Γραµµατικοί κανόνες Κανόνες µεταγραφής συµβόλων

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Γραµµατικοί κανόνες Κανόνες µεταγραφής συµβόλων"

Transcript

1 Πανεπιστήµιο Αθηνών, Τµήµα Ε.Μ.Μ.Ε. Εαρινό εξάµηνο 2004 Σ. A. Μοσχονάς, Γενική Γλωσσολογία 25 Μαΐου 2004 Γραµµατικοί κανόνες - Κανόνες µεταγραφής Ιεραρχία γραµµατικών: Γραµµατικές Πεπερασµένων Καταστάσεων, Συµφραστικά Ανεξάρτητες Γραµµατικές, Συµφραστικά Εξαρτηµένες γραµµατικές, Γραµµατικές Φραστικής οµής, Μετασχηµατιστικές Γραµµατικές Παραγωγή συµβολοσειρών Φραστικοί δείκτες οµική αµφισηµία Πρόταση Π Φράσεις ΟΦ, ΡΦ µη τερµατικά σύµβολα Μέρη του λόγου Α, Ο, Ρ Λέξεις ο Βαγγέλης κοιµάται τερµατικά σύµβολα Γραµµατικοί κανόνες Κανόνες µεταγραφής συµβόλων Α! Β / Γ, όπου: 1. Α, Β, Γ, είναι σύµβολα ή σειρές συµβόλων (συµβολοσειρές) 2. Α ή Β (αλλά όχι Α και Β) µπορούν να είναι Ø (κενά) 3. Γ, µπορούν να είναι Ø. Εάν Γ ή Ø, ο κανόνας λέγεται συµφραστικά εξαρτηµένος (contextsensitive) εάν Γ και = Ø, ο κανόνας λέγεται συµφραστικά ανεξάρτητος (context-free). Εάν Α! X Α, ο κανόνας λέγεται αναδροµικός (αναδροµικός δεξιά). Εάν Α! Α X, ο κανόνας λέγεται αναδροµικός αριστερά. Μια γραµµατική αποτελείται από (1) ένα αρχικό σύµβολο Π [=Πρόταση], (2α) ένα σύνολο τερµατικών συµβόλων, (2β) ένα σύνολο µη τερµατικών συµβόλων και (3) ένα σύνολο κανόνων που παράγουν συµβολοσειρές. Μια γλώσσα είναι ένα (άπειρο) σύνολο τερµατικών συµβολοσειρών. Λέµε ότι µια γλώσσα «περιγράφεται» ή «γεννιέται» ή «παράγεται» ή «απαριθµείται» ή «υπολογίζεται» από µια γραµµατική. Είδη γραµµατικής Γραµµατική Πεπερασµένων Καταστάσεων: Α! α Β (ή Α! Β α), Α! α, όπου τα Α, Β είναι µη τερµατικά (τελικά) σύµβολα και το α είναι τερµατικό (τελικό) σύµβολο. Συµφραστικά Ανεξάρτητη Γραµµατική: όπου το Α είναι µη τερµατικό σύµβολο και το Β είναι µια σειρά τερµατικών ή µη τερµατικών συµβόλων. Συµφραστικά Εξαρτηµένη Γραµµατική: ΓΑ! ΓΒ (Α! Β / Γ ), όπου το Α είναι µη τερµατικό σύµβολο, τα Γ, είναι σειρές τερµατικών ή µη τερµατικών συµβόλων και τουλάχιστον ένα από τα Γ, δεν είναι Ø. Εναλλακτικά: όπου Α, Β είναι δύο οποιεσδήποτε συµβολοσειρές: Α Β, όπου Χ το µήκος της συµβολοσειράς Χ. 1

2 Γραµµατικές Φραστικής οµής: όπου Α, Β είναι δύο οποιεσδήποτε συµβολοσειρές, τερµατικών ή µη τερµατικών συµβόλων. Μετασχηµατιστικές Γραµµατικές: γραµµατικές εξαρτηµένες ή ανεξάρτητες συµφραστικά οι οποίες, επιπλέον, περιέχουν κανόνες φραστικής δοµής όπου Α, Β είναι οποιεσδήποτε σειρές τερµατικών ή µη τερµατικών συµβόλων. Οι κανόνες αυτοί λέγονται µετασχηµατισµοί. Ιεραρχία των γραµµατικών µετασχηµατιστικές γραµµατικές γραµµατικές φραστικής δοµής συµφραστικά εξαρτηµένες γραµµατικές συµφραστικά ανεξάρτητες γραµµατικές γραµµατικές πεπερασµένων καταστάσεων µετασχηµατιστικές γραµµατικές γραµµατικές φραστικής δοµής συµφραστικά εξαρτηµένες γραµµατικές συµφραστικά ανεξάρτητες γραµµατικές γραµµατικές πεπερασµένων καταστάσεων Παραδείγµατα 1. comes S! the A, A! man B 1, man A! men B 2, S F B 1! comes F, the B 2! come F. men come 2. άνθρωπος έρχεται πολύ S! o Α 1, S! oι Α 2, Α 1! άνθρωπος Β 1, o Β 1! έρχεται Γ 1, Γ 1! πολύ Γ 1 S F Γ 1! γρήγορα F οι γρήγορα Α 2! άνθρωποι Β 2, έρχονται Β 2! έρχονται Γ 2, Γ 2! πολύ Γ 2 άνθρωποι Γ 2! γρήγορα F. 2

3 3. Επίθετο Όνοµα Ρήµα ενικός αριθµός Επιρ. Προσδ. Άρθρο S Επίρρηµα F Άρθρο Όνοµα Ρήµα πληθυντικός αριθµός Επίθετο 4. {αβ, ααββ, αααβββ, } = {α ν β ν : ν 1} Μη τερµατικά σύµβολα: Π 1. Π! α Π β 2. Π! Ø α Π β α α Π β β α α Ø ββ α α β β 5. {αα, ββ, αββα, βααβ, αααα, ββββ, ααββαα, αββββα, } = {ww R : w = α,β} Μη τερµατικά σύµβολα: Π 1. Π! α Π α 2. Π! β Π β 3. Π! Ø 6. {αα, ββ, αβαβ, βαβα, αααα, ββββ, ααβααβ, αββαββ, } = {ww: w = α,β} Μη τερµατικά σύµβολα: Π, Χ 1, Χ 2, Χ 3, Α, Β 1. Π! Χ 1 Χ 2 Χ 3 2. Χ 1 Χ 2! α Χ 1 Α 3. Χ 1 Χ 2! β Χ 1 Β 4. Α β! β Α 5. Β α! α Β 6. Α Χ 3! Χ 2 α Χ 3 7. Β Χ 3! Χ 2 β Χ 3 8. α Χ 2! Χ 2 α 9. β Χ 2! Χ 2 β 10. Χ 1 Χ 2! Ø 11. Χ 3! Ø α Π α α α Π α α α α β Π β α α α α β α Π α β α α α α β α Ø α β α α α α β α α β α α Χ 1 Χ 2 Χ 3 α Χ 1 Α Χ 3 α Χ 1 Χ 2 α Χ 3 α β Χ 1 Β α Χ 3 α β Χ 1 α Β Χ 3 α β Χ 1 α Χ 2 β Χ 3 α β Χ 1 Χ 2 α β Χ 3 α β Ø α β Ø α β α β 3

4 Θεώρηµα 1. Οι φυσικές γλώσσες δεν µπορούν να παραχθούν από γραµµατικές πεπερασµένων καταστάσεων. Απόδειξη: Έστω µια γλώσσα που περιέχει τις µονάδες (σύµβολα) α, β. Οι ακόλουθες δοµές της γλώσσας αυτής δεν µπορούν να παραχθούν από γραµµατικές πεπερασµένων καταστάσεων: (i) αβ, ααββ, αααβββ, Γ={α ν β ν : ν 1} (ii) αα, ββ, αββα, βααβ, αααα, ββββ, ααββαα, αββββα, Γ = {ww R : w = α,β} (iii) αα, ββ, αβαβ, βαβα, αααα, ββββ, ααβααβ, αββαββ, Γ= {ww: w = α,β} Η (i) και η (ii) παράγονται από µια συµφραστικά ανεξάρτητη γραµµατική. Η (iii) παράγεται από µια γραµµατική φραστικής δοµής (βλ. παραπάνω). Όµως οι δοµές αυτού του τύπου είναι πολύ διαδεδοµένες στις φυσικές γλώσσες. Π.χ., Εάν Π 1 τότε Π 2 Είτε Π 3 είτε Π 4 [ α [ α [ α ] β ] β ] β Είπε ότι θα έρθει, αλλά πολύ αµφιβάλλω αν θα έρθει Ο άνθρωπος που είπε ότι Π 5 φτάνει σήµερα Ήρθε και ο σκύλος και τρόµαξε το γάτο που έφαγε τον ποντικό που πήρε το φυτίλι µέσα απ το καντήλι που έφεγγε και κένταγε η κόρη το µαντίλι. Άρα, οι γραµµατικές πεπερασµένων καταστάσεων δεν είναι κατάλληλες για τις φυσικές γλώσσες. Θεώρηµα 2. Οι γραµµατικές των φυσικών γλωσσών δεν είναι ισοδύναµες µε τις µετασχηµατιστικές γραµµατικές ή µε τις γραµµατικές φραστικής δοµής. Απόδειξη (Peters Ritchie): Οι µετασχηµατιστικές γραµµατικές και οι γραµµατικές φραστικής δοµής είναι πολύ ισχυρές για να είναι χρήσιµες στην περιγραφή των φυσικών γλωσσών. Ασκήσεις 1. Θ. Παυλίδου, Επίπεδα γλωσσικής ανάλυσης, σσ Πολλοί ξεχνιούνται στο ταίριασµα των παρενθέσεων. Γράψτε µια γραµµατική ισορροπηµένων παρενθέσεων, δηλ. µια γραµµατική που να παράγει τη γλώσσα: { (), (()),, ()(), ()(()),, (())(), (())(),, (()())((())),, (()()(()())), }. 3. Σχεδιάστε φραστικούς δείκτες για τις ακόλουθες δοµικά διφορούµενες φράσεις και προτάσεις: η αγάπη του Θεού η περιγραφή του παιδιού Σκότωσε τον άνθρωπο µε το πριόνι πολλοί φοιτητές και ενδιαφερόµενοι καθηγητές Έφτασε νωρίς χτες βράδι. 4. Γράψτε γραµµατικές για το ακόλουθο τµήµα της ελληνικής γλώσσας: {Ο Γιάννης, που ήρθε χτες, κοιµάται σήµερα Η Μαρία, που κοιµόταν χτες, ήρθε σήµερα Ο Νίκος, που έγραφε χτες, διαβάζει σήµερα Η Γιαννούλα, που έφυγε σήµερα, έγραφε χτες } 5. Γράψτε τη γραµµατική της γλώσσας {α ν γ ν β ν : ν 1}. Τι παρατηρείτε σε σχέση µε τη γραµµατική της γλώσσας {α ν β ν : ν 1}; 4

