ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING. Sample Requirements

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING. Sample Requirements"

Transcript

1 ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING Η εταιρία Macrogen χρησιμοποιεί την τελευταία λέξη της τεχνολογίας για την καλύτερη δυνατή παροχή Υπηρεσιών Sequencing. Μέσα από την 10ετη της εμπειρία, συγκέντρωσε στον οδηγό αυτό, χρήσιμες πληροφορίες για την προετοιμασία και την αποστολή των δειγμάτων ώστε να διασφαλισθεί η καλύτερη δυνατή ποιότητα ανάγνωσης. Ακολουθώντας πιστά τις αναλυτικές οδηγίες για κάθε τύπο δείγματος προς αποστολή, επιτυγχάνονται τα καλύτερα δυνατά αποτελέσματα sequencing. Template Type/Format Plasmid 16S PCR Product (Purified) PCR Product (Unpurified) Difficult Sequence Sample Requirements Remarks * 100 ng/µl * Minimum volume of 20µl For re-sequencing, at lease 5 µl is required. * Agar Plate/Glycerol Stock * gdna:30-50ng * Minimum volume of 20µl N/A * 50 ng/µl * Minimum volume of 20µl For re-sequencing, at lease 5 µl is required. * 100 ng/µl * Minimum volume of 20µl N/A * 100 ng/µl * Minimum volume of 40µl N/A Primer Walking * 8 µg (for an insert size of up to 4kb) Single Strand Sequencing: 1 µg/1 kb insert. If insert size is longer than 4kb, clone is required in an agar stab culture status. It is possible to send us either a stab or glycerol culture with the selected E.coli clone, the purified plasmid DNA or your unpurified or purified PCR product. Templates and primers must be provided in DI water or 10mM Tris buffer, not in TE

2 a) Sample for individual tube : -General glycerol stock/ Agar-stab/Agar-plate culture at room temperature µl microcentrifuge tube is recommended in a dried (lyophilized) form or solution (Nuclease-free TE or distilled water) at room temperature.. - Free re-sequencing is included

3

4 It is highly recommended that your PCR template is first observed on a gel to confirm that there is a specific product with the correct size. Commercially available Gel extraction kit or PCR cleanup kit (i.e NucleoSpin or equivalent) can be used to remove all of the unwanted products from your template. 2) Host strains The host strain can have an impact on the quality of the template DNA prepared even using the best methods. DH5-α host strains consistently produce good results. HB101, XL-1 Blue, JM109 and MV1190 are usually fine but JM101 is often poor. The growth media you use can also affect the outcome yields, while LB is usually fine. 3) Quantitation Sequencers are able to handle a wide range of DNA concentrations however with very low amounts of DNA the data quality will be significantly affected. Using UV absorbance to quantitate dilute DNA solutions tends to give widely inaccurate results. A good way to quantitate DNA is to run an aliquot on a minigel and compare the intensity to the control of a known concentration There are also concentration ladders that are commercially available. For each reaction, please provide 10 ng/100 bases, and at least 20 ng/µl solution in deionized water. Please provide at least 10 ul for any possible re-sequencing. Please be advised that "Gel Electrophoresis rather than Nano-drop "is recommended

5 4) Primers preparation Primer Considerations Primers should be provided in DI water at the required concentration (see table above). -High Purity -Appropriate concentration -No secondary priming sites -No mismatches -A length of bases. -GC% content between 40% and 60%. -A Tm (melting temperature) between 55 C and 60 C -No significant hairpins (>3bp) -Free of salts, EDTA, or other contaminants Please supply primers at concentration of (10 pmole/µl =60 ng/µl) in deionized water at volume of greater than 20 µl Primers supplied by customers should be desalted or purified. Crude primers generally do not work well for sequencing. We have the following primers available at no extra charge.

6 Primer Name Sequence Base T7 AATACGACTCACTATAG 17 T7terminator GCTAGTTATTGCTCAGCGG 19 T7promoter TAATACGACTCACTATAGGG 20 T3 ATTAACCCTCACTAAAG 17 SP6 ATTTAGGTGACACTATAG 18 M13F-pUC(-40) GTTTTCCCAGTCACGAC 17 M13R-pUC(-40) CAGGAAACAGCTATGAC 17 M13F(-20) GTAAAACGACGGCCAGT 17 M13R(-20) GCGGATAACAATTTCACACAGG 22 pgex5 GGCAAGCCACGTTTGGTG 18 pgex3 GGAGCTGCATGTGTCAGAGG 20 27F AGAGTTTGATCMTGGCTCAG R TACGGYTACCTTGTTACGACTT F CCAGCAGCCGCGGTAATACG R TACCAGGGTATCTAATCC 18 ITS1 TCCGTAGGTGAACCTGCGG 19 ITS4 TCCTCCGCTTATTGATATGC 20 BGH-R TAGAAGGCACAGTCGAGG 18 CMV-F CGCAAATGGGCGGTAGGCGTG 21 RVprimer3 CTAGCAAAATAGGCTGTCCC 20 RVprimer4 GACGATAGTCATGCCCCGCG 20 GLprimer1 TGTATCTTATGGTACTGTAACTG 23 GLprimer2 CTTTATGTTTTTGGCGTCTTCCA 23 pqe-f CCCGAAAAGTGCCACCTG 18 pqe-r GTTCTGAGGTCATTACTGG 19 Gal4AD TACCACTACAATGGATG 17 pbad-f ATGCCATAGCATTTTTATCCA 21 pbad-r GATTTAATCTGTATCAGG 18 EGFP-CF AGCACCCAGTCCGCCCTGAGC 21 EGFP-CR CGTCCATGCCGAGAGTG 17 EGFP-NR CGTCGCCGTCCAGCTC 16

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =

Διαβάστε περισσότερα

2 Composition. Invertible Mappings

2 Composition. Invertible Mappings Arkansas Tech University MATH 4033: Elementary Modern Algebra Dr. Marcel B. Finan Composition. Invertible Mappings In this section we discuss two procedures for creating new mappings from old ones, namely,

Διαβάστε περισσότερα

CYTA Cloud Server Set Up Instructions

CYTA Cloud Server Set Up Instructions CYTA Cloud Server Set Up Instructions ΕΛΛΗΝΙΚΑ ENGLISH Initial Set-up Cloud Server To proceed with the initial setup of your Cloud Server first login to the Cyta CloudMarketPlace on https://cloudmarketplace.cyta.com.cy

Διαβάστε περισσότερα

Homework 3 Solutions

Homework 3 Solutions Homework 3 Solutions Igor Yanovsky (Math 151A TA) Problem 1: Compute the absolute error and relative error in approximations of p by p. (Use calculator!) a) p π, p 22/7; b) p π, p 3.141. Solution: For

Διαβάστε περισσότερα

Terabyte Technology Ltd

Terabyte Technology Ltd Terabyte Technology Ltd is a Web and Graphic design company in Limassol with dedicated staff who will endeavour to deliver the highest quality of work in our field. We offer a range of services such as

Διαβάστε περισσότερα

EE512: Error Control Coding

EE512: Error Control Coding EE512: Error Control Coding Solution for Assignment on Finite Fields February 16, 2007 1. (a) Addition and Multiplication tables for GF (5) and GF (7) are shown in Tables 1 and 2. + 0 1 2 3 4 0 0 1 2 3

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 6/5/2006

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 6/5/2006 Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Ολοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα είναι μικρότεροι το 1000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Διάρκεια: 3,5 ώρες Καλή

Διαβάστε περισσότερα

The Nottingham eprints service makes this work by researchers of the University of Nottingham available open access under the following conditions.

