST, ( GST2Yex),SDS2PAGE 26 ELISA MUC1ΠYex
5 5 : MUC1ΠY 583 Fig 6 Affinity purification and enzyme digestion of GST2Yex 1,5 Protein markers ; 2,4 Affinity purified GST2Yex ; 3 Thrombin digested GST2Yex ; 6 Affinity purified GST V2 M V M [4 ] MUC1ΠY, MUC1ΠY cdna, ; p GEX22T [11 ], p GEX, : (1) ; (2) ; (3), GST MUC1ΠYex, kd 3 PEST [ KET2 SATQR(32 39), REGTINVH ( ), KTEAASR ( ) ] [12 ],MUC1Π Yex [13 ] 3 (Pichia pastoris) MUC1 1q21 [9 ] (3 5 d), mrna p GEX22T GST MUC1 5 MUC1ΠYex MUC1ΠREP,MUC1ΠSEC,MUC1ΠX [8 ],MUC1ΠY MUC1ΠZ [10 ] MUC1ΠREP MUC1ΠSEC p GEX22T VNTRs, MUC1, ; MUC1ΠX MUC1ΠY MUC1ΠZ [14 ] VNTRs 5, [15 IPTG ] MUC1ΠY MUC1ΠY DNA p GEX22T DH5 IPTG GST2Yex MUC1ΠY 25 % 30 %, GST2Yex,,30 37, MUC1ΠY HeLa 30 > 25 > 37 [8 ] RT2PCR HeLa [4 ] MUC1ΠY cdna IPTG, GST2Yex GST2Yex MUC1ΠY
6 [5 ] MUC1ΠY, N2 MUC1ΠY MUC1ΠY ( References) and tumor2associated mucin glycoproteins expressed by human mammary 1 Taylor2Papadimitriou J,Finn O J Biology,biochemistry and immunology epithelium Proc Natl Acad Sci USA,1987,84(17) : of carcinoma2associated mucins Immunol Today,1997,18 (3) : Oosterkamp H M,Scheiner L,Stefanova M C,Lloyd K O,Finstad C L 107 Comparison of MUC21 mucin expression in epithelial and nonepithelial 2 MUC1 ( Zhang Li2xin,Li Chun2 hai Immunological functions and its application in cancer biotherapy of MUC1 Chin J Cancer Biotherapy),2000,7(3) : Agrawal B,Gendler S J,Longenecker B M The biological role of mucins in cellular interactions and immune regulation :prospects for cancer im2 munotherapy Mol Med Today,1998,4 (9) : Zrihan2licht S,Vos H L,Baruch A, Elroy2stein O,Sagiv D, Keydar I, Hilkins J,Wreschner D H Characterization and molecular cloning of a novel MUC1 protein, devoid of tandem repeats, expressed in human breast cancer tissue Eur J Biochem,1994,224(2) : Hartman M,Baruch A,Ron I,Aderet Y,Yoeli M,Saggi2Assif O, Green2 stein S,Stadler Y,Weiss M,Yaakubovits M,Keydar I,Smorodinsky N I, Wreschner D H MUC1 isoform specific monoclonal antibody 6E6Π2 de2 tects preferential expression of the novel MUC1ΠY protein in breast and ovarian cancer Int J Cancer,1999,82 (2) : Zrihan2licht S,Baruch A, Elroy2stein O, Keydar I,Wreschner D H Ty2 rosine phosphorylation of MUC1 breast cancer membrane proteins2cyto2 kine receptor2like molecules FEBS Lett,1994,356(1) : Pandey P, Kharbanda S, Kufe D Association of the DF3ΠMUC1 breast cancer antigen with Grb2 and SosΠRas exchange protein Cancer Res, 1995,55(18) : Baruch A,Hartman M,Zrihan2licht S, Greenstein S,Burstein M, Keydar I,Weiss M,Smorodinsky NI,Wreschner D H Preferential expression of novel MUC1 tumor antigen isoforms in human epithelial tumors and their tumor potentiation function Int J Cancer,1997,71 (5) : Gendler S J,Burchell J M,Duhig T,Lamport D,White R, Parker M, Taylor2Papadimitriou J Cloning of partial cdna encoding differentiation cancer cell lines and demonstration of a new short variant form (MUC1Π Z) Int J Cancer,1997,72 (1) : Smith D B,Johnson K S Single step purification of polypetides expressed in Escherichia coli as fusions with glutathione S2transferase Gene,1998, 67 (1) : Rodgers S,Wells R,Rechsteiner