20 % 30 %, 25 % 50 %,, 2 1,32. (endo 21,42xyla2 nase, EC ) ( 21,42xylosidase,EC ), ( 2L2arabinofuranosidase, EC ( 2D2glucuronidase, EC
|
|
- Νανα Κομνηνός
- 8 χρόνια πριν
- Προβολές:
Transcript
1 Chinese Journal of Biotechnology Vol. 20 No. 4 July , ,2 3 1 (, ) 2 (, ) 2, Thermotoga maritima, Thermotoga T. maritima 2, AGA AGGAUA, BL212CodonPlus(DE3)2RIL, 20 % 5 ; Ni 2 +,, 511, 5511 %, TB, OD IPTG 5h, 2,,, Q814 A (2004) , 517, 42O2, 20 %30 %, [1 ] 25 %50 %,, 2, 21,4, 1,32 1,2242O2, [1,5, ],,, 2 [2 ] (endo 21,42xyla2 Thermotoga maritima nase, EC ),, , [6-10 ] ( 21,42xylosidase,EC ),,, ( 2L2arabinofuranosidase, EC ) 2D2 ( 2D2glucuronidase, EC ) ( EC ) [3,4 ], : , : : Tel : ; Fax : ; wl. wx. jsinfo. net 3 3 :Tel : ;Fax : ,,
2 4 : 2 555,, T. maritima : 015 %, 80,, 8h xynb : DNA DNA [7-10 ] agua,, DNA, 2, [ 11 ] DNA T7 pet, Qiagen,T. maritima PCR agua : Gen2, BL212CodonPlus Bank agua,n (5 2 (DE3)2RIL agua,ccgttccatggactacaggatgtgc23 ) 2 Nco, C ( 5 2CCGCTCGAGCG2, GATATATCTTTCTTCCCTT23 ) Xho ; 94 50s, min, : T. maritima 3 min, min, ATCC43589, E. coli JM109 JM109 ( DE3 ) Promega ( Wisconsin, WI, USA), pet228a ( + ) pet220b E. coli BL21 (DE3) BL212CodonPlus (DE3)2RIL Novagen : Xho, Nco, T4 DNA Pyrobest DNA, DNA : Sanger,,Rapid Affinity Purification Kit Novagen ; K IPTG ; : O2 2D2 21,42 pet228a ( + )2aguA BL212CodonPlus Sigma ; QIAprep Spin Plasmid Miniprep Kit QIAquick Gel Extraction Kit,37 ;500 L Qiagen 011 g, ( [6,10 ] ) 15 ml, ph Na 2 S 015 gπl, 100 ml 42O2MeGlcA,,, PCR : 95 5min, Pyrobest DNA : PCR pet228a ( + ) Nco Xho,T4, pet228a ( + )2aguA pet228a ( + )2aguA agua Nco Xho, pet220b, pet220b2agua (DE3)2RIL, Kna Cam LB 100 ml Kna Cam LB, OD , IPTG : LB 1mmolΠL, agua TB, SOC, ; IPTG : (Amp ) mmolΠL, 5h, agua gπml, ( Kna) 30gΠmL, (Cam) 60gΠmL, [11 ] ( [ 10, T. maritima ( 12]) : 2 42O2 ) : 015 g, ( resazurin) 1mg, 2 % 42O2 2D2 NaCl 28 g, MgSO 4 7H 2 O 315 g, MgCl 2 6H 2 O 217 g, 0105 mgπml 21,42,55 KCl 0133 g, NH 4 Cl 0125 g, CaCl g, 16 h, 50 15, - 20 MeGlcAX 2,
3 [13,, (Sigma Inc. ) ] 10min,,620nm agua 1mol PCR,2 kb agua 2 ph pet228a ( + )2aguA Sanger, min ph ph mmolπl Tris2,pH 815, mmolπl Tris2HCl ph 517 Tris2 5min ; 55,65,75,85,95 1 h(ph 517 Tris2 ), (1) : pet228 ( + )2aguA E. coli BL212CodonPlus(DE3)2RIL, 1 % 015 % 1 %NaCl pet228a ( + )2aguAΠNco, Xho ; 6 : PCR amplified fragments % Kna % Cam, , 200rΠmin, % ml Kna pet220b2agua Nco Xho Cam LB 1L 37,, 5 pet228a ( + )2aguA 220 rπmin OD IPTG, Nco Xho 018 mmolπl, 4 h,4,5 000 g PCR ( 20 min 1), agua pet220b (2) : pet228a ( + ) (5mmolΠL 20mmolΠL Hris2HCl, ph 719), ( French Pressure,Thermo), g 20 min, min,9 600 g 30 min, (3) Ni 2 + : 0145m (Novagen) (116cm 2cm), (60mmolΠL 20mmolΠL Tris2HCl, ph 719), (1molΠL 20 mmolπl Tris2HCl, ph 719), 015 mlπmin, 1 ml, 3,SDS2 PAGE SDS2PAGE : 12 %, R250, FR200 Fig. 2 Construction of plasmid pet220b2agua : Bradford and pet228a ( + )2aguA 2 ph, ph 40 PCR [10 ] 1 DNA Fig. 1 Agarose gel electrophoresis of DNA 1 : 2 EcoT141 digeast DNA marker ; 2 : pet220bπnco, Xho ; 3 : pet220b2aguaπnco, Xho ;4 :pet228a ( + )ΠNco, Xho ; 5 : 2