The Nottingham eprints service makes this work by researchers of the University of Nottingham available open access under the following conditions. Luevorasirikul, Kanokrat (2007) Body image and weight management: young people, internet advertisements and pharmacists. PhD thesis, University of Nottingham. Access from the University of Nottingham repository:

Διαβάστε περισσότερα

Surface Mount Aluminum Electrolytic Capacitors

Surface Mount Aluminum Electrolytic Capacitors FEATURES CYLINDRICAL V-CHIP CONSTRUCTION LOW COST, GENERAL PURPOSE, 2000 HOURS AT 85 O C NEW EXPANDED CV RANGE (up to 6800µF) ANTI-SOLVENT (2 MINUTES) DESIGNED FOR AUTOMATIC MOUNTING AND REFLOW SOLDERING

Διαβάστε περισσότερα

UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education

UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education *2517291414* GREEK 0543/02 Paper 2 Reading and Directed Writing May/June 2013 1 hour 30 minutes

Διαβάστε περισσότερα

If we restrict the domain of y = sin x to [ π, π ], the restrict function. y = sin x, π 2 x π 2

If we restrict the domain of y = sin x to [ π, π ], the restrict function. y = sin x, π 2 x π 2 Chapter 3. Analytic Trigonometry 3.1 The inverse sine, cosine, and tangent functions 1. Review: Inverse function (1) f 1 (f(x)) = x for every x in the domain of f and f(f 1 (x)) = x for every x in the

Διαβάστε περισσότερα

Potential Dividers. 46 minutes. 46 marks. Page 1 of 11

Potential Dividers. 46 minutes. 46 marks. Page 1 of 11 Potential Dividers 46 minutes 46 marks Page 1 of 11 Q1. In the circuit shown in the figure below, the battery, of negligible internal resistance, has an emf of 30 V. The pd across the lamp is 6.0 V and

Διαβάστε περισσότερα

If we restrict the domain of y = sin x to [ π 2, π 2

If we restrict the domain of y = sin x to [ π 2, π 2 Chapter 3. Analytic Trigonometry 3.1 The inverse sine, cosine, and tangent functions 1. Review: Inverse function (1) f 1 (f(x)) = x for every x in the domain of f and f(f 1 (x)) = x for every x in the

Διαβάστε περισσότερα

Advanced Subsidiary Unit 1: Understanding and Written Response

Advanced Subsidiary Unit 1: Understanding and Written Response Write your name here Surname Other names Edexcel GE entre Number andidate Number Greek dvanced Subsidiary Unit 1: Understanding and Written Response Thursday 16 May 2013 Morning Time: 2 hours 45 minutes

Διαβάστε περισσότερα

Areas and Lengths in Polar Coordinates

Areas and Lengths in Polar Coordinates Kiryl Tsishchanka Areas and Lengths in Polar Coordinates In this section we develop the formula for the area of a region whose boundary is given by a polar equation. We need to use the formula for the

Διαβάστε περισσότερα

Απόκριση σε Μοναδιαία Ωστική Δύναμη (Unit Impulse) Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο. Απόστολος Σ.

Απόκριση σε Μοναδιαία Ωστική Δύναμη (Unit Impulse) Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο. Απόστολος Σ. Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο The time integral of a force is referred to as impulse, is determined by and is obtained from: Newton s 2 nd Law of motion states that the action

Διαβάστε περισσότερα

Precision Metal Film Fixed Resistor Axial Leaded

Precision Metal Film Fixed Resistor Axial Leaded Features EIA standard colour-coding Non-Flame type available Low noise and voltage coefficient Low temperature coefficient range Wide precision range in small package Too low or too high ohmic value can

Διαβάστε περισσότερα

1. Πως μειώνεται η ταχύτητα των καυσαερίων από το σημείο εξόδου τους στο ακροφύσιο εξόδου του κινητήρα? 2. Με ποιους τρόπους γίνεται η σήμανση της

1. Πως μειώνεται η ταχύτητα των καυσαερίων από το σημείο εξόδου τους στο ακροφύσιο εξόδου του κινητήρα? 2. Με ποιους τρόπους γίνεται η σήμανση της 1. Πως μειώνεται η ταχύτητα των καυσαερίων από το σημείο εξόδου τους στο ακροφύσιο εξόδου του κινητήρα? 2. Με ποιους τρόπους γίνεται η σήμανση της επικίνδυνης περιοχής μπροστά από το κινητήρα? 3. Ποιοιείναιοικύκλοιασφαλείαςγύρωαπότοαεροσκάφοςκαιτιαντιπροσωπεύουν?

Διαβάστε περισσότερα

Exercises 10. Find a fundamental matrix of the given system of equations. Also find the fundamental matrix Φ(t) satisfying Φ(0) = I. 1.

Exercises 10. Find a fundamental matrix of the given system of equations. Also find the fundamental matrix Φ(t) satisfying Φ(0) = I. 1. Exercises 0 More exercises are available in Elementary Differential Equations. If you have a problem to solve any of them, feel free to come to office hour. Problem Find a fundamental matrix of the given

Διαβάστε περισσότερα

ΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ : ΧΗΜΙΚΑ ΠΡΟΣΘΕΤΑ ΠΟΥ ΠΡΟΟΡΙΖΟΝΤΑΙ ΓΙΑ ΤΟ ΝΕΡΟ ΤΟΥ ΑΤΜΟΛΕΒΗΤΑ

ΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ : ΧΗΜΙΚΑ ΠΡΟΣΘΕΤΑ ΠΟΥ ΠΡΟΟΡΙΖΟΝΤΑΙ ΓΙΑ ΤΟ ΝΕΡΟ ΤΟΥ ΑΤΜΟΛΕΒΗΤΑ ΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ : ΧΗΜΙΚΑ ΠΡΟΣΘΕΤΑ ΠΟΥ ΠΡΟΟΡΙΖΟΝΤΑΙ ΓΙΑ ΤΟ ΝΕΡΟ ΤΟΥ ΑΤΜΟΛΕΒΗΤΑ ΣΠΟΥ ΑΣΤΗΣ : ΑΓΟΡΑΣΤΟΣ ΧΡΥΣΟΒΑΛΑΝΤΗΣ ΕΠΙΒΛΕΠΟΥΣΑ ΚΑΘΗΓΗΤΡΙΑ :

Διαβάστε περισσότερα

(1) Describe the process by which mercury atoms become excited in a fluorescent tube (3)

(1) Describe the process by which mercury atoms become excited in a fluorescent tube (3) Q1. (a) A fluorescent tube is filled with mercury vapour at low pressure. In order to emit electromagnetic radiation the mercury atoms must first be excited. (i) What is meant by an excited atom? (1) (ii)

Διαβάστε περισσότερα

Στο εστιατόριο «ToDokimasesPrinToBgaleisStonKosmo?» έξω από τους δακτυλίους του Κρόνου, οι παραγγελίες γίνονται ηλεκτρονικά.

