Research Paper. Thermomyces lanuginosus lipase TLL GS115 GS115 TLL. Sed1p TLL U / g TLL. K + Ca 2 + Mg 2 + Mn 2 + Ni 2 + Cu 2 +

Transcript

1 Acta Microbiologica Sinica July 2012 ISSN CN / Q http / / journals. im. ac. cn / actamicrocn Research Paper * Thermomyces lanuginosus lipase TLL GS115 TLL tll Sed1p ppiczαa-tls SacⅠ GS115 FLAG R-PE ph TLL 1 1% 120 h U / g % TLL pnpb 30 ph 8. 0 K + Ca 2 + Mg 2 + Mn 2 + Ni 2 + Cu 2 + EDTA SDS Tween 20 TLL TLL Q933 A George P. Smith lipase EC TLL * Tel Fax yanyunjun@ mail. hust. edu. cn dai. min_1987@ yahoo. com. cn

2 858 Min Dai et al. / Acta Microbiologica Sinica DH5α Pichia pastoris GS115 ppiczαa Invitrogen puc-tll 5 TLL Novozymes LLB YPD YPDS BMGY BMMY Lipolase TLL Invitrogen 100 ml BMMY 500 μl - B 100 ml BMMY 6 2 ml 400 μl 0. 2% Danielsen 7 TLL B M13 Ⅲ TLL DNA PrimeSTAR HS DNA TLL Lipozyme TLIM TaKaRa 8 9 DHA 10 C2-C16 D- D- Sigma BD 11 FLAG-tag Sed1p R-PE IgG sed1 GenePulserⅡ 12 Bio-RAD PCR 13 Sed1p Eppendorf TLL FC500 Beckman coulter Sed1p Nikon TLL GS N- FLAG tll Gene Bank AF TLL sed1 1 Sed1F TllF GS linker FLAG Escherichia coli DNA Omega PCR Table 1 1 The primers used in this article Primer Sequence 5' 3' Size / bp Restriction site Sed1F AACACGCGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAATTTTCCAACAGTACATCTGCTTC 80 MluⅠ Sed1R ATTAGCGGCCGCTTATAAGAATAACATAGCAACAC 39 NotⅠ TllF GATGAATTCGACTACAAGGATGACGATGACAAG GAGGTCTCGCAGGATCTGTTTA 55 EcoRⅠ TllR GATACGCGTAAGACATGTCCCAATTAACCCG 31 MluⅠ 1. 2 ppiczαa-tls DNA 14 Sed1F / Sed1R PCR EBY100 5'- GS linker Sed1 puc-

3 . / TLL DNA TllF / TllR PCR 1 μg FLAG 4 5'- FLAG tll PCR PBS 2 PBS EcoR I / Mlu I Mlu I / Not I EcoR I / Not I ppiczαa E. coli 1 μg R-PE IgG 1 h r / min 1 min PBS 2 DH5α LLB 25 μg / ml Zeocin pnp ppiczαa-tls Sac I 8-10 μg 80 μl P. pastoris GS V 25 μf 200 Ω 100 μg / ml mmol / L Zeocin YPDS d C2 C4 C8 C10 1% C12 C14 C d ph 8. 0 Tris-HCl DNA PCR min 1. 4 OD 405 Invitrogen h 1% ph h pnpb h 50 mmol / L ph 30 ph 8. 0 Tris-HCl ph pnpb 15 4 ml PVA = 1 3 v / v 5 ml Tris-HCl ph ph 50 mmol / L Na 2 HPO 4 / NaH 2 PO 4 mmol / L 1 ml 25 ml ph mmol / L Tris-HCl buffer ph min 15 ml mmol / L Glycine / NaOH buffer ph = 1 1 v / v 50 mmol / L NaOH 1% μmol 6 h ph 1 U U / g = V2 - V1 M N t m V 1 V 2 PEG600 DMSO NaOH ml M NaOH mmol / L 30 min ph N t min m 1 ml g ph % v / v mmol / L KCl CaCl 2 MgCl h MnCl 2 NiCl 2 CuCl 2 EDTA SDS Tween 20 mol / L PBS ph min ph mol / L PBS ph mg / ml BSA

