Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα"

Transcript

1 Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

2 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος περιέχει εκτός από άτοµα C και έτεροάτοµα Ν, Ο ή S) Ετεροκυκλικές ενώσεις είναι συνηθισµένες κι έχουν σπουδαία βιολογική δράση

3 2. Ακόρεστες ετεροκυκλικές ενώσεις µε πενταµελή δακτύλιο Πυρρόλιο, φουράνιο και θειοφαίνιο: πιο γνωστές ακόρεστες ετεροκυκλικές ενώσεις Χηµεία παραπάνω ετεροκυκλικών δακτυλίων ιδιάζουσα, π.χ. πυρρόλιο αν και είναι ταυτόχρονα αµίνη και συζυγιακό διένιο δεν παρουσιάζει καµία από τις παραπάνω χηµικές ιδιότητες

4 3. Δοµές πυρρολίου, φουρανίου και θειοφαινίου (5µελείς δακτύλιοι) Πυρρόλιο, φουράνιο και θειοφαίνιο δίνουν προϊόντα ηλεκτρονιόφιλης υποκατάστασης λόγω αρωµατικού χαρακτήρα Κάθε ένωση περιέχει έξη π ηλεκτρόνια σε ένα κυκλικό συζυγιακό σύστηµα στο οποίο υπάρχει αλληλοεπικάλυψη των τροχιακών p

5 4. Δοµή πυρρολίου Μονήρες ζεύγος ηλεκτρονίων του αζώτου αποτελεί τµήµα της αρωµατικής εξάδας και είναι λιγότερο διαθέσιµο για σχηµατισµό δεσµών µε οξέα (λιγότερο βασικό σε σχέση µε αλειφατικές αµίνες) Άτοµα C δακτυλίου έχουν αυξηµένη e - πυκνότητα και είναι περισσότερο πυρηνόφιλα σε σχέση µε άτοµα C του διπλού δεσµού ενός αλκενίου

6 5. Αντιδράσεις ηλεκτρονιόφιλης υποκατάστασης πυρρολίου, φουρανίου και θειοφαινίου Πραγµατοποιούνται αντιδράσεις αλογόνωσης, νίτρωσης, σουλφονίωσης και ακυλίωσης Friedel-Crafts Δραστικότητα αυξάνεται ως εξής: φουράνιο>πυρρόλιο> θειοφάινιο

7 6. Πυριδίνη: ετεροκυκλική ένωση µε 6µελή δακτύλιο Πυριδίνη: αζωτούχο ανάλογο του βενζολίου Επίπεδο αρωµατικό µόριο, γωνία δεσµών 120 ο, µήκος δεσµός C-C 1.39 Å (τιµή ενδιάµεση µεταξύ απλού και διπλού δεσµού) Πέντε άτοµα άνθρακα και το sp 2 -υβριδισµένο άτοµο του Ν συνεισφέρει από ένα π ηλεκτρόνιο στην αρωµατική εξάδα Σε αντίθεση µε πυρρόλιο, µονήρες ζεύγος ηλεκτρονίων του Ν καταλαµβάνει τροχιακό sp 2 στο επίπεδο του δακτυλίου και δε συµµετέχει σε σχηµατισµό δεσµών

8 7. Σχετική βασικότητα αζωτούχων ενώσεων σε κυκλική διάταξη Πυριδίνη ισχυρότερη βάση από πυρρόλιο διότι µονήρες ζεύγος ηλεκτρονίων Ν πυριδίνης δε συµµετέχει σε π αρωµατικό σύστηµα Αλκυλαµίνες ισχυρότερες βάσεις από πυριδίνη διότι µονήρες ζεύγος ηλεκτρονίων Ν πυριδίνης βρίσκεται σε sp 2 τροχιακό ενώ Ν αλκυλαµίνης σε sp 3 τροχιακό

9 8. Ετεροκυκλικές ενώσεις µε απλούς και συµπυκνωµένους δακτυλίους Από βιολογική άποψη σπουδαιότεροι ετεροκυκλικοί δακτύλιοι πυριµιδίνης και πουρίνης