4 4 : agua 214 BL212CodonPlus ( DE3) 2RILΠpET228a pet220b2agua pet228a ( + )2 agua JM109 (DE3) BL21 (DE3) BL212CodonPlus(DE3)2RIL, IPTG, (DE3)2RILΠpET228a ( + )2aguA,, SDS2 LB ( PAGE( 12 %), 4), 12 h 3, agua, OD 600,5 h, pet220b,, OD 600 pet228a ( + ), LB 1, JM109 (DE3) BL21 (DE3),TB pet228a ( + )2aguA BL212CodonPlus (DE3)2RIL, 72kD, ; ( 1), T. Maritima 5, 10 [10 ], AguA 20 %, agua pet228a ( + ) 3 SDS2PAGE Fig. 3 SDS2polyacrylamide gel (12 %) of 2glucuronidase after induced expression 1 :molecular mass markers ; 2 : E. coli BL212CodonPlus (DE3) 2 RILΠpET228a ( + ) ; 3 : E. coli JM109 (DE3)ΠpET228a ( + )2 agua ; 4 : E. coli BL21 (DE3)ΠpET228a ( + )2aguA ; 5 : E. coli BL212CodonPlus ( DE3)2RILΠpET228a ( + )2aguA ; 6 : purified products; 7 : E. coli BL212CodonPlus ( DE3 ) 2RILΠpTrc99A2 agua ; 8 : E. coli BL212CodonPlus(DE3) 2RIL ΠpET220b2aguA IPTG, 1 2 Table 1 Analysis of 2glucuronidase from engineered strain Expressed product Enzyme activity Π(uΠmg) BL212CodonPlus(DE3) 2RILΠpET228a( +) BL212CodonPlus(DE3) 2RILΠpET228a( +)2aguA Wild strain ( + )2aguA BL212CodonPlus 4 BL212CodonPlus(DE3) 2RILΠ pet228a ( + )2aguA Fig. 4 Growth curve of recombinant BL212CodonPlus (DE3)2RILΠpET228a ( + )2aguA 5a,, IPTG 5 h,,,, OD , IPTG, 5 h, 5b,IPTGOD , OD ,, OD , ( 2), OD IPTG BL212CodonPlus ( DE3) 2 RIL ΠpET228a ( + )2aguA, 70 20min, 0145m Poly2His,SDS2PAGE,, 90 %,, ( 6)
5 Fig. 5 The optimum induction conditions of the expression of the recombinant enzyme A :effect of induction duration on the synthesis of 2glucuronidase ; B : effect of induction time on the synthesis of 2glucuronidase 2 Table 2 Effect of induction time on the synthesis of 2glucuronidase No. OD 600 a OD 600 b Enzyme activityπ(uπml) Specific activityπ(uπmg) a :cell density before induction ; b : cell density in the end of induction 610, 85, 85 1h 70 % NaCl SDS2PAGE, NaCl 012 Fig. 6 SDS2polyacrylamide gel (12 %) of thermostable 2glucuronidase purification steps 1 :molecular mass markers ; 2 : crude extract of E. coli BL212CodonPlus (DE3)2RIL ΠpET228a ( + ) ; 3 :crude extract of E. coli BL212Condon Plus(DE3)2RILΠpET228a ( + )2aguA ; 4 : crude extract of E. coli BL212 CodonPlus(DE3)2RILΠpET228a ( + )2aguA after heat precipitation ; 5 : immobilized metal affinity chromatography 3, 511, 5511 % 216 2, (72a, b, c), ph molπl ( 72d ), T. maritima Table 3 Purification of thermostable 2glucuronidase from engineered Strain Step Total proteinπmg Specific activityπ(uπmg) Total activityπu RecoveryΠ% Purification fold Crude extract Heat treatment Immobilized metal affinity
