Chinese Journal of Biochemistry and Molecular Biology. ( OsSUT2) 6314 kd, E2mail : edu. cn
|
|
- Τάκης Ελευθεριάδης
- 8 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (6) : ( OsSUT2),,,,, (, ) Expression of a Fusion Protein Containing Non2transmembrane Region for Rice Sucrose Transporter 2 ( OsSUT2) in E coli and Generation of Its Polyclonal Antibody ZHAO Wei, WANG Xin2Sheng, LI Xiao2Rong, CHENG Wei,CHEN Xing, WANG Ying2Dian 3 ( College of Life Sciences, Beijing Normal University, Beijing , China) Abstract Sucrose transporter is a functional protein family related to the sucrose transportation and signal transduction in plants Using DNA recombination technology, it was prepared the specific antibody of rice sucrose transporter (OsSUT2) based on its typical sequence of hydrophilic non2transmembrane to provide efficient molecular tool in the research on the physiological function of this protein The cdna sequences of the hydrophilic non2transmembrane region of central loop (CL) and TACL ( Transmembrane and Apoplast regions and CL) of OsSUT2 were sub2cloned into the fusion expression vector pqe40 having dihydrofolate reductase (DHFR) to construct recombinant plasmid pqe402ossut22cl and pqe402 OsSUT22TACL, respectively The pqe402ossut22cl can be highly expressed in E coli M15, especially in E coli BL21 plyss However, the pqe402ossut22tacl cannot be expressed in E coli M15 DHFR2OsSUT22CL purified with SDS2PAGE gel was injected into rabbit to obtain the produce antiserum The specificity of obtained antibody was tested by Western blotting It was indicated that the raised antibody can specifically identify OsSUT2, and it can be efficiently used in the research on the physiological function of OsSUT2 Key words rice sucrose transporter 2, fusion protein, prokaryotic expression, antibody Q78,S (SUT1) Π, 4 (SUT4) [1 ] 2 (SUT2) [6 ] SUT2 (OsSUT2) [2 ] ( sucrose transporter, SUT) 6314 kd, 80, SUT, [3 5 ] : , : (No ), 12, 3 Tel : ; : E2mail edu cn 6 6 Received : January 25,2005 ;Accepted : March 31,2005 Supported by National Natural Science Foundation of China (No ), 3 : Π 595, 3 Corresponding author Tel : Tel : ; Fax : E2mail : edu cn
2 6 : (OsSUT2) 847 [7 ],, SUT p GEM2T2easy p GEX, SUT ( Bgl Nde [6,8 ], Sal Xho ) T4 DNA, Promega ;Pyrobest Taq DNA TaKaRa ; PCR OsSUT2 ; 2D2, ( IPTG) SIGMA ; OsSUT2, ; OsSUT2, ; (NC ) Western, Amersham Pharmacia ; Western OsSUT2 Blotting ; pqe40 E coli M15 QIAGEN, E coli BL21plysS OsSUT22TACL (204,, E coli DH5 112 OsSUT2 OsSUT2, OsSUT22CL (83, 8 kd) OsSUT22CL 22 kd) cdna (Fig 1) Fig 1 The predicted structure models of OsSUT2, OsSUT22CL and OsSUT22TACL OsSUT2 contains 12 transmembrane domains indicated with columns and an extra central loop indicated with CL ; OsSUT22TACL contains an central loop, two transmembrane domains indicated with TM and two regions outside cell indicated with AL pqe40 OsSUT2 (DHFR),, OsSUT22CL OsSUT22TACL cdna pqe40, pqe402ossut22cl pqe402 OsSUT22TACL, OsSUT22CL cdna pqe402ossut22cl : 5 2 p GEX, GST2OsSUT22CL 113 OsSUT2 pqe40 p GEX, GG AGATCT GAGATCCCGCTGGAACCA23,