Στο εστιατόριο «ToDokimasesPrinToBgaleisStonKosmo?» έξω από τους δακτυλίους του Κρόνου, οι παραγγελίες γίνονται ηλεκτρονικά. Διαστημικό εστιατόριο του (Μ)ΑστροΈκτορα Στο εστιατόριο «ToDokimasesPrinToBgaleisStonKosmo?» έξω από τους δακτυλίους του Κρόνου, οι παραγγελίες γίνονται ηλεκτρονικά. Μόλις μια παρέα πελατών κάτσει σε ένα

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY 21 ος ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ Δεύτερος Γύρος - 30 Μαρτίου 2011

ΚΥΠΡΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY 21 ος ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ Δεύτερος Γύρος - 30 Μαρτίου 2011 Διάρκεια Διαγωνισμού: 3 ώρες Απαντήστε όλες τις ερωτήσεις Μέγιστο Βάρος (20 Μονάδες) Δίνεται ένα σύνολο από N σφαιρίδια τα οποία δεν έχουν όλα το ίδιο βάρος μεταξύ τους και ένα κουτί που αντέχει μέχρι

Διαβάστε περισσότερα

Liner Shipping Hub Network Design in a Competitive Environment

Liner Shipping Hub Network Design in a Competitive Environment Downloaded from orbit.dtu.dk on: Oct 01, 2016 Liner Shipping Hub Network Design in a Competitive Environment Gelareh, Shahin; Nickel, Stefan; Pisinger, David Publication date: 2010 Document Version Publisher's

Διαβάστε περισσότερα

Linear diffuser. Dimensions. Description

Linear diffuser. Dimensions. Description Dimensions -- + D -- Description is a rectangular linear diffuser in aluminium. is suitable for both supply and exhaust air. is equipped with air guide baffles, making it possible to use for horizontal

Διαβάστε περισσότερα

Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ

Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ Εργαςτήριο Γεωργικών Καταςκευών ΠΜΣ Ενεργειακά Συςτήματα και Ανανεώςιμεσ Πηγέσ Ενέργειασ Διδακτορική διατριβή Καιιηέξγεηα

Διαβάστε περισσότερα

FINAL TEST B TERM-JUNIOR B STARTING STEPS IN GRAMMAR UNITS 8-17

FINAL TEST B TERM-JUNIOR B STARTING STEPS IN GRAMMAR UNITS 8-17 FINAL TEST B TERM-JUNIOR B STARTING STEPS IN GRAMMAR UNITS 8-17 Name: Surname: Date: Class: 1. Write these words in the correct order. /Γράψε αυτέσ τισ λέξεισ ςτη ςωςτή ςειρά. 1) playing / his / not /

Διαβάστε περισσότερα

UDZ Swirl diffuser. Product facts. Quick-selection. Swirl diffuser UDZ. Product code example:

UDZ Swirl diffuser. Product facts. Quick-selection. Swirl diffuser UDZ. Product code example: UDZ Swirl diffuser Swirl diffuser UDZ, which is intended for installation in a ventilation duct, can be used in premises with a large volume, for example factory premises, storage areas, superstores, halls,

Διαβάστε περισσότερα

*2354431106* GREEK 0543/02 Paper 2 Reading and Directed Writing May/June 2009

*2354431106* GREEK 0543/02 Paper 2 Reading and Directed Writing May/June 2009 UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education *2354431106* GREEK 0543/02 Paper 2 Reading and Directed Writing May/June 2009 1 hour 30 minutes

Διαβάστε περισσότερα

Correction Table for an Alcoholometer Calibrated at 20 o C

Correction Table for an Alcoholometer Calibrated at 20 o C An alcoholometer is a device that measures the concentration of ethanol in a water-ethanol mixture (often in units of %abv percent alcohol by volume). The depth to which an alcoholometer sinks in a water-ethanol

Διαβάστε περισσότερα

Paper Reference. Paper Reference(s) 1776/04 Edexcel GCSE Modern Greek Paper 4 Writing. Thursday 21 May 2009 Afternoon Time: 1 hour 15 minutes

Paper Reference. Paper Reference(s) 1776/04 Edexcel GCSE Modern Greek Paper 4 Writing. Thursday 21 May 2009 Afternoon Time: 1 hour 15 minutes Centre No. Candidate No. Paper Reference(s) 1776/04 Edexcel GCSE Modern Greek Paper 4 Writing Thursday 21 May 2009 Afternoon Time: 1 hour 15 minutes Materials required for examination Nil Paper Reference

Διαβάστε περισσότερα

Repeated measures Επαναληπτικές μετρήσεις

Repeated measures Επαναληπτικές μετρήσεις ΠΡΟΒΛΗΜΑ Στο αρχείο δεδομένων diavitis.sav καταγράφεται η ποσότητα γλυκόζης στο αίμα 10 ασθενών στην αρχή της χορήγησης μιας θεραπείας, μετά από ένα μήνα και μετά από δύο μήνες. Μελετήστε την επίδραση

Διαβάστε περισσότερα

LESSON 14 (ΜΑΘΗΜΑ ΔΕΚΑΤΕΣΣΕΡΑ) REF : 202/057/34-ADV. 18 February 2014

LESSON 14 (ΜΑΘΗΜΑ ΔΕΚΑΤΕΣΣΕΡΑ) REF : 202/057/34-ADV. 18 February 2014 LESSON 14 (ΜΑΘΗΜΑ ΔΕΚΑΤΕΣΣΕΡΑ) REF : 202/057/34-ADV 18 February 2014 Slowly/quietly Clear/clearly Clean Quickly/quick/fast Hurry (in a hurry) Driver Attention/caution/notice/care Dance Σιγά Καθαρά Καθαρός/η/ο

Διαβάστε περισσότερα

TMA4115 Matematikk 3

TMA4115 Matematikk 3 TMA4115 Matematikk 3 Andrew Stacey Norges Teknisk-Naturvitenskapelige Universitet Trondheim Spring 2010 Lecture 12: Mathematics Marvellous Matrices Andrew Stacey Norges Teknisk-Naturvitenskapelige Universitet

Διαβάστε περισσότερα

«Έντυπο και ψηφιακό βιβλίο στη σύγχρονη εποχή: τάσεις στην παγκόσμια βιομηχανία».