4 860 Min Dai et al. / Acta Microbiologica Sinica ppiczαa-tls tll sed1 PCR 846 bp 1052 bp ppiczαa-tls 1 ppiczαa-tls assay. 1. GS GS115 / ppiczαa-tls 19 #. 1 ppiczαa-tls 2. 3 Fig. 1 Schematic diagram of display vector ppiczαa-tls and digestion. A Schematic diagram of ppiczαa-tls B M. DS5000 DNA Marker 1. Plasmid of ppiczαa-tls 2. Digestion of ppiczαa-tls. 3 FLAG 2. 2 R-PE ppiczαa-tls P. pastoris GS115 3-B GS115 / ppiczαa-tls 24 P. pastoris GS115 3-D 120 h TLL Sed1p nm U / g 19 # GS115 / ppiczαa PCR - GS115 / ppiczαa-tls 19 # 2 2 GS115 / ppiczαa-tls 19 # PCR Fig. 2 PCR amplification and detection of lipase activity of GS115 / ppiczαa-tls 19 #. A PCR amplification. M. Trans 5000 DNA Marker 1. Genome DNA 2. PCR amplification of fused gene tll-sed1. B Tributyrin plate assay. 1. GS GS115 / ppiczαa-tls 19 # C Rhodamine B-olive oil plate 4

5 . / % 3 Fig. 3 Detection of the fermentation cells by the fluorescence microscope. A GS115 / ppiczαa-tls under white light B GS115 / ppiczαa-tls under fluorescent light C GS115 / ppiczα under white light D GS115 / ppiczα under fluorescent light TLL 5-A TLL C4 pnpb C8 C14-C16 TLL pnpb ph pnpb TLL 5-B ph 5-C TLL % 70 20% ph 8. 0 ph TLL TLL ph 9. 5 Fig. 4 Analysis picture of fermentation cells by 20% ph Flow Cytometer. a Peak of GS115 / ppiczα b TLL Peak of GS115 / ppiczαa-tls. 5-D TLL

6 862 Min Dai et al. / Acta Microbiologica Sinica h 90% 3 h 70% TLL 6 h PEG600 DMSO 50% 56% 34% 25% 5E 30 min 5 TLL ph TLL Fig. 5 Effects of substrate temperature ph metallic irons and detergents on the displayed TLL and its thermostability and organic tolerance. A Substrate specificity of the displayed TLL B Effects of temperature on the activity of the displayed TLL C Effects of ph on the activity of the displayed TLL D Thermostability of the displayed TLL E Organic tolerance of the displayed TLL F Effects of metallic irons and detergents on the displayed TLL.

7 . / Lipolase Zheng 5-F K + Ca 2 + Mg 2 + TLL TLL 144 h Mn 2 + Ni U / ml TLL 90% EDTA SDS U / g Tween 20 80% TLIM Triton X-100 U / g 40% Cu 2 + TLL 10% TLL pnpb ph 8. 0 ph Zheng 18 Arima 20 TLL TLL pnpb 30 Zheng 18 TLL VMD 6. 0 TLL Mogesen TLL pnpb C N TLL pnpb Flop1 N- Flos C Sed1p N Zheng Sed1p TLL min 50% TLL 1 h 5% 10 mmol / L K + Ca 2 + Mg 2 + EBY100 Sed1p TLL Zheng 18 GPI K + Ca 2 + TLL Cwp1p Cwp2p Tir1p O- Sed1p 6 7 Sed1p N- 12 Sed1p N- 21 Sed1p TLL TLL 10 mmol / L SDS TLL TLL Mogesen % Fino 23 SDS TLL TLL Sed1p TLL TLL Danielsen