5 Γ = { ν ν ν : ν 1} Τ. σ.:,, Μη τ. σ.: Π,, - Κ.: 1. Π! 2.! 3.! ! ! 5

ΣΥΝΤΑΚΤΙΚΟΙ ΟΡΟΙ. Η σύνταξη μιας πρότασης

ΣΥΝΤΑΚΤΙΚΟΙ ΟΡΟΙ. Η σύνταξη μιας πρότασης ΣΥΝΤΑΚΤΙΚΟΙ ΟΡΟΙ Η σύνταξη μιας πρότασης Τα δύο πιο βασικά στοιχεία σε κάθε πρόταση είναι το ρήμα και το ουσιαστικό. Το κομμάτι της πρότασης που αναφέρεται στο ρήμα το λέμε ρηματικό σύνολο (ΡΣ) ή ρηματικό

Διαβάστε περισσότερα

Θεωρία Υπολογισµού και Πολυπλοκότητα

Θεωρία Υπολογισµού και Πολυπλοκότητα Θεωρία Υπολογισµού και Πολυπλοκότητα Κεφάλαιο 3. Γλώσσες και Συναρτήσεις 30 Ιανουαρίου 2007 ρ. Παπαδοπούλου Βίκη 1 3.1.1. Αλφάβητο Πως υλοποιούµε σεέναυπολογιστήένααλγόριθµοήµια σχέση; Αλφάβητο ή Γλώσσα

Διαβάστε περισσότερα

Μηχανές Πεπερασµένων Καταστάσεων

Μηχανές Πεπερασµένων Καταστάσεων Μηχανές Επεξεργασίας Πληροφοριών Μηχανές Πεπερασµένων Καταστάσεων Είναι µηχανές που δέχονται ένα σύνολο από σήµατα εισόδου και παράγουν ένα αντίστοιχο σύνολο σηµάτων εξόδου Σήµατα Εισόδου Μηχανή Επεξεργασίας

Διαβάστε περισσότερα

Η δυαδική σχέση M ( «παράγει σε ένα βήμα» ) ορίζεται ως εξής: (q, w) M (q, w ), αν και μόνο αν w = σw, για κάποιο σ Σ

Η δυαδική σχέση M ( «παράγει σε ένα βήμα» ) ορίζεται ως εξής: (q, w) M (q, w ), αν και μόνο αν w = σw, για κάποιο σ Σ Πεπερασμένα Αυτόματα (ΠΑ) Τα πεπερασμένα αυτόματα είναι οι απλούστερες «υπολογιστικές μηχανές». Δεν έχουν μνήμη, μόνο μία εσωτερική μονάδα με πεπερασμένο αριθμό καταστάσεων. Διαβάζουν τη συμβολοσειρά εισόδου

Διαβάστε περισσότερα

Μοντελοποίηση Υπολογισμού. Γραμματικές Πεπερασμένα Αυτόματα Κανονικές Εκφράσεις

Μοντελοποίηση Υπολογισμού. Γραμματικές Πεπερασμένα Αυτόματα Κανονικές Εκφράσεις Μοντελοποίηση Υπολογισμού Γραμματικές Πεπερασμένα Αυτόματα Κανονικές Εκφράσεις Προβλήματα - Υπολογιστές Δεδομένου ενός προβλήματος υπάρχουν 2 σημαντικά ερωτήματα: Μπορεί να επιλυθεί με χρήση υπολογιστή;

Διαβάστε περισσότερα

ΕΛΑΧΙΣΤΑ ΑΝΩ ΜΕΓΙΣΤΑ ΚΑΤΩ ΦΡΑΓΜΑΤΑ

ΕΛΑΧΙΣΤΑ ΑΝΩ ΜΕΓΙΣΤΑ ΚΑΤΩ ΦΡΑΓΜΑΤΑ ΕΛΑΧΙΣΤΑ ΑΝΩ ΜΕΓΙΣΤΑ ΚΑΤΩ ΦΡΑΓΜΑΤΑ Κασαπίδης Γεώργιος Μαθηµατικός Στο άρθρο αυτό µελετάµε την πιο χαρακτηριστική ιδιότητα του συνόλου R των πραγµατικών αριθµών. ΟΡΙΣΜΟΣ 1 Ένα σύνολο Α από πραγµατικούς

Διαβάστε περισσότερα

Απάντηση: (func endfunc)-([a-za-z])+

Απάντηση: (func endfunc)-([a-za-z])+ Γλώσσες Προγραμματισμού Μεταγλωττιστές Ασκήσεις Επανάληψης ) Περιγράψτε τις κανονικές εκφράσεις που υποστηρίζουν (i) συμβολοσειρές που ξεκινούν με το πρόθεμα "func" ή "endfunc" ακολουθούμενο το σύμβολο

Διαβάστε περισσότερα

Μάθημα 1. Ας γνωριστούμε λοιπόν!!! Σήμερα συναντιόμαστε για πρώτη φορά. Μαζί θα περάσουμε τους επόμενους

Μάθημα 1. Ας γνωριστούμε λοιπόν!!! Σήμερα συναντιόμαστε για πρώτη φορά. Μαζί θα περάσουμε τους επόμενους Μάθημα 1 Ας γνωριστούμε λοιπόν!!! Σήμερα συναντιόμαστε για πρώτη φορά. Μαζί θα περάσουμε τους επόμενους μήνες και θα μοιραστούμε πολλά! Ας γνωριστούμε λοιπόν. Ο καθένας από εμάς ας πει λίγα λόγια για τον

Διαβάστε περισσότερα

ΟΡΙΣΜΟΣ ΠΑΡΑΓΩΓΟΥ ΟΡΙΣΜΟΣ ΕΦΑΠΤΟΜΕΝΗΣ

ΟΡΙΣΜΟΣ ΠΑΡΑΓΩΓΟΥ ΟΡΙΣΜΟΣ ΕΦΑΠΤΟΜΕΝΗΣ ΟΡΙΣΜΟΣ ΠΑΡΑΓΩΓΟΥ. Mια συνάρτηση λέμε ότι είναι παραγωγίσιμη σε ένα σημείο του πεδίου ορισμού ( της, αν υπάρει το lim και είναι πραγματικός αριθμός. Το όριο αυτό λέγεται παράγωγος της στο και συμβολίζεται

Διαβάστε περισσότερα

Το σύνολο Z των Ακεραίων : Z = {... 2, 1, 0, 1, 2, 3,... } Να σηµειώσουµε ότι οι φυσικοί αριθµοί είναι και ακέραιοι.

Το σύνολο Z των Ακεραίων : Z = {... 2, 1, 0, 1, 2, 3,... } Να σηµειώσουµε ότι οι φυσικοί αριθµοί είναι και ακέραιοι. 1 E. ΣΥΝΟΛΑ ΘΕΩΡΙΑ 1. Ορισµός του συνόλου Σύνολο λέγεται κάθε συλλογή πραγµατικών ή φανταστικών αντικειµένων, που είναι καλά ορισµένα και διακρίνονται το ένα από το άλλο. Τα παραπάνω αντικείµενα λέγονται

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕΔΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΦΑΡΜΟΣΜΕΝΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΘΕΩΡΙΑ ΥΠΟΛΟΓΙΣΜΩΝ ΚΑΙ ΑΥΤΟΜΑΤΩΝ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕΔΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΦΑΡΜΟΣΜΕΝΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΘΕΩΡΙΑ ΥΠΟΛΟΓΙΣΜΩΝ ΚΑΙ ΑΥΤΟΜΑΤΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕΔΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΦΑΡΜΟΣΜΕΝΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΘΕΩΡΙΑ ΥΠΟΛΟΓΙΣΜΩΝ ΚΑΙ ΑΥΤΟΜΑΤΩΝ Τελικές εξετάσεις 3 Ιανουαρίου 27 Διάρκεια εξέτασης: 3 ώρες (2:-5:) ΘΕΜΑ ο

Διαβάστε περισσότερα

Η γεωµετρική εποπτεία στην παρουσίαση της απόλυτης τιµής

Η γεωµετρική εποπτεία στην παρουσίαση της απόλυτης τιµής Η γεωµετρική εποπτεία στην παρουσίαση της απόλυτης τιµής Η µέθοδος άξονα-κύκλου: µια διδακτική πρόταση για την επίλυση εξισώσεων και ανισώσεων µε απόλυτες τιµές στην Άλγεβρα της Α Λυκείου ηµήτριος Ντρίζος

Διαβάστε περισσότερα

Γλώσσες Χωρίς Συμφραζόμενα

Γλώσσες Χωρίς Συμφραζόμενα Γλώσσες Χωρίς Συμφραζόμενα Διδάσκοντες: Φ. Αφράτη, Δ. Φωτάκης, Δ. Σούλιου Επιμέλεια διαφανειών: Δ. Φωτάκης Σχολή Ηλεκτρολόγων Μηχανικών και Μηχανικών Υπολογιστών Εθνικό Μετσόβιο Πολυτεχνείο Γλώσσα χωρίς

Διαβάστε περισσότερα

Αυτόματα. Παράδειγμα: πωλητής καφέ (iii) Παράδειγμα: πωλητής καφέ (iv) Εισαγωγή στην Επιστήμη των Υπολογιστών 6

Αυτόματα. Παράδειγμα: πωλητής καφέ (iii) Παράδειγμα: πωλητής καφέ (iv) Εισαγωγή στην Επιστήμη των Υπολογιστών 6 Εισαγωγή στην Επιστήμη των Υπολογιστών 3η ενότητα: Αυτόματα και Τυπικές Γραμματικές http://www.corelab.ece.ntua.gr/courses/ Αυτόματα Τρόπος κωδικοποίησης αλγορίθμων. Τρόπος περιγραφής συστημάτων πεπερασμένων

Διαβάστε περισσότερα

11, 12, 13, 14, 21, 22, 23, 24, 31, 32, 33, 34, 41, 42, 43, 44.