«Έντυπο και ψηφιακό βιβλίο στη σύγχρονη εποχή: τάσεις στην παγκόσμια βιομηχανία». ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΙΟΝΙΩΝ ΝΗΣΩΝ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ ΚΑΙ ΕΠΙΚΟΙΝΩΝΙΑΣ Ταχ. Δ/νση : ΑΤΕΙ Ιονίων Νήσων- Λεωφόρος Αντώνη Τρίτση Αργοστόλι- Κεφαλληνίας, Ελλάδα 28100, +30

Διαβάστε περισσότερα

Cambridge International Examinations Cambridge International General Certificate of Secondary Education

Cambridge International Examinations Cambridge International General Certificate of Secondary Education Cambridge International Examinations Cambridge International General Certificate of Secondary Education *4358398658* GREEK 0543/04 Paper 4 Writing May/June 2015 1 hour Candidates answer on the Question

Διαβάστε περισσότερα

Inverse trigonometric functions & General Solution of Trigonometric Equations. ------------------ ----------------------------- -----------------

Inverse trigonometric functions & General Solution of Trigonometric Equations. ------------------ ----------------------------- ----------------- Inverse trigonometric functions & General Solution of Trigonometric Equations. 1. Sin ( ) = a) b) c) d) Ans b. Solution : Method 1. Ans a: 17 > 1 a) is rejected. w.k.t Sin ( sin ) = d is rejected. If sin

Διαβάστε περισσότερα

Capacitors - Capacitance, Charge and Potential Difference

Capacitors - Capacitance, Charge and Potential Difference Capacitors - Capacitance, Charge and Potential Difference Capacitors store electric charge. This ability to store electric charge is known as capacitance. A simple capacitor consists of 2 parallel metal

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 24/3/2007

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 24/3/2007 Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Όλοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα μικρότεροι του 10000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Αν κάπου κάνετε κάποιες υποθέσεις

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 24/3/2007

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 24/3/2007 Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Όλοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα μικρότεροι του 10000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Αν κάπου κάνετε κάποιες υποθέσεις

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση

Διαβάστε περισσότερα

Volume of a Cuboid. Volume = length x breadth x height. V = l x b x h. The formula for the volume of a cuboid is

Volume of a Cuboid. Volume = length x breadth x height. V = l x b x h. The formula for the volume of a cuboid is Volume of a Cuboid The formula for the volume of a cuboid is Volume = length x breadth x height V = l x b x h Example Work out the volume of this cuboid 10 cm 15 cm V = l x b x h V = 15 x 6 x 10 V = 900cm³

Διαβάστε περισσότερα

ΤΕΙ ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΚΩΝ ΕΦΑΡΜΟΓΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ

ΤΕΙ ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΚΩΝ ΕΦΑΡΜΟΓΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΤΕΙ ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΚΩΝ ΕΦΑΡΜΟΓΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΜΕΛΕΤΗ ΦΩΤΟΒΟΛΤΑΙΚΟΥ ΠΑΡΚΟΥ ΜΕ ΟΙΚΙΣΚΟΥΣ ΓΙΑ ΠΑΡΑΓΩΓΗ ΗΛΕΚΤΡΙΚΗΣ ΕΝΕΡΓΕΙΑΣ ΜΕΣΗΣ ΤΑΣΗΣ STUDY PHOTOVOLTAIC PARK WITH SUBSTATIONS

Διαβάστε περισσότερα

VBA ΣΤΟ WORD. 1. Συχνά, όταν ήθελα να δώσω ένα φυλλάδιο εργασίας με ασκήσεις στους μαθητές έκανα το εξής: Version 25-7-2015 ΗΜΙΤΕΛΗΣ!!!!

VBA ΣΤΟ WORD. 1. Συχνά, όταν ήθελα να δώσω ένα φυλλάδιο εργασίας με ασκήσεις στους μαθητές έκανα το εξής: Version 25-7-2015 ΗΜΙΤΕΛΗΣ!!!! VBA ΣΤΟ WORD Version 25-7-2015 ΗΜΙΤΕΛΗΣ!!!! Μου παρουσιάστηκαν δύο θέματα. 1. Συχνά, όταν ήθελα να δώσω ένα φυλλάδιο εργασίας με ασκήσεις στους μαθητές έκανα το εξής: Εγραφα σε ένα αρχείο του Word τις

Διαβάστε περισσότερα

Right Rear Door. Let's now finish the door hinge saga with the right rear door

Right Rear Door. Let's now finish the door hinge saga with the right rear door Right Rear Door Let's now finish the door hinge saga with the right rear door You may have been already guessed my steps, so there is not much to describe in detail. Old upper one file:///c /Documents

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός

Διαβάστε περισσότερα

Quick Installation Guide

Quick Installation Guide A Installation 1 F H B E C D G 2 www.trust.com/17528/faq Quick Installation Guide C C D Freewave Wireless Audio Set 17528/ 17529 D Installation Configuration Windows XP 4 5 8 Windows 7/ Vista 6 7 9 10

Διαβάστε περισσότερα

UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education

UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education GREEK 0543/03 Paper 3 Speaking and Listening Role Play Booklet One For Examination from 2011

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ - - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ

Διαβάστε περισσότερα

Biodiesel quality and EN 14214:2012

Biodiesel quality and EN 14214:2012 3η Ενότητα: «Αγορά Βιοκαυσίμων στην Ελλάδα: Τάσεις και Προοπτικές» Biodiesel quality and EN 14214:2012 Dr. Hendrik Stein Pilot Plant Manager, ASG Analytik Content Introduction Development of the Biodiesel

Διαβάστε περισσότερα

S. Gaudenzi,. π υ, «aggregation problem»

S. Gaudenzi,. π υ, «aggregation problem» υμυμπα «ΜΜΜΜααΜΑΜΜπΜαΜΜυαΜαΜυαΜφαΜΜ πμαπυμαμμαμυααμυevidence based policy making)». Aα, 07.10.2015 H ΕΕΗ Η Η Η, Η ΗΗ Ω Ω Ω Η Η ΕΕΩ ΕΗΩ ΓΜΧΑ πάμαμφαμαπυμαμαα (ΑΜΑαπυα αω) αμχαμχωααμα ΑπυΜΑΘ, gmich@plandevel.auth.gr

Διαβάστε περισσότερα

Εγκατάσταση λογισμικού και αναβάθμιση συσκευής Device software installation and software upgrade

Εγκατάσταση λογισμικού και αναβάθμιση συσκευής Device software installation and software upgrade Για να ελέγξετε το λογισμικό που έχει τώρα η συσκευή κάντε κλικ Menu > Options > Device > About Device Versions. Στο πιο κάτω παράδειγμα η συσκευή έχει έκδοση λογισμικού 6.0.0.546 με πλατφόρμα 6.6.0.207.

