4. σε μια θέση έναρξης αντιγραφής η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται και στο παρακάτω σχήμα T C C Α Α Τ A T T A A G G

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "4. σε μια θέση έναρξης αντιγραφής η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται και στο παρακάτω σχήμα T C C Α Α Τ A T T A A G G"

Transcript

1 ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ BΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 2 ο - ΑΣΚΗΣΕΙΣ ΑΝΤΙΓΡΑΦΗ Γράφουμε τον ημισυντηρητικό τρόπο αντιγραφής του DNA. Αν χρειαστεί και τον κανόνα συμπληρωματικότητας και την αντιπαραλληλία των αλυσίδων (μοντέλο διπλής έλικας Watson & Crick) Για τα άκρα γράφουμε τα σχετικά με τον 3-5 φδδ και τη σύνθεση συνεχούς και ασυνεχούς αλυσίδας 1. Ένα μόριο DNA περιέχει στον έναν κλώνο Ν 15, ενώ στον άλλο Ν 14. Το μόριο αυτοδιπλασιάζεται σε περιβάλλον στο οποίο περιέχονται νουκλεοτίδια με Ν 14. Το αρχικό μόριο του DNA αποτελείται από 7200 νουκλεοτίδια. Πόσα νουκλεοτίδια με Ν 14 και πόσα με Ν 15 θα υπάρχουν στα μόρια του DNA που θα προκύψουν έπειτα από δυο συνεχείς αυτοδιπλασιασμούς.; 2. το κύριο κυκλικό μόριο DNA του βακτηρίου E.coli αποτελείται από 4χ10 6 ζεύγη βάσεων. Ένα βακτήριο E. coli αναπτύσσεται σε περιβάλλον με ραδιενεργό φώσφορο 32 Ρ. Αν ο χρόνος διπλασιασμού του βακτηρίου είναι 20 λεπτά, να εξηγήσεις μετά από 40 λεπτά: α. πόσα μόρια DNA σχηματίστηκαν; β. πόσα κανονικά και ραδιενεργά άτομα φωσφόρου περιέχονται στα μόρια του DNA που σχηματίστηκαν; 3. H ακόλουθη αλληλουχία βάσεων υπάρχει σε ένα δίκλωνο τμήμα μορίου DNA και αρχίζει να αντιγράφεται από το νουκλεοτίδιο με την υπογραμμισμένη Τ: 3..ΤCTGATATCAGTACG..5 Αν το πρωταρχικό τμήμα περιλαμβάνει 4 νουκλεοτίδια, ποια είναι η αλληλουχία των βάσεών του; 4. σε μια θέση έναρξης αντιγραφής η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται και στο παρακάτω σχήμα T C C Α Α Τ A T T A A G G A.Nα σχεδιάσετε σε αυτό όλες τις νεοσυντιθέμενες αλυσίδες του DNA και να σημειώσετε τον προσανατολισμό τους, γράφοντας τα 3 και 5 άκρα. B. να σημειώσετε τα πρωταρχικά τμήματα που σχηματίζονται στους κλώνους της συνεχούς αντιγραφής και αποτελούνται από 4 νουκλεοτίδια 5. Στην παρακάτω διχάλα αντιγραφής Α. να προσδιορίσετε τον προσανατολισμό των μητρικών και των θυγατρικών κλώνων Β. σε ποια περιοχή (A ή B) θα προσδεθεί πρωταρχικό τμήμα με αλληλουχία 5 CAA3 ;

2 6. Σε μια θέση τμήματος μορίου DNA με κλώνους Α και Β, έχει ξεκινήσει η αντιγραφή, όπως φαίνεται στο παρακάτω σχήμα. Η DNA δεσμάση εκτός του ότι συνδέει όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής, δρα κατά την αντιγραφή του κλώνου Β. Σε κάθε κλώνο να συμπληρώσετε τον προσανατολισμό της αντιγραφής και να χαρακτηρίσετε τον τρόπο σύνθεσης των νέων αλυσίδων DNA (μον. 4). Ποια ένζυμα τοποθετούν τα συμπληρωματικά νουκλεοτίδια και ποιους άλλους ρόλους έχουν; (μον. 7) (2008) 7. Δίνεται το παραπάνω τμήμα DNA, το οποίο αντιγράφεται. Στον κλώνο ΖΗ η αντιγραφή γίνεται με ασυνεχή τρόπο. Τα σημεία Δ και Η υποδεικνύουν τη θέση έναρξης της αντιγραφής. Α. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα, να σχεδιάσετε τα συνεχή και ασυνεχή τμήματα των νέων κλώνων με βέλη υποδεικνύοντας τους προσανατολισμούς των νέων και των μητρικών κλώνων (μον. 2). Να αιτιολογήσετε την απάντησή σας (μον. 4) (μον. 6) Β. στον κλώνο που αντιγράφεται με συνεχή τρόπο να γράψετε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισμό του πρωταρχικού τμήματος, το οποίο αποτελείται από 8 νουκλεοτίδια (μον. 2). Να αιτιολογήσετε την απάντησή σας (μον. 3) (μον. 5) (2011) 8. Δίνεται το παρακάτω τμήμα βακτηριακού DNA, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. α. να προσδιορίσετε την κωδική και τη μη κωδική αλυσίδα του παραπάνω τμήματος, επισημαίνοντας τα 5 και 3 άκρα των αλυσίδων του (μον. 1). Να αιτιολογήσετε την απάντησή σας (μον. 5) β. Το παραπάνω τμήμα DNA αντιγράφεται, και κατά τη διαδικασία της αντιγραφής δημιουργούνται τα παρακάτω πρωταρχικά τμήματα: 5 GAGAAUUC3, 5 UUAAGCUA3, 5 GUUGAAUU3 Να προσδιορίσετε ποια αλυσίδα αντιγράφεται, με συνεχή και ποια με ασυνεχή τρόπο (μον. 1). Να αιτιολογήσετε την απάντησή σας (μον. 5) (2012) 2