6 4 : ph(a) (b) (c) NaCl (d) Fig. 7 The optimal ph (a), the optimal temperature (b) and thermostability (c) of expressed 2glucuronidase and inhibiting effect from NaCl (d), pet220b2, agua BL212CodonPlus(DE3)2RIL,, pet220b T. maritima 2,, T7 Thermotoga 2 [10 ], pet228a ( + ), BL212CodonPlus (DE3)2RIL,, 2, TB, BL212CodonPlus 20 %,1L 90 % (DE3)2RILΠpET228a ( + )2aguA 40mg, 1315mg, 6163, agua pt727,10l, [10 313mg ] AguA, 2 ;, [16, pet228a, ] ( + )2aguA,, E. coli JM109 (DE3) BL21 (DE3), 2 2,, AguA 70 20min BL212CodonPlus (DE3)2RIL,, 90 %, pet228a ( + )2aguA 7416 % 2,, AGG AGA AUA CCC 914 % AGGAGA agua REFERENCES( ) 85 % BL212CodonPlus ( DE3) 2 RIL (AGA AGG) [ 2 ] Xue YM ( AUA CUA CCC, trna,argu trna iley trna leuw trna, AGAΠAGG AUA CUA, agua BL212CodonPlus (DE3)2RIL, agua AGA AGG AUA CCC [14,15 ] [ 1 ] Sunna A, Autranikian G. Xylanolytic enzymes from fungi and bacte2 ria. Critical Review in Biotechology, 1997, 17(1) :39-67 ),Mao ZG ( ),Liu HL ( ) et al. Advances in the studies on 2glucuronidase. Forestry Chemistry and Industry ( ),2002,22(4) :75-79 [ 3 ] Xue YM ( ),Shao WL ( ),Mao ZG ( ). The xylan2degrading enzymes system from microorganism. ( ), 2003,13 (1) : Biotechnology [ 4 ] Shao WL ( ), Xue YM ( ). Molecular biotechnology
7 in exploiting the resource of hemicellulose. Journal of Food Science and Biotechnology ( ), 2002, 21(1) :88-93 [ 5 ] Beg QK, Kapoor M, Mahajan L et al. Microbial xylanases and their industrial applications : a review. Appl Microbiol Biotechnol, 2001, 56 : [ 6 ] Rober H, Thomas AL, Helmut K et al. Thermotoga maritima sp. nov. represents a new genus of unique extremely thermophilic eubac2 teria growing up 90. Arch Microbiol, 1986,144 : [ 7 ] Christoph W, Wolfgang L. Two extremely thermostable xylanases of the hyperthermophilic bacterium Thermotoga maritima MSB81 Appl Environ Microbiol, 1995, 61 : [ 8 ] David JS,Liam CW,Rosalind AR et al. Sequence and expression of xylanase gene from sp strain Fjss32B. 1 and characterization of recom2 binant enzyme and its activity on kraft pulp. Appl Environ Microbiol, 1995, 61 : [ 9 ] Jiang ZQ ( ),Li LT ( ),Lin Q ( ) et al. Clo2 ning and expression of an xynb gene in E. coli. from the extreme2 thermophilic thermotoga maritima. Chin J Appl Environ Biol ( ), 2002, 8 (3) : [10 ] Ruile P, Winterhalter C, Liebl W. Isolation and analysis of a gene encoding 2glucuronidase, an enzyme with a novel primary structure involved in the breakdown of xylan. Mol Microbiol, 1997, 23 : [11 ] Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning : A Labora2 tory Manual. 2 nd ed, New York : Cold Spring Harbor Laboratory Press, 1989 [12 ] Milner Y, Avigad G. A copper reagent for the determination of hexu2 ronic acids and certain ketohexoses. Carbohydr Res, 1967, 4 : [13 ] Bradford MM. A rapid and sensitive method for the quantitation of microgrom quantities of protein utilizing the principle of protein2dye2 binding. Anal Biochem, 1976,72 : [14 ] Spanjiaard RA, Chen K, Walker JR et al Frame shift suppression