M Amino Acid Sequences Common to Rapidly Degraded Proteins : The PEST Hypothesis Science, 1986, 234 (4774) : Zhang L X,Li C H,Sun L Y Cloning of MUC1ΠYfull length cdna and secrete expression of its extracellular fragment in P pastoris J Tumor Marker Oncol,2000,15(1) : Frangioni J V,Neel B G Solubilization and purification of enzymatically active glutathione S2transferase (pgex) fusion protein Anal Biochem, 1993,210(1) : Saluta M,Bell P A Troubleshooting GST2fusion protein expression in E coli Life Science News, 1997, issue 1, http : www apbiotech comπ productπpublicationπlsnπlsn2127πlsn2127 htm www bcmb net cn bjmu edu cn
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Angioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1
ISSN 100727626 CN 1123870ΠQ 2005 10 Chinese Journal of Biochemistry and Molecular Biology 21 (5) :656 660 I2 ERR 1,,,,, (, 400038) 3 1 ( ERR 1) I2 (TNNI2) TNNI2 ERR 1, GST2TNNI2, 35 S ERR 1, GST,TNNI2
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
CK2, Basic Medical Sciences and Clinics (4) ( Π ) pt727 ( CIP), (TSR) 6 ( POP6) ( IPTG),, A,
392 Basic Medical Sciences and Clinics 2003123 (4) : 100126325 ( 2003) 0420392207 CK2 1 # 2, #, 1 1, 3 1, ( 11 ; 21, 524023) : PCR NIH 3T3 CK2 cdna ; CK2, CK2 cdna, CK2 cdna BL21 (DE3), 26kDa, 3117 %,
Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening
21 2 212126-130 2006 3 VIROLOGICA SINICA March 2006 HIV-1 * 1,3 1,3 1 2 2 1,** (1 650223; 2 650231; 3 100039) Expression and Purification of HIV-1 Protease and the Establishment of a Method for Protease
(Vibrio anguillarum) (Cyclina sinensis) *
43 4 Vol.43, No.4 2012 7 OCEANOLOGIA ET LIMNOLOGIA SINICA July, 2012 (Vibrio anguillarum) (Cyclina sinensis) * ( 300387) (GSTs), SMART cdna, σ (CsGSTS) PCR CsGSTS, CsGSTS cdna 793bp, 206, GST-N GST-C GSTs
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Chinese Journal of Biochemistry and Molecular Biology CK2 252
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 9 24 (9) :826 832 CK2 252 1) 3 3, 1),2) 3 3, 1),2) 3, 1) ( 1), 524023 ; 2), 523808) CK2 Π. CK2, pact2 cdna CK2. CK2,
rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1
rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Studies on purification and characteristics of glycosyltransferase from an engineering strain
DOI:10.16774/j.cnki.issn.1674-2214.2015.02.001 2015 2 4 44 2,, (, 310014) : pet28b-valg BL21(DE3), 10~40 C ph 5~11,, ph 30 C 8.0 1 mmol/l Ca 2+ Mg 2+ Mn 2+ Co 2+, Cu 2+ Zn 2+, 8 μmol/l 2 μmol/l A, K mb
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE
2011 33 5 0993-0998 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Ara h 2 1 2 3 4 5 6 2 4* 2 4* 1. 518060 2. 518060 3. 830000 4. 518060 5. 518045
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Chinese Journal of Biochemistry and Molecular Biology. ( OsSUT2) 6314 kd, E2mail : edu. cn
ISSN 100727626 CN 1123870ΠQ 2005 12 Chinese Journal of Biochemistry and Molecular Biology 21 (6) :846 851 ( OsSUT2),,,,, (, 100875) Expression of a Fusion Protein Containing Non2transmembrane Region for
CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...