3 ΜΕΤΑΓΡΑΦΗ Εύρεση Κωδικής αλυσίδας - Από υποκινητή + άκρα (ο Υ είναι μπροστά από το 5 άκρο της κωδικής) - Άκρα + κατεύθυνση μεταγραφής (η κατεύθυνση μεταγραφής είναι και η κατεύθυνση της κωδικής) - Άκρα + κωδικόνια (αναζητούμε τα κωδικόνια έναρξης και λήξης με βήμα τριπλέτας, στηριζόμενοι στο ότι ο γενετικός κώδικας είναι κώδικας τριαδικός, συνεχής, μη επικαλυπτομένος) - Κωδικόνια (τα άκρα των κωδικωνίων είναι και τα άκρα της κωδικής αλυσίδας) 9. το τμήμα DNA που ακολουθεί περιλαμβάνει δυο υποθετικά γονίδια Α και Β. Στο σχήμα σημειώνεται η θέση των δυο υποκινητών. Ποια θα είναι η μη κωδική αλυσίδα για το γονίδιο Α και ποια για το γονίδιο Β. Δικαιολογήστε την απάντησή σας Υποκινητής Υποκινητής Γονιδίου Α Γονιδίου Β Στο τμήμα εικονίζεται τμήμα ενός μορίου DNA κατά τη διάρκεια της μεταγραφής. Να απαντήσετε στα ακόλουθα ερωτήματα Α. ποιος είναι ο κωδικός κλώνος, ο μη κωδικός κλώνος και το m RNA Β. σημειώστε τα άκρα των κλώνων και του m RNA στους κενούς κύκλους 11. Στο σχήμα απεικονίζεται μια θηλιά που έχει σχηματιστεί κατά τη μεταγραφή ενός μορίου DNA καθώς και η φορά προς την οποία μετατοπίζεται η RNA πολυμεράση. Αν το τελευταίο ριβονουκλεοτίδιο που έχει τοποθετηθεί κατά τη μεταγραφή φέρει C, να απαντήστε στα παρακάτω Α. ποια είναι τα άκρα του μορίου DNA, ποιος είναι ο κωδικός και ο μη κωδικός κλώνος Β. πού βρίσκεται ο υποκινητής (θέση 1 ή 2) 12. Δίνεται η παρακάτω αλληλουχία βάσεων μιας αλυσίδας ενός βακτηριακού γονιδίου: 3 - CCCCGCTATAGTTTCATGGCGAAATAAGTAACGTCACCCC-5 α. να συνταχθεί η συμπληρωματική αλυσίδα του DNA β. ποια από τις δυο αλυσίδες είναι δυνατό να κωδικοποιεί μια πρωτεϊνη; Γ. να συνταχθεί το m RNA που παράγεται και να οριστούν οι αμετάφραστες περιοχές και τα διάφορα κωδικόνια. Δ. να γραφτούν τα αντικωδικόνια των t RNA E. να υπολογιστεί ο αριθμός των αμινοξέων που κωδικοποιούνται 13. Τμήμα βακτηριακού DNA αποτελείται από 720 νουκλεοτίδια και είναι υπεύθυνο για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας. Από πόσα κωδικόνια θα αποτελείται το mrna που θα προκύψει από τη μεταγραφή του DNA και από πόσα αμινοξέα η πολυπεπτιδική αλυσίδα που θα προκύψει από τη μετάφρασή του; 14. Το πρόδρομο mrna που προέκυψε από τη μεταγραφή ενός γονιδίου ευκαρυωτικού κυττάρου έχει 730 νουκλεοτίδια. Οι 5 και 3 αμετάφραστες περιοχές του mrna έχουν συνολικά 12 3