10 9. Νουκλεϊκά οξέα και νουκλεοτίδια Δεοξυριβονουκλεϊκό οξύ (DNA) και ριβονουκλεϊκό οξύ (RNA): µόρια φορείς της γενετικής πληροφορίας ενός κυττάρου DNA: µόριο που βρίσκονται κωδικοποιηµένες όλες οι πληροφορίες σχετικά µε φύση, ανάπτυξη, διαίρεση και λειτουργία κυττάρου Νουκλεϊκά οξέα: βιοπολυµερή που απαρτίζονται από νουκλεοτίδια, που ενώνονται µεταξύ τους προς σχηµατισµό αλυσίδων Νουκλεοτίδιο αποτελείται από ένα νουκλεοζίτη συνδεδεµένο µε φωσφορική οµάδα και κάθε νουκλεοζίτης από ένα σάκχαρο (αλδοπεντόζη) συνδεδεµένο µε µία ετεροκυκλική βάση πουρίνης ή πυριµιδίνης

11 Σάκχαρο RNA: ριβόζη 10. Σάκχαρα και ετεροκυκλικές ενώσεις νουκλεϊκών οξέων Σάκχαρο DNA: 2 -δεοξυριβόζη RNA ετεροκυκλικές βάσεις Δύο πουρίνες (αδενίνη και γουανίνη) Δύο υποκατεστηµένες πυριµιδίνες (κυτοσίνη και ουρακίλη) DNA ετεροκυκλικές βάσεις Δύο πουρίνες (αδενίνη και γουανίνη) Δύο υποκατεστηµένες πυριµιδίνες (κυτοσίνη και θυµίνη)

12 11. Νουκλεοζίτες και νουκλεοτίδια Υ=Η το σάκχαρο είναι δεοξυριβόζη (DNA) Υ=ΟΗ το σάκχαρο είναι ριβόζη (RNA) DNA και RNA: ετεροκυκλικές αµίνες (βάσεις) ενώνονται µε το C1 του σακχάρου ενώ η φωσφορική οµάδα µέσω εσωτερικού δεσµού µε το C5 του σακχάρου

13 12. Ονοµασίες και δοµές DNA & RNA DNA & RNA: παρόµοια από χηµική άποψη Μέγεθος και βιολογικός ρόλος τους πολύ διαφορετικός Μόρια DNA τεράστια Μ.Β. µέχρι τα 150 δισεκατοµµύρια και απαντούν κυρίως µέσα στον πυρήνα του κυττάρου Μόρια RNA πολύ µικρότερα µε Μ.Β. µέχρι και απαντούν κυρίως έξω από τον πυρήνα του κυττάρου

14 13. Δοµή DNA Νουκλεοτίδια συνδέονται στο DNA µέσω εστερικού φωσφορικού δεσµού ανάµεσα στην 5 -φωσφορική οµάδα ενός νουκλεοτιδίου και 3 -υδρόξυλοµάδα του σακχάρου ενός άλλου νουκλεοτιδίου Το ένα άκρο έχει ελεύθερη υδροξυλοµάδα (το άκρο 3 ) και το άλλο ελέυθερη φωσφορική οµάδα (το άκρο 5 )

15 14. Ακολουθία νουκλεοτιδίων Δοµή νουκλεϊκών οξέων εξαρτάται από ακολουθία νουκλεοτιδίων Ακολουθία νουκλεοτιδίων περιγράφεται ξεκινώντας από το άκρο 5 και προσδιορίζοντας τις βάσεις µε τη σειρά που απαντούν χρησιµοποιώντας συντοµογραφίες Α αδενοσίνη, T θυµίνη G γουανοσίνη και C κυτιδίνη

16 15. Μοντέλο Watson-Crick (1953) Διαφορετικoί ιστοί ίδιου βιολογικού είδους εµφανίζουν ίδια αναλογία ετεροκυκλικών βάσεων (αδενίνη & θυµίνη και κυτοσίνη & γουανίνη σε ίση αναλογία) 2ταγής δοµή DNA: 2 πολυνουκλεοτιδικοί κλώνοι σε δοµή διπλής έλικας Κλώνοι έχουν αντίθετη κατεύθυνση, συγκρατούνται µε δεσµούς Η ανάµεσα σε συγκεκριµένα ζευγάρια βάσεων Αδενίνη (Α) µε Θυµίνη (Τ) και Γουανίνη (G) µε Κυτoσίνη (C)