11, 12, 13, 14, 21, 22, 23, 24, 31, 32, 33, 34, 41, 42, 43, 44. ΤΕΧΝΙΚΕΣ ΚΑΤΑΜΕΤΡΗΣΗΣ Η καταµετρηση ενος συνολου µε πεπερασµενα στοιχεια ειναι ισως η πιο παλια µαθηµατικη ασχολια του ανθρωπου. Θα µαθουµε πως, δεδοµενης της περιγραφης ενος συνολου, να µπορουµε να ϐρουµε

Διαβάστε περισσότερα

8 η Ενότητα. Κατάκτηση του σημασιολογικού τομέα

8 η Ενότητα. Κατάκτηση του σημασιολογικού τομέα 8 η Ενότητα Κατάκτηση του σημασιολογικού τομέα 1. Εισαγωγή Είχαμε πει στο μάθημα Εισαγωγή στη Γλωσσολογία, ότι ο τομέας της Σημασιολογίας χωρίζεται στη λεξική και στη δομική σημασιολογία. Όσον αφορά τη

Διαβάστε περισσότερα

Απλές ασκήσεις για αρχάριους μαθητές 5

Απλές ασκήσεις για αρχάριους μαθητές 5 Περιεχόμενα Το ελληνικό αλφάβητο... 9 Ενεστώτας (το βοηθητικό ρήμα είμαι) Γραμματική...10 Ενεστώτας (ενεργητική φωνή, α συζυγία) Γραμματική...10 Ενεστώτας (ενεργητική φωνή, α συζυγία και βοηθητικό ρήμα

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΗ ΛΟΓΙΚΗ ΚΑΙ ΑΠΟΔΕΙΞΗ

ΜΑΘΗΜΑΤΙΚΗ ΛΟΓΙΚΗ ΚΑΙ ΑΠΟΔΕΙΞΗ ΜΑΘΗΜΑΤΙΚΗ ΛΟΓΙΚΗ ΚΑΙ ΑΠΟΔΕΙΞΗ Περιεχόμενα : Α) Προτάσεις-Σύνθεση προτάσεων Β)Απόδειξη μιας πρότασης Α 1 ) Τι είναι πρόταση Β 1 ) Βασικές έννοιες Α ) Συνεπαγωγή Β ) Βασικές μέθοδοι απόδειξης Α 3 ) Ισοδυναμία

Διαβάστε περισσότερα

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΔΗΜΗΤΡΙΟΥ ΑΘ. ΚΡΟΝΤΣΟΥ ΘΕΜΑ: ΓΡΑΜΜΑΤΙΚΗ-ΣΥΝΤΑΚΤΙΚΗ ΑΝΑΛΥΣΗ ΤΗΣ ΝΕΑΣ ΕΛΛΗΝΙΚΗΣ ΓΛΩΣΣΑΣ ΕΙΣΗΓΗΤΗΣ: ΙΩΑΝΝΗΣ ΡΕΦΑΝΙΔΗΣ

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΔΗΜΗΤΡΙΟΥ ΑΘ. ΚΡΟΝΤΣΟΥ ΘΕΜΑ: ΓΡΑΜΜΑΤΙΚΗ-ΣΥΝΤΑΚΤΙΚΗ ΑΝΑΛΥΣΗ ΤΗΣ ΝΕΑΣ ΕΛΛΗΝΙΚΗΣ ΓΛΩΣΣΑΣ ΕΙΣΗΓΗΤΗΣ: ΙΩΑΝΝΗΣ ΡΕΦΑΝΙΔΗΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ: ΓΡΑΜΜΑΤΙΚΗ-ΣΥΝΤΑΚΤΙΚΗ ΑΝΑΛΥΣΗ ΤΗΣ ΝΕΑΣ ΕΛΛΗΝΙΚΗΣ ΓΛΩΣΣΑΣ ΔΗΜΗΤΡΙΟΥ ΑΘ. ΚΡΟΝΤΣΟΥ ΕΙΣΗΓΗΤΗΣ: ΙΩΑΝΝΗΣ ΡΕΦΑΝΙΔΗΣ Στόχοι της εργασίας Εντρύφηση στις βασικές αρχές της Επεξεργασίας

Διαβάστε περισσότερα

Παραδείγµατα συναρτήσεων: f:[0,+ ) IR, f(x)=2+ x f:ir IR: f(x)=

Παραδείγµατα συναρτήσεων: f:[0,+ ) IR, f(x)=2+ x f:ir IR: f(x)= ΣΥΝΑΡΤΗΣΕΙΣ - 9 - ΚΕΦΑΛΑΙ ΚΕΦΑΛΑΙ ο - ΣΥΝΑΡΤΗΣΕΙΣ.. ρισµός Συνάρτηση από ένα σύνολο Α σ ένα σύνολο Β είναι ένας κανόνας µε τον οποίο κάθε στοιχείο του Α απεικονίζεται σε ένα ακριβώς στοιχείο του Β. Το

Διαβάστε περισσότερα

ΣΤΟΙΧΕΙΑ ΘΕΜΕΛΙΩΣΕΩΝ ΥΠΟΛΟΓΙΣΤΙΚΩΝ ΜΗΧΑΝΩΝ ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ ΚΑΙ ΤΟ ΛΥΚΕΙΟ

ΣΤΟΙΧΕΙΑ ΘΕΜΕΛΙΩΣΕΩΝ ΥΠΟΛΟΓΙΣΤΙΚΩΝ ΜΗΧΑΝΩΝ ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ ΚΑΙ ΤΟ ΛΥΚΕΙΟ ΜΕΡΟΣ ΤΡΙΤΟ Ένταξη των Τ.Π.Ε. στην διδασκαλία και τη µάθηση I) ΣΤΟΙΧΕΙΑ ΘΕΜΕΛΙΩΣΕΩΝ ΥΠΟΛΟΓΙΣΤΙΚΩΝ ΜΗΧΑΝΩΝ ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ ΚΑΙ ΤΟ ΛΥΚΕΙΟ Παύλος Γ. Σπυράκης (google: Paul Spirakis) Ερευνητικό Ακαδηµαϊκό

Διαβάστε περισσότερα

Βρέντζου Τίνα Φυσικός Μεταπτυχιακός τίτλος: «Σπουδές στην εκπαίδευση» ΜEd Email : stvrentzou@gmail.com

Βρέντζου Τίνα Φυσικός Μεταπτυχιακός τίτλος: «Σπουδές στην εκπαίδευση» ΜEd Email : stvrentzou@gmail.com Βρέντζου Τίνα Φυσικός Μεταπτυχιακός τίτλος: «Σπουδές στην εκπαίδευση» ΜEd Email : stvrentzou@gmail.com 1 1.Σύνολα Σύνολο είναι μια ολότητα από σαφώς καθορισμένα και διακεκριμένα αντικείμενα. Τα φωνήεντα

Διαβάστε περισσότερα

Επιμέλεια: Σπυρίδων Τζινιέρης-ΘΕΩΡΙΑ ΚΛΑΣΜΑΤΩΝ ΓΙΑ ΤΗΝ Α ΓΥΜΝΑΣΙΟΥ ΘΕΩΡΙΑ ΚΛΑΣΜΑΤΩΝ Α ΓΥΜΝΑΣΙΟΥ

Επιμέλεια: Σπυρίδων Τζινιέρης-ΘΕΩΡΙΑ ΚΛΑΣΜΑΤΩΝ ΓΙΑ ΤΗΝ Α ΓΥΜΝΑΣΙΟΥ ΘΕΩΡΙΑ ΚΛΑΣΜΑΤΩΝ Α ΓΥΜΝΑΣΙΟΥ Τι είναι κλάσμα; Κλάσμα είναι ένα μέρος μιας ποσότητας. ΘΕΩΡΙΑ ΚΛΑΣΜΑΤΩΝ Α ΓΥΜΝΑΣΙΟΥ Κλάσμα είναι ένας λόγος δύο αριθμών(fraction is a ratio of two whole numbers) Πως εκφράζετε συμβολικά ένα κλάσμα; Εκφράζετε

Διαβάστε περισσότερα

Λίστα Λσ Προτίμησης Ανδρών. Έκτορας Βάσω Δήμητρα Άννα Ελένη Γεωργία. Βασίλης Δήμητρα Βάσω Άννα Γεωργία Ελένη Γιάννης Βάσω Ελένη Γεωργία Δήμητρα Άννα

Λίστα Λσ Προτίμησης Ανδρών. Έκτορας Βάσω Δήμητρα Άννα Ελένη Γεωργία. Βασίλης Δήμητρα Βάσω Άννα Γεωργία Ελένη Γιάννης Βάσω Ελένη Γεωργία Δήμητρα Άννα Βασίλης Βασίλης Γά Βασίλης Ανδρέας Βασίλης Βασίλης Βασίλης Ανδρέας Βασίλης Ο Ανδρέας κάνει πρόταση στην. Βασίλης Γά Βασίλης Ανδρέας Βασίλης Βασίλης Βασίλης Ανδρέας Βασίλης Βασίλης Γά Βασίλης Ανδρέας Βασίλης

Διαβάστε περισσότερα

Γραμματική και Συντακτικό Γ Δημοτικού ανά ενότητα - Παρασκευή Αντωνίου

Γραμματική και Συντακτικό Γ Δημοτικού ανά ενότητα - Παρασκευή Αντωνίου Ενότητα 1η: «Πάλι μαζί!» Σημεία στίξης: τελεία ερωτηματικό...4 Η δομή της πρότασης: ρήμα υποκείμενο αντικείμενο...5 Ουσιαστικά: αριθμοί γένη...6 Ονομαστική πτώση ουσιαστικών...6 Οριστικό άρθρο...7 Ερωτηματικές

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 ο. Πίνακας διερεύνησης της εξίσωσης Εξίσωση: αx 2 +βx+γ=0 (α 0) (Ε) Έχει ΥΟ ρίζες άνισες που δίνονται από τους τύπους x 1,2 =

