Supplementary Information for. RRM2B Suppresses Activation of the Oxidative Stress Pathway and is. Up-regulated by P53 During Senescence

Transcript

1 Supplementary Information for RRM2B Suppresses Activation of the Oxidative Stress Pathway and is Up-regulated by P53 During Senescence Mei-Ling Kuo 1,**, Alexander J. Sy 1, Lijun Xue 1, Martin Chi 1, Michelle T.-C. Lee 1, Terence Yen 1, Mei-Iok Chiang 1, Lufen Chang 1, Peiguo Chu 2 & Yun Yen 1,* 1 Department of Molecular Pharmacology, Beckman Research Institute, City of Hope, Duarte, CA 91010, USA. 2 Department of Pathology, City of Hope, Duarte, CA 91010, USA. * Corresponding Author: Yun Yen, M.D., Ph.D E. Duarte Rd., Duarte, CA 91010, USA Tel: (626) , ext yyen@coh.org ** Co-Corresponding Author: Mei-Ling Kuo, Ph.D E. Duarte Rd., Duarte, CA 91010, USA Tel: (626) , ext mkuo@coh.org

2 Supplementary Materials and Methods Generation of tetracycline-inducible in the ptripz lentiviral vector and the pmscvhyg-rrm2b retroviral expression vector. Sense and antisense oligonucleotide pairs were designed to generate shrnas that target four different regions of RRM2B. Polymerase chain reactions (PCR) were performed using common forward and reverse primers. The 50-µl PCR mixture contained 10 pmol of each sense and antisense oligonucleotide, 0.5 pmol of each common forward primer and reverse primer, 200 μm of each dntp, 0.5 μl of Pfu Turbo and 1x Pfu buffer (20 mm Tris-HCl ph 8.8, 2 mm MgSO 4, 100 mm KCl, 10 mm (NH 4 ) 2 SO 4, 0.1% Triton X-100). PCR was performed using the following program: 94 C for 30 sec, 25 cycles at 94 C for 30 sec, 54 C for 30 sec and 72 C for 1 min and the ends were extended at 72 C for 10 min. The PCR products were digested with EcoRI and XhoI and then inserted to the ptripz vector (Thermo Fisher Scientific, Huntsville, AL, USA). ptripz-shns was purchased from Thermo Fisher Scientific. The oligonucleotide sequences are listed in Table S1. pmscvhyg (Clontech, Mountain View, CA, USA) was first modified by inserting annealed oligonucleotides (5 -gatctgcggccgcggatccagtgtggtggtacgtac and 5 -tcg agtacgtaccaccacactggatccgcggccgca) between the BglII and XhoI 2

3 sites to introduce more cloning sites. RRM2B cdna was synthesized by PCR and inserted into the BamHI and XhoI sites in the modified MSCVhyg vector. The PCR primer sequences are listed in Table S1. Lentiviral production and transduction. ptripz lentiviruses were produced as described 1. IMR90 cells were transduced with ptripz lentiviruses expressing vector, shns or -A, -B, -C and D. Infected cells were selected with puromycin (2 μg/ml) 2 days following infection for additional two days. Puromycin-resistant cells were treated with doxycyclin (1μg/ml) to induce the expression of shrna before analysis. For sequential infection, ptripz-transduced cells were reseeded and infected with the pmscvhyg retrovirus. Two days following the second infection, the cells were selected with 100 μg/ml hygromycin. Cell cycle analysis. Cells were harvested by trypsinization, collected by centrifugation and washed with PBS. Cells were then suspended in staining solution containing 0.05 mg/ml propidium iodide, 0.1 % (w/v) sodium citrate and 0.1 % (v/v) Triton X-100 followed by RNAse A digestion (2 μg/ml) at room temperature for 30 minutes and analyzed by flow cytometry. The percentage 3

4 of cells in each phase was analyzed by ModFit LT TM (Verity Software House, Inc, Topsham, ME, USA). Antibodies. Antibodies against HMW KARATIN (Dako corporation, Carpinteria, CA, USA) and p63 (Zeta Corporation, Sierra Madre, CA, USA) were used for IHC analysis of human prostate tissue samples. An antibody against Phospho-MAPKAPK-2 (T334) for Western blot analysis was purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Mitochondrial DNA (mtdna) content analysis. This procedure was performed as described previously 2. The levels of the mitochondrial COX-1 gene and nuclear β-globin gene were quantified by qpcr. The relative COX-1 DNA content was calculated from the ratio of the level of the COX-1 to that of the β-globin gene. Microarray and bioinformatics analysis. IMR90 cells were infected with psuper.retro.puro- or -mut, selected with puromycin for two days and allowed to culture for 3 weeks. Total RNA from the infected IMR90 cells was isolated using TRIzol reagent (Invitrogen). The Affymetrix 4

5 GeneChip Human Gene 1.0 ST Array (Affymetrix, Santa Clara, CA, USA) was used to detect the expression profiles of the samples. cdna synthesis, crna labeling, hybridization and the scanning of the GeneChips were performed by the Microarray Core at City of Hope according to the manufacturer s protocol. Microarray samples were RMA normalized 3 using Partek Genomics Suite TM (Version 6.6, revision ; Partek, Inc., St. Louis, MO, USA), and genes were defined as differentially expressed if they showed at least a 1.5-fold change ( -mut). For system-level analysis, Gene Ontology (GO) 4 enrichment was carried on the lists of the up- and down-regulated genes using Partek Genomics Suite TM. Statistical significance for GO enrichment was determined using Fisher s exact test. Supplementary References 46. Nguyen, H.V. et al. SUMOylation attenuates sensitivity toward hypoxiaor desferroxamine-induced injury by modulating adaptive responses in salivary epithelial cells. Am. J. Pathol. 168, (2006). 47. Wang, X. et al. Ribonucleotide reductase subunit p53r2 regulates mitochondria homeostasis and function in KB and PC-3 cancer cells. Biochem. Biophys. Res. Commun. 410, (2011). 48. Irizarry, R.A. et al. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4, (2003). 49. Ashburner, M. et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 25, (2000). 5

6 Supplementary Table S1. Oligo sequences for generation of shrna and synthesis of RRM2B cdna. Vector Oligo Sequence psuper. retro.puro -A sense 5 -GATCCCCCATCAGAGATCCCAAGAAATTCAAG AGATTTCTTGGGATCTCTGATGTTTTTA psuper. retro.puro -A 5 -AGCTTAAAAACATCAGAGATCCCAAGAAATCTC TTGAATTTCTTGGGATCTCTGATGGGG antisense psuper. retro.puro -B sense 5 -GATCCCCGGGAAAGAGTGGTGGCCTTTTCAA GAGAAAGGCCACCACTCTTTCCCTTTTTA psuper. retro.puro -B 5 -AGCTTAAAAAGGGAAAGAGTGGTGGCCTTTCT CTTGAAAAGGCCACCACTCTTTCCCGGG antisense psuper. retro.puro -C sense 5 -GATCCCCCAGCAGAGATGAAGGACTTTTCAAG AGAAAGTCCTTCATCTCTGCTGTTTTTA psuper. retro.puro -C 5 -AGCTTAAAAACAGCAGAGATGAAGGACTTTCT CTTGAAAAGTCCTTCATCTCTGCTGGGG antisense psuper. retro.puro -C-mut 5 -GATCCCCCAGCAGAGCGCAAGGACTTTTCAAG AGAAAGTCCTTGCGCTCTGCTGTTTTTA sense psuper. retro.puro -C-mut 5 -AGCTTAAAAACAGCAGAGCGCAAGGACTTTCT CTTGAAAAGTCCTTGCGCTCTGCTGGGG antisense psuper. retro.puro shtp53-a sense 5 -GATCCCCGAAATTTGCGTGTGGAGTATTCAAG AGATACTCCACACGCAAATTTCTTTTTA psuper. retro.puro shtp53-a antisense 5 -AGCTTAAAAAGAAATTTGCGTGTGGAGTATCTC TTGAATACTCCACACGCAAATTTCGGG psuper. retro.puro shtp53-b sense 5 -GATCCCCGCGCACAGAGGAAGAGAATTTCAAG AGAATTCTCTTCCTCTGTGCGCTTTTTA psuper. retro.puro shtp53-b antisense 5 -AGCTTAAAAAGCGCACAGAGGAAGAGAATTCT CTTGAAATTCTCTTCCTCTGTGCGCGGG psuper. retro.puro shtp53-c sense 5 -GATCCCCGCACAGAGGAAGAGAATCTTTCAAG AGAAGATTCTCTTCCTCTGTGCTTTTTA psuper. retro.puro shtp53-c antisense 5 -AGCTTAAAAAGCACAGAGGAAGAGAATCTTCT CTTGAAAGATTCTCTTCCTCTGTGCGGG psuper. shrb1-a 5 -GATCCCCGCTCAAAGAACCATATAAATTCAAGA

7 retro.puro sense GATTTATATGGTTCTTTGAGCTTTTTA psuper. retro.puro shrb1-a antisense 5 -AGCTTAAAAAGCTCAAAGAACCATATAAATCTC TTGAATTTATATGGTTCTTTGAGCGGG psuper. retro.puro shrb1-b sense 5 -GATCCCCGAACAGGAGTGCACGGATATTCAAG AGATATCCGTGCACTCCTGTTCTTTTTA psuper. retro.puro shrb1-b antisense 5 -AGCTTAAAAAGAACAGGAGTGCACGGATATCT CTTGAATATCCGTGCACTCCTGTTCGGG psuper. retro.puro shrb1-c sense 5 -GATCCCCTGTAAGATCTCCAAAGAAATTCAAGA GATTTCTTTGGAGATCTTACATTTTTA psuper. retro.puro shrb1-c antisense 5 -AGCTTAAAAATGTAAGATCTCCAAAGAAATCTC TTGAATTTCTTTGGAGATCTTACAGGG psuper. retro.puro shns sense 5 -GATCCCCCATGCCTGATCCGCTAGTCTTCAAG AGAGACTAGCGGATCAGGCATGTTTTTA psuper. retro.puro shns antisense 5 -AGCTTAAAAACATGCCTGATCCGCTAGTCTCTC TTGAAGACTAGCGGATCAGGCATGGGG ptripz -A sense 5 -TGCTGTTGACAGTGAGCGCTACATCAGAGATC CCAAGAAATAGTGAAGCCACAGATGTA ptripz -A antisense 5 ATTCCGAGGCAGTAGGCATTACATCAGAGATCC CAAGAAATACATCTGTGGCTTCACTA ptripz -B sense 5 TGCTGTTGACAGTGAGCGCTGGGGAAAGAGTG GTGGCCTTTAGTGAAGCCACAGATGTA ptripz -B anti sense 5 ATTCCGAGGCAGTAGGCATTGGGGAAAGAGTG GTGGCCTTTACATCTGTGGCTTCACTA ptripz -C sense 5 TGCTGTTGACAGTGAGCGAATCAGCAGAGATG AAGGACTTTAGTGAAGCCACAGATGTA ptripz -C antisense 5 ATTCCGAGGCAGTAGGCACATCAGCAGAGATG AAGGACTTTACATCTGTGGCTTCACTA ptripz -D sense 5 TGCTGTTGACAGTGAGCGCCAGAAGAAAGGGT CAGGGAGATAGTGAAGCCACAGATGTA ptripz -D antisense 5 ATTCCGAGGCAGTAGGCATCAGAAGAAAGGGT CAGGGAGATACATCTGTGGCTTCACTA ptripz Common forward primer 5 -CAGAAGGCTCGAGAAGGTATATTGCTGTTGAC AGTGAGCG

8 ptripz pmscv hyg pmscv hyg Common reverse primer RRM2B forward primer RRM2B reverse primer 5 -CTAAAGTAGCCCCTTGAATTCCGAGGCAGTAG GCA AAAGGATCCGCCACCATGGGCGACCCGGAAAGG CC AAAACTCGAGTTAAAAATCTGCATCCAAGGTGAA GACG

9 Supplementary Table S2. Primer sequences for q-rt-pcr. Gene Sequence RRM2B sense 5 -CCTTGCGATGGATAGCAGATAG RRM2B antisense 5 -GCCAGAATATAG CAGCAA AAGATC GAPDH sense 5 -GGGAAGGTGAGTCGGAGTC GAPDH antisense GATGGCAACAATATCCACTTTACC β-actin sense AGAGATGGCCACGGCTGCTT β-actin antisense GCCACAGGACTCCATGCCCA

10 Supplementary Table S3. List of up-regulated genes by silencing of RRM2B in IMR90 cells. Ratio(sh Column # Transcript RRM2B Change(shR RM2B shrrm2 mut) B-mut) NM_ // CDH10 // cadherin 10, type 2 (T cadherin) // 5p14-p13 // CDH10 NM_ /// ENST NR_ // TLR4 // toll-like receptor 4 // q32-q33 // 7099 /// TLR4 NR_ NM // TLR4 // NR_ // RBMY2EP // RNA binding motif protein, Y-linked, family RBMY2EP NR_ , member E pseudog NM_ // RFPL4A // ret finger protein-like 4A // RFPL4A NM_ q13.42 // /// NR_ // SNORA14A // small nucleolar RNA, H/ACA SNORA14A NR_ box 14A // 7q11.23 // NM_ // RFPL4A // ret finger protein-like 4A // RFPL4A NM_ q13.42 // ///

11 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // LIPG // lipase, endothelial // 18q21.1 // 9388 /// ENST // LIPG NM_ NM_ // CD177 // CD177 molecule // 19q13.2 // /// ENST // CD177 / NM_ // SPP1 // secreted phosphoprotein 1 // 4q21-q25 // 6696 /// CD177 NM_ SPP1 NM_ NM_ // MFAP5 // microfibrillar associated protein 5 // 12p13.1- p12.3 // 8076 /// MFAP5 NM_ NM_ // ANKRD1 // ankyrin repeat domain 1 (cardiac muscle) // 10q23.31 // // ANKRD1 NM_ NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // SNORD NR_