17 16. Συµπληρωµατικότητα κλώνων DNA Κλώνοι διπλής έλικας DNA όχι ταυτόσηµοι αλλά συµπληρωµατικοί Όταν στον ένα κλώνο βάση C ή A στον άλλο βάση G ή T, αντίστοιχα Διπλή έλικα DNA: πλάτος 20 Å και σε κάθε πλήρη περιέλιξη: 10 ζεύγη βάσεων Ύψος κάθε πλήρους περιέλιξης 34 Å

18 17. DNA double helix

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

Κεφάλαιο 6. Κατάταξη των οργανικών ενώσεων

Κεφάλαιο 6. Κατάταξη των οργανικών ενώσεων Κεφάλαιο 6 Κατάταξη των οργανικών ενώσεων Σύνοψη Στο κεφάλαιο αυτό γίνεται αναφορά στους τρόπους ταξινόμησης των οργανικών ενώσεων και παρέχονται κάποια στοιχεία για κάθε κατηγορία. Ιδιαίτερη αναφορά γίνεται

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 15: Βενζόλιο και αρωματικότητα

Οργανική Χημεία. Κεφάλαιο 15: Βενζόλιο και αρωματικότητα Οργανική Χημεία Κεφάλαιο 15: Βενζόλιο και αρωματικότητα 1. Αρωματικές ενώσεις Αρωματικές ενώσεις: ενώσεις με ευχάριστη οσμή Αρωματικές ενώσεις αναφέρονται συνήθως στο βενζόλιο και σε ενώσεις με συγγενική

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

Οργά νωση Γενετικού Υλικού

Οργά νωση Γενετικού Υλικού Βιολογία Γ Γυμνασίου: Διατήρηση και Συνέχεια της Ζωής Οργά νωση Γενετικού Υλικού Γονίδιο: Η μονάδα της κληρονομικότητας. Ουσιαστικά είναι ένα κομμάτι από το DNA που αποθηκεύει πληροφορίες για κάποιο συγκεκριμένο

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Κεφάλαιο 7 ΑΛΚΑΛΟΕΙΔΗ Τα αλκαλοειδή δεν αποτελούν μια ομογενή ομάδα ενώσεων, αποτέλεσμα να είναι ιδιαίτερα δύσκολος ο προσδιορισμός τους. με Ένας γενικότερος ορισμός των αλκαλοειδών αναφέρει ότι αυτά είναι

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01%

ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% Ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο συμμετέχουν, σε σημαντικό βαθμό, στη

Διαβάστε περισσότερα

ΒΙΟΧΗΜΕΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ. Στοιχείο O C H N Ca P K S Na Mg περιεκτικότητα % ,5 1 0,35 0,25 0,15 0,05

ΒΙΟΧΗΜΕΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ. Στοιχείο O C H N Ca P K S Na Mg περιεκτικότητα % ,5 1 0,35 0,25 0,15 0,05 ΒΙΟΧΗΜΕΙΑ Βιοχημεία: είναι η επιστήμη που ασχολείται με τη μελέτη των οργανικών ενώσεων που συναντώνται στον οργανισμό, καθώς και με τον μεταβολισμό τους. ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΟΡΙΩΝ 108 στοιχεία

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 16: Χημεία του βενζολίου: ηλεκτρονιόφιλη αρωματική υποκατάσταση

Οργανική Χημεία. Κεφάλαιο 16: Χημεία του βενζολίου: ηλεκτρονιόφιλη αρωματική υποκατάσταση Οργανική Χημεία Κεφάλαιο 16: Χημεία του βενζολίου: ηλεκτρονιόφιλη αρωματική υποκατάσταση 1. Αντιδράσεις αρωματικών ενώσεων Σημαντικότερη αντίδραση αρωματικών ενώσεων: ηλεκτρονιόφιλη αρωματική υποκατάσταση

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ Βιολογία ΘΕΜΑ Α κατεύθυνσης 1. δ 2. α 3. γ 4. δ 5. γ 6. α 7. δ 8. α 9. α 10. α ΘΕΜΑ Β Β1. Η ραδιενέργεια 32 Ρ θα βρίσκεται στο κλάσμα Β, δηλαδή στο κλάσμα εκείνο που περιλαμβάνει τα βακτήρια που έχουν

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός

Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός Ευαγγελία - Ειρήνη Τσερμπίνι 1. Σκοπός Σκοπός της παρούσας άσκησης είναι η απομόνωση ανθρώπινου DNA γονιδιώματος από δείγμα