Διαβάστε περισσότερα

Second Order Partial Differential Equations

Second Order Partial Differential Equations Chapter 7 Second Order Partial Differential Equations 7.1 Introduction A second order linear PDE in two independent variables (x, y Ω can be written as A(x, y u x + B(x, y u xy + C(x, y u u u + D(x, y

Διαβάστε περισσότερα

Trigonometric Formula Sheet

Trigonometric Formula Sheet Trigonometric Formula Sheet Definition of the Trig Functions Right Triangle Definition Assume that: 0 < θ < or 0 < θ < 90 Unit Circle Definition Assume θ can be any angle. y x, y hypotenuse opposite θ

Διαβάστε περισσότερα

UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education

UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education www.xtremepapers.com UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education *6301456813* GREEK 0543/03 Paper 3 Speaking Role Play Card One 1 March 30

Διαβάστε περισσότερα

ΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ ΣΤΗ ΙΟΙΚΗΣΗ ΕΠΙΧΕΙΡΗΣΕΩΝ. ιπλωµατική Εργασία. της ΘΕΟ ΟΣΟΠΟΥΛΟΥ ΕΛΕΝΗΣ ΜΣ:5411

ΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ ΣΤΗ ΙΟΙΚΗΣΗ ΕΠΙΧΕΙΡΗΣΕΩΝ. ιπλωµατική Εργασία. της ΘΕΟ ΟΣΟΠΟΥΛΟΥ ΕΛΕΝΗΣ ΜΣ:5411 Παρακίνηση εργαζοµένων: Ο ρόλος του ηγέτη στην παρακίνηση των εργαζοµένων. ΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ ΣΤΗ ΙΟΙΚΗΣΗ ΕΠΙΧΕΙΡΗΣΕΩΝ ιπλωµατική Εργασία της ΘΕΟ ΟΣΟΠΟΥΛΟΥ ΕΛΕΝΗΣ ΜΣ:5411 ΠΑΡΑΚΙΝΗΣΗ

Διαβάστε περισσότερα

EU-Profiler: User Profiles in the 2009 European Elections

EU-Profiler: User Profiles in the 2009 European Elections ZA5806 EU-Profiler: User Profiles in the 2009 European Elections Country Specific Codebook Cyprus COUNTRY SPECIFIC CODEBOOK: CYPRUS Variable answer_29 answer_30 saliency_29 saliency_30 party_val_49 party_val_50

Διαβάστε περισσότερα

Αναερόβια Φυσική Κατάσταση

Αναερόβια Φυσική Κατάσταση Αναερόβια Φυσική Κατάσταση Γιάννης Κουτεντάκης, BSc, MA. PhD Αναπληρωτής Καθηγητής ΤΕΦΑΑ, Πανεπιστήµιο Θεσσαλίας Περιεχόµενο Μαθήµατος Ορισµός της αναερόβιας φυσικής κατάστασης Σχέσης µε µηχανισµούς παραγωγής

Διαβάστε περισσότερα

Επίδραση της Συμβολαιακής Γεωργίας στην Χρηματοοικονομική Διοίκηση των Επιχειρήσεων Τροφίμων. Ιωάννης Γκανάς

Επίδραση της Συμβολαιακής Γεωργίας στην Χρηματοοικονομική Διοίκηση των Επιχειρήσεων Τροφίμων. Ιωάννης Γκανάς ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ ΚΑΙ ΑΝΑΠΤΥΞΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΣ ΤΟΥ ΑΝΘΡΩΠΟΥ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΟΡΓΑΝΩΣΗ ΚΑΙ ΔΙΟΙΚΗΣΗ ΕΠΙΧΕΙΡΗΣΕΩΝ ΤΡΟΦΙΜΩΝ & ΓΕΩΡΓΙΑΣ

Διαβάστε περισσότερα

Passport number (or) διαβατηρίου (ή)

Passport number (or) διαβατηρίου (ή) APPLICATION FOR DEMATERIALIZED SECURITIES SYSTEM (S.A.T.) ACCOUNT WITH THE ATHENS EXCHANGE ΑΙΤΗΣΗ ΓΙΑ ΛΟΓΑΡΙΑΣΜΟ ΣΤΟ ΣΥΣΤΗΜΑ ΑΥΛΩΝ ΤΙΤΛΩΝ (Σ.Α.Τ.) ΜΕ ΤΟ ΕΛΛΗΝΙΚΟ ΧΡΗΜΑΤΙΣΤΗΡΙΟ Please type Latin Characters.

Διαβάστε περισσότερα

Μιχάλης Βαφόπουλος, vafopoulos.org

Μιχάλης Βαφόπουλος, vafopoulos.org Μιχάλης Βαφόπουλος, vafopoulos.org Creative Commons License This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License. Πρόγραμμα σεμιναρίου Εισαγωγή Από τα ανοικτά

Διαβάστε περισσότερα

Διπλωματική Εργασία του φοιτητή του Τμήματος Ηλεκτρολόγων Μηχανικών και Τεχνολογίας Υπολογιστών της Πολυτεχνικής Σχολής του Πανεπιστημίου Πατρών

Διπλωματική Εργασία του φοιτητή του Τμήματος Ηλεκτρολόγων Μηχανικών και Τεχνολογίας Υπολογιστών της Πολυτεχνικής Σχολής του Πανεπιστημίου Πατρών ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ:ΗΛΕΚΤΡΟΝΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΩΝ ΕΦΑΡΜΟΓΩΝ Διπλωματική Εργασία του φοιτητή του Τμήματος Ηλεκτρολόγων

Διαβάστε περισσότερα

ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ

ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΠΑΡΑΡΤΗΜΑ ΧΑΝΙΩΝ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΤΟΜΕΑΣ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΧΗΜΕΙΑΣ & ΒΙΟΧΗΜΙΚΩΝ ΙΕΡΓΑΣΙΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ. Ψηφιακή Οικονομία. Διάλεξη 8η: Producer Behavior Mαρίνα Μπιτσάκη Τμήμα Επιστήμης Υπολογιστών

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ. Ψηφιακή Οικονομία. Διάλεξη 8η: Producer Behavior Mαρίνα Μπιτσάκη Τμήμα Επιστήμης Υπολογιστών ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ Ψηφιακή Οικονομία Διάλεξη 8η: Producer Behavior Mαρίνα Μπιτσάκη Τμήμα Επιστήμης Υπολογιστών Firm Behavior GOAL: Firms choose the maximum possible output (technological

Διαβάστε περισσότερα

ΣΗΣΛΟ: Ζ ΥΡΖΖ ΒΗΟΛΟΓΗΚΧΝ ΠΡΟΗΟΝΣΧΝ ΣΟΝ ΑΓΡΟΣΟΤΡΗΜΟ

ΣΗΣΛΟ: Ζ ΥΡΖΖ ΒΗΟΛΟΓΗΚΧΝ ΠΡΟΗΟΝΣΧΝ ΣΟΝ ΑΓΡΟΣΟΤΡΗΜΟ ΑΛΔΞΑΝΓΡΔΗΟ ΣΔΥΝΟΛΟΓΗΚΟ ΔΚΠΑΗΓΔΤΣΗΚΟ ΗΓΡΤΜΑ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΣΔΥΝΟΛΟΓΗΑ ΓΔΧΠΟΝΗΑ ΣΜΖΜΑ ΦΤΣΗΚΖ ΠΑΡΑΓΧΓΖ ΣΗΣΛΟ: Ζ ΥΡΖΖ ΒΗΟΛΟΓΗΚΧΝ ΠΡΟΗΟΝΣΧΝ ΣΟΝ ΑΓΡΟΣΟΤΡΗΜΟ ΓΚΟΓΚΗΓΟΤ ΗΧΑΝΝΑ Α.Μ:186/99 Δπηβιέπωλ θαζεγεηήο:παλασο

Διαβάστε περισσότερα

Test Data Management in Practice

Test Data Management in Practice Problems, Concepts, and the Swisscom Test Data Organizer Do you have issues with your legal and compliance department because test environments contain sensitive data outsourcing partners must not see?