12 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // IGFBP3 // insulin-like growth factor binding protein 3 // 7p13-p12 // 3 IGFBP3 NM_ NM_ // NAP1L2 // nucleosome assembly protein 1-like 2 // Xq13 // 4674 /// ENST000 NAP1L2 NM_ NM_ // ULBP1 // UL16 binding protein 1 // 6q25 // /// ENST // UL ULBP1 NM_ NM_ // SERPINB7 // serpin peptidase inhibitor, clade B (ovalbumin), member 7 SERPINB7 NM_ NM_ // ACRC // acidic repeat containing // Xq13.1 // /// ENST // ACRC NM_ AK // LOC // hypothetical LOC // 22q11.21 LOC AK

13 Column # Transcript NM_ // GDF15 // growth differentiation factor 15 // 19p13.11 // 9518 /// ENST0000 Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) GDF15 NM_ NM_ // SERPINI1 // serpin SERPINI1 peptidase inhibitor, clade NM_ I (neuroserpin), member NM_ // P2RX5 // purinergic receptor P2X, ligand-gated ion channel, 5 // 17p13.3 / P2RX5 NM_ NM_ // SLC39A8 // solute carrier family 39 (zinc transporter), member 8 // 4q22-q SLC39A8 NM_ NM_ // LRRN1 // leucine rich repeat neuronal 1 // 3p26.2 // /// ENST LRRN1 NM_ NM_ // TSPAN13 // tetraspanin 13 // p21.1 // /// ENST // TSPAN1 TSPAN13 NM_ NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // SNORD NR_ NM_ // OR2T6 // olfactory receptor, family 2, subfamily T, member 6 // OR2T6 NM_

14 Ratio(sh Column # Transcript RRM2B Change(shR RM2B shrrm2 mut) B-mut) NR_ // SNORD // small nucleolar RNA, C/D box SNORD NR_ // 15q11.2 // NM_ // KRT34 // keratin 34 // 17q12-q21 // KRT /// NM_ ENST // NM_ // AK3L // adenylate kinase 3-like // 1p31.3 // 205 /// NM // AK AK3L1 NM_ ENST // FMN1 // formin 1 // q13.3 // /// ENST // FMN1 // FMN1 ENST NM_ // SEC23B // Sec23 homolog B (S cerevisiae) // 20p11.23 // SEC23B NM_ /// NM NM_ // RTN1 // reticulon 1 // 14q23.1 // /// NM_ // RTN1 NM_ RTN1 // reticulon

15 Column # Transcript NR_ // PAR4 // Prader-Willi/Angelman region gene 4 // 15q11.2 // /// NR 00 Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) PAR4 NR_ NM_ // NRK // Nik related kinase // Xq // /// ENST // NRK / NRK NM_ NM_ // SLAMF7 // SLAM family member 7 // SLAMF7 1q23.1-q24.1 // /// NM_ ENST NM_ // SERPINA3 // serpin SERPINA3 peptidase inhibitor, clade NM_ A (alpha NM_ // TAS2R60 // taste receptor, type 2, member 60 // 7q35 // /// ENST000 TAS2R60 NM_ NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // SNORD NR_ NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // SNORD NR_ SNORD NR_ SNORD NR_ SNORD NR_

16 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // LGALS13 // lectin, galactosidebinding, soluble, 13 // q13.1 // // LGALS13 NM_ ENST // PRO2268 // hypothetical protein PRO2268 // 12q14.3 // PRO2268 ENST NM_ // PSG2 // pregnancy specific beta glycoprotein 2 // 19q13.1-q13.2 // 5670 PSG2 NM_ NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // AK // C18orf16 // chromosome 18 open reading frame 16 // 18q11.2 // SNORD NR_ SNORD NR_ SNORD NR_ C18orf16 AK NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // SNORD NR_

17 Column # Transcript NM_ // ZDHHC15 // zinc finger, DHHC-type containing 15 // Xq13.3 // /// NM Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) ZDHHC15 NM_ NM_ // CFHR3 // complement factor H CFHR3 related 3 // 1q32 // NM_ /// ENST NM_ // HSPA1A // heat shock 70kDa protein 1A // 6p21.3 // 3303 /// BC // HS HSPA1A NM_ NM_ // OPN1LW // opsin 1 (cone pigments), long-wavesensitive // Xq28 // 5956 OPN1LW NM_ NM_ // HSPA1A // heat shock 70kDa protein 1A // 6p21.3 // 3303 /// BC // HS HSPA1A NM_ AK // LOC // hypothetical LOC // 3p25.3 // /// LOC AK NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // SNORD NR_ NM_ // KRTAP4-11 // keratin associated protein 4-11 // 17q21.2 // /// ENST KRTAP4-11 NM_ NM_ // KRTAP4-8 // keratin associated protein 4-8 // 17q21.2 // /// NM 033 KRTAP4-8 NM_

18 Column # Transcript NR_ // SNORD115-6 // small nucleolar RNA, C/D box // 15q11.2 // Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) SNORD115-6 NR_ NM_ // C15orf48 // chromosome 15 open reading frame 48 // 15q21.1 // /// NM NM_ // IL1RAPL1 // interleukin 1 receptor accessory protein-like 1 // Xp22.1-p21. C15orf48 NM_ IL1RAPL1 NM_ NM_ // PPAPDC1A // phosphatidic acid phosphatase type 2 PPAPDC1A NM_ NM_ // ATP6V0D2 // ATPase, H+ transporting, lysosomal 38kDa, V0 NM_ // OR5J2 // olfactory receptor, family 5, subfamily J, member 2 // NM_ // NFASC // neurofascin homolog (chicken) // 1q32.1 // /// ATP6V0D2 NM_ OR5J2 NM_ NFASC NM_ NM_ // PAGE2 // P antigen family, member 2 (prostate associated) // Xp11.21 // PAGE2 NM_

19 Column # Transcript NM_ // CDKL4 // cyclindependent kinase-like 4 // 2p22.1 // /// Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) CDKL4 NM_ ENST // REEP3 // receptor accessory protein 3 // 10q21.3 // /// BC018 REEP3 ENST NM_ // KAL1 // Kallmann syndrome 1 sequence // Xp22.32 // 3730 /// NM_ // HSPA1B // heat shock 70kDa protein 1B // 6p21.3 // 3304 /// NM // H NM_ // HSPA1B // heat shock 70kDa protein 1B // 6p21.3 // 3304 /// NM // H NM_ // HSPA1B // heat shock 70kDa protein 1B // 6p21.3 // 3304 /// NM // H KAL1 NM_ HSPA1B NM_ HSPA1B NM_ HSPA1B NM_ AK // LOC // hypothetical LOC // 1p34.2 // LOC AK NM_ // PEG3 // paternally expressed 3 // 19q13.4 // 5178 /// NM // PEG3 PEG3 NM_

20 Column # Transcript AK // FLJ30430 // hypothetical protein FLJ30430 // 1q42.2 // Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) FLJ30430 AK NM_ // NAP1L3 // nucleosome assembly NAP1L3 protein 1-like 3 // Xq21.3- NM_ q22 // 4675 /// E NM_ // TNFRSF17 // tumor necrosis factor receptor superfamily, member 17 TNFRSF17 NM_ NM_ // PAPPA // pregnancy-associated plasma protein A, pappalysin 1 // 9q33.2 // AK // LOC // hypothetical LOC // 8p23.1 // PAPPA NM_ LOC AK NM_ // MFAP3L // microfibrillar-associated protein 3-like // 4q32.3 // 9848 /// N NM_ // SLCO1A2 // solute carrier organic anion transporter family, member 1A2 // NM_ // RAB1B // RAB1B, member RAS oncogene family // 11q12 // /// ENST00000 MFAP3L NM_ SLCO1A2 NM_ RAB1B NM_ AY // FAM48B1 // family with sequence similarity 48, member B1 // Xp22.11 // 1001 FAM48B1 AY AY // FAM48B1 // family with sequence similarity 48, member B1 // Xp22.11 // 1001 FAM48B1 AY

21 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // FUCA1 // fucosidase, alpha-l- 1, tissue // 1p34 // 2517 /// ENST FUCA1 NM_ NM_ // HSPB8 // heat shock 22kDa protein 8 // 12q24.23 // /// HSPB8 NM_ NM_ // C21orf7 // chromosome 21 open reading frame 7 // 21q22.3 // /// C21orf7 NM_ NM_ // TMEM217 // transmembrane protein 217 // 6p21.2 // /// NM NM_ // GPR112 // G protein-coupled receptor 112 // Xq26.3 // /// ENST00000 NM_ // KRTAP4-12 // keratin associated protein 4-12 // 17q12-q21 // /// NM NM_ // KRTAP4-12 // keratin associated protein 4-12 // 17q12-q21 // /// NM NM_ // OR6S1 // olfactory receptor, family 6, subfamily S, member 1 // NM_ // KRTAP4-11 // keratin associated protein 4-11 // 17q21.2 // /// NM 0 TMEM217 NM_ GPR112 NM_ KRTAP4-12 NM_ KRTAP4-12 NM_ OR6S1 NM_ KRTAP4-11 NM_

22 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // CHST11 // carbohydrate (chondroitin 4) sulfotransferase 11 // 12q NM_ // DUXA // double homeobox A // 19q13.43 // /// ENST // NM_ // COX7A1 // cytochrome c oxidase subunit VIIa polypeptide 1 (muscle) // 19q1 CHST11 NM_ DUXA NM_ COX7A1 NM_ NM_ // ST1 // S1 transmembrane family, member 1 // 3q13.2 // /// ST1 NM_ NM_ // CA8 // carbonic anhydrase VIII // 8q11-q12 // 767 /// ENST // C NR_ // SNORD115-1 // small nucleolar RNA, C/D box // 15q11.2 // NR_ // SNORD115-1 // small nucleolar RNA, C/D box // 15q11.2 // NR_ // SNORD115-1 // small nucleolar RNA, C/D box // 15q11.2 // CA8 NM_ SNORD115-1 NR_ SNORD115-1 NR_ SNORD115-1 NR_

23 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // OR2T5 // olfactory receptor, family 2, subfamily T, member 5 // NM_ // MPZL1 // myelin protein zero-like 1 // 1q24.2 // 9019 /// NM // MPZ OR2T5 NM_ MPZL1 NM_ NM_ // NTNG1 // netrin G1 // p13.3 // /// NM // NTNG1 NM_ NM_ // C16orf3 // chromosome 16 open reading frame 3 // 16q24.3 // 750 /// NM_ // TMEM63C // transmembrane protein 63C // 14q24.3 // C16orf3 NM_ TMEM63C NM_ NM_ // RGS4 // regulator of G-protein signaling 4 // 1q23.3 // 5999 /// NM 005 RGS4 NM_ NM_ // SERPINB2 // serpin SERPINB2 peptidase inhibitor, clade NM_ B (ovalbumin), member NM_ // S100A7 // S100 calcium binding S100A7 protein A7 // 1q21 // 6278 NM_ /// ENST NM_ // OR51A2 // olfactory receptor, family 51, subfamily A, member 2 // OR51A2 NM_

24 Column # Transcript NM_ // EDA2R // ectodysplasin A2 receptor // Xq12 // /// ENST // Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) EDA2R NM_ NM_ // FLJ43860 // FLJ43860 protein // q24.3 // NM_ // CYB5R1 // cytochrome b5 reductase 1 // 1p36.13-q41 // /// ENST FLJ43860 NM_ CYB5R1 NM_ NM_ // PAPPA // pregnancy-associated plasma protein A, pappalysin 1 // 9q33.2 // PAPPA NM_ NM_ // PRPS1 // phosphoribosyl pyrophosphate synthetase 1 // Xq PRPS1 NM_ NM_ // KRTAP4-9 // keratin associated protein 4-9 // 17q21.2 // /// KRTAP4-9 NM_ NM_ // FGFBP2 // fibroblast growth factor binding protein 2 // 4p16 // /// NM_ // KRTAP4-9 // keratin associated protein 4-9 // 17q21.2 // /// FGFBP2 NM_ KRTAP4-9 NM_ NM_ // NUAK1 // NUAK family, SNF1-like kinase, 1 // 12q23.3 // 9891 /// ENST00000 NUAK1 NM_

25 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // TRIM61 // tripartite motifcontaining 61 // 4q32.3 // /// ENST00 TRIM61 NM_ NM_ // C4orf18 // chromosome C4orf18 open reading frame 18 // NM_ q32.1 // /// NM NM_ // NHEDC // Na+/H+ exchanger domain containing 1 // 4q24 // /// NM 00 NHEDC1 NM_ NM_ // SCARB1 // scavenger receptor class B, member 1 // 12q24.31 // 949 /// NM 0 SCARB1 NM_ NM_ // OR4N4 // olfactory receptor, family 4, subfamily N, member 4 // OR4N4 NM_ NM_ // HIST2H2BE // histone cluster 2, H2be // 1q21- q23 // 8349 /// HIST2H2BE NM_ NM_ // ADAM21 // ADAM ADAM21 metallopeptidase domain NM_ // 14q24.1 // 8747 /// NM_ // GAGE12B // G antigen 12B // Xp11.23 // /// NM // GAGE12B NM_ NM_ // C1orf182 // chromosome 1 open reading frame 182 // 1q22 // /// ENST C1orf182 NM_ ENST // CYP2G1P // cytochrome P450, family 2, subfamily G, polypeptide 1 pse CYP2G1P ENST