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

Ποια είναι κατά τη γνώμη σας τα 30 μικρομόρια που συνιστούν τα πρόδρομα μόρια των βιομακρομορίων; Πώς μπορούν να ταξινομηθούν;

Ποια είναι κατά τη γνώμη σας τα 30 μικρομόρια που συνιστούν τα πρόδρομα μόρια των βιομακρομορίων; Πώς μπορούν να ταξινομηθούν; Ποια είναι κατά τη γνώμη σας τα 30 μικρομόρια που συνιστούν τα πρόδρομα μόρια των βιομακρομορίων; Πώς μπορούν να ταξινομηθούν; Γενικά Για να προσδιορίσουμε τα 30 πρόδρομα μόρια των βιομακρομορίων θα πρέπει

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα ΚΕΦΑΛΑΙΟ 1 Οργάνωση της ζωής βιολογικά συστήματα 1.1 Τα μόρια της ζωής Καινούριες γνώσεις Ποια μόρια συμμετέχουν στη δομή και στις λειτουργίες των οργανισμών. Ποια είναι η σημασία του νερού για τη ζωή

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

Τύποι νουκλεϊκών οξέων

Τύποι νουκλεϊκών οξέων Τύποι νουκλεϊκών οξέων DNA ένας τύπος, μια λειτουργία RNA - 4 τύποι, 4 λειτουργίες Ριβοσωμικό RNA Αγγελιαφόρο RNA Μεταφορικό RNA Καταλυτικό RNA Βιοχημεία Ι Δ-1 Βιοχημεία Ι Δ-2 3 5 φωσφοδιεστερικός δεσμός

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

Ε. Μαλαμίδου-Ξενικάκη

Ε. Μαλαμίδου-Ξενικάκη Ε. Μαλαμίδου-Ξενικάκη Θεσσαλονίκη 2015 Ηλεκτρονιόφιλη προσβολή σε παράγωγα του βενζολίου Ασπιρίνη Η ασπιρίνη παρασκευάζεται βιομηχανικά με εκλεκτική ηλεκτρονιόφιλη αρωματική υποκατάσταση της φαινόλης.

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (10/3/2014) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (10/3/2014) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια- Φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Τα χημικά μόρια που οικοδομούν τους οργανισμούς

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Τα χημικά μόρια που οικοδομούν τους οργανισμούς ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ Τα χημικά μόρια που οικοδομούν τους οργανισμούς Μελέτη φαινομένου της ζωής o Η μελέτη του φαινομένου της ζωής ξεκινά από το μοριακό επίπεδο δηλαδή από τα χημικά μόρια που οικοδομούν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ)

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες

Οργανική Χημεία. Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες Οργανική Χημεία Χημεία καρβονυλικών ενώσεων & Κεφάλαιο 19: Αλδεϋδες και κετόνες 1. Καρβονυλικές ενώσεις Καρβονυλική ομάδα C=O σημαντικότερη λειτουργική ομάδα οργανικής χημείας Καρβονυλικές ομάδες βρίσκονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

Οργανική Χημεία. Βιολογικές Επιστήμες Βιολογία Γεωπονία Ιατρική κ.α. Βιοχημεία. Οργανική Χημεία. Φυσικές Επιστήμες Φυσική Μαθηματικά

Οργανική Χημεία. Βιολογικές Επιστήμες Βιολογία Γεωπονία Ιατρική κ.α. Βιοχημεία. Οργανική Χημεία. Φυσικές Επιστήμες Φυσική Μαθηματικά Πέτρος Ταραντίλης Αναπληρωτής Καθηγητής Εργαστήριο Χημείας, Τμήμα Επιστήμης Τροφίμων και Διατροφής του Ανθρώπου Ιερά Οδός 75, 118 55 Αθήνα, e-mail: ptara@aua.gr, Τηλ.: 210 529 4262, Fax: 210 529 4265 Βιοχημεία

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΜΕΡΟΣ ΠΡΩΤΟ - ΠΕΡΙΓΡΑΜΜΑ 5.1 ΈΝΑ ΝΟΥΚΛΕΙΝΙΚΟ ΟΞΥ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΤΕΣΣΕΡΑ ΕΙΔΗ ΒΑΣΕΩΝ, ΠΟΥ ΠΡΟΣΔΕΝΟΝΤΑΙ ΣΕ ΈΝΑ ΚΟΡΜΟ ΣΑΚΧΑΡΩΝ ΦΩΣΦΟΡΙΚΩΝ 5.2 ΈΝΑ ΖΕΥΓΟΣ

Διαβάστε περισσότερα

2

2 1 2 3 4 5 6 7 8 9 Η μικρότερη σταθερότητα της βινυλικής ρίζας (για παράδειγμα σε σχέση με τη μεθυλική) θα μπορούσε να εξηγηθεί στη βάση του πόσο ισχυρά έλκονται τα ηλεκτρόνια από το κάθε άτομο άνθρακα.