at tandem AGA and AGG dodons by cloned trna genes : assigning a codon to argu trna and T4 trna Arg. Nucleic Acids Res, 1990, 18 : [15 ] Spanjiaard RA, Duin J. Translation of the sequence AGG2AGGyields 50 % ribosomal frameshift. Proc Natl Acad Sci USA, 1988, 85 : [16 ] Li YY( ). Gene Expression Technology. Beijing : China Sci2 ence Press, 2001 Expression and Purification of Thermostable 2Glucuronidase from Thermotoga maritima XUE Ye2Min MAO Zhong2Gui SHAO Wei2Lan 3 ( The Key Laboratory of Industrial Biotechnology, Ministry of Education, Southern Yangtze Univercity, Wuxi , China) Abstract The xylanolytic enzymes found in Thermotoga maritima showed extremely high thermostability and considerable po2 tential in industrial application. Yet expression level of the genes encoding these enzymes was very low. The 2glucuronidase gene agua from T. maritima ATCC was cloned and expressed in several E. coli strains with different vector. The 2glu2 curonidase was overexpressed in E. coli BL212CodonPlus(DE3) 2RIL with plasmid pet228a( + ), and made up about 20 % of the total proteins present in the intracellular soluble fraction. The results proved the assumption that rare codons for arginine (AGAΠAGG) and isoleucine (AUA) affect the expression of agua gene from hyperthermophilic bacterium T. maritima in E. coli. Purification procedure included two steps, heat treatment and immobilized metal affinity chromatography, and over 1315mg of pure enzyme was obrained from 1L of induced culture. The purified enzyme showed a single band on SDS polyacrylamide gel electrophoresis with a purification of 511 fold, and a yield of 5511 %. The optimum activity of recombinant 2glucuronidase was found at ph 610 and 85,the enzyme retained 70 % of its activity after 1 h of incubation at 85. The induction conditions for expression of recombinant strain BL212CodonPlus ( DE3) 2RILΠpET228a2aguA were studied on induction time and duration by IPTG. The results showed that the activity of thermostable 2glucuronidase reach the maximum in 52hour after inducted at the ex2 ponential phase ( OD 600 of ). Key words Thermotoga maritima, 2glucuronidase, gene overexpression, recombinant enzyme purification, characterization Received : This work was supported by Grant from 211 Fund of Ministry of Light Industry of Country. 3 Corresponding author. Tel : ; Fax : ; E2mail : wl. wx. jsinfo. net
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Studies on purification and characteristics of glycosyltransferase from an engineering strain
DOI:10.16774/j.cnki.issn.1674-2214.2015.02.001 2015 2 4 44 2,, (, 310014) : pet28b-valg BL21(DE3), 10~40 C ph 5~11,, ph 30 C 8.0 1 mmol/l Ca 2+ Mg 2+ Mn 2+ Co 2+, Cu 2+ Zn 2+, 8 μmol/l 2 μmol/l A, K mb
BL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
Optimization of fermentation process for achieving high product concentration high yield and high productivity