Διαβάστε περισσότερα

Πρόβλημα 1: Αναζήτηση Ελάχιστης/Μέγιστης Τιμής

Πρόβλημα 1: Αναζήτηση Ελάχιστης/Μέγιστης Τιμής Πρόβλημα 1: Αναζήτηση Ελάχιστης/Μέγιστης Τιμής Να γραφεί πρόγραμμα το οποίο δέχεται ως είσοδο μια ακολουθία S από n (n 40) ακέραιους αριθμούς και επιστρέφει ως έξοδο δύο ακολουθίες από θετικούς ακέραιους

Διαβάστε περισσότερα

Η ΕΡΕΥΝΑ ΤΗΣ ΓΛΩΣΣΙΚΗΣ ΑΛΛΑΓΗΣ ΣΤΑ ΚΕΙΜΕΝΑ ΤΗΣ ΜΕΣΑΙΩΝΙΚΗΣ ΕΛΛΗΝΙΚΗΣ: ΜΕΘΟΔΟΛΟΓΙΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ

Η ΕΡΕΥΝΑ ΤΗΣ ΓΛΩΣΣΙΚΗΣ ΑΛΛΑΓΗΣ ΣΤΑ ΚΕΙΜΕΝΑ ΤΗΣ ΜΕΣΑΙΩΝΙΚΗΣ ΕΛΛΗΝΙΚΗΣ: ΜΕΘΟΔΟΛΟΓΙΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ Η ΕΡΕΥΝΑ ΤΗΣ ΓΛΩΣΣΙΚΗΣ ΑΛΛΑΓΗΣ ΣΤΑ ΚΕΙΜΕΝΑ ΤΗΣ ΜΕΣΑΙΩΝΙΚΗΣ ΕΛΛΗΝΙΚΗΣ: ΜΕΘΟΔΟΛΟΓΙΚΗ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ ΠΗΓΩΝ Θεόδωρος Μαρκόπουλος University of Uppsala thodorismark@yahoo.gr Abstract This paper discusses methodological

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Ο ΜΗΤΡΙΚΟΣ ΘΗΛΑΣΜΟΣ ΚΑΙ Η ΣΧΕΣΗ ΤΟΥ ΜΕ ΤΟ ΚΑΡΚΙΝΟ ΤΟΥ ΜΑΣΤΟΥΣ ΣΤΙΣ ΓΥΝΑΙΚΕΣ ΠΟΥ ΕΙΝΑΙ ΦΟΡΕΙΣ ΤΟΥ ΟΓΚΟΓΟΝΙΔΙΟΥ BRCA1 ΚΑΙ BRCA2. Βασούλλα

Διαβάστε περισσότερα

Η αλληλεπίδραση ανάμεσα στην καθημερινή γλώσσα και την επιστημονική ορολογία: παράδειγμα από το πεδίο της Κοσμολογίας

Η αλληλεπίδραση ανάμεσα στην καθημερινή γλώσσα και την επιστημονική ορολογία: παράδειγμα από το πεδίο της Κοσμολογίας Η αλληλεπίδραση ανάμεσα στην καθημερινή γλώσσα και την επιστημονική ορολογία: παράδειγμα από το πεδίο της Κοσμολογίας ΠΕΡΙΛΗΨΗ Αριστείδης Κοσιονίδης Η κατανόηση των εννοιών ενός επιστημονικού πεδίου απαιτεί

Διαβάστε περισσότερα

Math 6 SL Probability Distributions Practice Test Mark Scheme

Math 6 SL Probability Distributions Practice Test Mark Scheme Math 6 SL Probability Distributions Practice Test Mark Scheme. (a) Note: Award A for vertical line to right of mean, A for shading to right of their vertical line. AA N (b) evidence of recognizing symmetry

Διαβάστε περισσότερα

Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ

Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΚΩΝ ΕΦΑΡΜΟΓΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ

Διαβάστε περισσότερα

«ΠΛΗΡΟΦΟΡΙΚΗ ΚΑΙ ΔΙΟΙΚΗΣΗ» ΠΡΟΣΔΙΟΡΙΣΤΙΚΟΙ ΠΑΡΑΓΟΝΤΕΣ ΤΗΣ ΧΡΗΜΑΤΟΠΙΣΤΩΤΙΚΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

«ΠΛΗΡΟΦΟΡΙΚΗ ΚΑΙ ΔΙΟΙΚΗΣΗ» ΠΡΟΣΔΙΟΡΙΣΤΙΚΟΙ ΠΑΡΑΓΟΝΤΕΣ ΤΗΣ ΧΡΗΜΑΤΟΠΙΣΤΩΤΙΚΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΔΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «ΠΛΗΡΟΦΟΡΙΚΗ ΚΑΙ ΔΙΟΙΚΗΣΗ» ΤΜΗΜΑΤΩΝ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Διπλωματική Εργασία ΠΡΟΣΔΙΟΡΙΣΤΙΚΟΙ ΠΑΡΑΓΟΝΤΕΣ

Διαβάστε περισσότερα

www.hepo.gr Αγαπητοί συνεργάτες,

www.hepo.gr Αγαπητοί συνεργάτες, /ΝΣΗ ΑΝΑΠΤΥΞΗΣ ΕΡΓΑΣΙΩΝ Αρµόδια: Ε. Παναγιωταροπούλου Τηλ.: 210 9982342 Fax : 210 9982402 e-mail: panagiotaropoulou@hepo.gr Url: ΚΥΠΡΟΣ - ΛΕΥΚΩΣΙΑ (13-15/12/2009) Αγαπητοί συνεργάτες, Εκατοντάδες ελληνικές

Διαβάστε περισσότερα

4.6 Autoregressive Moving Average Model ARMA(1,1)

4.6 Autoregressive Moving Average Model ARMA(1,1) 84 CHAPTER 4. STATIONARY TS MODELS 4.6 Autoregressive Moving Average Model ARMA(,) This section is an introduction to a wide class of models ARMA(p,q) which we will consider in more detail later in this

Διαβάστε περισσότερα

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας» ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΠΡΟΣΧΟΛΙΚΗΣ ΑΓΩΓΗΣ ΚΑΙ ΤΟΥ ΕΚΠΑΙ ΕΥΤΙΚΟΥ ΣΧΕ ΙΑΣΜΟΥ «ΠΑΙ ΙΚΟ ΒΙΒΛΙΟ ΚΑΙ ΠΑΙ ΑΓΩΓΙΚΟ ΥΛΙΚΟ» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ που εκπονήθηκε για τη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΤΗΣ ΕΛΙΑΣ

ΒΙΟΛΟΓΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΤΗΣ ΕΛΙΑΣ ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ: ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ: ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΤΗΣ ΕΛΙΑΣ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΠΑΛΑΤΟΣ ΑΘ. ΓΕΩΡΓΙΟΣ

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.36 Έκδοση ενημερωτικών φυλλαδίων Υπεύθυνος φορέας: Κέντρο Ελέγχου