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

στην Βιολογία Σάββατο 7/12/2013

στην Βιολογία Σάββατο 7/12/2013 Ε.Κ.Φ.Ε. ΑΙΓΑΛΕΩ Προκριματικός διαγωνισμός για την 12 th EUSO 2014 στην Βιολογία Σάββατο 7/12/2013 Ονοματεπώνυμα μελών ομάδας 1) 2) 3) Σχολείο: Διάρκεια: 1 ώρα 1. Απομόνωση Νουκλεϊκών οξέων από φυτικά

Διαβάστε περισσότερα

Φίλη μαθήτρια, φίλε μαθητή,

Φίλη μαθήτρια, φίλε μαθητή, Φίλη μαθήτρια, φίλε μαθητή, Το βιβλίο αυτό φιλοδοξεί να σε βοηθήσει στην κατανόηση των σύγχρονων δεδομένων της Μοριακής Βιολογίας και της Βιοτεχνολογίας, να αποτελέσει σύμμαχό σου στη μελέτη και να προκαλέσει

Διαβάστε περισσότερα

Μεσομερείς Δομές ή Δομές Συντονισμού

Μεσομερείς Δομές ή Δομές Συντονισμού Μεσομερείς Δομές ή Δομές Συντονισμού Σε περίπτωση ενώσεων που περιέχουν πολλαπλούς δεσμούς όπως το αιθυλένιο (αιθένιο), ο διπλός δεσμός δημιουργείται με συνεισφορά ενός ηλεκτρονίου από κάθε άτομο άνθρακα

Διαβάστε περισσότερα

διπλός δεσμός τριπλός δεσμός

διπλός δεσμός τριπλός δεσμός Ακόρεστοι Υδρογονάνθρακες Αλκένια Αλκίνια Αρωματικές ενώσεις Αλκένια διπλός δεσμός Αλκίνια τριπλός δεσμός Αρωματικοί υδρογονάνθρακες Βενζόλιο Αλκένια-ΑλκίνιαΑλκίνια Μη πολικές ενώσεις Αδιάλυτες στο νερό

Διαβάστε περισσότερα

ιδάσκοντες: Γιώργος Αϊβαλάκις, Επίκουρος Καθ. Γιώργος Καραµπουρνιώτης, Αναπληρωτής Καθ. Κώστας Φασσέας, Αναπληρωτής Καθ.

ιδάσκοντες: Γιώργος Αϊβαλάκις, Επίκουρος Καθ. Γιώργος Καραµπουρνιώτης, Αναπληρωτής Καθ. Κώστας Φασσέας, Αναπληρωτής Καθ. ιδάσκοντες: Γιώργος Αϊβαλάκις, Επίκουρος Καθ. Γιώργος Καραµπουρνιώτης, Αναπληρωτής Καθ. Κώστας Φασσέας, Αναπληρωτής Καθ. ιάρθρωση του µαθήµατος Κώστας Φασσέας Κεφάλαια: 1,2,3,6,8 Γιώργος Αϊβαλάκις Κεφάλαια:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΛΥΚΕΙΟ ΠΑΝ/ΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΠΕΙΡΑΜΑΤΑ 1. Σε ένα πείραμα παρόμοιο με αυτό που διεξήγαγε ο Griffith, αφού θανατώσατε με

Διαβάστε περισσότερα

Ηλεκτρονιόφιλη αρωµατική υποκατάσταση

Ηλεκτρονιόφιλη αρωµατική υποκατάσταση Ηλεκτρονιόφιλη αρωµατική υποκατάσταση Νικόλαος Αργυρόπουλος Θεσσαλονίκη 2007 Τυπικές αντιδράσεις ηλεκτρονιόφιλης αρωµατικής υποκατάστασης Ηλεκτρονιόφιλη προσθήκη στα αλκένια Μηχανισµός C C C C C C Το ηλεκτρονικό