1128 CHEMICAL INDUSTRY AND ENGINEERING PROGRESS 2006 25 10 ( 214036) (1) (2) (3) (4) (5) TQ 92 A 1000 6613 2006 10 1128 06 Optimization of fermentation process for achieving high product concentration
ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,
24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Antibacterial property of fabric treated with a fiber-reactive chitosan derivative
32 2 2011 2 Journal of Textile Research Vol. 32 No. 2 Fen. 2011 0253-9721 2011 02-0096-06 1 1 2 1. 201620 2. 201620 85% CTS N- HDCC HDCC N- NMA O- -N- NMA-HDCC HDCC NMA-HDCC 95% HDCC 100% 30 NMA-HDCC 85%
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Conductivity Logging for Thermal Spring Well
/.,**. 25 +,1- **-- 0/2,,,1- **-- 0/2, +,, +/., +0 /,* Conductivity Logging for Thermal Spring Well Koji SATO +, Tadashi TAKAYA,, Tadashi CHIBA, + Nihon Chika Kenkyuusho Co. Ltd., 0/2,, Hongo, Funabashi,
SUPPLEMENTARY INFORMATION
Sensitivity of [Ru(phen) 2 dppz] 2+ Light Switch Emission to Ionic Strength, Temperature, and DNA Sequence and Conformation Andrew W. McKinley, Per Lincoln and Eimer M. Tuite* SUPPLEMENTARY INFORMATION
Design and Fabrication of Water Heater with Electromagnetic Induction Heating
U Kamphaengsean Acad. J. Vol. 7, No. 2, 2009, Pages 48-60 ก 7 2 2552 ก ก กก ก Design and Fabrication of Water Heater with Electromagnetic Induction Heating 1* Geerapong Srivichai 1* ABSTRACT The purpose
ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5
42 5 2002 10 Acta Microbiologica Sinica Vol. 42 October No. 5 2002 Ea ge 3 33 ( 430070) : ge,, ge, GS115, G418, ge, Western blotting 33kD ELISA, ge, : ge,,, :Q93914 :A :000126209 (2002) 0520543207 (Pseudorabies,PR),
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
6 2011 5 31 3 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * 430070 PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp 6 801 bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances
3 3 Vol3 No3 3 9 Life Science Research June 9 *,,, 535 :, 3, 5- (TTC), 3,, T,, ; (5~5 μ 375~5 μ),, 5% (W/V), 55,, 55% 9% : ; ; ; ; :Q39 + :A :7-77(9)3-99-5 Screening of Respiration-deficient Saccharomyces
Supplementary Table 1. Construct List with key Biophysical Properties of the expression
SPINE Benchmark Target ID Well Code Tag (N or C) Fusion MW (kda) Fusion pi Cleavage site Prot MW (Da) Prot pi 1 A1 OPPF 2585 N-His6 21.75 6.41 Protease 3C 19.77 5.43 2 B1 OPPF 2586 N-His6 15.6 6.27 Protease
ACTA SCIEN TIAE CIRCUMSTAN TIAE
18 6 1998 11 ACTA SCIEN TIAE CIRCUMSTAN TIAE Vol. 18,No. 6 Nov.,1998 (, 215011). ;, 21. ; ;. 1 70,, 90.,,.,,,.,,.,,,, 4, :, ( ),.,. 2 211 1996 6 5, 1995, 818. [1 ], 1981 2125, 1986, 5. 1986 1995, 9.,,
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening
21 2 212126-130 2006 3 VIROLOGICA SINICA March 2006 HIV-1 * 1,3 1,3 1 2 2 1,** (1 650223; 2 650231; 3 100039) Expression and Purification of HIV-1 Protease and the Establishment of a Method for Protease
ΘΕΡΜΟΚΗΠΙΑΚΕΣ ΚΑΛΛΙΕΡΓΕΙΕΣ ΕΚΤΟΣ ΕΔΑΦΟΥΣ ΘΡΕΠΤΙΚΑ ΔΙΑΛΥΜΑΤΑ
ΘΕΡΜΟΚΗΠΙΑΚΕΣ ΚΑΛΛΙΕΡΓΕΙΕΣ ΕΚΤΟΣ ΕΔΑΦΟΥΣ ΘΡΕΠΤΙΚΑ ΔΙΑΛΥΜΑΤΑ Θρεπτικό διάλυμα Είναι ένα αραιό υδατικό διάλυμα όλων των θρεπτικών στοιχείων που είναι απαραίτητα για τα φυτά, τα οποία βρίσκονται διαλυμένα
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ ΕΠΙΜΕΛΕΙΑ: ΑΡΜΕΝΑΚΑΣ ΜΑΡΙΝΟΣ ΧΑΝΙΑ
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Purif ication of Ovalbumin from Hen Egg White by High- speed Counter-current Aqueous Two- phase Chromatography
21 1 2005 1 Chinese Journal of Biotechnology Vol. 21 No. 1 January 2005 Purif ication of Ovalbumin from Hen Egg White by High- speed Counter-current Aqueous Two- phase Chromatography 1 3, 2, 1 1, ZHI Wen-Bo
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Acknowledgements... 3 Contents... I Figures... VII Tables... IX Abbreviations... X
I Acknowledgements... 3... I Figures... VII Tables... IX Abbreviations... X Amino acids... XII Nucleobases... XII 1 Introduction... 1 1.1 Polyketides and non-ribosomal peptides... 1 1.2 Polyketide synthases...
ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ. Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή. Αζαλαζηάδνπ Βαξβάξα
ΣΔΥΝΟΛΟΓΙΚΟ ΔΚΠΑΙΓΔΤΣΙΚΟ ΙΓΡΤΜΑ ΘΔΑΛΟΝΙΚΗ ΥΟΛΗ ΣΔΥΝΟΛΟΓΙΑ ΣΡΟΦΙΜΩΝ & ΓΙΑΣΡΟΦΗ ΣΜΗΜΑ ΣΔΥΝΟΛΟΓΙΑ ΣΡΟΦΙΜΩΝ ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή Αζαλαζηάδνπ Βαξβάξα
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Supplementary information
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary information Synthesis of carboxyimidamide-substituted benzo[c][1,2,5]oxadiazoles
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement
J. Jpn. Soc. Soil Phys. No. 33, p.//0-,**/ ******* * Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement Masami OHTSUBO*, Hidekazu ISHIDA**, Hisakatsu
Fenton. COD ρ NH N TP ENVIRONMENTAL PROTECTION OF CHEMICAL INDUSTRY
COD TP DB32/ 939 6 Fenton ph 3.~3.5 H 2 O 2 3.8 ml/l FeSO 4 H 2 O.8 g/l1 min Fenton ph 7. 2 1 km 3 /d Fenton H 2 O 2 15 L/h FeSO 4 7H 2 O 7 L/h COD TP mg/l.4 mg/l.9 X73 A 6 1878 15 6 9 5 Research Institute
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΕΝΖΥΜΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ Μελέτη καθαρισμού και χημική τροποποίηση με πολυαιθυλενογλυκόλη του ενζύμου L-ασπαραγινάση από E. chrysanthemi
Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Ελαφρές κυψελωτές πλάκες - ένα νέο προϊόν για την επιπλοποιία και ξυλουργική. ΒΑΣΙΛΕΙΟΥ ΒΑΣΙΛΕΙΟΣ και ΜΠΑΡΜΠΟΥΤΗΣ ΙΩΑΝΝΗΣ
Ελαφρές κυψελωτές πλάκες - ένα νέο προϊόν για την επιπλοποιία και ξυλουργική ΒΑΣΙΛΕΙΟΥ ΒΑΣΙΛΕΙΟΣ και ΜΠΑΡΜΠΟΥΤΗΣ ΙΩΑΝΝΗΣ Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης Σχολή ασολογίας και Φυσικού Περιβάλλοντος,
Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.