3 5 2GG GTCGACTCAATGCCTCATGCTAGTCAA23, [9 Bgl Sal ; ] pqe402ossut22tacl : GG AGATCT TGGATGGCTGTTGGAAACGT2 3, 5 2GG GTCGAC TCATAGCAAACC AAATGCACCTT23, Bgl DHFR2OsSUT22CL, Sal ; p GEX2OsSUT22 CL : 5 2GGCATATG GAGATCCCG CTGGAACCA23, 5 2GG CTCGAGTCAATGCCTCATGCTA GTCAA23, ( ELISA) Nde Xho, , 114 pqe402ossut22cl pqe402ossut22 TACL pgex2ossut2 2CL 100 mg 6 d RNA,, 100 l (50 mmolπl OsSUT2 OsSUT22CL OsSUT22TACL Tris2HCl, 5 mmolπl EDTA, 5 mmolπl Na2 p GEM2T2easy, diethyldithiocarbamate, 1 mmolπl NaHSO 3, 100 gπml DH 5 PMSF, ph 810), rπmin 15 min, DNA, Bgl Sal, 100 g pqe40,, 12 % SDS2PAGE,200 ma pqe402ossut22cl pqe402ossut22tacl, NC (4,1 h) 115 % p GEX2OsSUT22CL 3 % PBST ( + 10 % M15 BL21 plyss, Tween 20,pH 712) 1 h GST2OsSUT22CL 115 NC 1 h,pbst pqe402ossut22cl pqe402ossut22 IgG 1 h,pbst 5 min 3,BCIPΠNBT TACL M15 BL21 plyss ( Π ) 4, 5 ml LB 10 min ( 100 mgπl ), LB ( 100 mgπl ), rπmin 3 4 h, A , IPTG 1 mmolπl, rπmin 4 h 1 ml (2 000 g 5 min), Bgl Sal Fig 2 SDS2PAGE,12 % SDS2PAGE, pqe402ossut22cl 250 bp, ImageMasterR VDS, pqe402ossut22tacl 600 bp DE (Amersham Pharmacia) DNA, OsSUT22CL p GEX2OsSUT22CL OsSUT22TACL, DHFR BL21 plyss 37, 300 rπmin 4 p GEX2OsSUT22CL h, 12 % SDS2PAGE, DNA, Nde Xho, 250 bp GST2OsSUT22CL, GST2 ( Fig 2) DNA, OsSUT22CL, 5 mgπl h, pqe402ossut22cl BL21 plyss 12 % SDS2PAGE,, mgπ, 10 d 117 Westhern, pqe402ossut22cl pqe402ossut22tacl DNA, 1 % GST OsSUT22CL
4 6 : (OsSUT2) 849 Fig 2 Restriction analysis of the vectors pqe402ossut22cl, pqe2 OsSUT22TACL and pgex2ossut22cl 1 : DNA marker ; 2 : pqe402ossut22cl digested by Bgl and Sal ; 3 : pqe402ossut22tacl digested by Bgl and Sal ; 4 : p GEX2OsSUT22TACL digested by Nde and Xho Arrowheads indicate the products digested by enzymes Digested products were separated on 1 % agarose gel (Fig 3) 212 D HFR2OsSUT22CL, D HFR2OsSUT22TACL pqe402ossut22cl BL21 plyss GST2OsSUT22CL, 1 mmolπl IPTG pqe402ossut22cl M15 DHFR2 OsSUT22CL pqe402ossut22 TACL M15, 37, BL21 plyss DHFR2OsSUT2 2CL 28, 1 mmolπl IPTG (Fig 4A), Fig 3 37, DHFR2OsSUT22CL M15 pqe402ossut22cl M15 12 %, BL21 plyss, 34 kd, 31 % Fig 4B,p GEX2, pqe402ossut22tacl M15 OsSUT22CL BL21 plyss, (48 kd) GST2OsSUT22CL, 28, pqe402 Fig 3 Expression of DHFR2OsSUT22CL and DHFR2OsSUT22TACL Induced by IPTG in E coli M15 1 : Standard protein ; 2 : DHFR2OsSUT22TACL uninduced by IPTG at 37 ; 3 : DHFR2OsSUT22TACL induced by IPTG at 37 ; 4 : DHFR2 OsSUT22TACL uninduced by IPTG at 28 ; 5 : DHFR2OsSUT22TACL induced by IPTG at 28 ; 6 : DHFR2OsSUT22CL uninduced by IPTG at 37 ; 7 : DHFR2OsSUT22CL induced by IPTG at 37 Arrowhead indicates DHFR2OsSUT22CL The 100 g per lane of total protein was separated on 12 % SDS2PAGE OsSUT22TACL M15 Fig 4 Expression of DHFR2OsSUT22CL and GST2OsSUT22CL Induced by IPTG in E coli BL21 plyss and E coli M15 (A) 1 : Standard protein ; 2 : DHFR2OsSUT22CL