4 νουκλεοτίδια. Αν η πολυπεπτιδική αλυσίδα (μη λειτουργική πρωτεϊνη) που προέκυψε με τη μετάφραση έχει 205 αμινοξέα, να βρείτε τον αριθμό των νουκλεοτιδίων που ανήκουν στα εσώνια του γονιδίου. 15. Δίνεται m RNA με την παρακάτω αλληλουχία βάσεων: 5 -GAUAGGUGAUGCCCUUUAAAGGGUAACCCUAGG-3 Να βρεθεί η αλληλουχία του γονιδίου και τα t RNA που θα ενωθούν με αυτό το m RNA. 18. Μία μεταγραφόμενη αλυσίδα βακτηριακού DNA έχει την παρακάτω αλληλουχία βάσεων 3 -TACTGCATAATGATT-5. α.. ποια είναι η αλληλουχία των βάσεων στη συμπληρωματική αλυσίδα; β. ποια είναι η ακολουθία των κωδικονίων στο mrna που μεταγράφεται; γ. ποια είναι τα αντικωδικόνια που αντιστοιχούν στα κωδικόνια του mrna δ. ποια είναι τα κωδικόνια του γονιδίου 16. Δίνεται δίκλωνο μόριο DNA το οποίο περιέχει τμήμα ασυνεχούς γονιδίου που μεταγράφεται σε m RNA. Α. πού συναντάμε ασυνεχή γονίδια (μον. 2) Β. να προσδιορίσετε τα 3 και 5 άκρα του παραπάνω μορίου DNA (μον. 2). Να αιτιολογήσετε την απάντησή σας (μον. 4) Γ. να γράψετε το τμήμα του πρόδρομο m RNA και του ώριμου m RNA που προκύπτουν από τη μεταγραφή του παραπάνω μορίου DNA, χωρίς αιτιολόγηση (μον. 2) Δ. πώς προκύπτει το ώριμο m RNA (μον. 3) (2009) 17. Δίνεται το παρακάτω τμήμα βακτηριακού DNA, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. Nα προσδιορίσετε την κωδική και τη μη κωδική αλυσίδα του παραπάνω τμήματος, επισημαίνοντας τα 5 και 3 άκρα των αλυσίδων του (μον. 1). Να αιτιολογήσετε την απάντησή σας (μον. 5) (2012) 18, Στο παρακάτω τμήμα δίκλωνου μορίου DNA, μεταξύ των σημείων Κ και Λ περιέχεται ένα γονίδιο. Στο διάγραμμα υποδεικνύεται η θέση του υποκινητή του γονιδίου. Να μεταφέρετε το σχήμα στο τετράδιό σας. 1. να σημειώσετε στο σχήμα τους προσανατολισμούς των κλώνων του μορίου (μον. 2) και να αιτιολογήσετε την απάντησή σας (μον.4) (μον. 6) 2. να τοποθετήσετε στο σχήμα και στις κατάλληλες θέσεις το κωδικόνιο έναρξης του γονιδίου και ένα από τα κωδικόνια λήξης (της επιλογής σας) (μον. 4). Να αιτιολογήσετε την απάντησή σας (μον. 9) (μον. 13) 4

5 3. να εξηγήσετε τι γίνεται κατά την έναρξη της μεταγραφής ενός γονιδίου (μον. 6) (ΕΠΑΝΑΛΗΠΤΙΚΕΣ 2011) 19. Σε ένα μόριο DNA ευκαρυωτικού κυττάρου υπάρχουν δυο γονίδια Α και Β, όπως φαίνεται στο σχήμα: 1. να μεταφέρετε το σχήμα στο τετράδιό σας και να ορίσετε τους προσανατολισμούς των αλυσίδων του DNA (μον. 2). Να αιτιολογήσετε την απάντησή σας (μον.4) 2. τα γονίδια Α και Β μεταγράφονται σε RNA. Να ορίσετε τους προσανατολισμούς του RNA (μον. 2). Να αιτιολογήσετε την απάντησή σας (μον.4) 3. ποια είναι η κωδική αλυσίδα για το γονίδιο Α και ποια για το Β (μον. 2). Να αιτιολογήσετε την απάντησή σας (μον. 5) 4. τι είναι ο υποκινητής (μον. 2); Να ορίσετε τη θέση του υποκινητή για κάθε γονίδιο με ένα βέλος (μον.4) (ΕΣΠΕΡΙΝΑ 2011) 20. Δίνονται τρια κωδικόνια ενός τμήματος γονιδίου από ένα μόριο DNA ευκαρυωτικού κυττάρου που κωδικοποιούν τη σύνθεση ενός πεπτιδικού τμήματος μιας πρωτεϊνης, και η διεύθυνση της μεταγραφής. Αλυσίδα 1... ACA AAG ATA...ελεύθερο υδροξύλιο Αλυσίδα 2... TGT TTC TAT... Διεύθυνση μεταγραφής Να ορίσετε τα άκρα 3 και 5 των παραπάνω αλυσίδων.. και να αιτιολογήσετε την απάντησή σας (μονάδες 5). Να γράψετε την αλληλουχία των βάσεων του τμήματος του m RNA που προκύπτει από τη μεταγραφή, σημειώνοντας τα άκρα 3 και 5 και να αιτιολογήσετε την απάντησή σας (μονάδες 7). Ποιο ένζυμο καταλύει το μηχανισμό της μεταγραφής και ποια είναι η δράση του μετά την πρόσδεσή του στον υποκινητή (μονάδες 7); (ΕΠΑΝ, 2005) Δίνεται τμήμα DNA το οποίο κωδικοποιεί τα οκτώ πρώτα αμινοξέα του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης. 1. να εντοπίσετε την κωδική αλυσίδα (μ.1). Να σημειώσετε τον προσανατολισμό των αλυσίδων (μ.1). Να αιτιολογήσετε την απάντησή σας (μ.4) (μον.6) 2. να γράψετε το τμήμα του mrna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος του γονιδίου και να ορίσετε τα 5 και 3 άκρα του (μ.2). Να αιτιολογήσετε την απάντησή σας (μ.3) (μον. 5) 3. να γράψετε το τμήμα του mrna στο οποίο θα συνδεθεί η μικρή υπομονάδα κατά την έναρξη της μετάφρασης (μ.2) 5