ΚΕΦΑΛΑΙΟ 4 ο. Πίνακας διερεύνησης της εξίσωσης Εξίσωση: αx 2 +βx+γ=0 (α 0) (Ε) Έχει ΥΟ ρίζες άνισες που δίνονται από τους τύπους x 1,2 = ΕΞΙΩΕΙ-ΑΝΙΩΕΙ ου ΒΑΘΜΟΥ - 38 - ΚΕΦΑΑΙΟ 4 ΚΕΦΑΑΙΟ 4 ο Εξισώσεις - Ανισώσεις β βαθµού 5.1. Μορφή και διερεύνηση της εξίσωσης β βαθµού Άθροισµα και γινόµενο των ριζών της Κάθε εξίσωση β βαθµού πριν τη λύσουµε,

Διαβάστε περισσότερα

Αφιέρωση Στα παιδιά µας Στους µαθητές που ατενίζουν µε αισιοδοξία το µέλλον

Αφιέρωση Στα παιδιά µας Στους µαθητές που ατενίζουν µε αισιοδοξία το µέλλον Αφιέρωση Σταπαιδιάµας Στουςµαθητέςπουατενίζουν µεαισιοδοξίατοµέλλον Φίληµαθήτρια,φίλεµαθητή Τοβιβλίοαυτόέχειδιπλόσκοπό: Νασεβοηθήσειστηνάρτιαπροετοιµασίατουκαθηµερινούσχολικού µαθήµατος. Νασουδώσειόλατααπαραίτηταεφόδια,ώστενααποκτήσειςγερές

Διαβάστε περισσότερα

Ä ÑÁÓÔÇÑÉÏÔÇÔÁ 1ç. Απάντηση Οι γωνίες που σχηµατίζονται είναι: Α. αµβλεία Β. ευθεία Γ. πλήρης. οξεία Ε. ορθή Ζ. αµβλεία Η. οξεία.

Ä ÑÁÓÔÇÑÉÏÔÇÔÁ 1ç. Απάντηση Οι γωνίες που σχηµατίζονται είναι: Α. αµβλεία Β. ευθεία Γ. πλήρης. οξεία Ε. ορθή Ζ. αµβλεία Η. οξεία. Ä ÑÁÓÔÇÑÉÏÔÇÔÁ 1ç Σε όλα τα παρακάτω αντικείµενα σχηµατίζονται διάφορες γωνίες ανάλογα µε τη σχετική θέση, κάθε φορά, δύο ηµιευθειών που έχουν ένα κοινό ση- µείο, όπως π.χ. είναι οι δείκτες του ρολογιού,

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ Β ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ Β ΛΥΚΕΙΟΥ ΜΑΘΗΜΑΤΙΚΑ ΚΑΤΕΥΘΥΝΣΗΣ Β ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΘΕΜΑ 1 ο Α) Συµπληρώστε τα κενά στις παρακάτω προτάσεις: 1) Ο κύκλος µε κέντρο Κ(α, β) και ακτίνα ρ > έχει εξίσωση... ) Η εξίσωση του κύκλου µε κέντρο στην αρχή

Διαβάστε περισσότερα

CSC 314: Switching Theory

CSC 314: Switching Theory CSC 314: Switching Theory Course Summary 9 th January 2009 1 1 Θέματα Μαθήματος Ερωτήσεις Τι είναι αλγόριθμος? Τι μπορεί να υπολογιστεί? Απαντήσεις Μοντέλα Υπολογισμού Δυνατότητες και μη-δυνατότητες 2

Διαβάστε περισσότερα

Ερωτήσεις θεωρίας για τα Μαθηματικά Γ γυμνασίου

Ερωτήσεις θεωρίας για τα Μαθηματικά Γ γυμνασίου Ερωτήσεις θεωρίας για τα Μαθηματικά Γ γυμνασίου Άλγεβρα 1.1 Β : Δυνάμεις πραγματικών αριθμών. 1. Πως ορίζεται η δύναμη ενός πραγματικού αριθμού ; Η δύναμη με βάση έναν πραγματικό αριθμό α και εκθέτη ένα

Διαβάστε περισσότερα

Σηµειώσεις στις σειρές

Σηµειώσεις στις σειρές . ΟΡΙΣΜΟΙ - ΓΕΝΙΚΕΣ ΕΝΝΟΙΕΣ Σηµειώσεις στις σειρές Στην Ενότητα αυτή παρουσιάζουµε τις βασικές-απαραίτητες έννοιες για την µελέτη των σειρών πραγµατικών αριθµών και των εφαρµογών τους. Έτσι, δίνονται συστηµατικά

Διαβάστε περισσότερα

2. Στοιχεία Πολυδιάστατων Κατανοµών

2. Στοιχεία Πολυδιάστατων Κατανοµών Στοιχεία Πολυδιάστατων Κατανοµών Είναι φανερό ότι έως τώρα η µελέτη µας επικεντρώνεται κάθε φορά σε πιθανότητες που αφορούν µία τυχαία µεταβλητή Σε αρκετές όµως περιπτώσεις ενδιαφερόµαστε να εξετάσουµε

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις Αλληλεπιδράσεις γονιδίων Ι ασκήσεις 1. Στους σκύλους Labrador ένα θηλυκό άτομο με καστανό χρωματισμό διασταυρώθηκε με αρσενικό που είχε χρυσαφί χρωματισμό. Όλοι οι F1 απόγονοι είχαν μαύρο χρωματισμό. Η

Διαβάστε περισσότερα

4.4 Ερωτήσεις διάταξης. Στις ερωτήσεις διάταξης δίνονται:

4.4 Ερωτήσεις διάταξης. Στις ερωτήσεις διάταξης δίνονται: 4.4 Ερωτήσεις διάταξης Στις ερωτήσεις διάταξης δίνονται:! µία σειρά από διάφορα στοιχεία και! µία πρόταση / κανόνας ή οδηγία και ζητείται να διαταχθούν τα στοιχεία µε βάση την πρόταση αυτή. Οι ερωτήσεις

Διαβάστε περισσότερα

Επίπεδα Γραφήματα (planar graphs)

Επίπεδα Γραφήματα (planar graphs) Επίπεδα Γραφήματα (planar graphs) Μπορούν να σχεδιαστούν στο επίπεδο χωρίς να τέμνονται οι ακμές τους 1 2 1 2 3 4 3 4 Άρα αυτό το γράφημα είναι επίπεδο Επίπεδα Γραφήματα (planar graphs) Μπορούν να σχεδιαστούν

Διαβάστε περισσότερα

6. Εγγεγραμμένα Σχήματα. Αθανασίου Δημήτρης (Μαθηματικός) asepfreedom@yahoo.gr

6. Εγγεγραμμένα Σχήματα. Αθανασίου Δημήτρης (Μαθηματικός) asepfreedom@yahoo.gr 6. Εγγεγραμμένα Σχήματα Αθανασίου Δημήτρης (Μαθηματικός) asepfreedom@yahoo.gr 1 Επίκεντρη γωνία Μια γωνία λέγεται επίκεντρη γωνία ενός κύκλου αν η κορυφή της είναι το κέντρο του κύκλου. Το τόξο ΑΓΒ που

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ & ΤΕΧΝ/ΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΘΕΜΑ Α A. Έστω μια συνάρτηση f η οποία είναι συνεχής σε ένα διάστημα Δ. Αν f () σε κάθε εσωτερικό σημείο του Δ, τότε να αποδείξετε ότι η f είναι

Διαβάστε περισσότερα

9.9 Ανεξαρτησία του επικαμπυλίου ολοκληρώματος από την καμπύλη ολοκληρώσεως. Συνάρτηση δυναμικού

9.9 Ανεξαρτησία του επικαμπυλίου ολοκληρώματος από την καμπύλη ολοκληρώσεως. Συνάρτηση δυναμικού 1 2 Τα θεωρήματα του Green, Stokes και Gauss 211 9.9 Ανεξαρτησία του επικαμπυλίου ολοκληρώματος από την καμπύλη ολοκληρώσεως. Συνάρτηση δυναμικού Ήδη στην παράγραφο 5.7 ασχοληθήκαμε με την ύπαρξη συνάρτησης

Διαβάστε περισσότερα

Κατανόηση γραπτού λόγου

Κατανόηση γραπτού λόγου Α1 1 Επίπεδο Α1 ιάρκεια: 30 λεπτά Πρώτο µέρος (12 µονάδες) Ερώτηµα 1 (6 µονάδες) Ένας φίλος σας σάς προσκαλεί στη βάφτιση της κόρης του. ιαβάστε το προσκλητήριο και σηµειώστε στις προτάσεις που πιστεύετε

Διαβάστε περισσότερα

1. Ποιος μαθητής πήγε στους Αρχιερείς; Τι του έδωσαν; (Μτ 26,14-16) Βαθ. 1,0 2. Πόσες μέρες έμεινε στην έρημο; (Μκ 1,12)

1. Ποιος μαθητής πήγε στους Αρχιερείς; Τι του έδωσαν; (Μτ 26,14-16) Βαθ. 1,0 2. Πόσες μέρες έμεινε στην έρημο; (Μκ 1,12) ΔΙΑΓΩΝΙΣΜΑ ΣΤΑ ΘΡΗΣΚΕΥΤΙΚΑ ΤΑΞΗ: Β ΤΕΤΡΑΜΗΝΟ Α ΟΜΑΔΑ: 1 1. Ποιος μαθητής πήγε στους Αρχιερείς; Τι του έδωσαν; (Μτ 26,14-16),0 2. Πόσες μέρες έμεινε στην έρημο; (Μκ 1,12),0 3. Ποιοι είναι οι μαθητές του

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΜΑΘΗΜΑΤΙΚΗ ΕΤΑΙΡΕΙΑ ΠΑΓΚΥΠΡΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ

ΚΥΠΡΙΑΚΗ ΜΑΘΗΜΑΤΙΚΗ ΕΤΑΙΡΕΙΑ ΠΑΓΚΥΠΡΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΚΥΠΡΙΑΚΗ ΜΑΘΗΜΑΤΙΚΗ ΕΤΑΙΡΕΙΑ ΠΑΓΚΥΠΡΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ Α ΓΥΜΝΑΣΙΟΥ Ημερομηνία: 20/12/08 Ώρα εξέτασης: 09:30-12:30 ΟΔΗΓΙΕΣ: 1. Να λύσετε όλα τα θέματα.κάθε θέμα βαθμολογείται με 10 μονάδες. 2. Να γράφετε με