in BL21 plyss uninduced ; 3 : DHFR2OsSUT22CL in BL21 plyss induced by IPTGfor 4 hours ; 4 : DHFR2OsSUT22CL in M15 uninduced ; 5 : DHFR2OsSUT22CL in M15 induced by IPTGfor 4 hours (B) 1 : Standard protein ; 2 : GST2OsSUT22CL in BL21 plyss uninduced ; 3 : GST2OsSUT22CL in BL21 plyss induced by IPTGfor 4 hours Arrowheads indicate DHFR2OsSUT22CL and GST2OsSUT22CL, respectively Total protein of 100 g per lane was separated on 12 % SDS2PAGE Standard protein is given at the left
5 OsSUT2,, 12 % SDS2PAGE NC,, Fig 5, OsSUT2,, 64 kd, OsSUT2,, GST2OsSUT22CL M15, DHFR2OsSUT22CL,64 kd (Fig15) Fig 5 The specificity analysis on the anti2ossut2 serum by Western blotting 1 : Incubation with pre2immune serum ; 2 : Incubation with anti2ossut2 serum ; 3 : Incubation with anti2ossut2 serum pretreated by 5 mgπl GST2 OsSUT22CL Arrowhead indicates the objective band of OsSUT2 Total protein of 100 g per lane, which was extracted from the rice caryopses at the 6th day after heading, was separated on 12 % SDS2PAGE 3,Western,,, OsSUT2 (Fig 5) GST2OsSUT22CL,OsSUT22CL,, OsSUT2, OsSUT2 ( ),, ( E coli) OsSUT2, ( References),, OsSUT2,,, DHFR2OsSUT22TACL,, DHFR2OsSUT22 TACL (Fig 3), OsSUT2,,, OsSUT2,, DHFR2 OsSUT22CL, M15 12 %, BL21 plyss, 31 % ( Fig 4), BL21 plyss DHFR2OsSUT22CL BL21 plyss T7, [10, ], DHFR2OsSUT22CL 1 Sheen J, Zhou L, Jyun2Chyun J Sugars as signaling molecules Curr Opin Plant Biol, 1999, 2 : Chiou T, Bush D R Sucrose is a signal molecule in assimilate partitioning Proc Natl Acad Sci USA, 1998, 95 : Riesmeier J W, Willmitzer L, Frommer W B Evidence for an essential role of the sucrose transporter in phloem loading and assimilate partitioning EMBO J, 1994, 13 : 1 7
6 6 : (OsSUT2) Lalonde S, Boles E, Hellmann H, Barker L, Patrick J W, Frommer W B,Ward J M The dual function of sugar carriers : transport and sugar sensing Plant Cell, 1999, 11 : K hn C, Hajirezaei M R, Fernie A R, Tunali U R, Czechowski T, Hirner B, Frommer W B The sucrose transporter StSUT1 localizes to sieve elements in potato tuber phloem and influences tuber physiology and development Plant Physiol, 2003, 131 : Barker L, K hn C, Weise A, Schulz A, Gebhardt C, Hirner B, Hellmann H, Schulze W, Ward J M, Frommer W B SUT2, a putative sucrose sensor in sieve elements Plant Cell, 2000, 12 : Rico L, Dieter L Strategies for prokaryotic expression of eukaryotic membrane proteins Traffic, 2001, 2 : Weise A, Barker L, K hn C, Lalonde S, Buschmann H, Frommer W B, Ward J M New subfamily of sucrose transporters, SUT4, with low affinityπhigh capacity localized in enucleate sieve elements of plants Plant Cell, 2000, 12 : Chiristian K, Ruth S, Norbert S, Gertrud L AmSUT1, a sucrose transporter in collection and transport phloem of the putative symplastic phloem loader Alonsoa meridionalis 214 Plant Physiol, 2004, 134 : ,,, ( Shen Yi2Jun, Yao Jian2Er, Yi Jin2Hua, Su Yong Advance in high density cultivation of recombinant E coli Pharm Biotechnol),2000, 7 (4) : H Science, 3,, H CFH,,CFH, CFH,CFH,,, CFH, CFH, CFH, CFH 7 1,,1 CFH CFH 3, CFH,,,,,,3 3,, CFH CFH,, CFH, CFH CFH, CFH ( N Seppa : Science News,March 12,2005,Vol 167,p 163)