26 Column # Transcript NM_ // KBTBD8 // kelch repeat and BTB (POZ) domain containing 8 // 3p14 // Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) KBTBD8 NM_ NM_ // RBM24 // RNA binding motif protein 24 // 6p22.3 // /// NM AK // ACAA1 // acetyl-coenzyme A acyltransferase 1 // 3p23- p22 // 30 NM_ // CXADR // coxsackie virus and adenovirus receptor // 21q21.1 // 1525 /// EN RBM24 NM_ ACAA1 AK CXADR NM_ NM_ // SLC10A5 // solute carrier SLC10A5 family 10 (sodium/bile NM_ acid cotransporter fam NM_ // IFNB1 // interferon, beta 1, fibroblast // 9p21 // 3456 /// ENST IFNB1 NM_ NM_ // COBLL1 // COBL-like 1 // 2q24.3 // /// ENST // COBLL1 // COBLL1 NM_ NM_ // KRTAP2-1 // keratin associated protein 2-1 // 17q12-q21 // /// NM_ // KRTAP2-1 // keratin associated protein 2-1 // 17q12-q21 // /// KRTAP2-1 NM_ KRTAP2-1 NM_

27 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 5781 NM_ // DHRS3 // dehydrogenase/reductas DHRS3 e (SDR family) member 3 NM_ // 1p36.1 // 9249 / NM_ // RRAGD // Ras-related GTP binding D // 6q15-q16 // /// RRAGD NM_ ENST NM_ // MCTP1 // multiple C2 domains, MCTP1 transmembrane 1 // 5q15 NM_ // /// NM NM_ // TMPRSS11B // transmembrane protease, serine 11B // 4q13.2 // /// EN TMPRSS11B NM_ NM_ // MT1X // metallothionein 1X // 16q13 // 4501 /// ENST // MT1X // MT1X NM_ NM_ // PPIC // peptidylprolyl isomerase C (cyclophilin C) // 5q23.2 // 5480 /// E PPIC NM_ NM_ // GNRHR // gonadotropin-releasing hormone receptor // 4q21.2 // 2798 /// NM GNRHR NM_

28 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // CD40LG // CD40 ligand // Xq26 // /// CD40LG NM_ ENST // NM_ // HIST1H1T // histone cluster 1, H1t // p21.3 // 3010 /// HIST1H1T NM_ ENST / NM_ // SPINLW1 // serine peptidase inhibitor-like, with Kunitz and WAP domains 1 SPINLW1 NM_ AK // HIST2H2BF // histone cluster 2, H2bf HIST2H2BF AK // 1q21.2 // NM_ // TC2N // tandem C2 domains, nuclear // 14q32.12 // /// NM TC2N NM_ NM_ // EPB41L4A // erythrocyte membrane protein band 4.1 like 4A // 5q22.1- NM_ // OR2G2 // olfactory receptor, family 2, subfamily G, member 2 // NM_ // FABP6 // fatty acid binding protein 6, ileal // 5q33.3-q34 // 2172 /// NM_ // CXCL16 // chemokine (C-X-C motif) ligand 16 // 17p13 // /// NM EPB41L4A NM_ OR2G2 NM_ FABP6 NM_ CXCL16 NM_ NM_ // GPRC5C // G protein-coupled receptor, family C, 5, member C // 17q25 GPRC5C NM_

29 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // SELPLG // selectin P ligand // 12q SELPLG // 6404 /// NM_ ENST // NM_ // VN1R1 // vomeronasal 1 receptor // 19q13.4 // /// VN1R1 NM_ ENST NM_ // ADAM21 // ADAM metallopeptidase domain 21 // 14q24.1 // 8747 /// ADAM21 NM_ NM_ // CACNB2 // calcium channel, voltage-dependent, beta 2 subunit // 10p12 // 7 CACNB2 NM_ AF // PP2672 // hypothetical LOC // 1q42.3 PP2672 AF // /// ENST NM_ // TXNDC11 // thioredoxin domain containing 11 // 16p13.13 // /// ENST0 TXNDC11 NM_ NM_ // CD48 // CD48 molecule // 1q21.3-q22 // 962 /// ENST // CD48 // NM_ // BCHE // butyrylcholinesterase // 3q26.1-q26.2 // 590 /// ENST / CD48 NM_ BCHE NM_

30 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // TCP10L // t-complex 10 (mouse) TCP10L like // 21q22.11 // NM_ /// BC // NM_ // UBE2U // 4731 ubiquitin-conjugating enzyme E2U (putative) // UBE2U NM_ p31.3 // / 5486 NM_ // KCNK2 // potassium channel, subfamily K, member 2 // 1q41 // 3776 KCNK2 NM_ NR_ // SIGLECP3 // sialic acid binding Ig-like lectin, pseudogene 3 // 19q13.3 NR_ // C10orf110 // chromosome 10 open reading frame 110 // 10p15.3 // /// NM_ // TNFRSF10D // tumor necrosis factor receptor superfamily, member NM_ // RETSAT // retinol saturase (alltrans-retinol 13,14- reductase) // 2p11.2 / SIGLECP3 NR_ C10orf110 NR_ TNFRSF10D NM_ RETSAT NM_ NM_ // TMEM108 // transmembrane protein 108 // 3q21 // /// NM // NM_ // FBXO16 // F-box protein 16 // 8p21.1 // /// ENST // FBXO TMEM108 NM_ FBXO16 NM_

31 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // MAMDC2 // MAM domain containing 2 // 9q21.12 // /// MAMDC2 NM_ ENST // OR2AP1 // olfactory receptor, family 2, subfamily AP, member 1 // 12 OR2AP1 ENST NM_ // CHST15 // carbohydrate (Nacetylgalactosamine sulfate 6-O) sulfotransfer CHST15 NM_ NM_ // MRAS // muscle RAS oncogene homolog // 3q22.3 // /// NM MRAS NM_ NM_ // DNAJB3 // DnaJ (Hsp40) homolog, subfamily B, member 3 // 2q37 // DNAJB3 NM_ NM_ // TGFB2 // transforming growth factor, beta 2 // 1q41 // 7042 /// NM 0032 TGFB2 NM_

32 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // APOD // apolipoprotein D // q26.2-qter // 347 /// APOD NM_ ENST // APOD NM_ // OR2J3 // olfactory receptor, family 2, OR2J3 NM_ subfamily J, member 3 // NM_ // UGT2B7 // UDP glucuronosyltransferase 2 family, polypeptide B7 // 4q13 // UGT2B7 NM_ NM_ // SRGN // serglycin // 10q22.1 // 5552 /// ENST // SRGN NM_ NR_ // LOC // hypothetical LOC // 8q12.3 // /// LOC NR_ NM_ // TFEC // transcription factor EC // 7q31.2 // /// NM // TFE NM_ // HTR3E // 5-hydroxytryptamine (serotonin) receptor 3, family member E // 3q NM_ // C12orf5 // chromosome 12 open reading frame 5 // 12p13.3 // /// TFEC NM_ HTR3E NM_ C12orf5 NM_ NM_ // S100A7A // S100 calcium binding protein A7A // 1q21.3 // /// ENST00 S100A7A NM_

33 Ratio(sh RRM2B Change(shR RM2B shrrm2 mut) B-mut) Column # Transcript NM_ // GATA6 // GATA binding protein 6 // 18q11.1-q11.2 // 2627 /// ENST GATA6 NM_ NM_ // FXYD2 // FXYD domain containing ion transport regulator 2 // 11q23 // 486 FXYD2 NM_ NM_ // CDRT1 // CMT1A duplicated region transcript 1 // 17p12 // /// ENST0 CDRT1 NM_ NM_ // GFRA2 // GDNF family receptor alpha 2 // 8p21.3 // 2675 /// ENST GFRA2 NM_ NM_ // CCL26 // chemokine (C-C motif) ligand 26 // 7q11.23 // /// ENST00000 CCL26 NM_ BC // KIAA1539 // KIAA1539 // 9p13.3 // /// AB // KIAA1539 // KIAA153 KIAA1539 BC NM_ // TP63 // tumor protein p63 // 3q28 // 8626 /// NM // TP63 TP63 NM_ NM_ // CRYAB // crystallin, alpha B // q22.3-q23.1 // 1410 /// ENST CRYAB NM_ NM_ // PIGZ // phosphatidylinositol glycan anchor biosynthesis, class Z // BC // DENND2C // DENN/MADD domain containing 2C // 1p13.2 // PIGZ NM_ DENND2C BC

34 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // CDKN1A // cyclin-dependent kinase inhibitor 1A (p21, CDKN1A NM_ Cip1) // 6p21.2 // NM_ // CTH // cystathionase (cystathionine gammalyase) CTH NM_ // 1p31.1 // 1491 /// NM NM_ // M2 // midline 2 // Xq22.3 // /// NM_ // M2 // midline 2 // M2 NM_ NM_ // KLHL4 // kelch-like 4 (Drosophila) // Xq21.3 // /// NM // KLH KLHL4 NM_ NM_ // OR1D2 // olfactory receptor, family , subfamily D, member 2 // 17p13-p12 OR1D2 NM_ NM_ // ACY1 // aminoacylase 1 // 3p21.1 // 95 /// ENST // NM_ // LRP5 // low density lipoprotein receptor-related protein 5 // 11q13.4 // 4 NM_ // SPHK1 // sphingosine kinase 1 // 17q25.2 // 8877 /// NM // SPHK1 // NM_ // OR13C2 // olfactory receptor, family 13, subfamily C, member 2 // ACY1 NM_ LRP5 NM_ SPHK1 NM_ OR13C2 NM_ NM_ // TSPYL5 // TSPY-like 5 // 8q22.1 // /// ENST // TSPYL5 // TSPYL5 NM_

35 Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) NM_ // OR2W1 // olfactory receptor, family , subfamily W, member OR2W1 NM_ // 6p21.33-p NM_ // OR2W1 // olfactory receptor, family , subfamily W, member OR2W1 NM_ // 6p21.33-p NM_ // OR2W1 // olfactory receptor, family , subfamily W, member 1 // 6p21.33-p2 OR2W1 NM_ AY // UNQ5836 // HSAL5836 // 9q22.33 // /// ENST // UNQ5836 UNQ5836 AY NM_ // DYSF // dysferlin, limb girdle muscular dystrophy 2B (autosomal recessi DYSF NM_ NR_ // NAPSB // napsin B aspartic peptidase pseudogene // 19q13.33 // /// NAPSB NR_ NM_ // FAM71F1 // family with sequence similarity 71, member F1 // 7q32.1 // 8469 FAM71F1 NM_ S56770 // KCNC1 // potassium voltage-gated channel, Shaw-related subfamily, member 1 // KCNC1 S

36 Column # Transcript NM_ // OR11G2 // olfactory receptor, family 11, subfamily G, member 2 // Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) OR11G2 NM_ NM_ // NEDD4L // neural NEDD4L precursor cell expressed, NM_ developmentally down- Highlighted: Up-regulation of protein expression was demonstrated by Western blotting.

37 Supplementary Table S4. List of down-regulated genes by silencing of RRM2B in IMR90 cells. Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // TRPA1 // transient receptor potential cation channel, TRPA1 NM_ subfamily A, member NM_ // DEPDC1 // DEP domain containing 1 // 1p31.2 // DEPDC1 NM_ /// NM // NM_ // DLGAP5 // discs, large (Drosophila) homologassociated DLGAP5 NM_ protein 5 // NM_ // CDC2 // cell division cycle 2, G to S and G2 to M // CDC2 NM_ q21.1 // 983 /// N NM_ // APOBEC3B // apolipoprotein B mrna APOBEC3B NM_ editing enzyme, catalytic NM_ // RRM2B // ribonucleotide reductase M2 B (TP53 inducible) // RRM2B NM_ q23.1 // NM_ // TTK // TTK protein kinase // q13-q21 // 7272 /// TTK NM_ ENST // NM_ // SGOL1 // shugoshin-like (S. pombe) // 3p24.3 // SGOL1 NM_ /// NM

38 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // HIST1H3I // histone cluster 1, H3i // p22-p21.3 // 8354 /// HIST1H3I NM_ BC // H NM_ // TOP2A // topoisomerase (DNA) II alpha 170kDa // 17q21- TOP2A NM_ q22 // 7153 /// ENST NM_ // PBK // PDZ binding kinase // p21.2 // /// ENST // PBK // PBK NM_ NM_ // HIST1H2BF // histone cluster 1, H2bf // 6p21.3 // 8343 /// BC // NM_ // CASP1 // caspase 1, apoptosisrelated cysteine peptidase (interleukin 1, HIST1H2BF NM_ CASP1 NM_ NR_ // DLEU2 // deleted in lymphocytic leukemia 2 (non-protein coding) // 13q14.3 DLEU2 NR_ NM_ // C1R // complement component 1, r subcomponent // 12p13 // 715 /// C1R NM_ NM_ // NUSAP1 // nucleolar and spindle associated protein 1 // 15q15.1 // / NUSAP1 NM_ NM_ // CASC5 // cancer susceptibility candidate 5 // 15q14 // /// NM CASC5 NM_

39 Column # Transcript NM_ // PTX3 // pentraxin-related gene, rapidly induced by IL-1 beta // 3q25 // 58 Ratio(shR RM2B -mut) Change(s hrrm2b PTX3 NM_ NM_ // TMSB15A // thymosin beta 15a // Xq21.33-q22.3 // /// D82345 // TMSB1 TMSB15A NM_ NM_ // CDKN3 // cyclin-dependent kinase inhibitor 3 // 14q22 // 1033 /// NM NM_ // KIF20A // kinesin family member 20A // 5q31 // /// ENST / NM_ // HIST1H4L // histone cluster 1, H4l // 6p22-p21.3 // 8368 /// BC // H NM_ // SHCBP1 // SHC SH2-domain binding protein 1 // 16q11.2 // /// CDKN3 NM_ KIF20A NM_ HIST1H4L NM_ SHCBP1 NM_ NM_ // SKA1 // spindle and kinetochore associated complex subunit 1 // SKA1 NM_ NM_ // CCNB2 // cyclin B2 // 15q22.2 // 9133 /// ENST // NM_ // WDR76 // WD repeat domain 76 // 15q15.3 // /// ENST // NM_ // HIST1H4C // histone cluster 1, H4c // 6p21.3 // 8364 /// BC // CCNB2 NM_ WDR76 NM_ HIST1H4C NM_ NM_ // HGF // hepatocyte growth factor (hepapoietin A; scatter factor) // 7q21.1 HGF NM_