Table of Content CHAPTER-1... 1 1 INTRODUCTION... 1 CHAPTER-2... 4 2 REVIEW OF LITERATURE... 4 2.1 History of Filariasis... 4 2.1.1 Discovery of Symptoms (1588-1592)... 4 2.1.2 Discovery of Microfilariae
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %
Research Papers Progress in Biochemistry and Biophysics 2009, 36(4): 424~430 wwwpibbaccn * TNF-α 1, 2) 1) 1)** ( 1) 100101 2) 100039) TNF-α TNF-α TNF-α TNF-α TNF-α TNF-α 9C6 TNF-α 29~40 TNF-α 9C6 TNF-α
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Sequencing and Comparison of Two2passage Genomes of Fast2growth Isolates of Attenuated Hepatitis A Virus( H2 Strain) in KMB17 Cells
ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :541 546 ( H2 ) 3 ( 650118) ( H2 ) (HAVH2K7) KMB17 28 d 14 d 22 1 1024 lgccid 50 ( ml) 7183 6 22 AC2PCR
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
BL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
6 2011 5 31 3 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * 430070 PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp 6 801 bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC
Preparation and Characterization of a Novel Recombinant Imaging Agent Directing Thrombus
ISSN 100727626 CN 1123870ΠQ 2001 12 Chinese Journal of Biochemistry and Molecular Biology 17 (6) :781 785,,,, (, 100871) 3 2 GMP2140 SZ51, 1 SZ51 (ScFv2SZ51) 1 (MT2 ) cdna, BL21 (DE3) plyss, HLMT 40 mgπl
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x - 2 - orfh79
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com orfh79 1 2 1 1 2 1 2 2 1. / 330031 2. / 430072 orfh79 orfh79 pet - 28a - orfh79
Chalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα ΣΤ... 3 1.1 ΜΑΡΚΟΠΟΥΛΟΥ- ΣΠΥΡΟΠΟΥΛΟΥ -ΚΩΝΣΤΑΝΤΟΠΟΥΛΟΥ... 3 1.2 ΜΑΡΚΟΣ- ΚΟΥΤΣΟΠΟΥΛΟΣ ΑΥΓΕΡΗ - ΜΠΟΥΖΑΛΑ... 3 1.3
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
Removing Endotoxin from rhsa-ifnα2b by Chromatography
Chin J Biotech 2008, January 25; 24(1): 159-163 journals.im.ac.cn Chinese Journal of Biotechnology ISSN 1000-3061 cjb@im.ac.cn 2008 Institute of Microbiology, CAS & CSM, All rights reserved. α2b 1, 2,3,
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Design and Fabrication of Water Heater with Electromagnetic Induction Heating
U Kamphaengsean Acad. J. Vol. 7, No. 2, 2009, Pages 48-60 ก 7 2 2552 ก ก กก ก Design and Fabrication of Water Heater with Electromagnetic Induction Heating 1* Geerapong Srivichai 1* ABSTRACT The purpose
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών
Ιούλιος 2005 Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών ρ. Α. Προµπονά Εργαστήριο Ρύθµισης της Μεταγραφής από το Βιολογικό Ρολόι Κιρκαδικό Ρολόι Ρυθµοί µε περίοδο ~ 24 ωρών
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
Chinese Journal of Biochemistry and Molecular Biology. (growth inhibitory factor,gif, 2Sepharose 4B PC12,
ISSN 100727626 CN 1123870ΠQ 2004 8 Chinese Journal of Biochemistry and Molecular Biology 20 (4) :534539 G Rab3a ( GIF) 1) 1) 1) 2) 1) 3,,,, ( 1), 100871 ; 2), 225009) G Rab3a (growth inhibitory factor,gif,
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Monday 26 January2015
Πρόγραμμα Monday 26 January2015 09:30 10:00 Arrival of participants, Registration 10:00 10:30 Welcome and Introduction: Presentation of the Institution and group activities V. Georgoulias, D. Mavroudis