Otorhinolaryngologia - Head and Neck Surgery Issue 50, October - November - December 2012, pages 18-22 ORIGINAL REVIEW ARITCLE Mitomycin C application for the prevention of postoperative synechiae formation
MnZn. MnZn Ferrites with Low Loss and High Flux Density for Power Supply Transformer. Abstract:
MnZn JFE No. 8 5 6 p. 32 37 MnZn Ferrites with Low Loss and High Flux Density for Power Supply Transformer FUJITA Akira JFE Ph. D. FUKUDA Yutaka JFE NISHIZAWA Keitarou JFE TOGAWA Jirou MnZn Fe2O3 1 C NiO
ΜΕΛΕΤΗ ΤΗΣ ΠΛΑΣΤΙΚΟΤΗΤΑΣ ΑΡΓΙΛΟΥΧΩΝ ΜΙΓΜΑΤΩΝ ΜΕ ΠΡΟΣΘΗΚΗ ΣΙΔΗΡΑΛΟΥΜΙΝΑΣ ΑΠΟ ΤΗ ΔΙΕΡΓΑΣΙΑ BAYER
Πρακτικά 1ου Πανελληνίου Συνεδρίου για την Αξιοποίηση των Βιομηχανικών Παραπροϊόντων στη Δόμηση, ΕΒΙΠΑΡ, Θεσσαλονίκη, 24-26 Νοεμβρίου 2005 ΜΕΛΕΤΗ ΤΗΣ ΠΛΑΣΤΙΚΟΤΗΤΑΣ ΑΡΓΙΛΟΥΧΩΝ ΜΙΓΜΑΤΩΝ ΜΕ ΠΡΟΣΘΗΚΗ ΣΙΔΗΡΑΛΟΥΜΙΝΑΣ
Isolation, purification and partial characterization of the 2N2acetyl2D2 glucosaminidase from the pupae of Helicoverpa armigera
Acta Entomologica Sinica, August 2005, 48 (4) : 498-502 ISSN 045426296 N2 2 2D2 1, 2, 1, 2, 1 3 (1.,, 350002 ; 2.,, 361005) : Helicoverpa armigera, Sephadex G2200 DEAE232, N2 2 2D2 2 678179 UΠmg 2 N2 2
CK2, Basic Medical Sciences and Clinics (4) ( Π ) pt727 ( CIP), (TSR) 6 ( POP6) ( IPTG),, A,
392 Basic Medical Sciences and Clinics 2003123 (4) : 100126325 ( 2003) 0420392207 CK2 1 # 2, #, 1 1, 3 1, ( 11 ; 21, 524023) : PCR NIH 3T3 CK2 cdna ; CK2, CK2 cdna, CK2 cdna BL21 (DE3), 26kDa, 3117 %,
A research on the influence of dummy activity on float in an AOA network and its amendments
2008 6 6 :100026788 (2008) 0620106209,, (, 102206) : NP2hard,,..,.,,.,.,. :,,,, : TB11411 : A A research on the influence of dummy activity on float in an AOA network and its amendments WANG Qiang, LI
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x - 2 - orfh79
2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com orfh79 1 2 1 1 2 1 2 2 1. / 330031 2. / 430072 orfh79 orfh79 pet - 28a - orfh79
and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol
FeCl 3 6H 2 O-Catalyzed Disproportionation of Allylic Alcohols and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol Jialiang Wang, Wen Huang, Zhengxing Zhang, Xu
2 ( EC ) 2D2
29 2 2010 4 Journal of Huazhong Agricultural University Vol. 29 No. 2 Apr. 2010,175 180 3 3, 430070 PCR lac4,p ET2 28a ( + ),BL21, (44. 78 2. 84) U/ ml Ni2Resin HP,SDS2PA GE, 122 ku, 43, 37 30 min, p H
GF GF 3 1,2) KP PP KP Photo 1 GF PP GF PP 3) KP ULultra-light 2.KP 2.1KP KP Fig. 1 PET GF PP 4) 2.2KP KP GF 2 3 KP Olefin film Stampable sheet
JFE No. 4 20045 p 82 Composite Material for Automotive Headliners Expandable Stampable Sheet with Light Weight and High Stiffness A JFE SUZU JFE HA KP 50 mass 30 UL 800 g/m 2 7.2 N/mm Abstract: KP-Sheet
Metallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )
23 6 2003 12 Metallurgical Analysis :1000-7571(2003) 06-0024 - 09 3, (, 130022) : (19982001), 147 :; :O657132 :A,,Cu 2 + 4,22 2, ph10 Cu + 2,2 2 (Bi2qu) (BPB) Cu(Bi2 qu) 2 BPB,, [13 ] BPB (19982001) Cu
E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils
J. Jpn. Soc. Soil Phys. No. 3+, p..3 /1,**, * ** ** E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils Kaoru UENO*, Tadashi ADACHI** and Hajime NARIOKA** * The Graduate School