40 Column # Transcript NM_ // HIST1H1E // histone cluster 1, H1e // 6p21.3 // 3008 /// Ratio(shR RM2B -mut) Change(s hrrm2b HIST1H1E NM_ NM_ // FAM111B // family with sequence similarity 111, member B // 11q12.1 // 374 FAM111B NM_ NR_ // MIR155HG // MIR155 host gene (non-protein coding) // --- // MIR155HG NR_ NM_ // ARHGAP11A // Rho GTPase activating protein 11A // 15q13.2 // 9824 /// NM 1 ARHGAP11A NM_ NM_ // HMMR // hyaluronanmediated motility receptor (RHAMM) // NM_ // NUF2 // NUF2, NDC80 kinetochore complex component, homolog (S. HMMR NM_ NUF2 NM_ AK // FAM38B // family with sequence FAM38B similarity 38, member B // AK p11.22 // NM_ // CENPE // centromere protein E, kDa // 4q24-q25 // 1062 /// ENST CENPE NM_ NM_ // ANLN // anillin, actin binding protein // 7p15-p14 // /// ENST ANLN NM_ NM_ // FBXO5 // F-box protein 5 // 6q // /// NM // FBXO5 NM_

41 Column # Transcript NM_ // NCAPG // non-smc condensin I complex, subunit G // 4p15.33 // /// NM Ratio(shR RM2B -mut) Change(s hrrm2b NCAPG NM_ NM_ // SKA3 // spindle and kinetochore associated complex subunit 3 // 13q12.11 / SKA3 NM_ NM_ // ASPM // asp (abnormal spindle) homolog, microcephaly associated (Drosophil NM_ // KIAA0101 // KIAA0101 // 15q22.31 // 9768 /// NM // ASPM NM_ KIAA0101 NM_ NM_ // PLK4 // polo-like kinase (Drosophila) // 4q28 // /// PLK4 NM_ NM_ // PRC1 // protein regulator of PRC1 cytokinesis 1 // 15q26.1 // NM_ /// NM NM_ // ESCO2 // establishment of cohesion 1 homolog 2 ESCO2 NM_ (S. cerevisiae) // 8p NM_ // PCOLCE // procollagen C- endopeptidase enhancer // 7q22 // 5118 /// PCOLCE NM_ NM_ // RRM2 // ribonucleotide reductase RRM2 M2 // 2p25-p24 // 6241 /// NM_ ENST

42 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // BUB1 // budding uninhibited by benzimidazoles 1 BUB1 NM_ homolog (yeast) // 2q NM_ // CFH // complement factor H // q32 // 3075 /// CFH NM_ NM_ // CFH // comp NM_ // CDCA2 // cell division cycle associated 2 // 8p21.2 // CDCA2 NM_ /// ENST NM_ // KIF20B // kinesin family member B // 10q23.31 // 9585 KIF20B NM_ /// ENST NM_ // CEP55 // centrosomal protein kDa // 10q23.33 // CEP55 NM_ /// NM M77840 // RNU5F // RNA, U5F small nuclear // 1p34.1 // /// RNU5F M M77840 // RNU5F // RNA NM_ // MKI67 // antigen identified by monoclonal antibody Ki- MKI67 NM_ // 10q25-qter // NM_ // GAS2L3 // growth arrest-specific like 3 // 12q23.1 // GAS2L3 NM_ /// ENST NM_ // HIST1H3B // histone HIST1H3B cluster 1, H3b // 6p21.3 // NM_ /// BC //

43 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // SMC4 // structural maintenance of SMC4 chromosomes 4 // 3q26.1 NM_ // /// NM NM_ // RAD51AP1 // RAD associated protein 1 // RAD51AP1 NM_ p13.2-p13.1 // /// NM 5473 NM_ // DTL // denticleless homolog (Drosophila) // 1q32.1- q32.2 // /// ENST DTL NM_ NM_ // C11orf82 // chromosome 11 open reading frame 82 // 11q14.1 // /// E C11orf82 NM_ NM_ // PLK1 // polo-like kinase (Drosophila) // 16p12.2 // 5347 /// ENST PLK1 NM_ NM_ // KIF14 // kinesin family member // 1q32.1 // 9928 /// ENST // KIF14 NM_ NM_ // CKAP2L // cytoskeleton associated protein 2-like // 2q13 // /// ENS CKAP2L NM_ NM_ // HIST1H1B // histone cluster 1, H1b // 6p22- p21.3 // 3009 /// HIST1H1B NM_ AY // LOC // arsenic transactivated protein 1 // 1p34.3 // LOC AY NM_ // CENPF // centromere protein F, 350/400ka (mitosin) // 1q32-q41 // 1063 /// CENPF NM_

44 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // METTL7A // methyltransferase like 7A // 12q13.12 // /// ENST METTL7A NM_ NM_ // HIST1H2BM // histone cluster 1, H2bm // 6p22- p21.3 // 8342 /// HIST1H2BM NM_ NM_ // KIF15 // kinesin family member // 3p21.31 // /// ENST KIF15 NM_ NM_ // CCNA2 // cyclin A2 // 4q25-q31 // 890 /// ENST // NM_ // TNFAIP6 // tumor necrosis factor, alpha-induced protein 6 // 2q23.3 // 713 CCNA2 NM_ TNFAIP6 NM_ NM_ // KIF11 // kinesin family member // 10q24.1 // 3832 /// ENST / KIF11 NM_ NM_ // HIST1H2BH // histone cluster 1, H2bh // 6p21.3 // 8345 /// HIST1H2BH NM_ NM_ // SPC25 // SPC25, NDC kinetochore complex component, homolog (S. cerevisia SPC25 NM_

45 Column # Transcript NM_ // TRIP13 // thyroid hormone receptor interactor 13 // 5p15.33 // 9319 /// EN Ratio(shR RM2B -mut) Change(s hrrm2b TRIP13 NM_ NM_ // SPAG5 // sperm associated antigen 5 // 17q11.2 // /// NM_ // HIST1H2AL // histone cluster 1, H2al // 6p22- p21.3 // 8332 /// SPAG5 NM_ HIST1H2AL NM_ NM_ // NDC80 // NDC80 homolog, kinetochore complex component (S. cerevisiae) // 1 NDC80 NM_ NM_ // ERCC6L // excision repair crosscomplementing rodent repair deficiency, co ERCC6L NM_ NM_ // CENPK // centromere protein K // p15.2-q12.3 // /// ENST CENPK NM_ NM_ // CENPH // centromere protein H // 5p15.2 // /// ENST // CE NM_ // CHRM2 // cholinergic receptor, muscarinic 2 // 7q31-q35 // 1129 /// NM CENPH NM_ CHRM2 NM_

46 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // PCDH18 // protocadherin 18 // q31 // /// ENST // PCDH18 PCDH18 NM_ NM_ // SLC14A1 // solute carrier SLC14A1 family 14 (urea NM_ transporter), member NM_ // TPX2 // TPX2, microtubuleassociated, homolog (Xenopus laevis) // TPX2 NM_ NM_ // PTGER2 // prostaglandin E receptor 2 (subtype EP2), 53kDa // 14q22 // NM_ // KIF4A // kinesin family member 4A // Xq13.1 // /// ENST / NM_ // ELOVL2 // elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, NM_ // BRIP1 // BRCA1 interacting protein C-terminal helicase 1 // 17q22-q24 // NM_ // HIST1H4K // histone cluster 1, H4k // 6p22- p21.3 // 8362 /// NM_ // TYMS // thymidylate synthetase // 18p11.32 // 7298 /// ENST // PTGER2 NM_ KIF4A NM_ ELOVL2 NM_ BRIP1 NM_ HIST1H4K NM_ TYMS NM_

47 Column # Transcript NM_ // CDC20 // cell division cycle 20 homolog (S. cerevisiae) // 1p34.1 // 991 / Ratio(shR RM2B -mut) Change(s hrrm2b CDC20 NM_ NM_ // HIST2H2AB // histone cluster 2, H2ab // 1q21 // /// HIST2H2AB NM_ AK // DHFR // dihydrofolate reductase // DHFR 5q11.2-q13.2 // 1719 /// AK J00146 // LOC NM_ // CDCA8 // cell division cycle associated 8 // 1p34.3 // /// ENST00000 NM_ // MAD2L1 // MAD2 mitotic arrest deficient-like 1 (yeast) // 4q27 // 4085 /// CDCA8 NM_ MAD2L1 NM_ NM_ // HIST1H4F // histone cluster 1, H4f // p21.3 // 8361 /// BC // HIST1 HIST1H4F NM_ NM_ // CFHR1 // complement factor H related 1 // 1q32 // 3078 /// BC // CFH CFHR1 NM_ NM_ // POLE2 // polymerase (DNA directed), epsilon 2 (p59 subunit) // 14q21-q22 / POLE2 NM_ NM_ // MLF1IP // MLF1 interacting protein // 4q35.1 // /// ENST MLF1IP NM_

48 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // PRR11 // proline rich 11 // 17q22 // /// PRR11 NM_ ENST // PRR11 // NM_ // HIST1H2AJ // histone HIST1H2AJ NM_ cluster 1, H2aj // 6p NM_ // FOXM1 // forkhead box M1 // p13 // 2305 /// FOXM1 NM_ NM // FOXM1 // NR_ // ZNF487 // zinc finger protein 487 // q11.21 // /// ZNF487 NR_ AK // ZN NM_ // SAMD9 // sterile alpha motif domain containing 9 // SAMD9 NM_ q21.2 // /// EN NM_ // MCM7 // minichromosome maintenance complex MCM7 NM_ component 7 // 7q21.3- q22.1 // NM_ // BLM // Bloom syndrome, RecQ helicase-like // 15q26.1 // BLM NM_ /// ENST NM_ // CFHR2 // complement factor H related 2 // 1q31-q32.1 // CFHR2 NM_ /// BC NM_ // CASP4 // caspase 4, apoptosisrelated cysteine CASP4 NM_ peptidase // 11q

49 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // TK1 // thymidine kinase 1, soluble // 17q23.2-q25.3 TK1 NM_ // 7083 /// ENST NM_ // IRAK3 // interleukin-1 receptorassociated kinase 3 // IRAK3 NM_ q14.3 // // NM_ // HIST1H2BB // histone cluster 1, H2bb // 6p21.3 HIST1H2BB NM_ // 3018 /// NM_ // HIST1H1A // histone HIST1H1A cluster 1, H1a // 6p21.3 // NM_ /// NM_ // SV2A // synaptic vesicle SV2A glycoprotein 2A // 1q21.2 NM_ // 9900 /// ENST AB // FAM72D // family with sequence similarity 72, member D // 1q21.1 // FAM72D AB NM_ // CENPA // centromere protein A // p24-p21 // 1058 /// NM // CENP CENPA NM_ NM_ // NCKAP5 // NCK-associated protein 5 // 2q21.2 // /// NM // NM_ // RELN // reelin // 7q22 // 5649 /// NM_ // RELN // reelin // 7q22 // NM_ // HIST1H3F // histone cluster 1, H3f // 6p22.2 // 8968 /// BC // HIST1 NCKAP5 NM_ RELN NM_ HIST1H3F NM_

50 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 4836 NM_ // FNBP1L // formin binding FNBP1L protein 1-like // 1p22.1 // NM_ /// NM NM_ // CLDN11 // claudin 11 // 3q q26.3 // 5010 /// CLDN11 NM_ ENST // CLDN NM_ // IGFBP5 // insulin-like growth factor binding protein 5 // 2q33- q36 // 3488 IGFBP5 NM_ NM_ // HELLS // helicase, lymphoidspecific // 10q24.2 // 3070 /// HELLS NM_ NM_ // SLFN11 // schlafen family member 11 // 17q12 // /// SLFN11 NM_ NM_ // PTGS1 // prostaglandinendoperoxide synthase PTGS1 NM_ (prostaglandin G/H NM_ // F2RL2 // coagulation factor II (thrombin) receptor-like 2 // 5q13 // 2151 F2RL2 NM_

51 Column # Transcript NM_ // HIST1H4B // histone cluster 1, H4b // 6p21.3 // 8366 /// BC // Ratio(shR RM2B -mut) Change(s hrrm2b HIST1H4B NM_ NM_ // HMGB2 // high-mobility box 2 // 4q31 // 3148 /// NM // HMGB2 NM_ NM_ // NR5A2 // nuclear receptor subfamily 5, A, member 2 // 1q32.1 // NM_ // BUB1B // budding uninhibited by benzimidazoles 1 homolog beta (yeast) // 1 NR5A2 NM_ BUB1B NM_ NM_ // HIST2H3D // histone HIST2H3D cluster 2, H3d // 1q21.2 // NM_ /// NM_ // PTN // pleiotrophin // 7q33-q34 // 5764 /// ENST // PTN NM_ NM_ // KIFC1 // kinesin family member C1 // 6p21.3 // 3833 /// ENST // KIFC1 NM_ NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s 14-Sep NM_ NM_ // NCAPG2 // non-smc condensin II complex, subunit G2 // 7q36.3 // /// NCAPG2 NM_ NM_ // GPC6 // glypican 6 // 13q32 // /// ENST // GPC6 // glypic GPC6 NM_