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια

Οργανική Χημεία. Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια Οργανική Χημεία Κεφάλαιο 17 & 18: Αλκοόλες, θειόλες, αιθέρες και εποξείδια 1. Αλκοόλες Ενώσεις που περιέχουν ομάδες υδροξυλίου συνδεδεμένες με κορεσμένα άτομα άνθρακα υβριδισμού sp 3 Βάσει παραπάνω ορισμού,

Διαβάστε περισσότερα

CO 2 H 2 O O 2 C 6 H 12 O 6 ATP ADP DNA NADPH - TAC AAA CAT CCC GGG TTT ATT

CO 2 H 2 O O 2 C 6 H 12 O 6 ATP ADP DNA NADPH - TAC AAA CAT CCC GGG TTT ATT ΘΕΜΑ ο Α. (Μ 5) Ποιο φαινόµενο ονοµάζεται «µετουσίωση των πρωτεινών»; Να αναφέρεις ένα παράδειγµα. Β. (Μ 5) Να περιγράψεις το φαινόµενο της «ενδοκύττωσης» Γ. (Μ 5) Στις παρακάτω ερωτήσεις -5 να γράψεις

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 5 ΣΕΠΤΕΜΒΡΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου.

Kυτταρική Bιολογία ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ ΔIAΛEΞΗ 2 (22/2/2016) Χημικοί δεσμοί - Το νερό & ο ρόλος του. Τα μόρια του κυττάρου. Kυτταρική Bιολογία ΔIAΛEΞΗ 2 (22/2/2016) ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΚΥΤΤΑΡΩΝ Χημικοί δεσμοί - Το νερό & ο ρόλος του Τα μόρια του κυττάρου. Ενεργοποιημένα μόρια-φορείς ενέργειας AΣ ΘYMHΘOYME Tι είπαμε στην προηγούμενη

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 1 ο -Το γενετικό υλικό Το γενετικό υλικό Ιστορική αναδρομή 1869: Το DNA εντοπίζεται στον πυρήνα των κυττάρων 1944: Μέχρι τότε δεν ήταν γνωστό ότι αποτελεί το γενετικό

Διαβάστε περισσότερα

Επιβίωση ποντικών 1 ζωντανά βακτήρια S ΟΧΙ 2 ζωντανά βακτήρια R ΝΑΙ ένεση σε ποντικούς 3 βακτήρια S που προηγουμένως θανατώθηκαν με θέρμανση ΝΑΙ

Επιβίωση ποντικών 1 ζωντανά βακτήρια S ΟΧΙ 2 ζωντανά βακτήρια R ΝΑΙ ένεση σε ποντικούς 3 βακτήρια S που προηγουμένως θανατώθηκαν με θέρμανση ΝΑΙ 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DA είναι το γενετικό υλικό Να περιγράψετε το πείραμα του Griffith Ο Griffith ασχολήθηκε με δύο στελέχη 1 του πνευμονόκοκκου (του βακτηρίου 2 Diplococcus pneumoniae) που είχαν τις

Διαβάστε περισσότερα

Το κεντρικό δόγμα (The central dogma)

Το κεντρικό δόγμα (The central dogma) Οι βασικές μοριακές γενετικές διαδικασίες Αντιγραφή Μεταγραφή Μετάφραση ΠΡΩΤΕΪΝΗ Το κεντρικό δόγμα (The central dogma) Σύσταση νουκλεοτιδίων του DNA και του RNA Α 5 -άκρο Θυμίνη (Θ) Β 5 άκρο Αδενίνη (Α)

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. Καθηγητής Μόσχος Πολυσίου / Εργαστήριο Γενικής Χημείας Γ.Π.Α.