6 ΜΕΤΑΦΡΑΣΗ - Ο γενετικός κώδικας είναι τριαδικός, συνεχής, μη επικαλυπτόμενος - Το κωδικόνιο λήξης δεν έχει t RNA - Απέναντι από τα 5 και 3 άκρα του m RNA αντιστοιχούν το αμινικό και καρβοξυλικό άκρο της πολυπεπτιδικής αλυσίδας, αντίστοιχα - Όταν φεύγει ένα t RNA έρχεται το μεθεπόμενο 22. Δίνεται η ακόλουθη αλληλουχία του 3 ου άκρου ενός μορίου m-rna : UGGAUUCUCCCUACAAGGUAAGCGGAAU-3 Πόσα αμινοξέα κωδικοποιούνται από αυτό το τμήμα του m-rna Ποια είναι η ακολουθία των νουκλεοτιδίων στο γονίδιο που κωδικοποιεί αυτό το m-rna και τα t RNA που θα ενωθούν με αυτό το m RNA. 23. Ένα τμήμα DNA του βακτηρίου Ε. coli αποτελείται από νουκλεοτίδια. Πόσα αμινοξέα μπορούν να κωδικοποιηθούν από αυτό το τμήμα 24. δίνεται το γονίδιο 5 - ACCGATGCTTACCGTTGTGTCATGAAACA TGGCTACGAATGGCAACACAGTACTTTGT-5 το οποίο παράγει το πεπτίδιο : λευκίνη- βαλίνη- σερίνη α. να εντοπίσετει ποια είναι η κωδική αλυσίδα και ποια η μη κωδική αλυσίδα β. να γράψετε το m RNA που προκύπτει και να προσδιορίσετε τις 5 και 3 αμετάφραστες περιοχές του, τα εσώνια και τα εξώνια του γ. με ποιες διαδικασίες καταλήξαμε από το γονίδιο στο πεπτίδιο και σε ποιες περιοχές του κυττάρου έγιναν αυτές; Δίνεται τμήμα του γενετικού κώδικα: Λευκίνη CUU, βαλίνη GUG, σερίνη UCA 24. Κατά τη σύνθεση ενός πεπτιδίου, μετά το μόριο t RNA που φέρνει το αμινοξύ μεθειονίνη ήρθαν στο ριβόσωμα κατά σειρά μόρια t RNA με αντικωδικόνια: 5 AGC3, 5 CCA3. Ποια θα είναι τα 3 πρώτα αμινοξέα που θα ενταχθούν στην πολυπεπτιδική αλυσίδα; 25. Αν ένα τμήμα της κωδικής αλυσίδας ενός μορίου DNA περιέχει την ακόλουθη διαδοχή αζωτούχων βάσεων, να απαντήσετε στις ακόλουθες ερωτήσεις: -ATG-CCT-TTA-AAA-CGA-TCC-GTA-CAC-TCG-TGA- Α. ποια είναι η μη κωδική αλυσίδα του DNA Β. ποιο είναι το τμήμα του m RNA που συντίθεται; Γ. ποια είναι τα αντικωδικόνια των t RNA που παίρνουν μέρος στη μετάφραση; Δ. το πρωτεϊνικό τμήμα που παράγεται από πόσα αμινοξέα αποτελείται; Ε. ποιο είναι το σύνολο των δεσμών υδρογόνου και των φωσφοδιεστερικών δεσμών σ αυτό το τμήμα DNA 26. μία αλυσίδα DNA γονιδίου, που κωδικοποιεί πεπτίδιο και απομονώθηκε από βακτήριο E.coli, περιέχει την ακόλουθη αλληλουχία: CCGGTTAAGGCTCATACAGCATGAGCCGAT Α. να γράψετε τη συμπληρωματική της Β. ποια από τις δυο αλυσίδες είναι η μη κωδική και γιατί; Γ. να τοποθετήσετε τα 5 και 3 άκρα των αλυσίδων αυτών Δ. να γράψετε το m-rna που προκύπτει από τη μεταγραφή του τμήματος αυτού Ε. να γράψετε το πεπτίδιο που προκύπτει από τη μετάφραση του m-rna αυτού και να σημειώσετε το αμινικό και καρβοξυλικό άκρο (να συμβουλευτείτε το γενετικό κώδικα) Στ. κατά τη διάρκεια της μετάφρασης: 1. όταν η αμινομάδα της λευκίνης σχηματίζει πεπτιδικό δεσμό, να βρείτε πόσοι και ποιοι δεσμοί σπάζουν 2. όταν το t RNA που μεταφέρει τη λευκίνη αφήνει το ριβόσωμα, να βρείτε ποιο t RNA θα συνδεθεί στη συνέχεια; 6