Molecular evolutionary dynamics of respiratory syncytial virus group A in
Molecular evolutionary dynamics of respiratory syncytial virus group A in recurrent epidemics in coastal Kenya James R. Otieno 1#, Charles N. Agoti 1, 2, Caroline W. Gitahi 1, Ann Bett 1, Mwanajuma Ngama
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
Supplementary Table 1. Construct List with key Biophysical Properties of the expression
SPINE Benchmark Target ID Well Code Tag (N or C) Fusion MW (kda) Fusion pi Cleavage site Prot MW (Da) Prot pi 1 A1 OPPF 2585 N-His6 21.75 6.41 Protease 3C 19.77 5.43 2 B1 OPPF 2586 N-His6 15.6 6.27 Protease
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Extraction, Amplification and Sequence Analysis of Xiajiadian Ancient Human Bone D NA
ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :636 641 DNA,,, 3,, ( DNA, 130023) DNA 2 000 5 000 ( :M89, M11, M12 AM4), DNA MTND 4 11 210 11 414 (205
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
Chinese Journal of Biochemistry and Molecular Biology. p38mapk
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :537 542 Grx1 HEK293T H 2 O 2 p38mapk 1), 2), 1), 1), 3), 1), 1) 3 ( 1), 150081 ; 2), 150081 ; 3), 161042)
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
,Ab 2 Ab 1. (internal image) Ab 2 : (1) Ab 1,
(, 100021) : (), Ab 2 (internal image), :, ; ; Advances in Research of Anti2idiotypic Antibody LI Min, J I Rong (National Institute for Nutrition and Food Safety, Chinese CDC, Beijing 100021, China) Abstract
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Η ΦΛΕΓΜΟΝΩ ΗΣ ΑΝΤΙ ΡΑΣΗ ΤΟΥ ΓΑΣΤΡΙΚΟΥ ΒΛΕΝΝΟΓΟΝΟΥ ΣΤΗ ΛΟΙΜΩΞΗ ΜΕ ΕΛΙΚΟΒΑΚΤΗΡΙ ΙΟ ΤΟΥ ΠΥΛΩΡΟΥ ΠΡΙΝ ΚΑΙ ΜΕΤΑ ΤΗ ΘΕΡΑΠΕΙΑ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΤΟΜΕΑΣ ΥΓΕΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟΣ ΙΕΥΘΥΝΤΗΣ: Ο ΚΑΘΗΓΗΤΗΣ ΓΕΩΡΓΙΟΣ ΚΑΡΚΑΒΕΛΑΣ ΠΑΝΕΠ. ΕΤΟΣ 2008-2009 Αριθµ. 2084 Η ΦΛΕΓΜΟΝΩ ΗΣ ΑΝΤΙ
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
http://doc.rero.ch To whom correspondence should be addressed: Dr. Beat Schwaller, Unit of Anatomy,
Published in "" which should be cited to refer to this work. Calretinin is essential for mesothelioma cell growth/survival in vitro: a potential new target for malignant mesothelioma therapy? Anatomy,
Journal of the CUN(Natural Sciences Edition) ...
2007 2 16 1 ( ) Journal of the CUN(Natural Sciences Edition) Feb. 2007 Vol. 16 No. 1 1,2, 1, 1, 2 (11, 100081 ; 21, 100875) :. 2,42D NAA 62BA.,.. : ; ; ; :Q94513 :A :100528036 (2007) 0120023206 : (1),
ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΓΕΝΕΤΙΚΗΣ ΚΤΙΡΙΟ 0 ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ ΔΡΑΓΑΝΑ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗ 6800 HELLENIC REPUBLIC DEMOCRITUS UNIVERSITY OF THRACE DEPARTMENT
ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
Introduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers
An HBsAg Binding Protein Expressed in Pichia pastoris Can be Used as an HBV Vaccine Adjuvant
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 11 25 (11) :1024 1029,, 3 (, 200433) (HBsAg binding protein, SBP) HBsAg,., SBP., SBP, ( ELISA) (SPF) SBP, HBsAg,.