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. Καθηγητής Μόσχος Πολυσίου / Εργαστήριο Γενικής Χημείας Γ.Π.Α. ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ Καθηγητής Μόσχος Πολυσίου / Εργαστήριο Γενικής Χημείας Γ.Π.Α. ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ Η Οργανική Χημεία μελετά τις ενώσεις του άνθρακα. Ο Wohler το828 πρώτος παρασκεύασε οργανική ένωση από ανόργανο

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Κεφάλαιο 3. Στοιχειώδεις αντιδράσεις στην Οργανική Χημεία

Κεφάλαιο 3. Στοιχειώδεις αντιδράσεις στην Οργανική Χημεία Κεφάλαιο 3 Στοιχειώδεις αντιδράσεις στην Οργανική Χημεία Σύνοψη Στο κεφάλαιο αυτό παρουσιάζονται οι στοιχειώδεις αντιδράσεις στην Οργανική Χημεία, οι οποίες μπορούν να διαχωριστούν στις εξής κατηγορίες:

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ Β ΤΡΙΜΗΝΟΥ Γ 4 23.1.12 ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΕΡΓΑΣΤΗΚΑΝ: ΑΛΕΞΑΝΔΡΟΣ ΔΕΛΗΜΙΧΑΛΗΣ ΑΡΤΕΜΗΣ ΑΝΑΣΤΑΣΙΑΔΗΣ 1 ΕΙΣΑΓΩΓΗ Το δεοξυριβονουκλεϊκό οξύ (Deoxyribonucleic acid -

Διαβάστε περισσότερα

ΗΜΥ 001 -Υγεία και Τεχνολογία. Σενάρια Ιατρικής Φαντασίας (Γενετική)

ΗΜΥ 001 -Υγεία και Τεχνολογία. Σενάρια Ιατρικής Φαντασίας (Γενετική) ΗΜΥ 001 -Υγεία και Τεχνολογία Σενάρια Ιατρικής Φαντασίας (Γενετική) Γενετική ηµιουργήµατα της φύσης συνέπεια στα µορφολογικά χαρακτηριστικά τους αναπαραγωγική διαδικασία οι απόγονοι µοιάζουν σε µικρό ή

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες

ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ. 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ 2 η θεματική ενότητα: Χημικοί δεσμοί και μοριακές ιδιότητες Σχολή: Περιβάλλοντος Τμήμα: Επιστήμης Τροφίμων και Διατροφής Εκπαιδευτής: Χαράλαμπος Καραντώνης Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

Εισαγωγικά. Σύνταξη, ταξινόμηση και τάξεις οργανικών ενώσεων. Τρόποι γραφής οργανικών ενώσεων. Λειτουργικές ομάδες.

Εισαγωγικά. Σύνταξη, ταξινόμηση και τάξεις οργανικών ενώσεων. Τρόποι γραφής οργανικών ενώσεων. Λειτουργικές ομάδες. ΤΜΗΜΑ ΓΕΩΠΟΝΙΑΣ - Μάθημα «ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ» Ακαδημαϊκό έτος 2012-2013 ΠΡΟΓΡΑΜΜΑ ΘΕΩΡΗΤΙΚΩΝ, ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΚΑΙ ΦΡΟΝΤΙΣΤΗΡΙΑΚΩΝ ΜΑΘΗΜΑΤΩΝ ΤΡΙΤΗ 9.00-12.00 (Ι3 - Θεωρία) ΠΕΜΠΤΗ 10.00 12.00 (I3-Θεωρία) ή (Εργαστήρια)

Διαβάστε περισσότερα

Οργανική Χημεία. Πέτρος Ταραντίλης Επίκουρος Καθηγητής Εργαστήριο Χημείας, Γενικό Τμήμα, Τηλ.: , Fax:

Οργανική Χημεία. Πέτρος Ταραντίλης Επίκουρος Καθηγητής Εργαστήριο Χημείας, Γενικό Τμήμα,   Τηλ.: , Fax: Πέτρος Ταραντίλης Επίκουρος Καθηγητής Εργαστήριο Χημείας, Γενικό Τμήμα, Ιερά Οδός 75, 118 55 Αθήνα, e-mail: ptara@aua.gr, Τηλ.: 210 529 4262, Fax: 210 529 4265 Θεωρία -Ύλη μαθήματος Ανθρακας-ταξινόμηση

Διαβάστε περισσότερα

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες;

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Οι πρωτεΐνες αποτελούν δομικά ή λειτουργικά συστατικά των κυττάρων και δομούνται από απλούστερες ενώσεις, τα αμινοξέα.