Διαβάστε περισσότερα

ΓΙΑ ΕΦΗΒΟΥΣ ΚΑΙ ΕΝΗΛΙΚΟΥΣ Π Ι Σ Τ Ο Π Ο Ι Η Σ Η Ε Π Α Ρ Κ Ε Ι Α Σ Τ Η Σ ΕΛΛΗΝΟΜΑΘΕΙΑΣ Κ Α Τ Α Ν Ο Η Σ Η Γ Ρ Α Π Τ Ο Υ Λ Ο Γ Ο Υ Π Ρ Ω Τ Η Σ Ε Ι Ρ Α

ΓΙΑ ΕΦΗΒΟΥΣ ΚΑΙ ΕΝΗΛΙΚΟΥΣ Π Ι Σ Τ Ο Π Ο Ι Η Σ Η Ε Π Α Ρ Κ Ε Ι Α Σ Τ Η Σ ΕΛΛΗΝΟΜΑΘΕΙΑΣ Κ Α Τ Α Ν Ο Η Σ Η Γ Ρ Α Π Τ Ο Υ Λ Ο Γ Ο Υ Π Ρ Ω Τ Η Σ Ε Ι Ρ Α ΓΙΑ ΕΦΗΒΟΥΣ ΚΑΙ ΕΝΗΛΙΚΟΥΣ Ε Π Α Ρ Κ Ε Ι Α Σ Τ Η Σ ΕΛΛΗΝΟΜΑΘΕΙΑΣ Κ Α Τ Α Ν Ο Η Σ Η Γ Ρ Α Π Τ Ο Υ Λ Ο Γ Ο Υ Π Ρ Ω Τ Η Σ Ε Ι Ρ Α Δ Ε Ι Γ Μ Α Τ Ω Ν Μ Ν Α Δ Ε Σ Y Π Ο Υ Ρ Γ Ε Ι Ο Π Α Ι Δ Ε Ι Α Σ Κ Α Ι Θ Ρ Η

Διαβάστε περισσότερα

Ψυχογλωσσολογία. Ενότητα 4 : Επεξεργασία προτάσεων. Χριστίνα Μανουηλίδου, Επίκουρη Καθηγήτρια Τμήμα Φιλολογίας

Ψυχογλωσσολογία. Ενότητα 4 : Επεξεργασία προτάσεων. Χριστίνα Μανουηλίδου, Επίκουρη Καθηγήτρια Τμήμα Φιλολογίας Ψυχογλωσσολογία Ενότητα 4 : Επεξεργασία προτάσεων Χριστίνα Μανουηλίδου, Επίκουρη Καθηγήτρια Τμήμα Φιλολογίας Σκοποί ενότητας Συντακτική επεξεργασία-ανάλυση (parsing) Στρατηγικές συντακτικής επεξεργασίας

Διαβάστε περισσότερα

THE G C SCHOOL OF CAREERS ΕΙΣΑΓΩΓΗ ΣΤΗΝ Ε ΤΑΞΗ

THE G C SCHOOL OF CAREERS ΕΙΣΑΓΩΓΗ ΣΤΗΝ Ε ΤΑΞΗ THE G C SCHOOL OF CAREERS ΔΕΙΓΜΑ ΕΞΕΤΑΣΤΙΚΟΥ ΔΟΚΙΜΙΟΥ ΕΛΛΗΝΙΚΩΝ 2 ΕΙΣΑΓΩΓΗ ΣΤΗΝ Ε ΤΑΞΗ Χρόνος: 1 ώρα Αυτό το γραπτό αποτελείται από 7 σελίδες, συμπεριλαμβανομένης και αυτής. Να απαντήσεις σε ΟΛΕΣ τις ερωτήσεις,

Διαβάστε περισσότερα

ΚΕΙΜΕΝΑ - ΛΕΞΙΛΟΓΙΟ - ΑΣΚΗΣΕΙΣ. Η Ελένη, η Σοφία, η Βασιλική, η Ειρήνη, ο Κωνσταντίνος, ο Απόστολος και ο Αλέξανδρος χαιρετούν τους φίλους τους

ΚΕΙΜΕΝΑ - ΛΕΞΙΛΟΓΙΟ - ΑΣΚΗΣΕΙΣ. Η Ελένη, η Σοφία, η Βασιλική, η Ειρήνη, ο Κωνσταντίνος, ο Απόστολος και ο Αλέξανδρος χαιρετούν τους φίλους τους ΕΝΟΤΗΤΑ 1 Καλημέρα! A ΜΕΡΟΣ ΚΕΙΜΕΝΑ - ΛΕΞΙΛΟΓΙΟ - ΑΣΚΗΣΕΙΣ Α. ΔΙΑΛΟΓΟΣ Καλημέρα! Η Ελένη, η Σοφία, η Βασιλική, η Ειρήνη, ο Κωνσταντίνος, ο Απόστολος και ο Αλέξανδρος χαιρετούν τους φίλους τους Καλημέρα,

Διαβάστε περισσότερα

4.2 4.3 ΕΥΚΛΕΙ ΕΙΑ ΙΑΙΡΕΣΗ ΙΑΙΡΕΤΟΤΗΤΑ

4.2 4.3 ΕΥΚΛΕΙ ΕΙΑ ΙΑΙΡΕΣΗ ΙΑΙΡΕΤΟΤΗΤΑ 1 4.2 4.3 ΕΥΚΛΕΙ ΕΙΑ ΙΑΙΡΕΣΗ ΙΑΙΡΕΤΟΤΗΤΑ ΘΕΩΡΙΑ 1. Θεώρηµα Αν α, β ακέραιοι µε β 0, τότε υπάρχουν µοναδικοί ακέραιοι κ και υ, έτσι ώστε α = κβ + υ µε 0 υ < β. 2. Τέλεια διαίρεση Αν το υπόλοιπο υ της Ευκλείδειας

Διαβάστε περισσότερα

Θεώρημα Ι Η διάμεσος ορθογωνίου τριγώνου που φέρουμε από την κορυφή της ορθής γωνίας είναι ίση με το μισό της υποτείνουσας.

Θεώρημα Ι Η διάμεσος ορθογωνίου τριγώνου που φέρουμε από την κορυφή της ορθής γωνίας είναι ίση με το μισό της υποτείνουσας. ΠΡΟΛΟΓΟΣ Τα πιο κάτω θεωρήματα καθώς και το Θεώρημα Ι σ. 104 είναι SOS όχι μόνο για θεωρία αλλά και για χρήση στις ασκήσεις, οπότε πρέπει να κατανοήσετε τι λένε, να ξέρετε την απόδειξη και να είστε έτοιμοι

Διαβάστε περισσότερα

Ορισµοί. Τυπικές Γλώσσες Γραµµατικές και Μεταφραστές. Αλφάβητο: ένα οποιδήποτε µη κενό και πεπερασµένο σύνολο Σ αποτελούµενο από σύµβολα

Ορισµοί. Τυπικές Γλώσσες Γραµµατικές και Μεταφραστές. Αλφάβητο: ένα οποιδήποτε µη κενό και πεπερασµένο σύνολο Σ αποτελούµενο από σύµβολα Ορισµοί Τυπικές Γλώσσες Γραµµατικές και Μεταφραστές Αλφάβητο: ένα οποιδήποτε µη κενό και πεπερασµένο σύνολο Σ αποτελούµενο από σύµβολα { 0, } δυαδικό αλφάβητο { Α, Β, Γ,, Ω } κεφαλαία ελληνικά γράµµατα

Διαβάστε περισσότερα

ΜΑΘΗΜΑ 16 1.4 1.5 ΟΡΙΟ ΣΥΝΑΡΤΗΣΗΣ ΣΤΟ xo

ΜΑΘΗΜΑ 16 1.4 1.5 ΟΡΙΟ ΣΥΝΑΡΤΗΣΗΣ ΣΤΟ xo ΜΑΘΗΜΑ 6.4.5 ΟΡΙΟ ΣΥΝΑΡΤΗΣΗΣ ΣΤΟ R Η έννια τυ ρίυ Όρι ταυττικής σταθερής συνάρτησης Ι ΙΟΤΗΤΕΣ ΤΩΝ ΟΡΙΩΝ Όρι και διάταξη Όρια και πράξεις Κριτήρι παρεµβλής Τριγωνµετρικά όρια Όρι σύνθετης συνάρτησης Θεωρία

Διαβάστε περισσότερα

Όλοι οι ακέραιοι αριθμοί από το 0 και μετά λέγονται φυσικοί αριθμοί π.χ.

Όλοι οι ακέραιοι αριθμοί από το 0 και μετά λέγονται φυσικοί αριθμοί π.χ. 1. Οι φυσικοί αριθμοί. Όλοι οι ακέραιοι αριθμοί από το 0 και μετά λέγονται φυσικοί αριθμοί π.χ. 0, 1,2,3,4,5,6,7,8,9, 10,..., 100,..., 1.000,..., 10.0000,10.001,..., 100.000, 100.001, 100.002,..., 200.000,...,

Διαβάστε περισσότερα

ΕΙΝΑΙ ΤΟ ΤΡΙΓΩΝΟ ΙΣΟΣΚΕΛΕΣ;

ΕΙΝΑΙ ΤΟ ΤΡΙΓΩΝΟ ΙΣΟΣΚΕΛΕΣ; ΕΙΝΑΙ ΤΟ ΤΡΙΓΩΝΟ ΙΣΟΣΚΕΛΕΣ; Γιώργου Τσαπακίδη Είναι εύκολο να παρατηρήσουμε ότι τα συμμετρικά σχήματα έχουν πολύ περισσότερες ιδιότητες από τα μη συμμετρικά σχήματα. Το ισοσκελές τρίγωνο, που έχει άξονα

Διαβάστε περισσότερα

ΓΡΑΜΜΙΚΗ ΑΛΓΕΒΡΑ (ΗΥ-119)

ΓΡΑΜΜΙΚΗ ΑΛΓΕΒΡΑ (ΗΥ-119) ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ ΙΩΑΝΝΗΣ Α. ΤΣΑΓΡΑΚΗΣ ΓΡΑΜΜΙΚΗ ΑΛΓΕΒΡΑ (ΗΥ-119) ΜΕΡΟΣ 5: ΔΙΑΝΥΣΜΑΤΙΚΟΙ ΥΠΟΧΩΡΟΙ ΓΡΑΜΜΙΚΗ ΑΝΕΞΑΡΤΗΣΙΑ ΒΑΣΕΙΣ & ΔΙΑΣΤΑΣΗ Δ.Χ. ΣΗΜΕΙΩΣΕΙΣ

Διαβάστε περισσότερα

ΘΕΩΡΙΑ ΠΙΝΑΚΩΝ. Ορισμός 1: Ένας πίνακας Α με m γραμμές και n στήλες,

ΘΕΩΡΙΑ ΠΙΝΑΚΩΝ. Ορισμός 1: Ένας πίνακας Α με m γραμμές και n στήλες, ΘΕΩΡΙΑ ΠΙΝΑΚΩΝ Ορισμός 1: Ένας πίνακας Α με m γραμμές και n στήλες, παριστάνεται με την εξής ορθογώνια διάταξη: α11 α12 α1n α21 α22 α2n A = αm1 αm2 αmn Ορισμός 2: Δύο πίνακες Α και Β είναι ίσοι, και γράφουμε

Διαβάστε περισσότερα

ΣΥΝΑΡΤΗΣΕΙΣ I. ΣΥΝΟΛΑ

ΣΥΝΑΡΤΗΣΕΙΣ I. ΣΥΝΟΛΑ ΣΥΝΑΡΤΗΣΕΙΣ I. ΣΥΝΟΛΑ 1.Τι ονοµάζεται σύνολο; Σύνολο ονοµάζεται κάθε συλλογή αντικειµένων, που προέρχονται από την εµπειρία µας ή την διανόηση µας, είναι καλά ορισµένα και διακρίνονται το ένα από το άλλο.

