The Structure of Lecithin Cholesterol Acyltransferase( LCAT)

HTML
DOWNLOAD

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "The Structure of Lecithin Cholesterol Acyltransferase( LCAT)"

Λαύρα Αναγνώστου
8 χρόνια πριν
Προβολές:

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 18 (1) :64 69 cdna,, 3,,, 1) (, ) (LCAT) cdna, mrna cdna, SMART2 RACE, LCAT cdna, LCAT cdna ( GenBank AF324887) bp, bp 451, LCAT C 12, 98 % 83 % 82 % LCAT, LCAT,,, cdna Q751,Q55 The Structure of Lecithin Cholesterol Acyltransferase( LCAT) : , : , (No ),, ,, 3 Tel : , E2mail com 1), Received :April 2,2001 ; Accepted :May 28,2001 Supported by the National Scaling for Heights Program and National Natural Sciences Foundation of China (No ) 3 Corresponding author Tel : , E2mail : com cd NA and Its Protein from Beijing Duck ZENG Wu2wei, ZHANGJian 3 3, CHEN Bao2sheng 3, WU Gang, ZHANG Ke2man, XUE Hong ( Department of Biochemistry and Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, School of Basic Medical Sciences, Perking Union Medical College, National Laboratory of Medical Molecular Biology, Beijing , China) Abstract To obtain the nucleotide sequence and deduced amino acid sequence of lecithin cholesterol acyl2 transferase (LCAT) cdna from Beijing Duck, one kind of anti2atherosclerosis animals The sequence of leci2 thin :cholesterol acyltransferase cdna from Beijing Duck was obtained by utilizing the technique of SMART (Switching Mechanism At 5 end of RNA Transcript) and RACE( Rapid Amplification of cdna End) from the first strand of cdna The amino acid sequence of Beijing Duck LCAT was deduced from this cdna and its primary and secondary structures were predicted by using softwares for molecular biology The cdna sequence of lecithin cholesterol acyltransferase from Beijing Duck covered bp, including a bp fragment in an open reading frame (ORF) as well as 1bp and 596 bp at 5 and 3 of the untranslated regions respectively The ORF encoded 451 amino acids(aa) precuser, which contained a hydrophobic signal peptide of 23 amino acids and a mature peptide of 428 amino acids Comparing and aligning this amino acid sequence of LCAT with those of other published animals, it revealed that the mature protein had more 12 amino acids than that of the human, baboon and rabbit The homology among Beijing Duck and chicken, human, rabbit LCAT were

2 1 : cdna %, 83 % and 82 % at protein level,respectively The amino acid residues concerned with the catalytic ac2 tivity were highly conserved The cdna sequence of LCAT from Beijing Duck was registered at GenBank with the accession number of AF Although the amino acid sequence of Beijing Duck LCAT has some differ2 ence from that of other species, the regions which are important to function of LCAT are highly preserved Key words Beijing Duck,lecithin cholesterol acyltransferase (LCAT),cDNA and protein Superscript 200U h,, (high den2 cdna sity lipoprotein,hdl), %, (lecithin chol2 LCAT cdna, 2 esterol acyltransferase,lcat) B1 B2, cdna, 1 [1 ] 1 kb GenBank Blast LCAT LCAT cdna HDL, 1 kb B3 B6, LCAT, LCAT cdna 5 2UTR,LCAT CDS, B4 B5, B3 B4, B5 B6, 1 kb 600 [2 ] bp 2, Blast, 2, LCAT cdna 3 5 [3 ] apoai, apoai LCAT 1 111,, GenBank Blast,, ;MMLV Superscript LCAT cdna GIBCO BRL ; RACE2PCR GenBank Clontech 5 SMART :5 2AAGCAGTG2 GTAACAACGCAGAGTACGCGGG23 ; 3 LCAT cdna CDS 5 2 ATTCTAgAggCCgAggCggCCgACATg2d (T) 30 N 1 N B1 :5 2gAAgCCAAA(g) CTggA2 CAAg(A) CC23, B2 :5 2gTTgCTgAAgACCATgTTgAg23 ; 2 B3 : 5 2gAggATggCTggTACATgTgg2 3,B4 : 5 2ATTCTAgAggCCgAggCggC23 ; LCAT cdna B5 :5 2CAC(g) gaggcacca ( T) gggctgg23,b6 :5 2 gtgcatctcctctatcagtgc LCAT cdna bp 1 ATG Trizol 23, + 4 ( 1 0 g) RNA, Oligo (dt)2 G, mrna 2 g mrna, CDS 3, SMART 5, MMLV LCAT cdna,, 3, LCAT cdna 113 LCAT cdna LCAT cdna 114 LCAT DNAMANPCGENE,, 2 LCAT cdna bp, bp,5 1 bp, cdna TGA, 3 poly (A) 17 bp poly (A)

3 66 18 AATAAA(Fig 1) LCAT cdna 3 2UTR, LCAT cdna 212 LCAT 500 Blast, LCAT cdna LCAT cdna 1 23, 92 % 85 % 85 % 83 % 81 % 80 % cdna LCAT cdna cdna LCAT 451, SignalP Server [4 ],