52 Column # Transcript NM_ // HAS2 // hyaluronan synthase 2 // 8q24.12 // 3037 /// ENST // HA Ratio(shR RM2B -mut) Change(s hrrm2b HAS2 NM_ NM_ // CCNB1 // cyclin B1 // 5q12 // 891 /// CCNB1 ENST // NM_ CCNB1 // cyclin B NM_ // CDC6 // cell division cycle 6 homolog (S. cerevisiae) // 17q21.3 // 990 // AK // ZNF724P // zinc finger protein 724 pseudogene // 19p12 // AK // ZNF730 // zinc finger protein 730 // 19p12 // /// ENST NM_ // CCNE2 // cyclin E2 // 8q22.1 // 9134 /// ENST // NM_ // CIT // citron (rho-interacting, serine/threonine kinase 21) // 12q24 // 11 CDC6 NM_ ZNF724P AK ZNF730 AK CCNE2 NM_ CIT NM_ NM_ // BGN // biglycan // Xq28 // 633 /// ENST // BGN // biglycan // X BGN NM_ NM_ // KIFC1 // kinesin family member C1 // 6p21.3 // 3833 /// ENST // KIFC1 NM_ NM_ // DTX3L // deltex 3-like (Drosophila) // 3q21.1 // /// ENST DTX3L NM_

53 Column # Transcript ENST // FAM38B2 // family with sequence similarity 38, member B2 // 18p11.22 Ratio(shR RM2B -mut) Change(s hrrm2b FAM38B2 ENST NM_ // IFLTD1 // intermediate filament tail domain containing 1 // 12p12.1 // IFLTD1 NM_ NM_ // DBF4 // DBF4 homolog (S. cerevisiae) // 7q21.3 // /// NM_ // APOL6 // apolipoprotein L, 6 // 22q12.3 // /// ENST // AP NM_ // FRZB // frizzled-related protein // 2qter // 2487 /// ENST // F DBF4 NM_ APOL6 NM_ FRZB NM_ NM_ // KNTC1 // kinetochore associated // 12q24.31 // 9735 /// ENST KNTC1 NM_ NM_ // HIST1H4E // histone HIST1H4E cluster 1, H4e // 6p21.3 // NM_ /// CR // NM_ // GNG2 // guanine nucleotide binding protein (G protein), gamma 2 // NM_ // KIAA1107 // KIAA1107 // 1p22.1 // /// ENST // KIAA1107 // GNG2 NM_ KIAA1107 NM_

54 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // LRRCC1 // leucine rich repeat and coiled-coil domain LRRCC1 NM_ containing 1 // 8q NM_ // KIF18A // kinesin family member A // 11p14.1 // KIF18A NM_ /// ENST NM_ // AIM1 // absent in melanoma 1 // q21 // 202 /// AIM1 NM_ ENST // AIM1 // NM_ // ANO4 // anoctamin 4 // 12q23.1 // /// ANO4 NM_ ENST // ANO4 // an NM_ // PTPLAD2 // protein tyrosine phosphataselike PTPLAD2 NM_ A domain containing NM_ // C6orf173 // chromosome open reading frame C6orf173 NM_ // 6q22.32 // NM_ // MTBP // Mdm2, transformed 3T MTBP cell double minute 2, p53 NM_ binding protein (m NM_ // VCAM1 // 4861 vascular cell adhesion molecule 1 // 1p32-p31 // VCAM1 NM_ /// NM

55 Column # Transcript NM_ // C1S // complement component 1, s subcomponent // 12p13 // 716 /// Ratio(shR RM2B -mut) Change(s hrrm2b C1S NM_ NM_ // ZNF300 // zinc finger protein 300 // q33.1 // /// ENST / ZNF300 NM_ NM_ // XRCC2 // X-ray repair complementing defective repair in Chinese XRCC2 NM_ NM_ // FANCI // Fanconi anemia, complementation I // 15q26.1 // // FANCI NM_ NM_ // RPL22L1 // ribosomal protein L22-like 1 // 3q26.2 // /// RPL22L1 NM_ NM_ // GPR37 // G protein-coupled receptor 37 (endothelin receptor type B-like) / GPR37 NM_ NM_ // TNC // tenascin C // 9q33 // 3371 /// ENST // NM_ // CENPI // centromere protein I // Xq22.1 // 2491 /// ENST // TNC NM_ CENPI NM_ NM_ // SPON2 // spondin 2, extracellular matrix protein // 4p16.3 // /// NM SPON2 NM_ NM_ // NCAPH // non-smc condensin I complex, subunit H // 2q11.2 // /// ENS NCAPH NM_

56 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 4937 NM_ // OLFML3 // olfactomedin-like 3 // p13.2 // /// OLFML3 NM_ ENST // OL NM_ // SLITRK6 // SLIT and NTRK-like family, member 6 // SLITRK6 NM_ q31.1 // /// ENS BC // C5orf34 // chromosome 5 open reading frame 34 // 5p12 // /// NM 1985 C5orf34 BC NM_ // HIST1H2AK // histone cluster 1, H2ak // 6p22- p21.3 // 8330 /// NR_ // SNORD // small nucleolar RNA, C/D box 79 // 1q25.1 // NM_ // CCDC18 // coiled-coil domain containing 18 // 1p22.1 // /// ENST000 NM_ // KDELC2 // KDEL (Lys-Asp-Glu-Leu) containing 2 // 11q22.3 // /// ENS HIST1H2AK NM_ SNORD79 NR_ CCDC18 NM_ KDELC2 NM_ NM_ // EML5 // echinoderm microtubule associated protein like 5 // 14q31.3 // 161 EML5 NM_

57 Column # Transcript NR_ // SNORD27 // small nucleolar RNA, C/D box 27 // 11q13 // 9301 /// AK / Ratio(shR RM2B -mut) Change(s hrrm2b SNORD27 NR_ NM_ // SERPINF1 // serpin SERPINF1 peptidase inhibitor, clade NM_ F (alpha-2 antiplasmin, NM_ // FGF7 // fibroblast growth factor 7 (keratinocyte growth factor) // 15q15-q NM_ // COLEC10 // collectin sub-family member 10 (C-type lectin) // 8q23-q24.1 // NM_ // FANCD2 // Fanconi anemia, complementation D2 // 3p26 // 2177 /// FGF7 NM_ COLEC10 NM_ FANCD2 NM_ NM_ // MND1 // meiotic nuclear divisions homolog (S. cerevisiae) // 4q31.3 // 8 MND1 NM_ NM_ // HIST1H2BC // histone cluster 1, H2bc // 6p21.3 // 8347 /// BC // HIST1H2BC NM_ NM_ // KIAA1524 // KIAA1524 // 3q13.13 // /// ENST // KIAA1524 / KIAA1524 NM_

58 Column # Transcript NM_ // HIST1H4J // histone cluster 1, H4j // 6p22-p21.3 // 8363 /// NM // Ratio(shR RM2B -mut) Change(s hrrm2b HIST1H4J NM_ ENST // C18orf58 // chromosome open reading frame 58 // 18p11.22-p11.21 / C18orf58 ENST NM_ // KIF23 // kinesin family member // 15q23 // 9493 /// NM // KIF23 KIF23 NM_ NM_ // NEIL3 // nei endonuclease VIIIlike 3 (E. coli) // 4q34.3 // /// ENS NEIL3 NM_ NM_ // SCARA3 // scavenger receptor class A, member 3 // 8p21 // /// NM 182 NM_ // MELK // maternal embryonic leucine zipper kinase // 9p13.2 // 9833 /// ENS NM_ // KIF2C // kinesin family member 2C // 1p34.1 // /// ENST / SCARA3 NM_ MELK NM_ KIF2C NM_ NM_ // IFITM1 // interferon induced IFITM1 transmembrane protein 1 NM_ (9-27) // 11p15.5 // NM_ // USP44 // ubiquitin specific peptidase 44 // 12q22 // /// NM USP44 NM_

59 Column # Transcript NM_ // IFI44 // interferon-induced protein 44 // 1p31.1 // /// ENST Ratio(shR RM2B -mut) Change(s hrrm2b IFI44 NM_ NM_ // BRCA2 // breast cancer 2, early onset // 13q12.3 // 675 /// ENST BRCA2 NM_ NM_ // FANCB // Fanconi anemia, complementation FANCB NM_ NM_ // HJURP // Holliday junction recognition protein // 2q37.1 // /// ENST HJURP NM_ NM_ // HIST1H3G // histone HIST1H3G NM_ cluster 1, H3g // 6p21.3 // NM_ // PDGFD // platelet derived growth factor D // 11q22.3 // /// NM PDGFD NM_ NM_ // BIRC3 // baculoviral IAP repeatcontaining 3 // 11q22 // 330 /// NM BIRC3 NM_ NM_ // C18orf54 // chromosome 18 open reading frame 54 // 18q21.2 // /// E C18orf54 NM_ NM_ // GRPR // gastrin-releasing peptide receptor // Xp22.2- p22.13 // 2925 /// EN GRPR NM_

60 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // NR4A2 // nuclear receptor subfamily 4, A, NR4A2 NM_ member 2 // 2q22-q23 // AK // GPAM // glycerol-3-phosphate acyltransferase, GPAM AK mitochondrial // 10q25.2 // AK // FLJ32742 // hypothetical locus FLJ32742 // Xp21.3 // FLJ32742 AK NM_ // CHEK1 // CHK1 checkpoint homolog (S. pombe) // CHEK1 NM_ q24-q24 // 1111 /// NM_ // MYBL1 // v-myb myeloblastosis viral MYBL1 NM_ oncogene homolog NM_ // LRRFIP1 // leucine rich repeat (in FLII) interacting protein 1 // LRRFIP1 NM_ NM_ // DPYSL3 // dihydropyrimidinase-like // 5q32 // 1809 /// ENST / DPYSL3 NM_ NM_ // ENPP2 // ectonucleotide ENPP2 pyrophosphatase/phosph NM_ odiesterase 2 // 8q24.1 // NR_ // KGFLP1 // keratinocyte growth factor-like protein 1 // 9p11.2 // // NR_ // KGFLP1 // keratinocyte growth factor-like protein 1 // 9p11.2 // // KGFLP1 NR_ KGFLP1 NR_

61 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NR_ // KGFLP1 // keratinocyte growth factor-like protein 1 // KGFLP1 NR_ p11.2 // // 5360 NM_ // HMCN1 // hemicentin 1 // 1q q31.1 // /// HMCN1 NM_ ENST // HMCN 4884 NM_ // GPSM2 // G-protein signaling modulator 2 (AGS3-like, C. elegans) // 1p13.3 GPSM2 NM_ NM_ // TOX // thymocyte selectionassociated high mobility box // 8q12.1 // NM_ // RFC3 // replication factor C (activator 1) 3, 38kDa // 13q12.3-q13 // 5983 TOX NM_ RFC3 NM_ NM_ // TMPO // thymopoietin // 12q22 // TMPO 7112 /// NM_ NM_ // TMPO // thymo NM_ // FAM83D // family with sequence similarity 83, member D // 20q11.22-q12 // FAM83D NM_ NM_ // SLC6A15 // solute carrier family 6 (neutral amino acid transporter), membe NM_ // RBL1 // retinoblastoma-like 1 (p107) // 20q11.2 // 5933 /// NM // R SLC6A15 NM_ RBL1 NM_

62 Column # Transcript NM_ // MCM8 // minichromosome maintenance complex component 8 // 20p12.3 // Ratio(shR RM2B -mut) Change(s hrrm2b MCM8 NM_ NM_ // SULF1 // sulfatase 1 // 8q13.2-q13.3 // /// NM // SULF1 // NM_ // PRRX1 // paired related homeobox 1 // 1q24 // 5396 /// NM // PRRX1 SULF1 NM_ PRRX1 NM_ NM_ // TNFRSF11B // tumor necrosis factor receptor superfamily, member 11b TNFRSF11B NM_ NM_ // CLSPN // claspin homolog (Xenopus laevis) // 1p34.2 // /// NM_ // NMI // N- myc (and STAT) interactor // 2q23 // 9111 /// ENST // CLSPN NM_ NMI NM_ AK // GPAM // glycerol-3-phosphate acyltransferase, mitochondrial // 10q25.2 // 5 GPAM AK NM_ // ATAD5 // ATPase family, AAA domain containing 5 // 17q11.2 // /// EN ATAD5 NM_ NM_ // GBP2 // guanylate binding protein GBP2 2, interferon-inducible // NM_ p22.2 // 263

63 Column # Transcript NM_ // HNRNPA1L2 // heterogeneous nuclear ribonucleoprotein A1-like 2 // 13q14 Ratio(shR RM2B -mut) Change(s hrrm2b HNRNPA1L2 NM_ NM_ // GALNT7 // UDP-N-acetyl-alpha-Dgalactosamine:polypeptid GALNT7 NM_ e N-acetylgalactosa NM_ // MCM6 // minichromosome maintenance complex component 6 // 2q21 // 4175 /// MCM6 NM_ NM_ // CDK2 // cyclin-dependent kinase 2 // 12q13 // 1017 /// NM // CDK2 / NM_ // DHFR // dihydrofolate reductase // 5q11.2-q13.2 // 1719 /// NM // D CDK2 NM_ DHFR NM_ NM_ // C14orf145 // chromosome 14 open reading frame 145 // 14q31.1 // /// C14orf145 NM_ NM_ // MYOCD // myocardin // p11.2 // /// NM // MYOCD // MYOCD NM_ NM_ // GRAMD1C // GRAM domain containing 1C // 3q13.31 // /// GRAMD1C NM_

64 Column # Transcript NM_ // PRIM2 // primase, DNA, polypeptide 2 (58kDa) // 6p12-p11.1 // 5558 /// Ratio(shR RM2B -mut) Change(s hrrm2b PRIM2 NM_ NM_ // EXO1 // exonuclease 1 // 1q q43 // 9156 /// NM // EXO1 // EXO1 NM_ NR_ // SUMO1P // SUMO1 pseudogene 3 SUMO1P3 NR_ // 1q22 // NM_ // LBR // lamin B receptor // 1q42.1 // 3930 /// NM // LBR // NM_ // GPD2 // glycerol-3-phosphate dehydrogenase 2 (mitochondrial) // 2q24.1 LBR NM_ GPD2 NM_ NM_ // SAMD9L // sterile alpha motif domain containing 9-like // 7q21.2 // SAMD9L NM_ NM_ // DHFR // dihydrofolate reductase // DHFR 5q11.2-q13.2 // 1719 /// NM_ ENST NM_ // HIST1H2AB // histone cluster 1, H2ab // 6p21.3 // 8335 /// BC // HIST1H2AB NM_ ENST // PTCH2 // patched homolog 2 (Drosophila) // 1p33-p34 // 8643 NM_ // HIST1H2AM // histone cluster 1, H2am // 6p22- PTCH2 ENST HIST1H2AM NM_

65 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // BARD1 // BRCA1 associated RING BARD1 domain 1 // 2q34-q35 // NM_ /// ENST NM_ // HIST1H3J // histone cluster 1, H3j // 6p22-p21.3 // 8356 HIST1H3J NM_ NM_ // HIST1H3D // histone HIST1H3D cluster 1, H3d // 6p21.3 // NM_ /// NM // BC // MGC87042 // STEAP family protein MGC87042 // 7p15.3 // /// ENST00000 NM_ // RACGAP1 // Rac GTPase activating protein 1 // 12q13.12 // MGC87042 BC RACGAP1 NM_ NM_ // SYTL2 // synaptotagmin-like 2 // q14 // /// NM // SYTL2 // SYTL2 NM_ NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s BC // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s 14-Sep NM_ Sep NM_ PCMTD2 BC Sep NM_ Sep NM_

66 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b BC // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase PCMTD2 BC NM_ // SEPT14 // septin 14 // 7p11.2 // /// 14-Sep NM_ ENST // SEPT14 // s NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s 14-Sep NM_ NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s 14-Sep NM_ Sep NM_ BC // C4orf21 // chromosome 4 open reading frame 21 // 4q25 // /// AK C4orf21 BC NM_ // CTSK // cathepsin K // 1q21 // 1513 /// ENST // NM_ // VAT1L // vesicle amine transport protein 1 homolog (T. californica)-like / CTSK NM_ VAT1L NM_ NM_ // KIAA1199 // KIAA1199 // 15q24 // /// ENST // KIAA1199 NM_

67 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // FRRS1 // ferric-chelate reductase 1 // 1p21.2 // /// ENST FRRS1 NM_ NM_ // USP18 // ubiquitin specific peptidase 18 // 22q11.21 // /// ENST0000 USP18 NM_ BX // WEE1 // WEE1 homolog (S. pombe) // 11p15.3-p15.1 WEE1 BX NM_ // SENP7 // SUMO1/sentrin specific peptidase 7 // 3q12 // /// NM NM_ // EYA4 // eyes absent homolog 4 (Drosophila) // 6q23 // 2070 /// NM / SENP7 NM_ EYA4 NM_ NM_ // GNG11 // guanine nucleotide binding protein (G protein), gamma 11 // GNG11 NM_ NM_ // SASS6 // spindle assembly 6 homolog (C. elegans) // 1p21.2 // /// E SASS6 NM_

68 Column # Transcript NM_ // RRM1 // ribonucleotide reductase M1 // 11p15.5 // 6240 /// ENST Ratio(shR RM2B -mut) Change(s hrrm2b RRM1 NM_ NM_ // FGL2 // fibrinogen-like 2 // q11.23 // /// ENST // FGL2 NM_ NM_ // SGOL2 // shugoshin-like 2 (S pombe) // 2q33.1 // /// SGOL2 NM_ NR_ // ZNF273 // zinc finger protein 273 // 7q11.21 // /// NM // ZNF ZNF273 NR_ NM_ // ANO3 // anoctamin 3 // 11p14.2 // /// ENST // ANO3 // ano ANO3 NM_ NM_ // PRIM1 // primase, DNA, polypeptide 1 (49kDa) // 12q13 // 5557 /// NM_ // C14orf106 // chromosome 14 open reading frame 106 // 14q21.2 // /// PRIM1 NM_ C14orf106 NM_ NM_ // IL12A // interleukin 12A (natural killer cell stimulatory factor 1, cytoto IL12A NM_ NM_ // TMEM194A // transmembrane protein 194A // 12q13.3 // /// NM TMEM194A NM_

69 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // CCRL1 // chemokine (C-C motif) receptor-like 1 // 3q22 // CCRL1 NM_ /// NM NM_ // NLGN1 // neuroligin 1 // 3q26.31 // /// NLGN1 NM_ ENST // NLGN1 // NR_ // KGFLP1 // keratinocyte growth factor-like protein 1 // KGFLP1 NR_ p11.2 // // NM_ // RBBP8 // retinoblastoma binding protein 8 // 18q11.2 // RBBP8 NM_ /// NM NM_ // C13orf34 // chromosome 13 open reading frame 34 // C13orf34 NM_ q22.1 // /// EN 9012 NM_ // CCDC15 // coiled-coil domain containing 15 // 11q24.2 CCDC15 NM_ // /// ENST NM_ // PION // pigeon homolog (Drosophila) // 7q11.23 // /// PION NM_ NM_ // WDHD1 // WD repeat and HMG-box WDHD1 DNA binding protein 1 // NM_ q22.2 // / NR_ // SNORD // small nucleolar RNA, SNORD77 NR_ C/D box 77 // 1q25.1 //

70 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // GLYATL2 // glycine-nacyltransferase-like 2 // GLYATL2 NM_ q12.1 // /// NM_ // CENPQ // centromere protein Q // p12.3 // /// CENPQ NM_ ENST // CE NM_ // CDCA7 // cell division cycle associated 7 // 2q31 // CDCA7 NM_ /// NM / NM_ // EMP2 // epithelial membrane protein 2 // 16p13.2 // EMP2 NM_ /// ENST NM_ // TAF9B // TAF9B RNA polymerase II, TATA box binding TAF9B NM_ protein (TBP)-associate NM_ // TAF9B // TAF9B RNA polymerase II, TATA box binding TAF9B NM_ protein (TBP)-associate NR_ // BRCA1 // breast cancer 1, early onset // 17q21 // 672 /// BRCA1 NR_ NM // BRC NM_ // CD302 // CD302 molecule // q24.2 // 9936 /// ENST // CD302 // CD302 NM_ BC // GABPA // GA binding protein GABPA transcription factor, alpha BC subunit 60kDa // 21 BC // TAS2R5 // taste receptor, type 2, member 5 // 7q31.3-q32 TAS2R5 BC //

71 Column # Transcript NM_ // TCF4 // transcription factor 4 // 18q21.1 // 6925 /// NM // TCF4 Ratio(shR RM2B -mut) Change(s hrrm2b TCF4 NM_ NM_ // BTN3A3 // butyrophilin, subfamily 3, member A3 // 6p21.3 // /// NM 1 BTN3A3 NM_ NM_ // CNTN3 // contactin (plasmacytoma associated) // 3p26 // CNTN3 NM_ NM_ // MATN3 // matrilin 3 // 2p24-p23 // /// ENST // MATN3 NM_ NM_ // QSER1 // glutamine and serine rich 1 // 11p13 // /// ENST QSER1 NM_ NM_ // COL6A3 // collagen, type VI, alpha COL6A3 // 2q37 // 1293 /// NM_ NM // COL NR_ // SNORD22 // small nucleolar RNA, C/D box 22 // 11q13 // 9304 /// AK / SNORD22 NR_ NM_ // LDB2 // LIM domain binding 2 // LDB2 4p16 // 9079 /// NM_ NM // LDB2 // L AB // FAM72D // family with sequence similarity 72, member D // 1q21.1 // FAM72D AB

72 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // TMSB15B // thymosin beta 15B // Xq22.2 // /// TMSB15B NM_ NR // H2BFXP / NM_ // ECT2 // epithelial cell transforming sequence 2 ECT2 NM_ oncogene // 3q NM_ // NUP107 // nucleoporin 107kDa // 12q15 // /// ENST // NUP1 NUP107 NM_ NM_ // SEMA3D // sema domain, immunoglobulin domain (Ig), short basic domain, sec SEMA3D NM_ NM_ // PRKG2 // protein kinase, cgmpdependent, type II // 4q13.1-q21.1 // 5593 / AB // FAM72D // family with sequence similarity 72, member D // 1q21.1 // PRKG2 NM_ FAM72D AB NM_ // TMEM56 // transmembrane protein 56 // 1p21.3 // /// ENST TMEM56 NM_

73 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // ATAD2 // ATPase family, AAA domain containing 2 // 8q24.13 // /// EN NM_ // CHAF1B // chromatin assembly factor 1, subunit B (p60) // 21q22.13 // 8208 AB // FAM72D // family with sequence similarity 72, member D // 1q21.1 // ATAD2 NM_ CHAF1B NM_ FAM72D AB NM_ // C15orf42 // chromosome 15 open reading frame 42 // 15q26.1 // /// EN C15orf42 NM_ NM_ // VEPH1 // ventricular zone expressed PH domain homolog 1 (zebrafish) // NM_ // FAM111A // family with sequence similarity 111, member A // 11q12.1 // 639 VEPH1 NM_ FAM111A NM_ NM_ // CHN1 // chimerin (chimaerin) 1 // q31.1 // 1123 /// NM // CHN1 CHN1 NM_ NM_ // EZH2 // enhancer of zeste homolog 2 (Drosophila) // 7q35-q36 // 2146 /// N NM_ // GK // glycerol kinase // Xp21.3 // 2710 /// NM_ // GK // glycerol NM_ // ZNF681 // zinc finger protein 681 // 19p12 // /// ENST / EZH2 NM_ GK NM_ ZNF681 NM_

74 Column # Transcript NM_ // ANKRD32 // ankyrin repeat domain 32 // 5q15 // /// ENST / Ratio(shR RM2B -mut) Change(s hrrm2b ANKRD32 NM_ NM_ // GK // glycerol kinase // Xp // 2710 /// NM_ // GK // glycerol GK NM_ NM_ // LIN7A // lin-7 homolog A (C. elegans) // 12q21 // 8825 /// ENST LIN7A NM_ NM_ // GMNN // geminin, DNA replication inhibitor // 6p22.3 // /// ENST0000 GMNN NM_ NR_ // RPSAP58 // ribosomal protein SA pseudogene 58 // 19p12 // /// BC071 NM_ // MCTP2 // multiple C2 domains, transmembrane 2 // 15q26.2 // /// NM_ // FBLN1 // fibulin 1 // 22q13.31 // 2192 /// NM_ // FBLN1 // fibulin 1 NM_ // TACC3 // transforming, acidic coiled-coil containing protein 3 // 4p16.3 / RPSAP58 NR_ MCTP2 NM_ FBLN1 NM_ TACC3 NM_ NM_ // RPL39L // ribosomal protein L like // 3q27 // /// ENST RPL39L NM_ NM_ // SEPT14 // septin 14 // 7p11.2 // /// ENST // SEPT14 // s 14-Sep NM_

75 Column # Transcript BC // C20orf69 // chromosome 20 open reading frame 69 // --- // /// ENST00 Ratio(shR RM2B -mut) Change(s hrrm2b C20orf69 BC NM_ // TRIM6-TRIM34 // TRIM6-TRIM34 readthrough transcript // TRIM6-TRIM34 NM_ NM_ // SQRDL // sulfide quinone reductase-like (yeast) // 15q15 // /// ENST NM_ // RASGRF2 // Ras protein-specific guanine nucleotidereleasing factor 2 // 5 SQRDL NM_ RASGRF2 NM_ NM_ // CASP6 // caspase 6, apoptosisrelated cysteine peptidase // 4q25 // 839 // CASP6 NM_ NR_ // HIST2H2BA // histone cluster 2, H2ba // 1p12- p11.2 // /// HIST2H2BA NR_ NM_ // MAB21L2 // mab-21-like 2 (C. elegans) // 4q31 // /// ENST MAB21L2 NM_ NR_ // FLJ37201 // tigger transposable element derived 2 pseudogene // 10q23.31 FLJ37201 NR_ NM_ // LYPD1 // LY6/PLAUR domain containing 1 // 2q21.2 // LYPD1 NM_ /// NM

76 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // PDE7B // phosphodiesterase 7B // q23-q24 // /// PDE7B NM_ ENST // NM_ // RAPGEF4 // Rap guanine nucleotide exchange RAPGEF4 NM_ factor (GEF) 4 // 2q NM_ // TNFRSF19 // tumor necrosis factor receptor TNFRSF19 NM_ superfamily, member NM_ // CCDC109B // coiled-coil domain containing 109B CCDC109B NM_ // 4q25 // /// NM_ // PLA2G4A // phospholipase A2, IVA (cytosolic, PLA2G4A NM_ calcium-dependent) // NM_ // B3GALT2 // UDP-Gal:betaGlcNAc beta 1,3- B3GALT2 NM_ galactosyltransferase, NM_ // ABHD10 // abhydrolase domain containing 10 // 3q13.2 // ABHD10 NM_ /// ENST NM_ // PROS1 // protein S (alpha) // q11.2 // 5627 /// PROS1 NM_ ENST // PROS NM_ // LXN // latexin // 3q25.32 // /// ENST // LXN NM_

77 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // ZFPM2 // zinc finger protein, multitype 2 // 8q23 // ZFPM2 NM_ /// ENST NM_ // GNAI1 // guanine nucleotide binding protein (G GNAI1 NM_ protein), alpha inhibiting NM_ // PARP9 // poly (ADP-ribose) polymerase family, PARP9 NM_ member 9 // 3q21 // 6096 NM_ // STIL // SCL/TAL1 interrupting locus // 1q32 1p32 // STIL NM_ /// NM NM_ // UBE2T // ubiquitin-conjugating enzyme E2T (putative) // 1q32.1 // // UBE2T NM_ NM_ // PTTG1 // pituitary tumortransforming 1 // 5q35.1 // 9232 /// NM_ // FAM54A // family with sequence similarity 54, member A // 6q23.3 // PTTG1 NM_ FAM54A NM_ NM_ // VRK1 // vaccinia related kinase // 14q32 // 7443 /// ENST // VRK1 NM_ NM_ // GALNTL2 // UDP-N-acetyl-alpha-Dgalactosamine:polypeptid GALNTL2 NM_ e N-acetylgalactos

78 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // TXNIP // thioredoxin interacting TXNIP protein // 1q21.1 // NM_ /// ENST NM_ // CKS2 // CDC28 protein kinase regulatory subunit 2 // CKS2 NM_ q22 // 1164 /// ENST NM_ // MFSD6 // major facilitator superfamily domain MFSD6 NM_ containing 6 // 2q32.2 // NM_ // GINS2 // GINS complex subunit (Psf2 homolog) // GINS2 NM_ q24.1 // /// ENS NM_ // SNRPB2 // small nuclear ribonucleoprotein polypeptide B'' // 20p12.2-p11.2 SNRPB2 NM_ NR_ // GSTTP1 // glutathione S-transferase GSTTP1 theta pseudogene 1 // NR_ q12 // / NM_ // IL15 // interleukin 15 // 4q31 // /// NM_ // IL15 NM_ IL15 // interleuki NM_ // EGR1 // early growth response // 5q31.1 // 1958 /// EGR1 NM_ ENST // E NM_ // SMCHD1 // structural maintenance of chromosomes flexible SMCHD1 NM_ hinge domain cont NM_ // LRRFIP1 // leucine rich repeat (in FLII) interacting protein 1 // LRRFIP1 NM_

79 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 7198 NM_ // CKS1B // CDC28 protein kinase regulatory subunit 1B // CKS1B NM_ q21.2 // 1163 /// NM_ // TMEFF2 // transmembrane protein with EGF-like and two TMEFF2 NM_ follistatin-like dom NM_ // LPHN3 // latrophilin 3 // 4q13.1 // /// ENST // LPHN3 // LPHN3 NM_ NM_ // GSTM4 // glutathione S-transferase mu 4 // 1p13.3 // 2948 /// NR // NR_ // ANKRD20B // ankyrin repeat domain 20B // 2q11.1 // /// GSTM4 NM_ ANKRD20B NR_ NM_ // CKS1B // CDC28 protein kinase regulatory subunit 1B // 1q21.2 // 1163 /// CKS1B NM_ NM_ // ARHGAP11B // Rho GTPase activating protein 11B // 15q13.2 // NM_ // MMP2 // matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa t NM_ // SLC7A2 // solute carrier family 7 (cationic amino acid transporter, y+ sys ARHGAP11B NM_ MMP2 NM_ SLC7A2 NM_

80 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // PDK1 // pyruvate dehydrogenase kinase, isozyme 1 // PDK1 NM_ q31.1 // 5163 /// ENS NM_ // PARP14 // poly (ADP-ribose) polymerase family, PARP14 NM_ member 14 // 3q21.1 // NM_ // B3GALTL // beta 1, B3GALTL galactosyltransferase-like NM_ // 13q12.3 // /// NM_ // PBX1 // pre-b-cell leukemia homeobox 1 // 1q23 // 5087 /// NM_ // PHLDB2 // pleckstrin homology-like domain, family B, member 2 // NM_ // SEMA3A // sema domain, immunoglobulin domain (Ig), short basic domain, sec PBX1 NM_ PHLDB2 NM_ SEMA3A NM_ NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // SNORD NR_ NR_ // SNORD50B // small nucleolar RNA, C/D box 50B // 6q14.3 // SNORD50B NR_ NM_ // RCN3 // reticulocalbin 3, EF-hand calcium binding domain // 19q13.33 // 57 BC // ROCK1 // Rho-associated, coiledcoil containing protein kinase 1 // 18q11.1 RCN3 NM_ ROCK1 BC

81 Column # Transcript NM_ // SMCHD1 // structural maintenance of chromosomes flexible hinge domain cont Ratio(shR RM2B -mut) Change(s hrrm2b SMCHD1 NM_ ENST // FAM64A // family with sequence similarity 64, member A // 17p13.2 // FAM64A ENST BC // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase BC // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase BC // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase NM_ // HSPA2 // heat shock 70kDa protein 2 // 14q24.1 // 3306 /// NM_ // GBP3 // guanylate binding protein 3 // 1p22.2 // 2635 /// ENST PCMTD2 BC PCMTD2 BC PCMTD2 BC HSPA2 NM_ GBP3 NM_ NM_ // IL13RA2 // interleukin 13 receptor, alpha 2 // Xq13.1-q28 // 3598 /// ENST IL13RA2 NM_ NM_ // HIST1H2BD // histone cluster 1, H2bd // 6p21.3 // 3017 /// NM // HIST1H2BD NM_ NM_ // DRP2 // dystrophin related protein DRP2 2 // Xq22 // 1821 /// NM_ ENST /

82 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // MXRA5 // matrix-remodelling MXRA5 associated 5 // Xp22.33 // NM_ /// ENST NM_ // hcg_ // hypothetical protein hcg_ NM_ LOC // 2q11.2 // /// E NM_ // ASF1B // ASF1 anti-silencing function 1 homolog B (S. cerevisiae) // 19p13 ASF1B NM_ NM_ // C8orf79 // chromosome C8orf79 open reading frame 79 // NM_ p22 // /// NM ENST // LOC // hypothetical LOC // 17q11.2 // LOC ENST NM_ // GABRB1 // gamma-aminobutyric acid (GABA) A receptor, GABRB1 NM_ beta 1 // 4p12 // NM_ // DNALI1 // dynein, axonemal, light intermediate chain 1 // DNALI1 NM_ p35.1 // 7802 /

83 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 9209 NM_ // SBF2 // SET binding factor 2 // p15.4 // /// SBF2 NM_ ENST // SB NM_ // KIF4B // kinesin family member B // 5q33.1 // /// KIF4B NM_ NM // AK // C12orf48 // chromosome 12 open reading frame 48 // 12q23.2 // /// AK3 C12orf48 AK NM_ // SNX25 // sorting nexin 25 // 4q35.1 // /// ENST // SNX25 NM_ // HSD17B6 // hydroxysteroid (17- beta) dehydrogenase 6 homolog (mouse) // 12q SNX25 NM_ HSD17B6 NM_ NR_ // ZWILCH // Zwilch, kinetochore associated, homolog (Drosophila) // 15q22.31 ZWILCH NR_ NM_ // ABCC4 // ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 NM_ NM_ // POLD3 // polymerase (DNAdirected), delta 3, accessory subunit // POLD3 NM_ NM_ // ACBD5 // acyl-coenzyme A binding domain containing 5 // 10p12.1 // ACBD5 NM_ NR_ // SNORD25 // small nucleolar RNA, C/D box 25 // 11q13 // 9303 /// AK / SNORD25 NR_

84 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // ORC6L // origin recognition complex, subunit 6 like (yeast) // 16q12 // 23 ORC6L NM_ NM_ // DIAPH3 // diaphanous DIAPH3 homolog 3 (Drosophila) // NM_ q21.2 // /// NM NM_ // LIN9 // lin- 9 homolog (C. elegans) // LIN9 1q42.12 // /// NM_ ENST NM_ // SLC25A40 // solute carrier family 25, member 40 // 7q21.12 // SLC25A40 NM_ NM_ // DDX60 // DEAD (Asp-Glu-Ala-Asp) DDX60 box polypeptide 60 // NM_ q32.3 // /// NR_ // POT1 // POT1 protection of telomeres 1 homolog (S. POT1 NR_ pombe) // 7q31.33 // NM_ // TEK // TEK tyrosine kinase, endothelial // 9p21 // TEK NM_ /// NR_ // SNORA40 // small nucleolar RNA, H/ACA box 40 // 11q21 // SNORA40 NR_ /// AK NM_ // NCAPD2 // non-smc condensin I complex, subunit D2 // NCAPD2 NM_ p13.3 // 9918 /// E 6167 NM_ // ITGB3BP // integrin beta 3 binding protein (beta3- endonexin) // 1p31.3 // ITGB3BP NM_

85 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // RTKN2 // rhotekin 2 // 10q21.2 // /// RTKN2 NM_ ENST // RTKN2 // r NM_ // CNTNAP3 // contactin associated protein-like 3 // 9p13.1 // CNTNAP3 NM_ /// AF NM_ // CKAP2 // cytoskeleton associated protein 2 // 13q14 // CKAP2 NM_ /// NM NM_ // SEMA7A // semaphorin 7A, GPI membrane anchor (John Milton Hagen blood grou SEMA7A NM_ NM_ // AR5B // 7290 AT rich interactive AR5B domain 5B (MRF1-like) // NM_ q21.2 // // NM_ // COL12A // collagen, type XII, alpha 1 // 6q12-q13 // COL12A1 NM_ /// NM / NM_ // ACTG2 // actin, gamma 2, smooth muscle, enteric // 2p13.1 ACTG2 NM_ // 72 /// ENST NM_ // CNTNAP3 // contactin associated protein-like 3 // 9p13.1 // CNTNAP3 NM_ /// AF NM_ // CNTNAP3 // contactin associated protein-like 3 // 9p13.1 // CNTNAP3 NM_ /// AF NM_ // GULP1 // GULP, engulfment adaptor PTB domain GULP1 NM_ containing 1 // 2q

86 Column # Transcript NM_ // NT5DC3 // 5'- nucleotidase domain containing 3 // 12q22- Ratio(shR RM2B -mut) Change(s hrrm2b NT5DC3 NM_ NR_ // SNORD42B // small nucleolar RNA, C/D box SNORD42B NR_ NM_ // CDC25B // cell division cycle 25 homolog B (S. pombe) // 20p13 // 994 /// CDC25B NM_ NM_ // C4orf21 // chromosome C4orf21 open reading frame 21 // NM_ q25 // /// BX NM_ // GREM2 // gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) // GREM2 NM_ NM_ // SKA2 // spindle and kinetochore associated complex subunit 2 // 17q22 // 3 SKA2 NM_ NM_ // TOM1L1 // target of myb1 (chicken) like 1 // 17q23.2 // /// ENST0000 TOM1L1 NM_ NM_ // SPC24 // SPC24, NDC80 kinetochore complex component, homolog (S. cerevisia SPC24 NM_ AK // FLJ36840 // hypothetical LOC FLJ36840 AK // --- //

87 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // G2E3 // G2/M-phase specific E ubiquitin ligase // 14q12 G2E3 NM_ // /// ENST 7189 NM_ // MASTL // microtubule associated serine/threonine kinaselike MASTL NM_ // 10p12.1 // NM_ // RFTN2 // raftlin family member 2 // q33.1 // /// RFTN2 NM_ ENST / 8877 NM_ // GRIA4 // glutamate receptor, ionotrophic, AMPA 4 // GRIA4 NM_ q22 // 2893 /// NM NM_ // UGT2B4 // UDP glucuronosyltransferase UGT2B4 NM_ family, polypeptide B4 // 4q13 // BC // C1orf112 // chromosome 1 open reading frame 112 // C1orf112 BC q24.2 // /// NM NM_ // 6463 HIST2H3D // histone HIST2H3D cluster 2, H3d // 1q21.2 // NM_ /// NM_ // PER3 // 4274 period homolog (Drosophila) // 1p36.23 // PER3 NM_ /// ENST

88 Column # Transcript NM_ // DEPDC1B // DEP domain containing 1B // 5q12.1 // /// NM // Ratio(shR RM2B -mut) Change(s hrrm2b DEPDC1B NM_ NM_ // N4BP2 // NEDD4 binding protein 2 // 4p14 // /// ENST // N NM_ // MRE11A // MRE11 meiotic recombination 11 homolog A (S. N4BP2 NM_ MRE11A NM_ NM_ // CEP152 // centrosomal protein kDa // 15q21.1 // /// CEP152 NM_ NM_ // POLQ // polymerase (DNA directed), theta // 3q13.33 // /// NM_ // LMNB1 // lamin B1 // 5q23.3-q31.1 // 4001 /// ENST // POLQ NM_ LMNB1 NM_ NM_ // TNFSF4 // tumor necrosis factor (ligand) superfamily, member 4 // 1q25 // TNFSF4 NM_ NM_ // GTSE1 // G-2 and S-phase expressed 1 // 22q13.2- q13.3 // /// GTSE1 NM_

89 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // SCLT1 // sodium channel and clathrin linker 1 // 4q28.2 SCLT1 NM_ // /// ENST 4851 NM_ // LPPR4 // plasticity related gene // 1p21.2 // 9890 /// LPPR4 NM_ ENST / NM_ // IFI44L // 4782 interferon-induced IFI44L protein 44-like // 1p31.1 // NM_ /// ENST NM_ // FMR1 // fragile X mental retardation 1 // Xq27.3 // 2332 /// ENST FMR1 NM_ NM_ // MCM3 // minichromosome maintenance complex component 3 // 6p12 // 4172 /// NR_ // RACGAP1P // Rac GTPase activating protein 1 pseudogene // MCM3 NM_ RACGAP1P NR_