Διαβάστε περισσότερα

ΤΟ ΛΕΞΙΛΟΓΙΟ ΤΗΣ ΛΟΓΙΚΗΣ

ΤΟ ΛΕΞΙΛΟΓΙΟ ΤΗΣ ΛΟΓΙΚΗΣ 1. ΤΟ ΛΕΞΙΛΟΓΙΟ ΤΗΣ ΛΟΓΙΚΗΣ Στόχος Να γνωρίζουν οι μαθητές: να αξιοποιούν το σύμβολο της συνεπαγωγής και της ισοδυναμίας να αξιοποιούν τους συνδέσμους «ή», «και» ΕΙΣΑΓΩΓΗ Η συννενόηση μεταξύ των ανθρώπων

Διαβάστε περισσότερα

ΔΕΣΜΕΥΜΕΝΕΣ Ή ΥΠΟ ΣΥΝΘΗΚΗ ΠΙΘΑΝΟΤΗΤΕΣ

ΔΕΣΜΕΥΜΕΝΕΣ Ή ΥΠΟ ΣΥΝΘΗΚΗ ΠΙΘΑΝΟΤΗΤΕΣ ΔΕΣΜΕΥΜΕΝΕΣ Ή ΥΠΟ ΣΥΝΘΗΚΗ ΠΙΘΑΝΟΤΗΤΕΣ Έστω ότι επιθυμούμε να μελετήσουμε ένα τυχαίο πείραμα με δειγματικό χώρο Ω και έστω η πιθανότητα να συμβεί ένα ενδεχόμενο Α Ω Υπάρχουν περιπτώσεις όπου ενώ δεν γνωρίζουμε

Διαβάστε περισσότερα

ΑΛΓΕΒΡΑ Α ΛΥΚΕΙΟΥ. 118 ερωτήσεις θεωρίας με απάντηση 324 416 ασκήσεις για λύση. 20 συνδυαστικά θέματα εξετάσεων

ΑΛΓΕΒΡΑ Α ΛΥΚΕΙΟΥ. 118 ερωτήσεις θεωρίας με απάντηση 324 416 ασκήσεις για λύση. 20 συνδυαστικά θέματα εξετάσεων ΑΛΓΕΒΡΑ Α ΛΥΚΕΙΟΥ 118 ερωτήσεις θεωρίας με απάντηση 34 416 ασκήσεις για λύση ερωτήσεις κατανόησης λυμένα παραδείγματα 0 συνδυαστικά θέματα εξετάσεων Π Ε Ρ Ι Ε Χ Ο Μ Ε Ν Α Εισαγωγική ενότητα Το λεξιλόγιο

Διαβάστε περισσότερα

Οικονομικό Πανεπιστήμιο Αθηνών, Τμήμα Πληροφορικής Μάθημα: Γλωσσική Τεχνολογία, 2014 15 Διδάσκων: Ι. Ανδρουτσόπουλος

Οικονομικό Πανεπιστήμιο Αθηνών, Τμήμα Πληροφορικής Μάθημα: Γλωσσική Τεχνολογία, 2014 15 Διδάσκων: Ι. Ανδρουτσόπουλος Οικονομικό Πανεπιστήμιο Αθηνών, Τμήμα Πληροφορικής Μάθημα: Γλωσσική Τεχνολογία, 2014 15 Διδάσκων: Ι. Ανδρουτσόπουλος Ασκήσεις μελέτης της 4 ης ενότητας (σημασιολογική ανάλυση) 4.1. Παραστήστε σε πρωτοβάθμια

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

2. ΟΡΘΟΓΡΑΦΙΑ ОРФОГРАФИЯ. Προβληματικός κύκλος : - o - - e - - i - - a. ουδέτερο / επίθετο το ρούχο το ακριβό ποδήλατο

2. ΟΡΘΟΓΡΑΦΙΑ ОРФОГРАФИЯ. Προβληματικός κύκλος : - o - - e - - i - - a. ουδέτερο / επίθετο το ρούχο το ακριβό ποδήλατο 2. ΟΡΘΟΓΡΑΦΙΑ ОРФОГРАФИЯ Konstantinos Thodis by Προβληματικός κύκλος : - o - - e - - i - - a 1. - o - ( ο ) ουδέτερο / επίθετο το ρούχο το ακριβό ποδήλατο Средний / прилагательное το βιβλίο το νέο περιοδικό

Διαβάστε περισσότερα

ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γιώργος Πρέσβης ΜΑΘΗΜΑΤΙΚΑ B ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ Ο : ΕΞΙΣΩΣΗ ΕΥΘΕΙΑΣ ΕΠΑΝΑΛΗΨΗ Φροντιστήρια Φροντιστήρια ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ 1η Κατηγορία : Εξίσωση Γραμμής 1.1 Να εξετάσετε

Διαβάστε περισσότερα

Ι ΑΚΤΙΚΟ ΣΕΝΑΡΙΟ: Ας γνωριστούμε

Ι ΑΚΤΙΚΟ ΣΕΝΑΡΙΟ: Ας γνωριστούμε Ι ΑΚΤΙΚΟ ΣΕΝΑΡΙΟ: Ας γνωριστούμε Ενότητα: Χαιρετισμοί, συστάσεις, γνωριμία (2 φύλλα εργασίας) Επίπεδο: Α1, Α2 Κοινό: αλλόγλωσσοι ενήλικες ιάρκεια: 4 ώρες (2 δίωρα) Υλικοτεχνική υποδομή: Για τον διδάσκοντα:

Διαβάστε περισσότερα

Ανάπτυξη Λογισµικού για την Εύρεση και Παράσταση Σηµασιο-Συντακτικών έντρων στη Νέα Ελληνική Γλώσσα ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Ανάπτυξη Λογισµικού για την Εύρεση και Παράσταση Σηµασιο-Συντακτικών έντρων στη Νέα Ελληνική Γλώσσα ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ 1 ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ Ανάπτυξη Λογισµικού για την Εύρεση και Παράσταση Σηµασιο-Συντακτικών

Διαβάστε περισσότερα

ςεδς ΘΕΜΑΤΑ ΕΞΙΣΩΣΕΩΝ 3 0 ΚΕΦΑΛΑΙΟ ΕΞΙΣΩΣΕΙΣ Β ΒΑΘΜΟΥ ΔΙΩΝΥΜΕΣ ΕΞΙΣΩΣΕΙΣ ΕΠΙΜΕΛΕΙΑ Βαγγέλης Βαγγέλης Νικολακάκης Μαθηματικός

ςεδς ΘΕΜΑΤΑ ΕΞΙΣΩΣΕΩΝ 3 0 ΚΕΦΑΛΑΙΟ ΕΞΙΣΩΣΕΙΣ Β ΒΑΘΜΟΥ ΔΙΩΝΥΜΕΣ ΕΞΙΣΩΣΕΙΣ ΕΠΙΜΕΛΕΙΑ Βαγγέλης Βαγγέλης Νικολακάκης Μαθηματικός 014 ςεδς ΘΕΜΑΤΑ ΕΞΙΣΩΣΕΩΝ 0 ΚΕΦΑΛΑΙΟ ΕΞΙΣΩΣΕΙΣ Α ΒΑΘΜΟΥ ΔΙΩΝΥΜΕΣ ΕΞΙΣΩΣΕΙΣ ΕΞΙΣΩΣΕΙΣ Β ΒΑΘΜΟΥ Βαγγέλης ΕΠΙΜΕΛΕΙΑ Βαγγέλης Νικολακάκης Μαθηματικός ΣΗΜΕΙΩΜΑ Το παρόν φυλλάδιο είναι ένα τμήμα μιας προσωπικής

Διαβάστε περισσότερα

Όταν µπροστά από τα κύρια ονόµατα υπάρχει τίτλος, τότε το οριστικό άρθρο προηγείται του τίτλου: ο κύριος Μικέογλου ο πρίγκιπας Κάρολος

Όταν µπροστά από τα κύρια ονόµατα υπάρχει τίτλος, τότε το οριστικό άρθρο προηγείται του τίτλου: ο κύριος Μικέογλου ο πρίγκιπας Κάρολος 1. ΘΕΜΑ Το οριστικό άρθρο 2. ΠΑΡΑ ΕΙΓΜΑΤΑ Θα µιλήσει ο Χασάν. Μ αρέσει η µουσική. Αγαπάει τη ζωή. Σπρώξε την πόρτα. Το 2003 τελείωσε το λύκειο. Το Μάη είχαµε ωραίο καιρό. Ήρθε µε το λεωφορείο. Ήρθε το

Διαβάστε περισσότερα

Ο Αετός της Μάνης - Σας βλέπω πάρα πολύ ζωντανό και πολύ φιλόξενο. Έτσι είναι πάντα ο Ανδρέας Μαστοράκος;

