2. ANALYSIS OF FTO AND ALKBH5 GENE EXPRESSION BY QUANTITATIVE REAL-TIME PCR MIQE checklist of qpcr Item to check Experimental design

Transcript

1 Supplemental Material Decreased N 6 -methyladenosine in peripheral blood RNA from Diabetic Patients Is Associated with FTO Expression Rather than ALKBH5 Fan Shen, 1,2, Wei Huang, 2, Jing-Tao Huang, 1 Jun Xiong, 2 Ying Yang, 1 Ke Wu, 3 Gui-Fang Jia, 4 Yu-Qi Feng, 2,* Bi-Feng Yuan, 2,* Song-Mei Liu 1,* 1 Center for Gene Diagnosis, Zhongnan Hospital of Wuhan University, Donghu Road 169#, Wuhan, , P.R. China 2 Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), Department of Chemistry, Wuhan University, Wuhan , P. R. China 3 Center for Animal Experiment/ABSL-3 Laboratory, Wuhan University, Wuhan, , PR China 4 Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, Beijing, , P. R. China Running Title: Content of N 6 -methyladenosine is correlated with T2DM These authors contributed equally to this work. *To whom correspondence should be addressed. Tel ; fax address: Song-Mei Liu, smliu@whu.edu.cn; Bi-Feng Yuan, bfyuan@whu.edu.cn; Yu-Qi Feng, yqfeng@whu.edu.cn. 1. ENZYMATIC HYDROLYSIS OF RNA RNA (100 ng) was first denatured by heating at 95ºC for 5 min and then chilling on ice for 2 min. After adding 1/10 volume of S1 nuclease buffer (30 mm CH 3 COONa, ph 4.6, 280 mm NaCl, 1mM ZnSO 4 ) and 150 units of S1 nuclease, the mixture (20 μl) was then incubated at 37ºC for 16 h. To the solution was subsequently added 1/10 volume of alkaline phosphatase buffer (50 mm Tris-HCl, 10 mm MgCl 2, ph 9.0), units of venom phosphodiesterase I and 15 units of alkaline phosphatase. And then the incubation was continued at 37ºC for an additional 4 h followed by extraction with equal volume chloroform twice. The resulting aqueous layer was collected and lyophilized to dryness and then reconstituted in 100 μl water. The obtained 30 μl samples were then subjected to liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis. 2. ANALYSIS OF FTO AND ALKBH5 GENE EXPRESSION BY QUANTITATIVE REAL-TIME PCR MIQE checklist of qpcr Item to check Experimental design 1

2 Human: T2DM patients (n=88) and control subjects (n=92) Animal: STZ induced diabetic rats (n=7) and normal Sprague-Dawley rats (n=8) Sample 1mL of whole blood sample with EDTA anticoagulation Nucleic acid extraction A commercially available TIANamp Blood RNA Kit (Tiangen, Beijing, China). Reverse transcription An amount of 8 ul of RNA was treated by a commercially available FastQuant RT Kit (with gdnase) (Tiangen, Beijing, China) according to the manufacturer s protocol. qpcr target information For human samples: Location of amplicon in mrna: ALKBH5: ; FTO: ; β-actin: ; GAPDH: Amplicon length: ALKBH5:123bp; FTO: 129bp; β-actin: 122bp; GAPDH: 151bp. For rat samples: Location of amplicon in mrna: ALKBH5: ; FTO: ; β-actin: ; GAPDH: Amplicon length: ALKBH5: 186bp; FTO: 190bp; β-actin: 143bp; GAPDH: 137bp qpcr oligonucleotides Please see Supplemental Table 2 qpcr protocol Complete reaction conditions: After predenaturation a 95ºC for 5 min, DNA fragments were amplified for 40 cycles: denaturation at 95ºC for 10s, annealing at 60ºC for 30s. Reaction volume and amount of cdna/dna: qpcr was performed on a CFX96 Touch Real-Time PCR Detection System (BioRad, CA, USA). qpcr mixture of 10 μl included 5.0 μl (2 ) of itaq Universal Supermixes (BioRad, CA, USA), 50 nm of each forward and reverse primers, 1 μl cdna template and 3.0 μl double-distilled H 2 O. qpcr validation For SYBR Green I, Cq of the NTC: Cq values of NTCs > 35.0 was set as no significance. Specificity (gel, sequence, melt, or digest): The amplification specificity was validated by both dissociation curve (Supplemental Figure 2