7 27. Εστω το παρακάτω άκρο ενός τμήματος m-rna που εμπεριέχει τα κωδικόνια για κάποια αμινοξέα και αμετάφραστη περιοχή: UUUCAGUUUACGUCCUCGAACU Α. ποιο είναι το 3 και ποιο το 5 άκρο αυτού του τμήματος; Β. το τμήμα αυτό αντιστοιχεί στην αρχή ή στο τέλος του μορίου; Γ. πόσα αμινοξέα θα προκύψουν από αυτό το τμήμα; Δ. ποια είναι τα αντικωδικόνια των t-rna που αντιστοιχούν σε αυτό το τμήμα; 28. Στην εικόνα παρουσιάζεται ένα πολύσωμα στο οποίο υπάρχουν τρια ριβοσώματα. Λαμβάνοντας υπόψη τον αριθμό των αμινοξέων που έχουν ενταχθεί στις πολυπεπτιδικές αλυσίδες να επισημάνετε τα ελεύθερα άκρα του m RNA, αιτιολογώντας την επιλογή σας. 29. Στο σχήμα εικονίζεται τμήμα μορίου του DNA που μεταγράφεται από το Α προς το Β και κωδικοποιεί την παραγωγή ενός πεπτιδίου. Αν ο κωδικός κλώνος είναι ο επάνω, να απαντήσετε στα παρακάτω ερωτήματα Α.ποια είναι η αλληλουχία του μη κωδικού κλώνου και του m RNA που παράγεται; Β. ποια είναι τα άκρα των κλώνων και του m RNA Γ. πού (περιοχή Α ή Β) βρίσκεται ο υποκινητής και πού βρίσκονται οι αλληλουχίες λήξης της μεταγραφής. Δ. προς ποια κατεύθυνση μετατοπίζεται η RNA πολυμεράση Ε. ποιο άκρο του μη κωδικού κλώνου έχει ελεύθερη υδροξυλομάδα και ποιο άκρο έχει ελεύθερη φωσφορική ομάδα Στ. ποιο αμινοξύ θα έχει ελεύθερη αμινομάδα και ποια ελεύθερη καρβοξυλομάδα; Ζ. ποιο είναι το αντικωδικόνιο του 2 ου μορίου t RNA που θα χρησιμοποιηθεί; 30. Δίνεται τμήμα μορίου DNA ευκαρυωτικού κυττάρου που περιέχει ασυνεχές γονίδιο Εσώνιο. G A A T T C A T G T T T C C C C A G G T T T A A G A A T T C C T T A A G T A C AA A G G G G T C C A A A T T C T T A A G Εσώνιο Το οποίο είναι υπεύθυνο για τη σύνθεση του παρακάτω πεπτιδίου, που δεν έχει υποστεί καμία τροποποίηση H 2 N- Mεθειονίνη-φαινυλαλανίνη-βαλίνη-COOH Να γράψετε την κωδική και τη μη κωδική αλυσίδα του γονιδίου, το πρόδρομο m-rna και το ώριμο m-rna (Mονάδες4) και να ορίσετε τα 3 και 5 άκρα των παραπάνω νουκλεοτιδικών αλυσίδων αιτιολογώντας την απάντησή σας (μονάδες 8). Να αναφέρετε τις διαδικασίες κατά την πορεία από το γονίδιο στο πεπτίδιο και τις περιοχές του κυττάρου στις οποίες πραγματοποιούνται (μονάδες 6). Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων από το γενετικό κώδικα Μεθειονίνη AUG Φαινυλαλανίνη UUU Βαλίνη GUU (2005) 31. Ένα τμήμα αλυσίδας DNA, που λειτουργεί ως κωδική, απομονώθηκε από βακτήριο E.coli και έχει την παρακάτω αλληλουχία βάσεων. 5 GTAGCCTACCCATAGG 3 Υποθέτουμε ότι mrna μεταγράφεται από αυτό το DNA. Ποια θα είναι η αλληλουχία των βάσεων του mrna που θα προκύψει από τη μεταγραφή; Να σημειώσετε τον προσανατολισμό του mrna. Μονάδες 9 7

8 1. Να γράψετε την αλληλουχία των αμινοξέων του πεπτιδίου που θα προκύψει από τη μετάφραση του παραπάνω τμήματος mrna. Σημείωση: - Η μετάφραση αρχίζει ακριβώς στο 5 άκρο αυτού του mrna - Υποθέτουμε ότι δεν απαιτείται κωδικόνιο έναρξης - Δίνεται τμήμα του γενετικού κώδικα Μονάδες 6 Όταν το trna που μεταφέρει την αλανίνη εγκαταλείψει το ριβόσωμα, να αιτιολογήσετε ποιο αμινοξύ θα μεταφερθεί στο ριβόσωμα από το αντίστοιχο trna. Μον. 10 (2001) 32. Δίνεται το πεπτίδιο H 2 N Μεθειονίνη Αλανίνη Τυροσίνη Προλίνη Σερίνη COOH, που κωδικοποιείται από το παρακάτω τμήμα μορίου DNA ευκαρυωτικού κυττάρου: 5 CAAATGGCCTATAACTGGACACCCAGCTGACGA 3 3 GTTTACCGGATATTGACCTGTGGGTCGACTGCT 5 Να γράψετε την αλληλουχία του πρόδρομου mrna, την αλληλουχία του ώριμου mrna που προκύπτει μετά τη μεταγραφή του παραπάνω τμήματος DNA και να αιτιολογήσετε την απάντησή σας (μονάδες 9). Να γράψετε την αλληλουχία του εσωνίου που βρίσκεται στο παραπάνω τμήμα του μορίου DNA (μονάδες 8). Να περιγράψετε τη διαδικασία ωρίμανσης του πρόδρομου mrna (μονάδες 8). (επαναληπτικές 2006) Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων από το γενετικό κώδικα: Αλανίνη GCC, Μεθειονίνη AUG, Προλίνη CCC, Σερίνη AGC, Τυροσίνη UAU 33. Δίνεται το παρακάτω τμήμα βακτηριακού DNA που κωδικοποιεί τα πέντε (5) πρώτα αμινοξέα μιας πολυπεπτιδικής αλυσίδας. Η κατεύθυνση στην οποία κινείται η RNA πολυμεράση κατά τη μεταγραφή υποδεικνύεται από το βέλος. Α. ποια από τις δύο αλυσίδες του παραπάνω DNA είναι η κωδική και ποια είναι η μη κωδική; (μον. 2). Να αιτιολογήσετε την απάντησή σας (μον. 7) Β. να γράψετε την αλληλουχία του m RNA, που προκύπτει από τη μεταγραφή του παραπάνω DNA (μον. 3) Γ. να γράψετε και να αιτιολογήσετε το αντικωδικόνιο του t RNA, που μεταφέρει το 2ο αμινοξύ της πολυπεπτιδικής αλυσίδας. (μον. 5) Δ. τι είναι το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης (μον. 5) και ποια είναι η μετέπειτα πορεία του t RNA, που συμμετέχει σε αυτό; (μον. 3). (επαναληπτικές 2009) ΙV. ΔΙΑΦΟΡΕΣ 34. τμήμα DNA που αντιστοιχεί σε γονίδιο απομονώνεται από προκαρυωτικό κύτταρο. Στην κωδική αλυσίδα του βρέθηκε η εξής αναλογία: Α 18%, Τ24%, G16%. Nα υπολογίσετε την αναλογία βάσεων: α. στη μη κωδική αλυσίδα β. στο μόριο του DNA γ. στο RNA που προκύπτει από τη μεταγραφή του μορίου αυτού 35. Νουκλεϊκά οξέα: να γίνει απλή αναφορά των περιπτώσεων στις οποίες παρατηρείται συμπληρωματικότητα αδενίνης ουρακίλης (Πανελλαδικές Ιατρικής 1998) 36. Μία από τις δύο αλυσίδες του DNA που έχει τη σύνθεση βάσεων αδενίνη 21%, γουανίνη 29%, κυτοσίνη 29% και θυμίνη 21% διπλασιάζεται για να δώσει τη συμπληρωματική της αλυσίδα. Η συμπληρωματική αυτή αλυσίδα μεταγράφεται συνέχεια σε RNA. Nα δοθεί η σύνθεση των βάσεων του σχηματιζόμενου RNA. Να αιτιολογηθεί η απάντηση (Πανελλαδικές Ιατρικής 1988) 37Ένα μόριο RNA που παράχθηκε από ένα βακτήριο έχει 15%A, 30%U, 20%G, 35%C. Να βρείτε την εκατοστιαία αναλογία βάσεων στον κωδικό και μη κωδικό κλώνο και σε όλο το μόριο του DNA. 8