4 1 : cdna 67 Fig 1 The nucleotide sequence and its deduced amino acid sequence of Beijing Duck LCAT cdna, LCAT Table 1 The comparison of amino acids composition between LCAT Beijing Duck and human LCAT Table 1, LCAT 5 Cys, 2 4, 1 Cys31, LCAT 6 Cys, 2 LCAT Cys184 LCAT Asp Pro, LCAT C Pro, Pro, LCAT C 12, Pro,, C Glu401, LCAT, Ile390, Ser383 Gly374 LCAT [6 ], LCAT C, LCAT Amino acid LCAT, 98 %, 83 % 82 % 82 % 80 % 81 % LCAT Fig 2 Beijing duck Number molπmol ( %) Human Number molπmol ( %) A Ala C Cys D Asp E Glu F Phe G Gly H His I Ile K Lys L Leu M MET N Asn P Pro Q Gln R Arg S Ser T Thr V Val W Trp Y Tyr

5 68 18 Fig 2 Alignment of amino acid sequences of Beijing duck and other animals LCAT 3 LCAT,,,lids,LCAT sn2 Acyl2, 3 2OH,,, HDL LCAT,, LCAT HDL apoai LCAT Cys502Cys74, Try61 [6 ] LCAT LCAT LCAT Cys502Cys74, 5 (familial LCAT deficiency, FLD), (fish2eye dis2, [7 ease, FED), ] LCAT Cys502Cys74,LCAT, :Asp345 His377 Ser181,LCAT motif, GXSXG, LCAT AHS 3 MG, [8, ] Ala (A) Gly( G),, LCAT, LCAT motif LCAT C 12, (VFLIAHS 3 MGNLNVLYFLL) [10, ] Cys502Cys74 Ser1812Asp3452His377 LCAT 5 Cys, Ser181 4 Cys Cys50 Cys74, Cys313 Cys N2 (Asn20, 84, ) [9 ] LCAT lids,lids,, 2, LCAT 2 Cys

6 1 : cdna 69 LCAT 6 Cys, 2 LCAT 4 Cys, 2, 2 LCAT Cys LCAT 1 (Cys184), LCAT, 2 Cys LCAT [10 ], LCAT LCAT, 2 Cys, [7 2 Cys ] 3,, AI cdna, LCAT 4 N2 (Asn2X2SerΠ Thr,20,84,272,384), 1 (Asn272) LCAT [10 ], LCAT 2 O2 (Thr407 Ser409), LCAT 2, LCAT C2 Gly401 LCAT [5 ], LCAT C2 2 O2, LCAT cdna, LCAT cdna, LCAT LCAT,,LCAT,LCAT LCAT, ( References) 1 Wang K Q, Chen B S, Xie Y H, Hao Q L, Li Z G Are tree shrews and Beijing ducks good models for the study of the antiatherogeniety HDL? In : Woodford F P, Davignon J Sniderman A eds Atherosclero2 sis X, Amsterdam : EI Sevier Press, 1995 ec Fielding C J, Fielding P E Molecular physiology of reverse cholesterol transport J Lipid Res, 1995, 36 : (L Xin2yue,Chen Bao2 sheng Wang Ke2qin Clone and tissue expression of Beijing Duck apoli2 poprotein AI cdna Chin J Biochem Mol Biol),1998,14(5) : Nielsen H, Engelbrecht J, Brunak S, von Heijne G Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleav2 age sites Protein Engineering, 1997,10 : Lee Y P, Adimoolam S, Liu M, Subbaiah P V, Glenn K, Jonas A Analysis of human lecithin2cholesterol acyltransferase activity by carbox2 yl2terminal truncation Biochim Biophys Acta, 1997,1344 : McLean J, Fielding C, Drayna D, Dieplinger H, Baer B, Kohr W, Henzel W, Lawn R Cloning and expression of human lecithin2choles2 terol acyltransferase cdna 2339 Proc Natl Acad Sci USA, 1986, 83 : Kuivenhoven J A, Pritchard H, Hill J, Frohlich J, Assmann G, Kaste2 lein J The molecular pathology of lecithin cholesterol acyltransferrrase (LCAT) deficiency syndromes J Lipid Res, 1997, 38 : Peelman F, Vanloo B, Perez2Mendez O, Decout A, Verschelde JL, Labeur C, Vinaimont N, Verhee A, Duverger N, Brasseur R, Vandekerckhove J, Tavernier J, Rosseneu M Characterization of func2 tional residues in the interfacial recognition domain of lecithin cholesterol acyltransferase (LCAT) Protein Engineering, 1999, 12 (1) : Jonas A Lecithin cholesterol acyltransferase Biochim Biophys Acta, 2000,1529(123) : Hengstschlager2Ottnad E, Kuchler K, Schneider W J Chicken lecithin cholesterol acyltransferase J Biol Chem,1995, 270(44) :

Σχετικά έγγραφα

Malgorzata Korycka-Machala, Marcin Nowosielski, Aneta Kuron, Sebastian Rykowski, Agnieszka Olejniczak, Marcin Hoffmann and Jaroslaw Dziadek

Malgorzata Korycka-Machala, Marcin Nowosielski, Aneta Kuron, Sebastian Rykowski, Agnieszka Olejniczak, Marcin Hoffmann and Jaroslaw Dziadek Molecules 2017, 21, 154; doi:10.3390/molecules22010154 Supplementary Materials: Naphthalimides Selectively Inhibit the Activity of Bacterial, Replicative DNA Ligases and Display Bactericidal Effect against