3 4) and agarose gel electrophoresis (Supplemental Figure 5). The qpcr products showed the single peak at 81.0ºC, 83.5ºC, 80.5ºC, and 84.0ºC for ALKBH5, FTO, β-actin and GAPDH, respectively. Calibration curves with slope and y intercept: The standard curves (Supplemental Figure 3) for ALKBH5, FTO, β-actin and GAPDH were linear in the range tested (R ). The Cq values of unknown samples fell within the linear range. The slopes of the standard curves for ALKBH5, FTO, β-actin and GAPDH were , , and 3.527, respectively; the amplification efficiencies were 93.2%, 92.2%, 90.6%, and 92.1%. Cq variation at LOD: CVs of each gene: ALKBH5=2.0%; FTO=2.5%; β-actin=2.6%; GAPDH=0.8%. LOD: ALKBH5, (copy); FTO, (copy); β-actin, (copy); GAPDH, (copy). Data analysis qpcr analysis program (source, version): CFX96 Manager Software (BioRad, CA, USA). Method of Cq determination: Cq Results for NTCs: All Cq values of NTCs were > 35.0 Justification of number and choice of reference genes: β-actin and GAPDH. Description of normalization method: multiple reference genes (β-actin and GAPDH) normalization. Number and concordance of biological replicates: Total sample: n=180; CVs of each gene: Normal group: ALKBH5=6.49%, FTO=5.15%, β-actin=10.02% and GAPDH=5.67%. T2DM group: ALKBH5=9.57%, FTO=7.79%, β-actin=16.41% and GAPDH=9.82%. Number and stage (reverse transcription or qpcr) of technical replicates: N=3 Repeatability (intraassay variation): N=3 for each sample; the ΔCq between replicates were less than 0.5; CVs of each gene: ALKBH5<2.31%, FTO<2.12%, β-actin<2.95% and GAPDH<1.82%. Statistical methods for results significance: Statistical significance was set at p < Software (source, version): SPSS 17.0 (SPSS Inc., Chicago, USA). 3

4 Supplemental Table 1. m 6 A contents in 180 RNA samples derived from 88 T2DM patients and 92 control subjects. Sample Group a Gender b Age m 6 A/rA (%) ALHBH5 c FTO d (year) D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ±

5 D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ±0.071 D ± ± ± D ± ± ±0.078 D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ±

6 D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± D ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ±

7 C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ±

8 C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± C ± ± ± a Group: 1, Control subjects; 2, T2DM. b Gender: 1, Male; 2, Female. c Relative mrna expression level of ALKBH5 gene. d Relative mrna expression level of FTO gene. 8

9 Supplemental Table 2. Primers used for qpcr. Primers were designed to target the location of exon/intron junction to avoid the amplification of contaminated DNA. Genes ALKBH5 (human) FTO (human) GAPDH (human) β-actin (human) ALKBH5 (Rat) FTO (Rat) GAPDH (Rat) β-actin (Rat) Primers (5 3 ) Forward: AGGGGAAGCGTGACTGTGC Reverse: GGGTGCATCTAATCTTGTCTTCC Forward: CTTCACCAAGGAGACTGCTATTTC Reverse: CAAGGTTCCTGTTGAGCACTCTG Forward: TCTATAAATTGAGCCCGCAGC Reverse: CCAATACGACCAAATCCGTTG Forward: CCAGCTCCTCCCTGGAGAAG Reverse: ACAGGACTCCATGCCCAGG Forward: CAGTGGGTATGCTGCTGATG Reverse: GGGTCTCTGGTGTTTCCTGA Forward: GGCTGTGGAAGAAGATGGAG Reverse: TGCTGTGCTGGTAGAGTTCG Forward: TTCCAGTATGACTCTACCCACGGCA Reverse: GCACCAGCATCACCCCATTTG Forward: AGGGTGTGATGGTGGGTATGGGT Reverse: GTGGTGCCAAATCTTCTCCATATCG Amplicon Length 123 bp 129 bp 151 bp 122 bp 186 bp 190 bp 137 bp 143 bp 9