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Angioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Journal of the CUN(Natural Sciences Edition) ...
2007 2 16 1 ( ) Journal of the CUN(Natural Sciences Edition) Feb. 2007 Vol. 16 No. 1 1,2, 1, 1, 2 (11, 100081 ; 21, 100875) :. 2,42D NAA 62BA.,.. : ; ; ; :Q94513 :A :100528036 (2007) 0120023206 : (1),
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
CK2, Basic Medical Sciences and Clinics (4) ( Π ) pt727 ( CIP), (TSR) 6 ( POP6) ( IPTG),, A,
392 Basic Medical Sciences and Clinics 2003123 (4) : 100126325 ( 2003) 0420392207 CK2 1 # 2, #, 1 1, 3 1, ( 11 ; 21, 524023) : PCR NIH 3T3 CK2 cdna ; CK2, CK2 cdna, CK2 cdna BL21 (DE3), 26kDa, 3117 %,
Molecular Cloning of MUC1ΠY and Soluble Expression of Its
ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :579 584 MUC1ΠY, 3, ( 100039) MUC1ΠY cdna, RT2PCR HeLa MUC1ΠY cdna ;PCR, p GEX22T DH5a ; ; GST N ; MUC1ΠY
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1
ISSN 100727626 CN 1123870ΠQ 2005 10 Chinese Journal of Biochemistry and Molecular Biology 21 (5) :656 660 I2 ERR 1,,,,, (, 400038) 3 1 ( ERR 1) I2 (TNNI2) TNNI2 ERR 1, GST2TNNI2, 35 S ERR 1, GST,TNNI2
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
A summation formula ramified with hypergeometric function and involving recurrence relation
South Asian Journal of Mathematics 017, Vol. 7 ( 1): 1 4 www.sajm-online.com ISSN 51-151 RESEARCH ARTICLE A summation formula ramified with hypergeometric function and involving recurrence relation Salahuddin
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Chinese Journal of Biochemistry and Molecular Biology CK2 252
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 9 24 (9) :826 832 CK2 252 1) 3 3, 1),2) 3 3, 1),2) 3, 1) ( 1), 524023 ; 2), 523808) CK2 Π. CK2, pact2 cdna CK2. CK2,
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Introduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil
8 7 011 7 Journal of Highway and Transportation Research and Development Vol. 8 No. 7 Jul. 011 100-068 011 07-0014 - 05 1 1. 0009. 710064 k 0 Merchant 4 Merchant U416. 1 + 6 A Stress Relaxation Test and
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Supplementary Information for
Supplentary Information for Aggregation induced blue-shifted ission molecular picture from QM/MM study Qunyan Wu, a Tian Zhang, a Qian Peng,* b Dong Wang, a and Zhigang Shuai* a a Key Loratory of Organic
Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Preparation and Characterization of a Novel Recombinant Imaging Agent Directing Thrombus
ISSN 100727626 CN 1123870ΠQ 2001 12 Chinese Journal of Biochemistry and Molecular Biology 17 (6) :781 785,,,, (, 100871) 3 2 GMP2140 SZ51, 1 SZ51 (ScFv2SZ51) 1 (MT2 ) cdna, BL21 (DE3) plyss, HLMT 40 mgπl
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]
212 2 ( 4 252 ) No.2 in 212 (Total No.252 Vol.4) doi 1.3969/j.issn.1673-7237.212.2.16 STANDARD & TESTING 1 2 2 (1. 2184 2. 2184) CensusX12 ARMA ARMA TU111.19 A 1673-7237(212)2-55-5 Time Series Analysis
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
SUPPORTING INFORMATION
SUPPRTING INFRMATIN Per(-guanidino--deoxy)cyclodextrins: Synthesis, characterisation and binding behaviour toward selected small molecules and DNA. Nikolaos Mourtzis, a Kyriaki Eliadou, a Chrysie Aggelidou,
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Design and Fabrication of Water Heater with Electromagnetic Induction Heating
U Kamphaengsean Acad. J. Vol. 7, No. 2, 2009, Pages 48-60 ก 7 2 2552 ก ก กก ก Design and Fabrication of Water Heater with Electromagnetic Induction Heating 1* Geerapong Srivichai 1* ABSTRACT The purpose
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ
1 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 04.02.2014 Αρ. πρωτ. 1054 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Chinese Journal of Biochemistry and Molecular Biology. (growth inhibitory factor,gif, 2Sepharose 4B PC12,
ISSN 100727626 CN 1123870ΠQ 2004 8 Chinese Journal of Biochemistry and Molecular Biology 20 (4) :534539 G Rab3a ( GIF) 1) 1) 1) 2) 1) 3,,,, ( 1), 100871 ; 2), 225009) G Rab3a (growth inhibitory factor,gif,
Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn
2015 11 Nov 2015 36 6 Journal of Zhengzhou University Engineering Science Vol 36 No 6 1671-6833 2015 06-0056 - 05 C 1 1 2 2 1 450001 2 461000 C FCM FCM MIA MDC MDC MIA I FCM c FCM m FCM C TP18 A doi 10
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x - 2 - orfh79
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com orfh79 1 2 1 1 2 1 2 2 1. / 330031 2. / 430072 orfh79 orfh79 pet - 28a - orfh79
Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
ΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY
10 ο COMECAP 2010, Πρακτικά Συνεδρίου, Πάτρα 10 th COMECAP 2010, Proceedings, Patras, Greece ΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY ΥΧΡΟΥΡΟΝΗΚΖ ΓΗΑΚΤΜΑΝΖ ΣΧΝ ΖΛΔΚΣΡΗΚΧΝ ΔΚΚΔΝΧΔΧΝ ΣΖΝ ΔΛΛΑΓΑ ΓΗΑ ΣΖΝ ΥΡΟΝΗΚΖ ΠΔΡΗΟΓΟ 1998-2007
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Lecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3
Lecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3 1 State vector space and the dual space Space of wavefunctions The space of wavefunctions is the set of all
Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE
2011 33 5 0993-0998 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Ara h 2 1 2 3 4 5 6 2 4* 2 4* 1. 518060 2. 518060 3. 830000 4. 518060 5. 518045
ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΓΕΩΠΟΝΙΑΣ, ΔΑΣΟΛΟΓΙΑΣ ΚΑΙ ΦΥΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ ΤΟΜΕΑΣ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ Πτυχιούχου Γεωπόνου Κατόχου Μεταπτυχιακού