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DNA είναι το γενετικό υλικό. Ποιο πίστευαν αρχικά οι επιστήμονες πως είναι το μόριο που μεταφέρει τη γενετική πληροφορία; Παρ όλο που το DNA εντοπίστηκε στον πυρήνα των

Διαβάστε περισσότερα

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων Διαλέξεις Χημείας -2014 Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων 1. Συστατικά 1. Ριβόζη-Δεοξυριβόζη 2. Πουρίνες-Πυριμιδίνες 2. Νουκλεοσίδια ή νουκλεοζίτες

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Πυρηνόφιλα του Άνθρακα: ΥΛΙΔΙΑ ΦΩΣΦΟΡΟΥ Αντίδραση WITTIG

Πυρηνόφιλα του Άνθρακα: ΥΛΙΔΙΑ ΦΩΣΦΟΡΟΥ Αντίδραση WITTIG Georg Wittig Νόµπελ Χηµείας 1979 Πυρηνόφιλα του Άνθρακα: ΥΛΙΔΙΑ ΦΩΣΦΟΡΟΥ Αντίδραση WITTIG Υλίδιο: Ουδέτερη ένωση µε αρνητικά φορτισµένο άτοµο (C-) ενωµένο µε θετικά φορτισµένο ετεροάτοµο (P+) Υβρίδιο Δοµών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Οι James Watson και Francis Crick δίπλα από το μοντέλο της διπλής έλικας του DNA που τους εξασφάλισε το Βραβείο Νόμπελ. 2015 2 Β.

Διαβάστε περισσότερα

ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ ΠΕΡΙΓΡΑΜΜΑ ΎΛΗΣ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΤΗΣ ΧΗΜΕΙΑΣ ΕΝΟΤΗΤEΣ

ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ ΠΕΡΙΓΡΑΜΜΑ ΎΛΗΣ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΤΗΣ ΧΗΜΕΙΑΣ ΕΝΟΤΗΤEΣ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2016-2017 ΠΕΡΙΓΡΑΜΜΑ ΎΛΗΣ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΤΗΣ ΧΗΜΕΙΑΣ ΕΝΟΤΗΤEΣ 1 ΕΙΣΑΓΩΓΗ ΑΤΟΜΙΚΗ ΘΕΩΡΙΑ Δομικά σωματίδια (άτομα-μόρια-ιόντα) Δομή του ατόμου Ατομικός και μαζικός αριθμός Ισότοπα Ηλεκτρονική

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΚΑΙ ΑΝΟΡΓΑΝΗ ΧΗΜΕΙΑ

ΓΕΝΙΚΗ ΚΑΙ ΑΝΟΡΓΑΝΗ ΧΗΜΕΙΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΓΕΝΙΚΗ ΚΑΙ ΑΝΟΡΓΑΝΗ ΧΗΜΕΙΑ Ενότητα # (12): Αλογόνα Ακρίβος Περικλής Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΦΥΣΙΚΗ. Μαθηματική Εισαγωγή. Στοιχεία Διανυσματικού, Διαφορικού και Ολοκληρωτικού Λογισμού Εισαγωγή Διαίρεση Μηχανικής.

ΓΕΝΙΚΗ ΦΥΣΙΚΗ. Μαθηματική Εισαγωγή. Στοιχεία Διανυσματικού, Διαφορικού και Ολοκληρωτικού Λογισμού Εισαγωγή Διαίρεση Μηχανικής. ΓΕΝΙΚΗ ΦΥΣΙΚΗ Ι. ΜΗΧΑΝΙΚΗ Μαθηματική Εισαγωγή. Στοιχεία Διανυσματικού, Διαφορικού και Ολοκληρωτικού Λογισμού Εισαγωγή Διαίρεση Μηχανικής. Α Μηχανική Υλικού Σημείου Στατική Υλικού Σημείου, Σύνθεση δυνάμεων,

Διαβάστε περισσότερα

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά;

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; ΒΙΟΛΟΓΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ 12 26/10/2016 Κεφάλαιο 3 Α μέρος Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; Ποια είναι η δομή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

Αντιγραφή, έκφραση και ρύθµιση της γενετικής πληροφορίας. Κεφάλαιο 2

Αντιγραφή, έκφραση και ρύθµιση της γενετικής πληροφορίας. Κεφάλαιο 2 Αντιγραφή, έκφραση και ρύθµιση της γενετικής πληροφορίας Κεφάλαιο 2 Η συµπληρωµατικότητα των βάσεων του DNA T A G C Watson και Crick (1953): «είναι φανερό ότι το ειδικό ζευγάρωµα που έχουµε υποθέσει ότι

Διαβάστε περισσότερα