8 864 Min Dai et al. / Acta Microbiologica Sinica Smith GP. Filamentous fusion phage novel expression vector that display cloned antigens on the viron surface. Science Kondo A Ueda M. Yeast cell-surface display applications of molecular display. Applied Microbiology and Biotechnology Aufderheide KJ. An overview of techniques for immobilizing and viewing living cells. Micron Jaeger KE Reetz MT. Microbial lipases form versatile tools for biotechnology. Trends in Biotechnology Fernandez-Lafuente R. Lipase from Thermomyces lanuginosus uses and prospects as an industrial biocatalyst. Journal of Molecular Catalysis B Enzymatic Wollf AM Showell MS. Application of lipases in detergents. New York Marcel Dekker Danielsen S Eklund M Deussen H J Graslund TG Nygren PA Borchert TV. In vitro selection of enzymatically active lipase variants from phage libraries using a mechanism-based inhibitor. Gene Rodrigues RC Ayub MA. Effects of the combined use of Thermomyces lanuginosus and Rhizomucor miehei lipases for the transesterification and hydrolysis of soybean oil. Process biochemistry Verdugo C Luna D Posadillo A. Production of a new second generation biodiesel with a low cost lipase derived from Thermomyces lanuginosus optimization by response surface methodology. Catalysis Today Martin L Gonzalez PA Robles A Rodriguez A Hita E Jimenez MJ Esteban L Molina E. Concentration of docosahexaenoic acid DHA by kinetic resolution by a Thermomyces lanuginosus lipase. New Biotechnology De Schutter K Lin Y C Tiels P Van Hecke A Glinka S Weber-Lehmann J Rouze P Van de Peer Y Callewaert N. Genome sequence of the recombinant protein production host Pichia pastoris. Nature Biotechnology Shimoi H Kitagaki H Ohmori H Iimura Y Ito K. Sed1p is a major cell wall protein of Saccharomyces cerevisiae in the stationary phase and is involved in lytic enzyme resistance. Journal of Bacteriology Su GD Zhang X Lin Y. Surface display of active lipase in Pichia pastoris using Sed1 as an anchor protein. Biotechnology Letters Garten Y Kaplan S Pilpel Y. Extraction of transcription regulatory signals from genome-wide DNAprotein interaction data. Nucleic Acids Research Macedo GA Park YK Pastore GM. Partial purification and characterization of an extracellular lipase from a newly isolated strain of Geotrichum sp.. Revista de Microbiologia Lee SH Choi JI Park SJ Lee SY Park BC. Display of bacterial lipase on the Escherichia coli cell surface by using FadL as an anchoring motif and use of the enzyme in enantioselective biocatalysis. Applied and Environment Microbiology Zheng YY Guo XH Song NN Li DC. Thermophilic lipase from Thermomyces lanuginosus gene cloning expression and characterization. Journal of Molecular Catalysis B Enzymatic TLIM. Cereals and Oils Processing Arima K Liu WH Beppu T. Studies on the lipase of thermophilic fungus Humicola lanuginosa. Agricultural and Biological Chemistry Zheng XM Chu XY Zhang W Wu NF Fan YL. A novel cold-adapted lipase from Acinetobacter sp. XMZ- 26 gene cloning and characterization. Applied Microbiology and Biotechnology Mogensen JE Sehgal P Otzen DE. Activation inhibition and destabilization of Thermomyces lanuginosus lipase by detergents. Biochemistry Fano M van de Weert M Moeller EH et al. Ionic strength-dependent denaturation of Thermomyces lanuginosus lipase induced by SDS. Archives of Biochemistry and Biophysics

9 . / Cell surface display of Thermomyces lanuginosus lipase in Pichia pastoris and its characterization Min Dai Changtao Ji Xiaofeng Wang Xiaoyan Zhi Hua Shao Li Xu Yunjun Yan * Key Laboratory of Molecular Biophysics of the Ministry of Education College of Life Science and Technology Huazhong University of Science and Technology Wuhan China Abstract Objective To construct a novel cell-surface display system of Thermomyces lanuginosus lipase TLL based on an efficient anchor protein Sed1p in Pichia pastoris to screen recombinant strains with high enzyme activity and displaying rate and further to characterize the enzyme. Methods The lipase gene from T. lanuginosus was sub-cloned and fused with the anchor protein gene sed1 from Saccharomyces cerevisiae to construct a display vector ppiczαa- TLS. The vector ppiczαa-tls was linearized by SacⅠ and then transformed into P. pastoris GS115 by electroporation. After screening by tributyrin medium a clone exhibiting the maximum lipase activity in shaking flask was chosen to treat with rabbit anti-flag-tag and R-PE-conjugated goat anti-rabbit IgG and then its positive location on the cell wall was detected by fluorescence microscope and flow cytometer. The recombinant strain displaying TLL was further characterized as a whole-cell catalyst. Results A novel cell-surface display system of T. lanuginosus lipase was successfully established and a clone with lipase activity of U / g dry cells in shaking flask was obtained. The displayed TLL on the cell surface was confirmed by immunofluorescence and the treated cells under the fluorescence microscope emitted brightly red fluorescence and the displaying rate was % detected by Flow Cytometer. The displayed TLL exhibited excellent thermostability and high tolerance to some organic solvents and its maximal activity was observed at 30 and ph The lipase activity was a little enhanced by K + Ca 2 + and Mg 2 + and strongly inhibited by Cu 2 + Mn 2 + and Ni 2 +. However ethylenediaminetetraacetic acid EDTA Sodium lauryl sulfate SDS and Tween 20 showed little effect on the displayed TLL. Conclusion The lipase TLL was successfully displayed on the cell surface of P. pastoris by the anchor protein Sed1p for the first time to obtain a whole-cell catalyst which had high hydrolytic activity and excellent enzymatic characterization. Thus we here established a solid foundation for industrial applications of the displayed lipase TLL. Keywords Thermomyces lanuginosus lipase Pichia pastoris surface display whole-cell catalyst enzymatic characterization Supported by the Natural Science Foundation of China * Corresponding author. Tel Fax yanyunjun@ mail. hust. edu. cn Received 27 December 2011 / Revised 26 March 2012