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)
J. Comput. Chem. Jpn., Vol. 5, No. 1, pp. 29 38 (2006) Microsoft Excel, 184-8588 2-24-16 e-mail: yosimura@cc.tuat.ac.jp (Received: July 28, 2005; Accepted for publication: October 24, 2005; Published on
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land
J. Jpn. Soc. Soil Phys. No. 33, p.2/ 3.,**/ * * * ** Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land Tadashi ADACHI*, Yoko OKI*, Akihiro NAGAI* and Shogo NAKATSUKASA** * Faculty
http://doc.rero.ch To whom correspondence should be addressed: Dr. Beat Schwaller, Unit of Anatomy,
Published in "" which should be cited to refer to this work. Calretinin is essential for mesothelioma cell growth/survival in vitro: a potential new target for malignant mesothelioma therapy? Anatomy,
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΠΩΣ Η ΚΑΤΑΝΑΛΩΣΗ ΦΡΟΥΤΩΝ ΚΑΙ ΛΑΧΑΝΙΚΩΝ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ Όνομα φοιτήτριας ΚΑΛΑΠΟΔΑ ΜΑΡΚΕΛΛΑ
ect of Modified Wheat Starches on the Textural Properties of Baked Products, such as Cookies
224 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. // No. /. - (**2) 22 * * E# ect of Modified Wheat Starches on the Textural Properties of Baked Products such as Cookies Atsuko Higo and Yoshiko Wada* Bunkyo
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Research on Economics and Management
36 5 2015 5 Research on Economics and Management Vol. 36 No. 5 May 2015 490 490 F323. 9 A DOI:10.13502/j.cnki.issn1000-7636.2015.05.007 1000-7636 2015 05-0052 - 10 2008 836 70% 1. 2 2010 1 2 3 2015-03
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )
22 1 2002 1 Vol. 22 No. 1 Jan. 2002 Proceedings of the CSEE ν 2002 Chin. Soc. for Elec. Eng. :025828013 (2002) 0120017206 VSC 1, 1 2, (1., 310027 ; 2., 250061) STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL
Main source: "Discrete-time systems and computer control" by Α. ΣΚΟΔΡΑΣ ΨΗΦΙΑΚΟΣ ΕΛΕΓΧΟΣ ΔΙΑΛΕΞΗ 4 ΔΙΑΦΑΝΕΙΑ 1
Main source: "Discrete-time systems and computer control" by Α. ΣΚΟΔΡΑΣ ΨΗΦΙΑΚΟΣ ΕΛΕΓΧΟΣ ΔΙΑΛΕΞΗ 4 ΔΙΑΦΑΝΕΙΑ 1 A Brief History of Sampling Research 1915 - Edmund Taylor Whittaker (1873-1956) devised a
(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5
42 5 2002 10 Acta Microbiologica Sinica Vol. 42 October No. 5 2002 Ea ge 3 33 ( 430070) : ge,, ge, GS115, G418, ge, Western blotting 33kD ELISA, ge, : ge,,, :Q93914 :A :000126209 (2002) 0520543207 (Pseudorabies,PR),
*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Εφαρμογές της τεχνολογίας επίγειας σάρωσης Laser στις μεταφορές
Εφαρμογές της τεχνολογίας επίγειας σάρωσης Laser στις μεταφορές Ιουλία Μάρκου 1, Κωνσταντίνος Αντωνίου 12, Μαρία Τσακίρη 13 και Ανδρέας Γεωργόπουλος 14 1 Σχολή Αγρονόμων και Τοπογράφων Μηχανικών Εθνικό
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix algeriensis NRRL B-24137 and Biochemical Characterization of Two Pyrrothine N-Acyltransferases in This Extract.