10 Supplemental Table 3. Primers used for HRM and DNA sequencing. FTO SNPs Primers (5 3 ) rs HRM Forward: AGGCAGGTGGATCTGAAA Reverse: TCCTAGTCACGTGTCTTGG DNA Forward: AGCTGGACCTGAACAAGG sequencing Reverse: AAGGCACAATAAGAGGAGAT Amplicon Length 49 bp 301 bp rs HRM Forward: CATCTGTAAGTCTGGTATATCTAACTAAT Reverse: CATGCTACACAGTCTAAGATGAAAG DNA Forward: AGGAGAAGCCTGATTGTTCC sequencing Reverse: TCTGGGTTTGCTCTTCCATAA 65 bp 311 bp rs HRM Forward: TTGCCCACTGTGGCAAT Reverse: AGTCCATCTCTACAGTTTACCTAAG DNA Forward: CCCAGACAAGTGCCCGTAT sequencing Reverse: GAGGTGCCATTCCTCAAT 67 bp 425 bp rs DNA Forward: CGCTGCTATGGTTCTACAGTTC 491 bp sequencing Reverse: GCCCAAGGATGGTGTTTCTA 10

11 Supplemental Table 4. Linearity, LOD and LOQ of m 6 A by LC-ESI-MS/MS. Analyte Linear range (m 6 A/rA, %) Slope Regression line Intercept R 2 LOD (fmol) LOQ (fmol) m 6 A ± ±

12 Supplemental Table 5. The preparation of the quality control (QC) samples with the synthesized m 6 A-containing oligonucleotides. Methylation level m 6 A/A (%) Molar ratio (%) RNA standard 1 RNA Standard RNA standard 1 (10-mer RNA) RNA standard 2 (15-mer RNA) 5 -AUCUAUAUGC UAAUAC(m 6 A)GAGAAAUC-3 12

13 Supplemental Table 6. Accuracy and precision for the detection of m 6 A. Nominal [m 6 A]/[A]% QC samples Day 1 n=3 Measured mean [m 6 A]/[A]% RSD a (%) RE b (%) Day 2 n=3 Measured mean [m 6 A]/[A]% RSD (%) RE (%) Day 3 n=3 Measured mean [m 6 A]/[A]% RSD (%) RE (%) a Relative standard deviation. b Relative error. QC, quality control. 13