Gene Cloning and Structural Analysis of Virion Host Shutoff protein of Pseudorabies Virus
ISSN 100727626 CN 1123870ΠQ 2005 2 Chinese Journal of Biochemistry and Molecular Biology 21 (1) :65 71,,,,, (, 430070) 3 (pseudorabies vires,prv) UL41 (VHS), PCR UL41 1174 bp, p GEX2KG GST, BL21 (DE3)
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΠΩΣ Η ΚΑΤΑΝΑΛΩΣΗ ΦΡΟΥΤΩΝ ΚΑΙ ΛΑΧΑΝΙΚΩΝ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ Όνομα φοιτήτριας ΚΑΛΑΠΟΔΑ ΜΑΡΚΕΛΛΑ
Experimental Study of Dielectric Properties on Human Lung Tissue
32 2 2013 4 Chinese Journal of Biomedical Engineering Vol. 32 No. 2 April 2013 1 1* 2 1 300072 2 300052 Agilent 4294A 100 Hz ~ 100 MHz Cole-Cole 3 ~ 5 1. 6 ~ 3. 3 R α τ f c P < 0. 05 EIT R318 A 0258-8021
PrP C. PrP SC PrP. PrP. mrna
PrP C PrP SC PrP C PrP C PrP SC PrP C PrP SC PrP C PrP SC PrP PrP SC PrP SC PrP PrP SC PCR PCR mrna PrP PrP C RT-PCR PrP mrna PrP E-mail:zhaodm@ cau.edu.cn 1 SPF Ecoli DH 5α TRIZOL RNA Gibco dntpstakara
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΟΜΕΑΣ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ Υ ΑΤΙΚΩΝ & Ε ΑΦΙΚΩΝ ΠΟΡΩΝ ΕΠΙΒΑΡΥΝΣΗ ΜΕ ΒΑΡΕΑ ΜΕΤΑΛΛΑ Ε ΑΦΩΝ ΤΗΣ
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης
Τρίμηνη, ηλεκτρονική έκδοση του Τμήματος Νοσηλευτικής Α, Τεχνολογικό Εκπαιδευτικό Ίδρυμα Αθήνας _ΑΝΑΣΚΟΠΗΣΗ_ Πολυκανδριώτη Μαρία 1, Φούκα Γεωργία 2 1. Καθηγήτρια Εφαρμογών Νοσηλευτικής Α, ΤΕΙ Αθήνας 2.
Cloning of Stage2specific Gene Fragments in Rabbit Embryos
Chinese Journal of Zoology 2009,44 (4) :41 46 3 ( 271016 ; 100101 ; 236041) :, mrna ( Oryctolagus cuniculus domestica) 42, 5 NCBI EMBL, EMBL,, 8 16, : ;mrna ;; :Q132 :A :025023263 (2009) 04241206 Cloning
Antibacterial property of fabric treated with a fiber-reactive chitosan derivative
32 2 2011 2 Journal of Textile Research Vol. 32 No. 2 Fen. 2011 0253-9721 2011 02-0096-06 1 1 2 1. 201620 2. 201620 85% CTS N- HDCC HDCC N- NMA O- -N- NMA-HDCC HDCC NMA-HDCC 95% HDCC 100% 30 NMA-HDCC 85%
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
The RNA interference efficiency of glutathione S-transferases from Locusta migratoria manilensis
Chinese Journal of Applied Entomology 2011 48 4 820 825 * S - RNA 1 1 2 1 1** 1. 030006 2. 030006 Locusta migratoria manilensis Meyen GST GST 4 RNA dsrna dsrna Real time RT-PCR mrna 4 GST delta LmGSTd1
Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ
Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ Εργαςτήριο Γεωργικών Καταςκευών ΠΜΣ Ενεργειακά Συςτήματα και Ανανεώςιμεσ Πηγέσ Ενέργειασ Διδακτορική διατριβή Καιιηέξγεηα
Humanization of Ovarian Carcinoma Anti2idiotype Single2chain
ISSN 100727626 CN 1123870ΠQ 2002 8 Chinese Journal of Biochemistry and Molecular Biology 18 (4) :490 494 3,,,, (, 100044),, PCR, 6B11 ScFv, 6B11V L 2V H IgG1 CH3 (V L 2V H 2CH3), E coli BL21 (DE3) IPTG
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection