ScFv-Fc. China Biotechnology ScFv PCR. ScFv-Fc. ppiczα. Fc 2 ScFv-Fc ScFv. ppiczα /Fc. protein A. PCR ELISA Western blotting
|
|
- Λύσανδρος Βούλγαρης
- 6 χρόνια πριν
- Προβολές:
Transcript
1 China Biotechnology * ScFv-Fc 1** ScFv ScFv-Fc RT- PCR IgG1 Fc ppiczα ppiczα/fc Fc 2 ScFv-Fc ScFv ScFv ppiczα/fc 1L protein A PCR ELISA Western blotting 1L 20 ~30mg /L protein A >95% ScFv-Fc ScFv-Fc Q Skerra Better ScFv-Fc ScFv-Fc IgG1 Fc ppiczα Fc 2 ScFv-Fc ScFv ppiczα /ScFv-Fc His-tag 3-4 ScFv ScFv 37 ScFv ppiczα /Fc ScFv-Fc 5 ScFv-Fc ScFv-Fc ScFv-Fc Fc 1 A G XL1-Blue Zeocin X33 ppiczα Invitrogene * ** wangdingding305@ 163. com T4 DNA DNA
2 ScFv-Fc TaKaRa Trizol RNA DNA Invitrogene RNA LA PCR Kit TaKaRa Omega IgG-HRP ELISA ScFv -HBsAg ScFv 6 PCR United Biochemical Int 1 PCR min 294 1min ppiczα /Fc 1 ppiczα ScFv-Fc ppiczα / ScFv-Fc F1 F2 1 HBsAg ppiczα /ScFv-Fc RbAg 1μg TE 40μl min ScFv-Fc ppiczα / Xho I EcoR I ScFv-Fc HBsAg ppiczα /ScFv-Fc RbAg EcoR I Apa I Sac I 1μg Acc I Xho I EcoR I 80μl 0. 2cm ppiczα 5min fungi-pulse 16 XL1-Blue Zeocin 1ml 25 μg /ml Apa I Bgl II 1. 5ml EP 28 1 ~ 2h 50 ~ DNA 100μl Zeocin 100μg /ml 2 10ml YPD 28 2 ~ 3 10 Trizol RNA RT-PCR Zeocin 10ml BMGY 28 IgG1 Fc C H 2 C H 3 C1 C2 1 PCR min s 58 1min min ScFv-Fc PCR B1 B2 R1 R2 1min 72 2min min Xho I Apa I PCR ppiczα /Fc α 3' Fc 5' 24h OD ~ ml BMMY 28 24h 10min 0. 5% ppiczα 0h 24h 48h 72h 96h 120h 144h α 3' Apa I 1ml -HBs Xba I ppiczα ELISA Apa I Xba I Fc PCR Apa I Xba I 1 Table 1 Fc ScFv The sequences of primers and synthetic nucleotide chains Pimers and synthetic nucleotide chains Sequences 5' - 3' Fc upstream C1 5' - TAAGGGCCCCTGAGCCCAAATCTTGTG - 3' Fc downstream C2 5' - CCGTCTAGATCATTTACCCGGAGACAGGG - 3' synthetic nucleotide chain F1 TCGAGAAGAGACAGGTCGACCTGGTGGAGGGGCCCG synthetic nucleotide chain complementary F2 AATTCGGGCCCCTCCACCAGGTCGACCTGTCTCTTCTCGA anti-hbsag ScFv upstream B1 TATCTCGAGAAGAGACAGGTCGACCTGGTGGAG anti-hbsag ScFv downstream B2 ATCGAATTCGGGCCCCCGTTTGATTTCAACCTTGGTCCC anti-rabies ScFv upstream R1 TTACTCGAGAAGAGAGAGGTGCAGCTGCTGCAG anti-rabies ScFv downstream R2 ATTGAATTCGGGCCCTTTGATTTCCACCTTGGTCCC The restriction enzymes sites for Xho I CTCGAG BamH I GAATTC Xba I TCTAGA and Apa I GGGCCC included in the PCR primers are indicated by underlining. 111
3 China Biotechnology Vol. 31 No DNA PCR 200 mmol /L ph7. 0 ph DNA PCR 7. 0 A 5 20 ScFv-Fc mmol /L ph mol /L pmd18-t DNA 7 ph mol /L Tris SDS-PAGE ELISA HCl ph ~ 200μl /ml SDS-PAGE 10% ph 5% Bradford BSA 72h SDS 8 3 ~ 5min SDS-PAGE ScFvr /min 30s 60μl 40V Fc ELISA 100V ELISA 1 ScFv-Fc 0. 1 mol /L NaHCO 3 ph Western blot 1 ScFv-Fc IgG % BSA 37 SDS-PAGE 1 h 37 1 h HRP 2% BSA IgG h NC 2 NC 2 mol /L H 2 SO 4 OD ml /cm 2 IgG 2 ScFv-Fc IgG ~ ~ 4h TTBS NC 5min / 3 ~ h 72h 96h 120h 144h ELISA ~ ~4h TTBS NC 5min / 3 ~ 5 DAB 2 10min DAB ScFv-Fc 1 ~ 3min HRIG ScFv-Fc TBS 2 RV ScFv-Fc SDS-PAGE NC -HBs ScFv-Fc ScFv-Fc HRP IgG DAB ScFv-Fc ScFv-Fc 1L 2. 1 ppiczα 0. 5% 10% ~ 30% Xho I EcoR I ppiczα 45% ~ 70% r /min 4 20min PBS 1 DNA 24 ~ 48h 4 3 ~ 6h ppiczα -HBs ELISA 24h RV h 6 30 μl Xho I EcoR I Bgl II Apa I 1100bp EcoR I Apa I Protein A Sepharose CL-4B 2. 2 Fc ScFv-Fc 1. 5 RT-PCR 5 20 mmol /L 750bp 2 ph /10 Fc 112
4 ScFv-Fc 2. 3 ppiczα/fc ppiczα α 3' ApaI Xba I ppiczα ApaI Xba I Fc ppiczα ppiczα /Fc ApaI Xba I 750bp 3 DNA ppiczα /Fc ScFv-Fc PCR Zeocin 0h 24h ScFv anti-rabies 48h 72h 96h 120h 1ml ScFv anti-hbsag -HBs 750bp Xho I Apa ELISA I ppiczα /Fc SDS-PAGE Western blot Zeocin ScFv-Fc anti-rabies ScFv Fc 6 XhoI ApaI XhoI Xba I 750bp 1500bp 6 DNA ScFv 2. 5 DNA PCR 8 DNA PCR 1500bp pmd18- T DNA 2. 6 ScFv-Fc ScFv-Fc anti-rabies ScFv- Fc anti-hbsag YPD 10 anti-hbsag 56kDa 113
5 China Biotechnology Vol. 31 No SDS-PAGE ScFv-Fc 115kDa 55kDa 7 Bradford 1L 20 ~ 30mg /L protein A > 95% ELISA ScFv-Fc anti-rabies ScFv-Fc anti-hbsag ScFv-Fc 2. 8 ScFv-Fc ScFv-Fc 1L Protein A Sepharose CL- ScFv-Fc RV 4B 100% HRIG HRIG 150 IU /ml 114
6 ScFv-Fc ScFv-Fc RV and Drug Administration FDA % % ScFv-Fc 2 2 ScFv-Fc Table 2 Detection of rabies virus in supernatant of ScFv-Fc fusion protein by inoculating mouse brain Group Survival no. after 5 days Survival no. after 14 days survival % HRIG + RV Virus control Negative control ScFv-Fc + RV ScFv-Fc + RV ScFv-Fc + RV ScFv-Fc + RV ScFv-Fc + RV Asn-X-Ser /Thr ScFv-Fc ScFv ScFv-Fc 90% 15 4 AOX1 15 Fab ScFv Fv C g C 10g ScFv scfv Fab 18 scfv-fc sc Fv scfv Fc Fc 4. 2 g /L 21 Freyre 22 CEA immunoadhesin g /L TNFR 93% IgG Fc TNFR-Fc TNF-α 3 1 AOXI 2 8 ~ 14 ppiczα ScFv-Fc FDA Food IgG1 Fc 115
7 China Biotechnology Vol. 31 No ppiczα 6 Yan W Q Wang D D. Recombinant antibody against rabies Fc 2 ScFv-Fc ScFv antigen. China Sambrook J Russell D. Molecular Cloning A Laboratory Manual ppiczα /ScFv-Fc 8 Bradford M M. A rapid and sensitive method for the quantitation ScFv of microgram quantities of protein utilizing the principle of ppiczα /ScFv-Fc protein-dye binding Anal Biochem Stish B J Chen H Shu Y et al. Increasing anticarcinoma ScFv-Fc activity of an anti-erbb2 recombinant immunotoxin by the addition ppiczα / of an anti-epcam sfv. Clin Cancer Res ScFv-Fc Fc ScFv 10 Hamada T S Suzuki K Akahori Y. Antibody-dependent cellmediated cytotoxicity is induced by a single-chain Fv-protein III EcoR I ppiczα Apa I Acc I ScFv fusion in the presence of a rabbit anti-protein III polyclonal ScFv Acc antibody. Immunol Lett I 11 Niculescu-/duvaz I Springer C J. Antibody-dircted enzyme prodrug therapy ADEPT a review. Adv Drup Deliv Rev Chamow S M Ashkenazi A. Immunoadhesins principles and app1ication. TIBTECH Fischer R Drossard J Emans N et al. Towards molecular farming in the future Pichia pastoris-based production of singlechain antibody fragments. Biotechnol Appl Biochem His-tag Ni 14 Shapiro R I Wen D Levesque M et al. Expression of Sonic protein A hedgehog-fc fusion protein in Pichia pastoris. Identification and control of post-translational chemical and proteolytic modifications. Protein Expr Purif Cregg J M Vedvick T S Raschke W C. Advances in the expression of foreign genes in Pichia pastoris. Biotechnology 1 Skerra A Pluckthun A. Assembly of a functional immunoglobulin Fv fragment in Escherichia coli. Science Better M Chang C P Robinson R R et al. Escherichia coli secretion of an active chimeric antibody fragment. Science Desplancq D Rinaldi A Stoessed A et al. Single-chain Fv fragment antibodies selected from an intrabody library as effective mono-or bivalent reagents for in vitro proten detection. J immunol Methods 2011 in print. 4 Sakamoto S Taura F Tsuchihashi R et al. Expression purification and characterization of anti-plumbagin single-chain variable fragment antibody in Sf9 insect cell. Hybridoma Larchmt Sandrine M Ahmed E M Ole V et al. A multi-fc-species system for recombinant antibody production. BMC Biotechnology Article ID Jafari R Sundstrom B E Holm P. Optimization of production of the anti-keratin 8 single-chain Fv TS1-218 in Pichia pastoris using design of experiments. Microb Cell Fact Gurkan C Symeonides S N Ellar D J. High-level production in Pichia pastoris of an anti-p185her-2 single-chain antibody fragment using an alternative secretion expression vector. Biotechnol Appl Biochem Schoonooghe S Kaigorodov V Zawisza M et al. Efficient production of human bivalent and trivalent anti-muc1 Fab-scFv antibodies in Pichia pastoris. BMC Biotechnol Yamawaki S Matsumoto T Ohnishi Y et al. Production of single-chain variable fragment antibody scfv in fed-batch and continuous culture of Pichia pastoris by two different methanol feeding methods. J Biosci Bioeng Jafari R Holm P Piercecchi M et al. Construction of divalent anti-keratin 8 single-chain antibodies sc Fv 2 expression
8 ScFv-Fc in Pichia pastoris and their reactivity with multicellular tumor spheroids. J Immunol Methods Damasceno L M Pla I Chang H J et al. An optimized fermentation process for high-level production of a single-chain Fv antibody fragment in Pichia pastoris. Protein Expr Purif Freyre F M Vazquez J E Ayala M et al. Very high expression of an anti-carcinoembryonic antigen single chain Fv antibody fragment in the yeast Pichia pastoris. J Biotechnol A Vector System for the Production of Single-chain Fv-Fc Fusions in Pichia pastoris WANG Ding-ding 1 SU Man-man 2 HU Li-li 1 YUAN Li-ying 4 SUN Yan 1 WANG Ju 3 YAN Wei-qun 2 1 Institute of Life Science and Biological Pharmacy Guangdong Pharmaceutical University Guangzhou China 2 College of Pharmaceutical Jilin University Changchun China 3 College of Life Science and Technology Jinan University Guangzhou China 4 The 3rd Kindergarten Affiliated to Jilin University Changchun China Abstract Recombinant antibodies especially ScFv fragments can be applied as detection reagents and even substitute for some reagents used in immunoassays such as antibody-enzyme conjugates. For ScFv fragments a universal system available is necessary. A vector system was constructed based on ppiczα /Fc in which the hinge CH2 and CH3 domains Fc fragment of human IgG1 and His-tag were cloned into the Pichia expression vector ppiczα. Two fragments of ScFv were introduced into ppiczα /Fc which can bind HBsAg and rabies virus antigen to yield the expression cassette ppiczα /ScFv-Fc. Following fermentation in a 1-liter reactor the fusions were expressed at high levels in the methylotrophic yeast Pichia pastoris secreted as dimeric forms in the culture and purified by protein A column chromatography. The expression yield can reach 20 ~ 30mg / L of culture medium. The ScFv-Fc fusion proteins retain the biological binding ability of the parent ScFv. Furthermore successful expression and maintenance of the binding activity verify the efficacy of the vector system for use as detection reagents in vitro by reacting with the specific antigens and being readily detected using general anti-human IgG antibodies. Key words Fusion protein ScFv-Fc Vector system Expression Pichia pastoris 117
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Πρόσκληση υποβολής προσφοράς
Αθήνα, 5 Μαρτίου 2014 Πρόσκληση υποβολής προσφοράς από φυσικά ή νομικά πρόσωπα για την προμήθεια υλικών στην Πράξη «ΘΑΛΗΣ Εθνικό Ίδρυμα Ερευνών Βιοσύνθεση και Γενετική Επιλογή Κυκλικών Πεπτιδίων με Εν
(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5
42 5 2002 10 Acta Microbiologica Sinica Vol. 42 October No. 5 2002 Ea ge 3 33 ( 430070) : ge,, ge, GS115, G418, ge, Western blotting 33kD ELISA, ge, : ge,,, :Q93914 :A :000126209 (2002) 0520543207 (Pseudorabies,PR),
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
,Ab 2 Ab 1. (internal image) Ab 2 : (1) Ab 1,
(, 100021) : (), Ab 2 (internal image), :, ; ; Advances in Research of Anti2idiotypic Antibody LI Min, J I Rong (National Institute for Nutrition and Food Safety, Chinese CDC, Beijing 100021, China) Abstract
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %
Research Papers Progress in Biochemistry and Biophysics 2009, 36(4): 424~430 wwwpibbaccn * TNF-α 1, 2) 1) 1)** ( 1) 100101 2) 100039) TNF-α TNF-α TNF-α TNF-α TNF-α TNF-α 9C6 TNF-α 29~40 TNF-α 9C6 TNF-α
Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ
Εθνικό Μετσόβιο Πολυτεχνείο Σχολή Μηχανολόγων Μηχανικών ΕΡΓΑΣΤΗΡΙΟ ΕΜΒΙΟΜΗΧΑΝΙΚΗΣ ΚΑΙ ΣΥΣΤΗΜΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΜΗΧΑΝΟΛΟΓΙΚΩΝ ΚΑΤΑΣΚΕΥΩΝ ΚΑΙ ΑΥΤΟΜΑΤΟΥ ΕΛΕΓΧΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,
Studies on purification and characteristics of glycosyltransferase from an engineering strain
DOI:10.16774/j.cnki.issn.1674-2214.2015.02.001 2015 2 4 44 2,, (, 310014) : pet28b-valg BL21(DE3), 10~40 C ph 5~11,, ph 30 C 8.0 1 mmol/l Ca 2+ Mg 2+ Mn 2+ Co 2+, Cu 2+ Zn 2+, 8 μmol/l 2 μmol/l A, K mb
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE
2011 33 5 0993-0998 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Ara h 2 1 2 3 4 5 6 2 4* 2 4* 1. 518060 2. 518060 3. 830000 4. 518060 5. 518045
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Ankylosing Spondylitis AS. NSAIDs. NSAIDs 100% B27 NSAID ~ 90% FDA EMA
2016 12 12 Ankylosing Spondylitis AS human leukocyte antigen HLA- AS NSAIDs NSAIDs B27 100% NSAIDs NSAIDs 90% NSAID ~ AS 0.25% 2~3 1 100% 1 AS CFDA FDA EMA 14 AS NSAIDs 2 CFDA non-ster- AS 1 oidal anti-inflammatory
BL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 5.0.0 Αρ. πρωτ. 957 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης πρόκειται
JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA
6 2011 5 31 3 JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3 A ACC CT * 430070 PCR A ACC 2 42 ~ 147 bp 315 ~ 677 bp 6 801 bp A 3 BC BCCP CT CT pet-28a Escherichia coli BL21 DE3 Ni-NTA CT 1. 8 mg /ml ACC
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Optimization of fermentation process for achieving high product concentration high yield and high productivity
1128 CHEMICAL INDUSTRY AND ENGINEERING PROGRESS 2006 25 10 ( 214036) (1) (2) (3) (4) (5) TQ 92 A 1000 6613 2006 10 1128 06 Optimization of fermentation process for achieving high product concentration
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ
1 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 04.02.2014 Αρ. πρωτ. 1054 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης
Regioselectivity in the Stille coupling reactions of 3,5- dibromo-2-pyrone.
Regioselectivity in the Stille coupling reactions of 3,5- dibromo-2-pyrone. Won-Suk Kim, Hyung-Jin Kim and Cheon-Gyu Cho Department of Chemistry, Hanyang University, Seoul 133-791, Korea Experimental Section
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Studies on Synthesis and Biological Activities of 2( 1 H21,2,42 Triazol212yl)2 2Arylthioethyl Substituted Phenyl Ketones
2002 60 7, 1303 1310 ACTA CHIMICA SINICA Vol. 60, 2002 No. 7, 1303 1310 2( 1 H21,2,42 212 )2 2 ( 300071) Ξ Ξ 22(1 H21,2,42 212 )222 212 (2) 1,42, 3,,. R 1, R 1 = (CH 3 ) 3 C, R 1 = Ar, Ar., 1,42,, Studies
Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΕΦΑΡΜΟΣΜΕΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑ Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα
CHINA BIOTECHNOLOGY ,720 PEG PEG. 20kDa ; [2 ] PEG. (methoxypoly ethylene glycol,mpeg), [4 ] PEG [1 ] PEG. (1 50kDa),, mpeg. 3,
23 10 CHINA BIOTECHNOLOGY 2003 10 1,2 1 3 2 (1 100071 2 110161),,,, 40,720 FDA, 200 ( FDA ) 20kDa ;,, 1, (methoxypoly ethylene glycol,mpeg), ; ; [1 ] PEG, (1 50kDa),, (mpeg) FDA mpeg :2003203221 :2003208222
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon
50 1 Vol. 50 No. 1 2013 1 ACTA PEDOLOGICA SINICA Jan. 2013 N 2 O * N 210008 N 2 O N 2 O N N 2 O N N 5 ~ 20 μg N N 2 O N S8. 3 A N N 2 O N N N NO - 3 NO - 2 N N N MgO NH 3 Rittenberg 1 Dumas N 1 2 N N 2
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (
35 Þ 6 Ð Å Vol. 35 No. 6 2012 11 ACTA MATHEMATICAE APPLICATAE SINICA Nov., 2012 È ÄÎ Ç ÓÑ ( µ 266590) (E-mail: jgzhu980@yahoo.com.cn) Ð ( Æ (Í ), µ 266555) (E-mail: bbhao981@yahoo.com.cn) Þ» ½ α- Ð Æ Ä
9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer
Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Supplementary Table 1. Construct List with key Biophysical Properties of the expression
SPINE Benchmark Target ID Well Code Tag (N or C) Fusion MW (kda) Fusion pi Cleavage site Prot MW (Da) Prot pi 1 A1 OPPF 2585 N-His6 21.75 6.41 Protease 3C 19.77 5.43 2 B1 OPPF 2586 N-His6 15.6 6.27 Protease
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
Analysis on construction application of lager diameter pile foundation engineering in Guangdong coastal areas
29 2 2010 6 GLOBAL GEOLOGY Vol. 29 No. 2 Jun. 2010 1004-5589 2010 02-0341 - 06 1 2 3 4 5 6 1. 130032 2. 130012 3. 134000 4. 130021 5. 130012 6. 130012 1# 2# TU473 A doi 10. 3969 /j. issn. 1004-5589. 2010.
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix algeriensis NRRL B-24137 and Biochemical Characterization of Two Pyrrothine N-Acyltransferases in This Extract.
Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Humanization of Ovarian Carcinoma Anti2idiotype Single2chain
ISSN 100727626 CN 1123870ΠQ 2002 8 Chinese Journal of Biochemistry and Molecular Biology 18 (4) :490 494 3,,,, (, 100044),, PCR, 6B11 ScFv, 6B11V L 2V H IgG1 CH3 (V L 2V H 2CH3), E coli BL21 (DE3) IPTG
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Metallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )
23 6 2003 12 Metallurgical Analysis :1000-7571(2003) 06-0024 - 09 3, (, 130022) : (19982001), 147 :; :O657132 :A,,Cu 2 + 4,22 2, ph10 Cu + 2,2 2 (Bi2qu) (BPB) Cu(Bi2 qu) 2 BPB,, [13 ] BPB (19982001) Cu
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW
2014 6 33 6 779 * 1 1 2 3 1 2 1. 100050 2. 277500 3. 100050 DSC HPLC 99. 5 ± 0. 4 % k 2 P 0. 95 GBW09587 R978. 7 R927. 1 A 1004-0781 2014 06-0779 - 06 Purity Determination and Uncertainty Evaluation of
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran
1 Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran Munawar Hussain, a Rasheed Ahmad Khera, a Nguyen Thai Hung, a Peter Langer* a,b a Institut für Chemie, Universität Rostock,
ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ ΕΠΙΜΕΛΕΙΑ: ΑΡΜΕΝΑΚΑΣ ΜΑΡΙΝΟΣ ΧΑΝΙΑ
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
Heterobimetallic Pd-Sn Catalysis: Michael Addition. Reaction with C-, N-, O-, S- Nucleophiles and In-situ. Diagnostics
Supporting Information (SI) Heterobimetallic Pd-Sn Catalysis: Michael Addition Reaction with C-, N-, -, S- Nucleophiles and In-situ Diagnostics Debjit Das, a Sanjay Pratihar a,b and Sujit Roy c * a rganometallics
ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ
Supporting Information
Supporting Information for Lewis acid-catalyzed redox-neutral amination of 2-(3-pyrroline-1-yl)benzaldehydes via intramolecular [1,5]-hydride shift/isomerization reaction Chun-Huan Jiang, Xiantao Lei,
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή διατριβή. Ονοματεπώνυμο: Αργυρώ Ιωάννου. Επιβλέπων καθηγητής: Δρ. Αντρέας Χαραλάμπους
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή διατριβή Διερεύνηση της αποτελεσματικότητας εναλλακτικών και συμπληρωματικών τεχνικών στη βελτίωση της ποιότητας της ζωής σε άτομα με καρκίνο
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
LfcinB. Expression and Iden tif ica tion of Lfc inb Gene in P ich ia pastoris
265 ( LfcinB) 3 ( 518057) : ( Pichia pastors) ( bovine lactoferricin, Lf2 cinb), LfcinB pp IC9K, pp IC9K2LfcinB Sal, SMD1168 G418,, PCR LfcinB LfcinB, : (LfcinB),,, : Q782, Q784, Q786 : A : 025322654 (2007)
Supplementary information
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary information Synthesis of carboxyimidamide-substituted benzo[c][1,2,5]oxadiazoles
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol
FeCl 3 6H 2 O-Catalyzed Disproportionation of Allylic Alcohols and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol Jialiang Wang, Wen Huang, Zhengxing Zhang, Xu
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Τα αναλώσιμα μαζί με τα τεχνικά χαρακτηριστικά τους περιγράφονται αναλυτικά ανά ομάδα:
Στα πλαίσια του έργου ΠΡΟΪΟΝΤΑ ΜΕΙΩΜΕΝΟΥ ΚΙΝΔΥΝΟΥ ΓΙΑ ΤΗ ΝΙΚΟΤΙΝΗ: ΣΥΓΚΡΙΤΙΚΕΣ ΜΕΛΕΤΕΣ ΕΠΙΔΡΑΣΗΣ ΣΤΟΝ ΑΝΑΠΝΕΥΣΤΙΚΟ & ΛΙΠΩΔΗ ΙΣΤΟ, ΟΠΣ 5006015, Φ.Κ. 80534 με επιστημονικό υπεύθυνο τον Αναπληρωτή καθηγητή
ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΡΓΙΚΩΝ ΠΡΟΪΟΝΤΩΝ
ΤΕΧΝΟΛΟΓΙΚΟ ΙΔΡΥΜΑ ΚΑΛΑΜΑΤΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΡΓΙΚΩΝ ΠΡΟΪΟΝΤΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΙ ΑΝΙΧΝΕΥΣΗΣ - ΧΑΡΑΚΤΗΡΙΣΜΟΥ ΜΙΚΡΟΟΡΓΑΝΙΣΜΩΝ ΣΙΩΡΟΣ ΒΑΣΙΛΕΙΟΣ ΚΑΛΑΜΑΤΑ 2008
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,
24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).
Supporting Information. Experimental section
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information Experimental section General. Proton nuclear magnetic resonance ( 1
Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3
Supporting Information Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3 Shohei Shimokawa, Yuhsuke Kawagoe, Katsuhiko Moriyama, Hideo Togo* Graduate
An HBsAg Binding Protein Expressed in Pichia pastoris Can be Used as an HBV Vaccine Adjuvant
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 11 25 (11) :1024 1029,, 3 (, 200433) (HBsAg binding protein, SBP) HBsAg,., SBP., SBP, ( ELISA) (SPF) SBP, HBsAg,.
Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)
«Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.36 Έκδοση ενημερωτικών φυλλαδίων Υπεύθυνος φορέας: Κέντρο Ελέγχου
Angioarrestin( harp1) C FD
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :136 140 Angioarrestin( harp1) C FD,,,,, ( 200433) 3 Angioarrestin DNA angioarrestin C hfd cdna (MBP) pmal2c
Μειέηε, θαηαζθεπή θαη πξνζνκνίσζε ηεο ιεηηνπξγίαο κηθξήο αλεκνγελλήηξηαο αμνληθήο ξνήο ΓΗΠΛΩΜΑΣΗΚΖ ΔΡΓΑΗΑ
Μειέηε, θαηαζθεπή θαη πξνζνκνίσζε ηεο ιεηηνπξγίαο κηθξήο αλεκνγελλήηξηαο αμνληθήο ξνήο ΓΗΠΛΩΜΑΣΗΚΖ ΔΡΓΑΗΑ Κνηζακπφπνπινο Υ. Παλαγηψηεο Δπηβιέπσλ: Νηθφιανο Υαηδεαξγπξίνπ Καζεγεηήο Δ.Μ.Π Αζήλα, Μάξηηνο 2010
Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening
21 2 212126-130 2006 3 VIROLOGICA SINICA March 2006 HIV-1 * 1,3 1,3 1 2 2 1,** (1 650223; 2 650231; 3 100039) Expression and Purification of HIV-1 Protease and the Establishment of a Method for Protease
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%