14 Supplemental Table 7. Risk estimation based on the distributions of genotype and allele frequency of FTO SNPs Model Genotype Controls n (%) T2DMs n (%) OR a (95% CI) P AIC BIC rs Codominant CC 60 (75.0) 60 (68.2) 1.00 CT 17 (21.2) 26 (29.6) 1.53 ( ) TT 3 (3.8) 2 (2.3) 0.64 ( ) Dominant CC 60 (75.0) 60 (68.2) 1.00 CT+TT 20 (25.0) 28 (31.8) 1.40 ( ) Recessive CC+CT 77 (96.2) 86 (97.7) 1.00 TT 3 (3.8) 2 (2.3) 0.58 ( ) Overdominant CC+TT 63 (78.8) 62 (70.5) 1.00 CT 17 (21.2) 26 (29.6) 1.56 ( ) Addictive 1.21 ( ) Allele C 137 (85.6) 146 (83.0) 1.00 T 23 (14.4) 30 (17.0) 1.22( ) 0.56 rs Codominant AA 63 (78.8) 66 (75.9) 1.00 AG 14 (17.5) 17 (19.5) 1.16 ( ) GG 3 (3.8) 4 (4.6) 1.26 ( ) Dominant AA 63 (78.8) 66 (75.9) 1.00 AG+GG 17 (21.2) 21 (24.1) 1.18 ( ) Recessive AA+AG 77 (96.20) 83 (95.4) 1.00 GG 3 (3.8) 4 (4.6) 1.23 ( ) Overdominant AA+GG 66 (82.5) 70 (80.5) 1.00 AG 14 (17.5) 17 (19.5) 1.14 ( ) Addictive 1.14 ( ) Allele A 140 (87.5) 149 (85.6) 1.00 G 20 (12.5) 25 (14.4) 1.17( ) 0.63 rs Codominant CC 65 (81.2) 68 (77.3) 1.00 AC 13 (16.2) 20 (22.7) 1.48 ( ) AA 2 (2.5) 0 (0) 0.00 (0.00-NA) Dominant CC 65 (81.2) 68 (77.3) 1.00 AC+AA 15 (18.8) 20 (22.7) 1.27 ( ) Recessive CC+AC 78 (97.5) 88 (100) 1.00 AA 2 (2.5) 0 (0) 0.00 (0.00-NA) Overdominant CC+AA 67 (83.8) 68 (77.3) 1.00 AC 13 (16.2) 20 (22.7) 1.52 ( ) Addictive 1.07 ( ) Allele C 143 (89.4) 156 (88.6)

15 A 17 (10.6) 20 (11.4) 1.08( ) rs Codominant TT 64 (80.0) 66 (75.0) 1.00 AT 15 (18.8) 22 (25.0) 1.42 ( ) AA 1 (1.2) 0 (0) 0.00 (0.00-NA) Dominant TT 64 (80.0) 66 (78.8) 1.00 AT+AA 16 (20.0) 22 (75.0) 1.33 ( ) Recessive TT+AT 79 (98.8) 88 (100.0) AA 1 (1.2) 0 (0) 0.00 (0.00-NA) Overdominant TT+AA 65 (81.2) 66 (75.0) AT 15 (18.8) 22 (75.0) 1.44 ( ) Addictive 1.22 ( ) Allele A 143 (89.4) 154 (87.5) T 17 (10.6) 22 (12.5) 1.20( ) T2DM, Type 2 diabetes mellitus; OR, odds ratio; CI, confidence interval; AIC, Akaike Information Criterion; BIC, Bayesian Information Criterion. NA, not available a Adjusted for age and gender. 15

16 Supplemental Figure 1. Oxidative demethylation of m 6 A to adenosine in RNA by FTO or ALKBH5 in the presence of Fe(II) and α-kg. 16

17 Supplemental Figure 2. The MRM chromatograms of nucleosides. (A) Standard nucleosides. (B) 20 ng RNA from human peripheral blood. Shown in inset is the enlargement chromatogram of m 6 A. Experimental conditions: separation column, Hisep C18-T column; temperature, 35 C; flow rate, 0.2 ml/min; mobile phase, a mixture of formic acid in water (0.1%, v/v, solvent A) and a mixture of 0.1% formic acid in methanol (v/v, solvent B); gradient elution, 5 min 5% B, 10 min 5-30% B, 5 min 30-50% B, 3 min 50% B-5% B and 17 min 5% B. 17

18 Supplemental Figure 3. The genotyping results of high-resolution melting and DNA sequencing for the common four SNPs in FTO gene. (A) Three genotypes of rs , rs and rs by high-resolution melting. (B)-(E) Three genotypes of rs , rs , rs and rs by DNA sequencing. 18

19 Supplemental Figure 4. The standard curves, amplification plots and melting peaks of qpcr for ALKBH5, FTO, β-actin and GAPDH. ALKBH5 19

20 FTO 20

21 β-actin 21

22 GAPDH 22

23 Supplemental Figure 5. Gel electrophoresis of qpcr products for ALKBH5, FTO, β-actin and GAPDH. 23