Διαβάστε περισσότερα

DuPont Suva. DuPont. Thermodynamic Properties of. Refrigerant (R-410A) Technical Information. refrigerants T-410A ENG

DuPont Suva. DuPont. Thermodynamic Properties of. Refrigerant (R-410A) Technical Information. refrigerants T-410A ENG Technical Information T-410A ENG DuPont Suva refrigerants Thermodynamic Properties of DuPont Suva 410A Refrigerant (R-410A) The DuPont Oval Logo, The miracles of science, and Suva, are trademarks or registered

Διαβάστε περισσότερα

1000 VDC 1250 VDC 125 VAC 250 VAC J K 125 VAC, 250 VAC

1000 VDC 1250 VDC 125 VAC 250 VAC J K 125 VAC, 250 VAC Metallized Polyester Film Capacitor Type: ECQE(F) Non-inductive construction using metallized Polyester film with flame retardant epoxy resin coating Features Self-healing property Excellent electrical

Διαβάστε περισσότερα

Πτυχιακή Εργασία. Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους

Πτυχιακή Εργασία. Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΔΙΑΤΡΟΦΗΣ ΚΑΙ ΔΙΑΙΤΟΛΟΓΙΑΣ Πτυχιακή Εργασία Παραδοσιακά Προϊόντα Διατροφική Αξία και η Πιστοποίηση τους Εκπόνηση:

Διαβάστε περισσότερα

ΕΠΙΧΕΙΡΗΣΙΑΚΗ ΑΛΛΗΛΟΓΡΑΦΙΑ ΚΑΙ ΕΠΙΚΟΙΝΩΝΙΑ ΣΤΗΝ ΑΓΓΛΙΚΗ ΓΛΩΣΣΑ

ΕΠΙΧΕΙΡΗΣΙΑΚΗ ΑΛΛΗΛΟΓΡΑΦΙΑ ΚΑΙ ΕΠΙΚΟΙΝΩΝΙΑ ΣΤΗΝ ΑΓΓΛΙΚΗ ΓΛΩΣΣΑ Ανοικτά Ακαδημαϊκά Μαθήματα στο ΤΕΙ Ιονίων Νήσων ΕΠΙΧΕΙΡΗΣΙΑΚΗ ΑΛΛΗΛΟΓΡΑΦΙΑ ΚΑΙ ΕΠΙΚΟΙΝΩΝΙΑ ΣΤΗΝ ΑΓΓΛΙΚΗ ΓΛΩΣΣΑ Ενότητα 11: The Unreal Past Το περιεχόμενο του μαθήματος διατίθεται με άδεια Creative Commons

Διαβάστε περισσότερα

SAINT CATHERINE S GREEK SCHOOL ΕΛΛΗΝΙΚΟ ΣΧΟΛΕΙΟ ΑΓΙΑΣ ΑΙΚΑΤΕΡΙΝΗΣ

SAINT CATHERINE S GREEK SCHOOL ΕΛΛΗΝΙΚΟ ΣΧΟΛΕΙΟ ΑΓΙΑΣ ΑΙΚΑΤΕΡΙΝΗΣ SAINT CATHERINE S GREEK SCHOOL ΕΛΛΗΝΙΚΟ ΣΧΟΛΕΙΟ ΑΓΙΑΣ ΑΙΚΑΤΕΡΙΝΗΣ WELCOME TO ST. CATHERINE S GREEK SCHOOL! WEEKDAY GREEK SCHOOL - REGISTRATION FORM SCHOOL YEAR 2016-2017 ΑΙΤΗΣΗ ΕΓΓΡΑΦΗΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ

Διαβάστε περισσότερα

ΣΟΡΟΠΤΙΜΙΣΤΡΙΕΣ ΕΛΛΗΝΙΔΕΣ

ΣΟΡΟΠΤΙΜΙΣΤΡΙΕΣ ΕΛΛΗΝΙΔΕΣ ΕΛΛΗΝΙΔΕΣ ΣΟΡΟΠΤΙΜΙΣΤΡΙΕΣ ΕΚΔΟΣΗ ΤΗΣ ΣΟΡΟΠΤΙΜΙΣΤΙΚΗΣ ΕΝΩΣΗΣ ΕΛΛΑΔΟΣ - ΤΕΥΧΟΣ Νο 110 - Δ ΤΡΙΜΗΝΟ 2014 Το πρώτο βραβείο κέρδισε η Ελλάδα για την φωτογραφία Blue + Yellow = Green στον διαγωνισμό 2014 του

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ & ΠΛΗΡΟΦΟΡΙΚΗΣ. του Γεράσιμου Τουλιάτου ΑΜ: 697

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ & ΠΛΗΡΟΦΟΡΙΚΗΣ. του Γεράσιμου Τουλιάτου ΑΜ: 697 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ & ΠΛΗΡΟΦΟΡΙΚΗΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΣΤΑ ΠΛΑΙΣΙΑ ΤΟΥ ΜΕΤΑΠΤΥΧΙΑΚΟΥ ΔΙΠΛΩΜΑΤΟΣ ΕΙΔΙΚΕΥΣΗΣ ΕΠΙΣΤΗΜΗ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑ ΤΩΝ ΥΠΟΛΟΓΙΣΤΩΝ του Γεράσιμου Τουλιάτου

Διαβάστε περισσότερα

Η συμμετοχή της ορθοδοντικής θεραπείας στη δημιουργία υφιζήσεων των ούλων. Μία σύγχρονη επισκόπηση

Η συμμετοχή της ορθοδοντικής θεραπείας στη δημιουργία υφιζήσεων των ούλων. Μία σύγχρονη επισκόπηση Ορθοδοντική ΣTOMA 2014; 42 : 177-185 Βιβλιογραφική ανασκόπηση Η συμμετοχή της ορθοδοντικής θεραπείας στη δημιουργία υφιζήσεων των ούλων. Μία σύγχρονη επισκόπηση Ε. ΓΕΩΡΓΑΚΑ 1, Κ. ΑΛΕΞΑΝΔΡΟΥ 2, Ε. ΜΑΡΚΟΒΙΤΣΗ-ΓΕΩΡΓΙΑΔΟΥ

Διαβάστε περισσότερα

This is an electronic reprint of the original article. This reprint may differ from the original in pagination and typographic detail.