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
Room Temperature Highly Diastereoselective Zn-Mediated. Allylation of Chiral N-tert-Butanesulfinyl Imines: Remarkable Reaction Condition Controlled
Supporting Information for: Room Temperature Highly Diastereoselective Zn-Mediated Allylation of Chiral N-tert-Butanesulfinyl Imines: Remarkable Reaction Condition Controlled Stereoselectivity Reversal
Supporting Information
Supporting Information Montmorillonite KSF-Catalyzed One-pot, Three-component, Aza-Diels- Alder Reactions of Methylenecyclopropanes With Arylaldehydes and Aromatic Amines Li-Xiong Shao and Min Shi* General
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Enantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Enantioselective Organocatalytic Michael Addition of Isorhodanines to α,
17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective
( 31001) (CDZ)CDZCDZ GAMSSCDZCDZ (DSC)CDZCDZ (G) DakinCDZ 1 1 CDZ a =173.9 kj mol min -1 CDZ 17 min A=.69 10 A=1.175 10 17 R97.14A1007-7693(009)1-1019-05 a =17.3 kj mol 1 Mechanism and Kinetics of hermal
Supporting information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting information Copper-catalysed intramolecular O-arylation: a simple
In vitro και in vivo φαρμακοκινητική ανάλυση των παραγώγων ανθρακινόνης σε φυτικά σκευάσματα
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΤΟΜΕΑΣ ΦΑΡΜΑΚΟΓΝΩΣΙΑΣ ΦΑΡΜΑΚΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ ΦΑΡΜΑΚΟΛΟΓΙΑ ΚΑΙ ΘΕΡΑΠΕΥΤΙΚΗ In vitro και in vivo φαρμακοκινητική
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix algeriensis NRRL B-24137 and Biochemical Characterization of Two Pyrrothine N-Acyltransferases in This Extract.
J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5
Vol. 37 ( 2017 ) No. 5 J. of Math. (PRC) 1,2, 1, 1 (1., 225002) (2., 225009) :. I +AT +, T + = T + (I +AT + ) 1, T +. Banach Hilbert Moore-Penrose.. : ; ; Moore-Penrose ; ; MR(2010) : 47L05; 46A32 : O177.2
Divergent synthesis of various iminocyclitols from D-ribose
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 205 Divergent synthesis of various iminocyclitols from D-ribose Ramu Petakamsetty,
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Fe II aq Fe III oxide electron transfer and Fe exchange: effect of organic carbon
Supplementary materials Fe II aq Fe III oxide electron transfer and Fe exchange: effect of organic carbon Timothy Pasakarnis, A Michael L. McCormick, B Gene F. Parkin, A Aaron Thompson C and Michelle M.
Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
Angioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Laboratory Studies on the Irradiation of Solid Ethane Analog Ices and Implications to Titan s Chemistry
Laboratory Studies on the Irradiation of Solid Ethane Analog Ices and Implications to Titan s Chemistry 5th Titan Workshop at Kauai, Hawaii April 11-14, 2011 Seol Kim Outer Solar System Model Ices with
Supporting Information
Supporting Information Copper/Silver Cocatalyzed Oxidative Coupling of Vinylarenes with ICH 2 CF 3 or ICH 2 CHF 2 Leading to β-cf 3 /CHF 2 -Substituted Ketones Niannian Yi, Hao Zhang, Chonghui Xu, Wei