9 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 ΘΕΩΡΙΑ 1.ποιες κυτταρικές δομές αποτελούνται αποκλειστικά από νουκλεϊκό οξύ και πρωτεϊνες (3) 2. τι χρειάζεται (υλικά) για να γίνει η αντιγραφή, η μεταγραφή και η μετάφραση του DNA 3. πού γίνονται οι λειτουργίες: αντιγραφή, μεταγραφή και μετάφραση του γενετικού υλικού. 4. ποια ένζυμα καταλύουν το σχηματισμό 3-5 φωσφοδιεστερικού δεσμού (7) 5. ποια ένζυμα καταλύουν τη διάσπαση του 3-5 φωσφοδιεστερικού δεσμού (4) 6. αλληλόμορφο γονίδιο εντοπίζεται στον πυρήνα σωματικού κυττάρου διπλοειδούς οργανισμού. Πόσες φορές είναι δυνατό, κατά τη διάρκεια του κύκλου ζωής του κυττάρου, το γονίδιο αυτό: α. να αντιγράφεται β. να μεταγράφεται γ. να μεταφράζεται το προϊόν της μεταγραφής του. 7. δυο γονίδια προέρχονται από οργανισμούς διαφορετικών ειδών και κωδικοποιούν πρωτεϊνες που επιτελούν την ίδια λειτουργία. Η αλληλουχία βάσεων στα γονίδια διαφέρει κατά 35%, ενώ η αλληλουχία αμινοξέων στις αντίστοιχες πρωτεϊνες διαφέρει κατά 16%. Πώς δικαιολογείται αυτή η διαφορά; 8. μια πρωτεϊνη ενός ευκαρυωτικού κυττάρου αποτελείται από μια πολυπεπτιδική αλυσίδα 100 αμινοξέων. Το γονίδιο από το οποίο κωδικοποιήθηκε η πρωτεϊνη αποτελείται από πολύ περισσότερα νουκλεοτίδια από αυτά που κωδικοποιούν τα 100 αμινοξέα. Να αναφέρετε τους λόγους αυτής της διαφοράς. 9

10 9. ποια είναι τα τμήματα του DNA στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς που δεν μεταγράφονται. (3) 10. από τα τμήματα του DNA που μεταγράφονται ποια είναι αυτά δεν μεταφράζονται (4) 11. αν γνωρίζουμε την αλληλουχία των αμινοξέων μιας πολυπεπτιδικής αλυσίδας μπορούμε να γνωρίζουμε με ακρίβεια την αλληλουχία των νουκλεοτιδίων του γονιδίου;(5) 12. σε ποιες περιπτώσεις παρατηρούμε συμπληρωματικοτήτα βάσεων; DNA - (έναρξη αντιγραφής) DNA-..(αντιγραφή) RNA... (αυτοδιπλασιασμός ιών) DNA -..(μεταγραφή) RNA -. (αντίστροφη μεταγραφή) mrna - (μετάφραση) rrna-. (μετάφραση) DNA -.. (δίκλωνο μόριο) RNA... (δίκλωνο μοριο) DNA ή RNA και μορίων ανιχνευτών (κεφ. 4) 13. ποιες περιοχές του γονιδιώματος ενός ευκαρυωτικού κυττάρου δε μεταφράζονται σε αμινοξέα. Διαλέξτε: τα εσώνια ή εξώνια, τα κωδικόνια λήξης ή έναρξης οι 5 ή 3 αμετάφραστες περιοχές τα γονίδια που είναι υπεύθυνα για το σχηματισμό..,.., τα τμήματα του γονιδιώματος που δεν αντιστοιχούν σε γονίδια οι υποκινητές ή οι μεταγραφικοί παράγοντες οι αλληλουχίες λήξης της μεταγραφής ή της αντιγραφής 14. δίνονται 4 τριπλέτες νουκλεοτιδίων που αποτελούν τμήματα της κωδικής και της μη κωδικής αλυσίδας ενός μορίου DNA, του μορίου m RNA που κωδικοποιείται από αυτό το τμήμα DNA και του αντικωδικονίου που αντιστοιχείσε αυτό το τμήμα του m RNA. Δίνεται ότι η τριπλέτα του m RNA κωδικοποιεί το αμινοξύ μεθειονίνη. Να αντιστοιχίσετε τα στοιχεία της στήλης Α με αυτά της στήλης Β. Α Β 1. κωδική αλυσίδα DNA α. 3 ATG 5 2. μη κωδική αλυσίδα DNA β. 3 GUA 5 3. m RNA γ. 3 GTA 5 4. t RNA δ. 3 UAC 5 ε. 3 AUG 5 στ. 3 TAC 5 10

11 ΤΙ ΠΡΕΠΕΙ ΝΑ ΓΡΑΦΟΥΜΕ ΣΤΙΣ ΑΣΚΗΣΕΙΣ 2ου ΚΕΦΑΛΑΙΟΥ ΑΣΚΗΣΕΙΣ ΑΝΤΙΓΡΑΦΗΣ Γράφουμε τον ημισυντηρητικό τρόπο αντιγραφής του DNA. Αν χρειαστεί και τον κανόνα συμπληρωματικότητας και την αντιπαραλληλία των αλυσίδων (μοντέλο Watson & Crick). Στις ασκήσεις με συνέχεια-ασυνέχεια γράφουμε την σχετική θεωρία του βιβλίου Αριθμός ΦΔΔ ΦΩΣΦΟΔΙΕΣΤΕΡΙΚΟΣ ΔΕΣΜΟΣ: είναι ο ομοιοπολικός δεσμός που σχηματίζεται ανάμεσα στο υδροξύλιο του 3 άκρου της πεντόζης του ενός νουκλεοτιδίου και της φωσφορικής ομάδας που είναι στο 5 άκρο της πεντόζης του επόμενου νουκλεοτιδίου. Το τελευταίο όμως νουκλεοτίδιο σε ένα γραμμικό μόριο DNA (για κάθε αλυσίδα) ή RNA έχει ελεύθερο το υδροξύλιο στο 3 άκρο του και έτσι ο αριθμός των φδδ ισούται με τον αριθμό των νουκλεοτιδίων μείον ένα. Αν το μόριο είναι κυκλικό (μονόκλωνο ή δίκλωνο) δεν υπάρχει ελεύθερο άκρο κι έτσι ο αριθμός των φδδ ισούται με τον αριθμό των νουκλεοτιδίων. AΣΚΗΣΕΙΣ ΜΕΤΑΓΡΑΦΗΣ ΓΟΝΙΔΙΟ= από τον υποκινητή (δεν περιλαμβάνεται) μέχρι (περιλαμβάνεται) τις αλληλουχίες λήξης της μεταγραφής. Περιέχει: 5 αμετάφραστη περιοχή, κωδικόνιο έναρξης, εξώνια, εσώνια, κωδικόνιο λήξης, 3 αμετάφραστη περιοχή. Στο ώριμο m RNA λείπουν τα εσώνια, στην πολυπεπτιδική αλυσίδα μεταγράφονται μόνο τα κωδικόνια εκτός από τα κωδικόνια λήξης. Όταν πάμε από αλυσίδα σε αλυσίδα (κωδική, μη κωδική, RNA) αναφέρουμε 1. κανόνας συμπληρωματικότητας (Α-Τ, G-C, A-U στο RNA) 2. αντιπαραλληλία άκρων ΚΩΔΙΚΗ-ΜΗ ΚΩΔΙΚΗ Η κωδική αλυσίδα του DNA είναι η 5 3 και τα κωδικόνιά της είναι ίδια με του m RNA (εξαίρεση: αντί T στο m RNA έχουμε U). Η μη κωδική αλυσίδα (=μεταγραφόμενη) του DNA είναι η ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: η μεταγραφή γίνεται με κατεύθυνση 5 3 με πρότυπο τη μη κωδική αλυσίδα του DNA, όπου η RNA πολυμεράση κινείται με φορά 3 προς 5. Δηλαδή τα άκρα του RNA είναι αντιπαράλληλα της μη κωδικής αλυσίδας και παράλληλα της κωδικής (η μη κωδική είναι αντιπαράλληλη της κωδικής σύμφωνα με το μοντέλο της διπλής έλικας των Watson & Crick) ΕΥΡΕΣΗ ΚΩΔΙΚΗΣ: 1. Μας δίνει υποκινητή και άκρα : είναι η 5 3 μετά τον υποκινητή 2. Μας δίνει άκρα και κατεύθυνση μεταγραφής: είναι η 5 3 παράλληλη προς την κατεύθυνση μεταγραφής 3. Μας δίνει νουκλεοτίδια με άκρα: αναζητούμε τα κωδικόνια έναρξης και λήξης και στις δυο αλυσίδες προς όλες τις κατευθύνσεις (με βήμα τριπλέττας αν πρόκειται για βακτηριακό DNA) 4. Mας δίνει νουκλεοτίδια χωρίς άκρα: αναζητούμε ομοίως τα κωδικόνια έναρξης και λήξης και δηλώνουμε πως «Τα άκρα των κωδικονίων είναι και άκρα της κωδικής αλυσίδας» ΑΝΤΙΣΤΟΙΧΙΣΗ ΚΩΔΙΚΟΝΙΩΝ ΚΑΙ ΤΡΙΠΛΕΤΤΩΝ. RNA DNA κωδική DNA μη κωδική Κωδικόνιο έναρξης 5 AUG 3 5 ATG3 3 TAC5 Κωδικόνιο λήξης 5 UAG3 5 TAG3 3 ATC 5 5 UGA3 5 TGA3 3ACT5 5 UAA3 5 TAA3 3 ATT5 ΚΩΔΙΚΟΝΙΑ υπάρχουν στο m RNA και στην κωδική αλυσίδα του DNA. Η μη κωδική αλυσίδα έχει τριπλέτες που αντιστοιχούν σε κωδικόνια. Τα κωδικόνια αποτελούνται από 3 νουκλεοτίδια.τα άκρα τους είναι 5 3 ΥΠΟΚΙΝΗΤΗΣ= τμήμα DNA που βρίσκεται μπροστά από το γονίδιο (3 άκρο μη κωδικής, 5 άκρο κωδικής). Προσδένεται η RNA πολυμεράση και αρχίζει η μεταγραφή ΑΜΕΤΑΦΡΑΣΤΕΣ ΠΕΡΙΟΧΕΣ.. Mεταγράφουμε όλη τη μη κωδική του DNA ορίζοντας όμως τα τμήματα μπροστά και πίσω από τα κωδικόνια έναρξης και λήξης ως 5 αμετάφραστη και 3 αμετάφραστη περιοχή αντίστοιχα. 11