This is an electronic reprint of the original article. This reprint may differ from the original in pagination and typographic detail. This is an electronic reprint of the original article. This reprint may differ from the original in pagination and typographic detail. Author(s): Chasandra, Mary; Tsiaousi, Louisa; Zisi, Vasiliki; Karatzaferi,

Διαβάστε περισσότερα

Calculating the propagation delay of coaxial cable

Calculating the propagation delay of coaxial cable Your source for quality GNSS Networking Solutions and Design Services! Page 1 of 5 Calculating the propagation delay of coaxial cable The delay of a cable or velocity factor is determined by the dielectric

Διαβάστε περισσότερα

Thin Film Chip Resistors

Thin Film Chip Resistors FEATURES PRECISE TOLERANCE AND TEMPERATURE COEFFICIENT EIA STANDARD CASE SIZES (0201 ~ 2512) LOW NOISE, THIN FILM (NiCr) CONSTRUCTION REFLOW SOLDERABLE (Pb FREE TERMINATION FINISH) Type Size EIA PowerRating

Διαβάστε περισσότερα

Γιπλυμαηική Δπγαζία. «Ανθπυποκενηπικόρ ζσεδιαζμόρ γέθςπαρ πλοίος» Φοςζιάνηρ Αθανάζιορ. Δπιβλέπυν Καθηγηηήρ: Νηθφιανο Π. Βεληίθνο

Γιπλυμαηική Δπγαζία. «Ανθπυποκενηπικόρ ζσεδιαζμόρ γέθςπαρ πλοίος» Φοςζιάνηρ Αθανάζιορ. Δπιβλέπυν Καθηγηηήρ: Νηθφιανο Π. Βεληίθνο ΔΘΝΙΚΟ ΜΔΣΟΒΙΟ ΠΟΛΤΣΔΥΝΔΙΟ ΥΟΛΗ ΝΑΤΠΗΓΩΝ ΜΗΥΑΝΟΛΟΓΩΝ ΜΗΥΑΝΙΚΩΝ Γιπλυμαηική Δπγαζία «Ανθπυποκενηπικόρ ζσεδιαζμόρ γέθςπαρ πλοίος» Φοςζιάνηρ Αθανάζιορ Δπιβλέπυν Καθηγηηήρ: Νηθφιανο Π. Βεληίθνο Σπιμελήρ Δξεηαζηική

Διαβάστε περισσότερα

Cambridge International Examinations Cambridge International General Certificate of Secondary Education

Cambridge International Examinations Cambridge International General Certificate of Secondary Education Cambridge International Examinations Cambridge International General Certificate of Secondary Education GREEK 0543/03 Paper 3 Speaking Role Play Card One For Examination from 2015 SPECIMEN ROLE PLAY Approx.

Διαβάστε περισσότερα

Ενότητα 2 Εργαλεία για την αναζήτηση εργασίας: Το Βιογραφικό Σημείωμα

Ενότητα 2 Εργαλεία για την αναζήτηση εργασίας: Το Βιογραφικό Σημείωμα CURRICULUM VITAE Ενότητα 2 Εργαλεία για την αναζήτηση εργασίας: Το Βιογραφικό Σημείωμα 1.What is it? Τι είναι αυτό 2.Chronological example of a CV Χρονολογικό Παράδειγμα Βιογραφικού 3.Steps to send your

Διαβάστε περισσότερα

Συντακτικές λειτουργίες

Συντακτικές λειτουργίες 2 Συντακτικές λειτουργίες (Syntactic functions) A. Πτώσεις και συντακτικές λειτουργίες (Cases and syntactic functions) The subject can be identified by asking ποιος (who) or τι (what) the sentence is about.

Διαβάστε περισσότερα

ΓΗΠΛΧΜΑΣΗΚΖ ΔΡΓΑΗΑ ΑΡΥΗΣΔΚΣΟΝΗΚΖ ΣΧΝ ΓΔΦΤΡΧΝ ΑΠΟ ΑΠΟΦΖ ΜΟΡΦΟΛΟΓΗΑ ΚΑΗ ΑΗΘΖΣΗΚΖ

ΓΗΠΛΧΜΑΣΗΚΖ ΔΡΓΑΗΑ ΑΡΥΗΣΔΚΣΟΝΗΚΖ ΣΧΝ ΓΔΦΤΡΧΝ ΑΠΟ ΑΠΟΦΖ ΜΟΡΦΟΛΟΓΗΑ ΚΑΗ ΑΗΘΖΣΗΚΖ ΔΘΝΗΚΟ ΜΔΣΟΒΗΟ ΠΟΛΤΣΔΥΝΔΗΟ ΥΟΛΖ ΠΟΛΗΣΗΚΧΝ ΜΖΥΑΝΗΚΧΝ ΣΟΜΔΑ ΓΟΜΟΣΑΣΗΚΖ ΓΗΠΛΧΜΑΣΗΚΖ ΔΡΓΑΗΑ ΑΡΥΗΣΔΚΣΟΝΗΚΖ ΣΧΝ ΓΔΦΤΡΧΝ ΑΠΟ ΑΠΟΦΖ ΜΟΡΦΟΛΟΓΗΑ ΚΑΗ ΑΗΘΖΣΗΚΖ ΔΤΘΤΜΗΑ ΝΗΚ. ΚΟΤΚΗΟΤ 01104766 ΔΠΗΒΛΔΠΧΝ:ΑΝ.ΚΑΘΖΓΖΣΖ ΗΧΑΝΝΖ

Διαβάστε περισσότερα

Μηχανική Μάθηση Hypothesis Testing

Μηχανική Μάθηση Hypothesis Testing ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ Μηχανική Μάθηση Hypothesis Testing Γιώργος Μπορμπουδάκης Τμήμα Επιστήμης Υπολογιστών Procedure 1. Form the null (H 0 ) and alternative (H 1 ) hypothesis 2. Consider

Διαβάστε περισσότερα

Τομέας: Ανανεώσιμων Ενεργειακών Πόρων Εργαστήριο: Σχεδιομελέτης και κατεργασιών

Τομέας: Ανανεώσιμων Ενεργειακών Πόρων Εργαστήριο: Σχεδιομελέτης και κατεργασιών ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΡΗΤΗΣ ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΕΠΙΣΤΗΜΩΝ ΧΑΝΙΩΝ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ ΦΥΣΙΚΩΝ ΠΟΡΩΝ& ΠΕΡΙΒΑΛΛΟΝΤΟΣ Τομέας: Ανανεώσιμων Ενεργειακών Πόρων Εργαστήριο: Σχεδιομελέτης και κατεργασιών ΠΤΥΧΙΑΚΗ

Διαβάστε περισσότερα

EE101: Resonance in RLC circuits

EE101: Resonance in RLC circuits EE11: Resonance in RLC circuits M. B. Patil mbatil@ee.iitb.ac.in www.ee.iitb.ac.in/~sequel Deartment of Electrical Engineering Indian Institute of Technology Bombay I V R V L V C I = I m = R + jωl + 1/jωC

Διαβάστε περισσότερα

Δημιουργία Λογαριασμού Διαχείρισης Business Telephony Create a Management Account for Business Telephony

Δημιουργία Λογαριασμού Διαχείρισης Business Telephony Create a Management Account for Business Telephony Δημιουργία Λογαριασμού Διαχείρισης Business Telephony Create a Management Account for Business Telephony Ελληνικά Ι English 1/7 Δημιουργία Λογαριασμού Διαχείρισης Επιχειρηματικής Τηλεφωνίας μέσω της ιστοσελίδας

Διαβάστε περισσότερα

Case 1: Original version of a bill available in only one language.

Case 1: Original version of a bill available in only one language. currentid originalid attributes currentid attribute is used to identify an element and must be unique inside the document. originalid is used to mark the identifier that the structure used to have in the

Διαβάστε περισσότερα