Ο Αετός της Μάνης - Σας βλέπω πάρα πολύ ζωντανό και πολύ φιλόξενο. Έτσι είναι πάντα ο Ανδρέας Μαστοράκος; Ο Αετός της Μάνης - Σας βλέπω πάρα πολύ ζωντανό και πολύ φιλόξενο. Έτσι είναι πάντα ο Ανδρέας Μαστοράκος; Πρώτα, πρώτα είμαι άνθρωπος. Γεννήθηκα από φτωχή οικογένεια. Υπέφερα πολύ. Από 10 χρονών εργαζόμουν

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ Α ΓΥΜΝΑΣΙΟΥ

ΜΑΘΗΜΑΤΙΚΑ Α ΓΥΜΝΑΣΙΟΥ ΜΑΘΗΜΑΤΙΚΑ Α ΓΥΜΝΑΣΙΟΥ Πίνακας περιεχομένων Κεφάλαιο 1 - ΟΙ ΦΥΣΙΚΟΙ ΑΡΙΘΜΟΙ... 2 Κεφάλαιο 2 ο - ΤΑ ΚΛΑΣΜΑΤΑ... 6 Κεφάλαιο 3 ο - ΔΕΚΑΔΙΚΟΙ ΑΡΙΘΜΟΙ... 10 ΣΩΤΗΡΟΠΟΥΛΟΣ ΝΙΚΟΣ 1 Κεφάλαιο 1 - ΟΙ ΦΥΣΙΚΟΙ ΑΡΙΘΜΟΙ

Διαβάστε περισσότερα

Διακριτά Μαθηματικά. Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα

Διακριτά Μαθηματικά. Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα Διακριτά Μαθηματικά Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα Συνδυαστική ανάλυση μελέτη της διάταξης αντικειμένων 17 ος αιώνας: συνδυαστικά ερωτήματα για τη μελέτη τυχερών παιχνιδιών Απαρίθμηση:

Διαβάστε περισσότερα

ΓΡΑΜΜΙΚΗ ΑΛΓΕΒΡΑ (ΗΥ-119)

ΓΡΑΜΜΙΚΗ ΑΛΓΕΒΡΑ (ΗΥ-119) ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ ΙΩΑΝΝΗΣ Α ΤΣΑΓΡΑΚΗΣ ΓΡΑΜΜΙΚΗ ΑΛΓΕΒΡΑ (ΗΥ-119) ΜΕΡΟΣ 6: ΓΡΑΜΜΙΚΕΣ ΑΠΕΙΚΟΝΙΣΕΙΣ ΣΗΜΕΙΩΣΕΙΣ ΑΠΟ ΤΙΣ ΠΑΡΑΔΟΣΕΙΣ ΤΟΥ ΜΑΘΗΜΑΤΟΣ ΗΡΑΚΛΕΙΟ

Διαβάστε περισσότερα

Κεφάλαιο 4 Διανυσματικοί Χώροι

Κεφάλαιο 4 Διανυσματικοί Χώροι Κεφάλαιο Διανυσματικοί Χώροι Διανυσματικοί χώροι - Βασικοί ορισμοί και ιδιότητες Θεωρούμε τρία διαφορετικά σύνολα: Διανυσματικοί Χώροι α) Το σύνολο διανυσμάτων (πινάκων με μία στήλη) με στοιχεία το οποίο

Διαβάστε περισσότερα

Γνωστική Ψυχολογία ΙΙ (ΨΧ 05) Γλώσσα (1)

Γνωστική Ψυχολογία ΙΙ (ΨΧ 05) Γλώσσα (1) Γνωστική Ψυχολογία ΙΙ (ΨΧ 05) Γλώσσα (1) Ποιοι μιλούν Η γλώσσα των ζώων Είναι αυτόγλώσσα; Η Dr Pepperberg και ο Alex (ο παπαγάλος) 3 Δομή της γλώσσας Πώς μελετούν τη γλώσσα η γνωστική ψυχολογία, η νευροψυχολογία

Διαβάστε περισσότερα

HY118- ιακριτά Μαθηµατικά. Παράδειγµα άµεσης απόδειξης. Μέθοδοι αποδείξεως για προτάσεις της µορφής εάν-τότε. 08 - Αποδείξεις

HY118- ιακριτά Μαθηµατικά. Παράδειγµα άµεσης απόδειξης. Μέθοδοι αποδείξεως για προτάσεις της µορφής εάν-τότε. 08 - Αποδείξεις HY118- ιακριτά Μαθηµατικά Παρασκευή, 06/03/2015 Αντώνης Α. Αργυρός e-mail: argyros@csd.uoc.gr Το υλικό των διαφανειών έχει βασιστεί σε διαφάνειες του Kees van Deemter, από το University of Aberdeen 3/8/2015

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ II ΕΚΦΩΝΗΣΕΙΣ

ΜΑΘΗΜΑΤΙΚΑ II ΕΚΦΩΝΗΣΕΙΣ ΜΑΘΗΜΑΤΙΚΑ II ΕΠΑΛ (ΟΜΑ Α Β ) ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α A Έστω f µια συνάρτηση ορισµένη σε ένα διάστηµα Αν F είναι µια παράγουσα της f στο, τότε να αποδείξετε ότι: όλες οι συναρτήσεις της µορφής G() F() + c, c

Διαβάστε περισσότερα

Εντολές της LOGO (MicroWorlds Pro)

Εντολές της LOGO (MicroWorlds Pro) Εντολές της LOGO (MicroWorlds Pro) Εντολές εμφάνισης (εξόδου) και αριθμητικές πράξεις δείξε Εμφανίζει στην οθόνη έναν αριθμό, το αποτέλεσμα πράξεων, μια λέξη ή μια λίστα (ομάδα) λέξεων. δείξε 200 200 δείξε

Διαβάστε περισσότερα

math-gr Παντελής Μπουμπούλης, M.Sc., Ph.D. σελ. 2 math-gr.blogspot.com, bouboulis.mysch.gr

math-gr Παντελής Μπουμπούλης, M.Sc., Ph.D. σελ. 2 math-gr.blogspot.com, bouboulis.mysch.gr III Όριο Παντελής Μπουμπούλης, MSc, PhD σελ blogspotcom, bouboulismyschgr ΜΕΡΟΣ Πεπερασμένο Όριο στο Α Ορισμός Όριο στο : Όταν οι τιμές μιας συνάρτησης f προσεγγίζουν όσο θέλουμε έναν πραγματικό αριθμό,

Διαβάστε περισσότερα

ΑΓΓΛΙΚΗ ΣΧΟΛΗ ΛΕΥΚΩΣΙΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2000

ΑΓΓΛΙΚΗ ΣΧΟΛΗ ΛΕΥΚΩΣΙΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2000 ΑΓΓΛΙΚΗ ΣΧΟΛΗ ΛΕΥΚΩΣΙΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2000 ΤΑΞΗ Α ΕΛΛΗΝΙΚΑ Χρόνος: 1 ώρα και 15 λεπτά Οδηγίες 1. ιάβασε προσεχτικά αυτές τις οδηγίες. 2. Όλες σου τις απαντήσεις να τις γράψεις στο γραπτό που έχεις

Διαβάστε περισσότερα

Συνεχή Κλάσματα. Εμμανουήλ Καπνόπουλος Α.Μ 282

Συνεχή Κλάσματα. Εμμανουήλ Καπνόπουλος Α.Μ 282 Συνεχή Κλάσματα Εμμανουήλ Καπνόπουλος Α.Μ 282 5 Νοεμβρίου 204 Ορισμός και ιδιότητες: Ορισμός: Έστω a 0, a, a 2,...a n ανεξάρτητες μεταβλητές, n N σχηματίζουν την ακολουθία {[a 0, a,..., a n ] : n N} όπου

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ ΓΛΩΣΣΕΣ ΚΑΙ ΜΕΤΑΦΡΑΣΤΕΣ ΗΥ340

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ ΓΛΩΣΣΕΣ ΚΑΙ ΜΕΤΑΦΡΑΣΤΕΣ ΗΥ340 ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΥΠΟΛΟΓΙΣΤΩΝ ΓΛΩΣΣΕΣ ΚΑΙ ΜΕΤΑΦΡΑΣΤΕΣ ΗΥ340 ΕΑΡΙΝΟ ΕΞΑΜΗΝΟ 2010 Ι ΑΣΚΩΝ: ΑΝΤΩΝΙΟΣ ΣΑΒΒΙ ΗΣ ΒΑΣΙΚΗ ΕΡΓΑΣΙΑ ΦΑΣΗ 2η από 5 Ανάθεση: Πέµπτη 15 Απριλίου 2010, 11:00 (πρωί)

Διαβάστε περισσότερα

Στατιστική. Βασικές έννοιες

Στατιστική. Βασικές έννοιες Στατιστική Βασικές έννοιες Τι είναι Στατιστική; ή μήπως είναι: Στατιστική είναι ο κλάδος των εφαρμοσμένων επιστημών, η οποία βασίζεται σ ένα σύνολο αρχών και μεθοδολογιών που έχουν σκοπό: Το σχεδιασμό

Διαβάστε περισσότερα

Τα παραμύθια της τάξης μας!

Τα παραμύθια της τάξης μας! Τα παραμύθια της τάξης μας! ΟΙ λέξεις κλειδιά: Καρδιά, γοργόνα, ομορφιά, πυξίδα, χώρα, πεταλούδα, ανηφόρα, θάλασσα, φάλαινα Μας βοήθησαν να φτιάξουμε αυτά τα παραμύθια! «Χρυσαφένια χώρα» Μια φορά κι έναν

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ Α ΜΕΡΟΣ. Μαθαίνω να σχηµατίζω απλές προτάσεις... 7. Μαθαίνω να οµορφαίνω τις προτάσεις µου... 17

ΠΕΡΙΕΧΟΜΕΝΑ Α ΜΕΡΟΣ. Μαθαίνω να σχηµατίζω απλές προτάσεις... 7. Μαθαίνω να οµορφαίνω τις προτάσεις µου... 17 3 ΠΕΡΙΕΧΟΜΕΝΑ Α ΜΕΡΟΣ Μαθαίνω να σχηµατίζω απλές προτάσεις................ 7 Μαθαίνω να οµορφαίνω τις προτάσεις µου.............. 17 Μαθαίνω να µεγαλώνω τις προτάσεις µου............... 25 Μαθαίνω να γράφω

Διαβάστε περισσότερα

6.1 Η ΕΝΝΟΙΑ ΤΗΣ ΣΥΝΑΡΤΗΣΗΣ

6.1 Η ΕΝΝΟΙΑ ΤΗΣ ΣΥΝΑΡΤΗΣΗΣ 6. Η ΕΝΝΟΙΑ ΤΗΣ ΣΥΝΑΡΤΗΣΗΣ ΘΕΩΡΙΑ. Ορισµός της συνάρτησης Συνάρτηση από ένα σύνολο Α σε ένα σύνολο Β λέγεται µια διαδικασία (κανόνας τρόπος ), µε την οποία κάθε στοιχείο του συνόλου Α αντιστοιχίζεται σε

Διαβάστε περισσότερα

!! % 4 4 4 4 %,!,! %

!! % 4 4 4 4 %,!,! % ! %! & () +)!,!. / % %! 0 1!!! 2!! %!! %!! % %!. 3!!!!!! 4 4 4 4 % & 5) /!! % 6!! 7!! 8 % 8! %.! & 9)!! 7,!,! %. 6! !! %!.!! 6!! 6 :! %!! ;!!! %!!! %! %!!!! 0< 1.!!!?