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
«ΘΕΜΑΤΑ ΑΣΤΙΚΟΥ ΣΧΕΔΙΑΣΜΟΥ» ΔΙΔΑΣΚΟΥΣΕΣ: ΒΑΪΟΥ Ντ., ΜΑΝΤΟΥΒΑΛΟΥ Μ., ΜΑΥΡΙΔΟΥ Μ. «Gentrification Friendly» γειτονιές στο κέντρο της Αθήνας(;)
ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΑΡΧΙΤΕΚΤΟΝΩΝ ΜΗΧΑΝΙΚΩΝ Δ. Π. Μ. Σ.: ΑΡΧΙΤΕΚΤΟΝΙΚΗ ΣΧΕΔΙΑΣΜΟΣ ΤΟΥ ΧΩΡΟΥ ΚΑΤΕΥΘΥΝΣΗ Β : ΠΟΛΕΟΔΟΜΙΑ - ΧΩΡΟΤΑΞΙΑ «ΘΕΜΑΤΑ ΑΣΤΙΚΟΥ ΣΧΕΔΙΑΣΜΟΥ» ΔΙΔΑΣΚΟΥΣΕΣ: ΒΑΪΟΥ Ντ., ΜΑΝΤΟΥΒΑΛΟΥ
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ
ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.
Α.Τ.Ε.Ι. ΚΡΗΤΗΣ Σ.Ε.Υ.Π. ΤΜΗΜΑ ΚΟΙΝΩΝΙΚΗΣ ΕΡΓΑΣΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Τίτλος: «Χρήση ψυχοτρόπων ουσιών από μαθητές Α Λυκείου της Δευτεροβάθμιας Εκπαίδευσης του Νομού Ηρακλείου και ο ρόλος του Κοινωνικού
SCITECH Volume 13, Issue 2 RESEARCH ORGANISATION Published online: March 29, 2018
Journal of rogressive Research in Mathematics(JRM) ISSN: 2395-028 SCITECH Volume 3, Issue 2 RESEARCH ORGANISATION ublished online: March 29, 208 Journal of rogressive Research in Mathematics www.scitecresearch.com/journals
Reading Order Detection for Text Layout Excluded by Image
19 5 JOURNAL OF CHINESE INFORMATION PROCESSING Vol119 No15 :1003-0077 - (2005) 05-0067 - 09 1, 1, 2 (11, 100871 ; 21IBM, 100027) :,,, PMRegion,, : ; ; ; ; :TP391112 :A Reading Order Detection for Text
: Monte Carlo EM 313, Louis (1982) EM, EM Newton-Raphson, /. EM, 2 Monte Carlo EM Newton-Raphson, Monte Carlo EM, Monte Carlo EM, /. 3, Monte Carlo EM
2008 6 Chinese Journal of Applied Probability and Statistics Vol.24 No.3 Jun. 2008 Monte Carlo EM 1,2 ( 1,, 200241; 2,, 310018) EM, E,,. Monte Carlo EM, EM E Monte Carlo,. EM, Monte Carlo EM,,,,. Newton-Raphson.
100102; 2. Fe Cu Hg. Rapid multi-elemental analysis on four precious Tibetan medicines based on LIBS technique
2015 6 40 11 Vol. 40 No. 11 June 2015 LIBS 4 1,2, 1,2, 1,2, 1,2, 1,2* 1,2*, ( 1., 100102; 2., 100102) LIBS 4 4 Nd YAG 1 064 nm NIST LIBS 4 Ca Na K Mg C-N Fe Cu Hg Ag LIBS 4 LIBS Rapid multi-elemental analysis
Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
Homomorphism of Intuitionistic Fuzzy Groups
International Mathematical Forum, Vol. 6, 20, no. 64, 369-378 Homomorphism o Intuitionistic Fuzz Groups P. K. Sharma Department o Mathematics, D..V. College Jalandhar Cit, Punjab, India pksharma@davjalandhar.com
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%