12 ΑΣΚΗΣΕΙΣ ΜΕΤΑΦΡΑΣΗΣ Αν χρησιμοποιηθεί ο γεν. κώδικας σημειώνουμε πως ο γ.κ. είναι κώδικας τριπλέττας, συνεχής, μη επικαλυπτόμενος Tα αντικωδικόνια γράφονται με κόμμα πχ. 3 GCA5, 3 ACA5, 3 AUA5 Όλα τα κωδικόνια κωδικοποιούν αμινοξέα εκτός από τα κωδικόνια λήξης. Το πρώτο αμινοξύ κάθε πεπτιδικής αλυσίδας έχει ελεύθερο αμινικό άκρο (αντιστοιχεί στο 5 άκρο του m RNA) και το τελευταίο έχει ελεύθερο καρβοξυλικό άκρο (αντιστοιχεί στο 3 του m RNA) Όταν σχηματίζεται ένας πεπτιδικός δεσμός ανάμεσα σε 2 αμινοξέα, φεύγει το t RNA που κουβαλούσε το πρώτο αμινοξύ, μετακινείται το ριβόσωμα και έρχεται το t RNA που φέρει το 3ο αμινοξύ. 12

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ)

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 2000 ΗΜΕΡΗΣΙΟ Ζήτηµα 2ο Α. Η διαδικασία της αντιγραφής

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2015 2 0 1 5 ΗΜΕΡΗΣΙΑ ΛΥΚΕΙΑ ΕΣΠΕΡΙΝΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2013 2 0 1 3 ΛΥΚΕΙΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ 5 Γ Ε Λ Χ Α Λ Α Ν Δ Ρ Ι Ο Υ Περιεχόμενα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr ΚΕΦΑΛΑΙΟ 1 TO ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ερωτήσεις

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών Φ ρ ο ν τ ι σ τ ή ρ ι α δ υ α δ ι κ ό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Θ Ε Μ Α Α Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς 2 0 1 6 Βιολογία Γ λυκείου

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ Θέμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ 1. Ούλωφ Πάλμε & Επάφου & Χρυσίππου 1 Ζωγράφου, 210 74 88 030 2. Φανερωμένης 13 Χολαργός, 210 65 36 551 www.en-dynamei.gr ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ)

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 Θέμα 1 Α1. α Α2. δ Α3. γ Α4. β Α5. β Θέμα 2 Β1. Σελ. σχολικού βιβλίου 13 «Το 1928. για το πώς γίνεται αυτό» Β2. Σελ. σχολικού βιβλίου 101 «Τέλος, βλάβες στους

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 15 Ιουνίου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Επαναληπτικών Πανελλαδικών Εξετάσεων Εσπερινών Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 β Α.2 γ Α.3 δ Α.4 α Α.5

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2011 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Θέμα A A1: β A2: β A3: γ A4: β A5: α. Θέμα Β Β1.

ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Θέμα A A1: β A2: β A3: γ A4: β A5: α. Θέμα Β Β1. ΠΝΤΗΣΕΙΣ ΜΘΗΜ: ΙΟΛΟΓΙ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Θέμα A A1: β A2: β A3: γ A4: β A5: α Θέμα 1. Για να εκφράζονται και τα δυο αλληλόμορφα σε ετερόζυγα άτομα, τα γονίδια αυτά θα πρέπει να έχουν μεταξύ τους σχέση ατελών

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου 2011 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΟΣ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΟΣ ΘΕΜΑ Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΟΣ Β1. 1 Α, 2 Γ, 3 Α, 4 Β, 5 Α, 6 Α, 7 - Γ Β2. Τα χρωµοσώµατα ταξινοµούνται

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α. Α.1. γ. Α.2. β. Α.3. α. Α.4. δ.

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ)

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 28 ΝΟΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο

Διαβάστε περισσότερα