Διαβάστε περισσότερα

ΜΕΡΟΣ Α : ΕΚΘΕΣΗ (30 ΜΟΝΑΔΕΣ)

ΜΕΡΟΣ Α : ΕΚΘΕΣΗ (30 ΜΟΝΑΔΕΣ) ΤΕΛΙΚΕΣ ΕΝΙΑΙΕΣ ΓΡΑΠΤΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΘΗΜΑ : Ελληνικά ΕΠΙΠΕΔΟ : 2 ΑΠΑΝΤΗΣΕΙΣ ΜΕΡΟΣ Α : ΕΚΘΕΣΗ (30 ΜΟΝΑΔΕΣ) Να αναπτύξετε ΕΝΑ από τα πιο κάτω θέματα (150-180 λέξεις ή 15-20 γραμμές) 1. Πώς πέρασα το περασμένο

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ B ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΜΑΘΗΜΑΤΙΚΑ B ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γιώργος Πρέσβης ΜΑΘΗΜΑΤΙΚΑ B ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 3 Ο : ΚΩΝΙΚΕΣ ΤΟΜΕΣ ΕΠΑΝΑΛΗΨΗ Φροντιστήρια Φροντιστήρια ΜΕΘΟΔΟΛΟΓΙΑ ΠΑΡΑΔΕΙΓΜΑΤΑ η Κατηγορία : Ο Κύκλος και τα στοιχεία

Διαβάστε περισσότερα

Μαθηματική Λογική και Λογικός Προγραμματισμός

Μαθηματική Λογική και Λογικός Προγραμματισμός Τμήμα Μηχανικών Πληροφοριακών και Επικοινωνιακών Συστημάτων- Σημειώσεις έτους 2007-2008 Καθηγητής Γεώργιος Βούρος Μαθηματική Λογική και Λογικός Προγραμματισμός Τμήμα Μηχανικών Πληροφοριακών και Επικοινωνιακών

Διαβάστε περισσότερα

ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΙΑΓΩΝΙΣΜΑ ΣΤΗΝ ΟΜΗ ΕΠΑΝΑΛΗΨΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: 6

ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΙΑΓΩΝΙΣΜΑ ΣΤΗΝ ΟΜΗ ΕΠΑΝΑΛΗΨΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: 6 ΑΝΑΠΤΥΞΗ ΕΦΑΡΜΟΓΩΝ ΣΕ ΠΡΟΓΡΑΜΜΑΤΙΣΤΙΚΟ ΠΕΡΙΒΑΛΛΟΝ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΙΑΓΩΝΙΣΜΑ ΣΤΗΝ ΟΜΗ ΕΠΑΝΑΛΗΨΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: 6 ΘΕΜΑ 1 ο Α. Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) η λανθασµένες

Διαβάστε περισσότερα

Mία πρόταση για το μάθημα των αρχαίων ελληνικών από το πρωτότυπο

Mία πρόταση για το μάθημα των αρχαίων ελληνικών από το πρωτότυπο Mία πρόταση για το μάθημα των αρχαίων ελληνικών από το πρωτότυπο Θέμα: Επεξεργασία λεξιλογίου με τη βοήθεια ηλεκτρονικών λεξικών Εισαγωγή: η επεξεργασία του λεξιλογίου των ενοτήτων στο μάθημα της αρχαίας

Διαβάστε περισσότερα

Θεωρία Υπολογισμού και Πολυπλοκότητα

Θεωρία Υπολογισμού και Πολυπλοκότητα Θεωρία Υπολογισμού και Πολυπλοκότητα Κεφάλαιο 10. Μηχανές Turing 20,23 Μαρτίου 2007 Δρ. Παπαδοπούλου Βίκη 1 Μηχανές Turing: Ένα Γενικό Μοντέλο Υπολογισμού Ποια μοντέλα υπολογισμού μπορούν να δεχθούν γλώσσες

Διαβάστε περισσότερα

Βάση και Διάσταση Διανυσματικού Χώρου

Βάση και Διάσταση Διανυσματικού Χώρου Βάση και Διάσταση Διανυσματικού Χώρου Έστω V ένας διανυσματικός χώρος επί του σώματος F. Ορισμός : Ένα υποσύνολο S του διανυσματικού χώρου V θα λέμε ότι είναι βάση του V αν ισχύει Α) Η θήκη του S παράγει

Διαβάστε περισσότερα

16 Ασύμπτωτες. όπως φαίνεται στα παρακάτω σχήματα. 1. Κατακόρυφη ασύμπτωτη. Η ευθεία x = x0

16 Ασύμπτωτες. όπως φαίνεται στα παρακάτω σχήματα. 1. Κατακόρυφη ασύμπτωτη. Η ευθεία x = x0 6 Ασύμπτωτες Α. ΑΠΑΡΑΙΤΗΤΕΣ ΓΝΩΣΕΙΣ ΘΕΩΡΙΑΣ Ορίζουμε μια ευθεία ( ε ) ως ασύμπτωτη της γραφικής παράστασης της αν η απόσταση ενός μεταβλητού σημείου Ρ της γραφικής παράστασης από την ευθεία ( ε ) γίνεται

Διαβάστε περισσότερα

Γλώσσες που περιγράφονται από Κανονικές Εκφράσεις

Γλώσσες που περιγράφονται από Κανονικές Εκφράσεις Κανονικές Εκφράσεις Στοιχειώδεις Κανονικές Εκφράσεις Κανονικές Εκφράσεις Γλώσσες που περιγράφονται από Κανονικές Εκφράσεις ηµιουργία Κανονικών Εκφράσεων Παραδείγµατα Κανονικών Εκφράσεων Τις Κανονικές εκφράσεις

Διαβάστε περισσότερα

Μαθηματικά. Γ'Γυμνασίου. Μαρίνος Παπαδόπουλος

Μαθηματικά. Γ'Γυμνασίου. Μαρίνος Παπαδόπουλος Μαθηματικά Γ'Γυμνασίου Μαρίνος Παπαδόπουλος ΠΡΟΛΟΓΙΚΟ ΣΗΜΕΙΩΜΑ Σας καλωσορίζω στον όµορφο κόσµο των Μαθηµατικών της Γ Γυµνασίου. Τα µαθηµατικά της συγκεκριµένης τάξης αποτελούν ίσως το αποκορύφωµα των

Διαβάστε περισσότερα

Γραμματική και Συντακτικό Γ Δημοτικού ανά ενότητα - Παρασκευή Αντωνίου

Γραμματική και Συντακτικό Γ Δημοτικού ανά ενότητα - Παρασκευή Αντωνίου Ενότητα 7 η : «Πολιτείες ντυμένες στα λευκά!» Παρελθοντικοί χρόνοι: Αόριστος-Παρατατικός...24 Το ρήμα «είμαι» στον αόριστο και παρατατικό...25 Χρονικοί και Αιτιολογικοί σύνδεσμοι...26 Παραθετικά επιθέτων...26

Διαβάστε περισσότερα

Μαθηματικά των Υπολογιστών και των Αποφάσεων Τεχνητή Νοημοσύνη 1η Σειρά Ασκήσεων

Μαθηματικά των Υπολογιστών και των Αποφάσεων Τεχνητή Νοημοσύνη 1η Σειρά Ασκήσεων Π Π Τ Μ Τ Μ Η/Υ Π Δ Μ Π Μαθηματικά των Υπολογιστών και των Αποφάσεων Τεχνητή Νοημοσύνη 1η Σειρά Ασκήσεων Φοιτητής: Ν. Χασιώτης (AM: 0000) Καθηγητής: Ι. Χατζηλυγερούδης 22 Οκτωβρίου 2010 ΑΣΚΗΣΗ 1. Δίνεται

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΣΤΗΝ ΠΛΗΡΟΦΟΡΙΚΗ ΜΑΘΗΜΑΤΙΚΑ Ι (ΘΕ ΠΛΗ 12) ΕΡΓΑΣΙΑ 3 η Ημερομηνία Αποστολής στον Φοιτητή: 12 Ιανουαρίου 2009

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΣΤΗΝ ΠΛΗΡΟΦΟΡΙΚΗ ΜΑΘΗΜΑΤΙΚΑ Ι (ΘΕ ΠΛΗ 12) ΕΡΓΑΣΙΑ 3 η Ημερομηνία Αποστολής στον Φοιτητή: 12 Ιανουαρίου 2009 ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΣΤΗΝ ΠΛΗΡΟΦΟΡΙΚΗ ΜΑΘΗΜΑΤΙΚΑ Ι (ΘΕ ΠΛΗ ) ΕΡΓΑΣΙΑ η Ημερομηνία Αποστολής στον Φοιτητή: Ιανουαρίου 009 Ημερομηνία παράδοσης της Εργασίας: Φεβρουαρίου 009. Πριν

Διαβάστε περισσότερα

Οδηγίες για το CABRI - GEOMETRY II Μωυσιάδης Πολυχρόνης - Δόρτσιος Κώστας

Οδηγίες για το CABRI - GEOMETRY II Μωυσιάδης Πολυχρόνης - Δόρτσιος Κώστας Οδηγίες για το CABRI - GEOMETRY II Μωυσιάδης Πολυχρόνης - Δόρτσιος Κώστας Εκτελώντας το πρόγραμμα παίρνουμε ένα παράθυρο εργασίας Γεωμετρικών εφαρμογών. Τα βασικά κουμπιά και τα μενού έχουν την παρακάτω

Διαβάστε περισσότερα