90 Column # Transcript NM_ // KPNA5 // karyopherin alpha 5 (importin alpha 6) // 6q22.1 // 3841 /// ENST Ratio(shR RM2B -mut) Change(s hrrm2b KPNA5 NM_ NM_ // CAMK4 // calcium/calmodulindependent protein kinase IV // 5q21.3 // 814 / CAMK4 NM_ NM_ // HAUS6 // HAUS augmin-like complex, subunit 6 // 9p22.1 // /// HAUS6 NM_ NM_ // ABCA8 // ATP-binding cassette, sub-family A (ABC1), member 8 // 17q24 // 1 NR_ // SNORA4 // small nucleolar RNA, H/ACA box 4 // 3q27 // /// AK ABCA8 NM_ SNORA4 NR_ NM_ // POLA1 // polymerase (DNA directed), alpha 1, catalytic subunit // POLA1 NM_ NM_ // OIP5 // Opa interacting protein 5 // 15q15.1 // /// ENST NM_ // GPR85 // G proteincoupled receptor 85 // 7q31 // /// NM_ // SLC4A8 // solute carrier family 4, sodium bicarbonate OIP5 NM_ GPR85 NM_ SLC4A8 NM_

91 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // BCAS2 // breast carcinoma amplified sequence 2 // 1p21-p13.3 // /// BCAS2 NM_ NM_ // PFKP // phosphofructokinase, platelet // 10p15.3-p15.2 // 5214 /// ENST000 PFKP NM_ NM_ // MNS1 // meiosis-specific nuclear structural 1 // 15q21.3 // /// ENST MNS1 NM_ NM_ // C4orf46 // chromosome C4orf46 open reading frame 46 // NM_ q32.1 // /// E NM_ // PDE1C // phosphodiesterase 1C, calmodulin-dependent 70kDa // 7p14.3 // 513 PDE1C NM_ NM_ // LSM2 // LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) // 6 NM_ // LSM2 // LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) // 6 NM_ // LSM2 // LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) // 6 NM_ // TMOD1 // tropomodulin 1 // 9q22.3 // 7111 /// ENST // LSM2 NM_ LSM2 NM_ LSM2 NM_ TMOD1 NM_

92 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // EXOSC8 // exosome component 8 // 13q13.1 // /// NM // FAM4 EXOSC8 NM_ NM_ // MANSC1 // MANSC domain containing 1 // 12p13.2 // /// MANSC1 NM_ NM_ // SGCZ // sarcoglycan zeta // 8p // /// ENST // SGCZ // SGCZ NM_ NM_ // ECM1 // extracellular matrix protein 1 // 1q21 // 1893 /// NM // EC NM_ // LRRFIP1 // leucine rich repeat (in FLII) interacting protein 1 // ECM1 NM_ LRRFIP1 NM_ NM_ // PSMB8 // proteasome (prosome, macropain) subunit, beta type, 8 (large mult PSMB8 NM_ NM_ // PSMB8 // proteasome (prosome, macropain) subunit, beta type, 8 (large mult PSMB8 NM_

93 Column # Transcript NM_ // PSMB8 // proteasome (prosome, macropain) subunit, beta type, 8 (large mult Ratio(shR RM2B -mut) Change(s hrrm2b PSMB8 NM_ NM_ // ARHGAP20 // Rho GTPase activating protein 20 // 11q23.1 // ARHGAP20 NM_ ENST // FAM92A2 // CG6405-PAlike FAM92A2 ENST // 15q15.1 // NM_ // EXOC6 // exocyst complex component 6 // 10q23.33 // /// EXOC6 NM_ XM_ // LOC // similar LOC XM_ to hcg // 6p // NR_ // SNORD // small nucleolar RNA, C/D box // 15q11.2 // NM_ // ATG10 // ATG10 autophagy related 10 homolog (S. cerevisiae) // 5q14.1-q14. SNORD NR_ ATG10 NM_ NM_ // FAM129A // family with sequence similarity 129, member A // 1q25 // FAM129A NM_ NR_ // SNORD // small nucleolar RNA, SNORD28 NR_ C/D box 28 // 11q13 // NM_ // CHL1 // cell adhesion molecule with homology to L1CAM (close homolog of L1 CHL1 NM_

94 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // NSUN6 // NOL1/NOP2/Sun domain NSUN6 family, member 6 // NM_ p12.31 // /// E NM_ // DAB1 // 6148 disabled homolog (Drosophila) // 1p32-p31 DAB1 NM_ // 1600 /// ENST NM_ // CRHBP // corticotropin releasing hormone binding protein CRHBP NM_ // 5q11.2-q13.3 / NM_ // IQGAP3 // IQ motif containing GTPase activating IQGAP3 NM_ protein 3 // 1q22-q23.1 // NM_ // HIST1H2BI // histone cluster 1, H2bi // 6p21.3 HIST1H2BI NM_ // 8346 /// BC // 9742 NM_ // CARD17 // caspase recruitment domain CARD17 NM_ family, member 17 // NM_ // HIST1H3A // histone HIST1H3A cluster 1, H3a // 6p21.3 // NM_ /// BC // NM_ // TBXAS1 // thromboxane A synthase 1 (platelet) // TBXAS1 NM_ q34-q35 // 6916 /// N L23320 // RFC1 // replication factor C (activator 1) 1, 145kDa // 4p14-p13 // 5981 RFC1 L

95 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // LUM // lumican // 12q21.3-q22 // /// LUM NM_ ENST // 4812 NM_ // LRRC8C // leucine rich repeat containing 8 family, LRRC8C NM_ member C // 1p22.2 // NM_ // MCART1 // mitochondrial carrier triple repeat 1 // 9p13.3- p12 // /// MCART1 NM_ NM_ // ST8SIA6 // ST8 alpha-nacetyl-neuraminide alpha-2,8- ST8SIA6 NM_ NM_ // IL7R // interleukin 7 receptor // 5p13 // 3575 /// ENST // NM_ // RNASEH2A // ribonuclease H2, subunit A // 19p13.2 // /// IL7R NM_ RNASEH2A NM_ NM_ // THBS3 // thrombospondin 3 // q21 // 7059 /// ENST // THBS3 NM_ NM_ // ANXA3 // annexin A3 // 4q13-q22 // 306 /// ENST // NM_ // KCNN2 // potassium intermediate/small conductance calciumactivated channe ANXA3 NM_ KCNN2 NM_

96 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // CDC25A // cell division cycle homolog A (S. pombe) // CDC25A NM_ p21 // 993 /// N NM_ // ALG10B // asparaginelinked glycosylation 10, ALG10B NM_ alpha-1,2-glucosyltransfe NM_ // C6orf167 // chromosome 6 open reading frame 167 // 6q16.1 // /// EN BC // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase C6orf167 NM_ PCMTD2 BC NR_ // SNORD59A // small nucleolar RNA, C/D box 59A // 12p13-qter // SNORD59A NR_ NM_ // HNRNPD // heterogeneous nuclear ribonucleoprotein D (AUrich element RNA b NM_ // PSD3 // pleckstrin and Sec7 domain containing 3 // 8pter-p23.3 // // NM_ // UGDH // UDP-glucose dehydrogenase // 4p15.1 // 7358 /// ENST // HNRNPD NM_ PSD3 NM_ UGDH NM_ NM_ // TNFAIP8 // tumor necrosis factor, alpha-induced protein 8 // 5q23.1 // 258 TNFAIP8 NM_

97 Column # Transcript BC // C17orf58 // chromosome 17 open reading frame 58 // 17q24.2 // /// EN Ratio(shR RM2B -mut) Change(s hrrm2b C17orf58 BC NM_ // PLAU // plasminogen activator, urokinase // 10q24 // 5328 /// NM PLAU NM_ NM_ // NQO1 // NAD(P)H dehydrogenase, quinone 1 // 16q22.1 // 1728 /// NM_ // RIF1 // RAP1 interacting factor homolog (yeast) // 2q23.3 // /// ENS NR_ // DLEU1 // deleted in lymphocytic leukemia 1 (non-protein coding) // 13q14.3 NM_ // E // insulin-degrading enzyme // 10q23-q25 // 3416 /// NM_ // HIP1 // huntingtin interacting protein 1 // 7q11.23 // 3092 /// ENST NM_ // DNAH5 // dynein, axonemal, heavy chain 5 // 5p15.2 // 1767 /// ENST NQO1 NM_ RIF1 NM_ DLEU1 NR_ E NM_ HIP1 NM_ DNAH5 NM_ NR_ // SNORD // small nucleolar RNA, C/D box 78 // 1q25.1 // SNORD78 NR_ NM_ // MORN2 // MORN repeat containing 2 // 2p22.1 // /// MORN2 NM_

98 Column # Transcript NM_ // CPS1 // carbamoyl-phosphate synthetase 1, mitochondrial // 2q35 // Ratio(shR RM2B -mut) Change(s hrrm2b CPS1 NM_ NM_ // PPIL5 // peptidylprolyl isomerase (cyclophilin)-like 5 // 14q21.3 // PPIL5 NM_ NM_ // SCML2 // sex comb on midleg-like 2 (Drosophila) // Xp22 // /// ENST0 SCML2 NM_ NM_ // POSTN // periostin, osteoblast specific factor // 13q13.3 // /// NM POSTN NM_ NM_ // SSR2 // signal sequence receptor, beta (translocon-associated SSR2 NM_ BC // FAM107B // family with sequence similarity 107, member B // 10p13 // NM_ // ALG10 // asparagine-linked glycosylation 10, alpha- 1,2-glucosyltransferase FAM107B BC ALG10 NM_ NM_ // TET1 // tet oncogene 1 // 10q21 // /// ENST // TET1 // te TET1 NM_

99 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 6921 NM_ // ANGEL2 // angel homolog (Drosophila) // 1q32.3 // ANGEL2 NM_ /// ENST NM_ // HSD17B11 // hydroxysteroid (17-beta) HSD17B11 NM_ dehydrogenase 11 // NM_ // RAB38 // RAB38, member RAS oncogene family // 11q14 // /// ENST00000 NM_ // COQ3 // coenzyme Q3 homolog, methyltransferase (S. cerevisiae) // 6q16.2 / RAB38 NM_ COQ3 NM_ NM_ // ACPP // acid phosphatase, ACPP prostate // 3q21-q23 // 55 NM_ /// NM // A NM_ // MYBL2 // v-myb myeloblastosis viral oncogene homolog (avian)-like 2 // 20q MYBL2 NM_ NM_ // ANKRD50 // ankyrin repeat domain // 4q28.1 // /// ENST ANKRD50 NM_ NR_ // SNORA1 // small nucleolar RNA, H/ACA box 1 // 11q21 // NM_ // MCM4 // minichromosome maintenance complex component 4 // 8q11.2 // 4173 / SNORA1 NR_ MCM4 NM_

100 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // DEK // DEK oncogene // 6p // 7913 /// DEK NM_ NM // DEK // NM_ // DSN1 // DSN1, MIND kinetochore complex DSN1 NM_ component, homolog (S NM_ // ELK3 // ELK3, ETS-domain protein (SRF accessory protein 2) // 12q23 // 200 ELK3 NM_ NM_ // TSLP // thymic stromal lymphopoietin // 5q22.1 // /// NM // NM_ // HAUS6 // HAUS augmin-like complex, subunit 6 // 9p22.1 // /// NM_ // PAG1 // phosphoprotein associated with glycosphingolipid NM_ // RBM43 // RNA binding motif protein 43 // 2q23.3 // /// TSLP NM_ HAUS6 NM_ PAG1 NM_ RBM43 NM_ NM_ // RPL36A // ribosomal protein L36a // Xq22.1 // 6173 /// AY // RPL36AP RPL36A NM_ NM_ // CHEK2 // CHK2 checkpoint homolog (S. pombe) // 22q11 22q12.1 NM_ // GINS4 // GINS complex subunit 4 (Sld5 homolog) // 8p11.21 // /// ENS NM_ // STK32B // serine/threonine kinase 32B // 4p16.2 // /// ENST CHEK2 NM_ GINS4 NM_ STK32B NM_

101 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) BC // UNQ565 // IGYY565 // 11q24.2 // UNQ565 BC NM_ // HLA-DMA // major histocompatibility HLA-DMA complex, class II, DM NM_ alpha // 6p NM_ // HLA-DMA // major histocompatibility HLA-DMA complex, class II, DM NM_ alpha // 6p NM_ // ZNF670 // 7065 zinc finger protein 670 // q44 // /// ZNF670 NM_ ENST // NM_ // RMI1 // RMI1, RecQ mediated genome instability 1, RMI1 NM_ homolog (S. cerevisiae) NM_ // ORC1L // origin recognition complex, subunit 1-like ORC1L NM_ (yeast) // 1p32 // NM_ // C4orf33 // chromosome 4 open reading frame 33 // C4orf33 NM_ q28.2 // /// NM_ // ZNF680 // zinc finger protein 680 // q11.21 // /// ZNF680 NM_ NM //

102 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // SLC38A4 // solute carrier family 38, member 4 // 12q13 // /// NM 001 NM_ // PLEKHA9 // pleckstrin homology domain containing, family A (phosphoinositi SLC38A4 NM_ PLEKHA9 NM_ NM_ // MYLK // myosin light chain kinase MYLK // 3q21 // 4638 /// NM_ NM // MYLK // NM_ // MAP3K5 // mitogen-activated protein kinase kinase kinase 5 // 6q22.33 // 4 MAP3K5 NM_ NM_ // HIST2H2AC // histone cluster 2, H2ac // 1q21- q23 // 8338 /// NM_ // SLC7A14 // solute carrier family 7 (cationic amino acid transporter, y+ sy HIST2H2AC NM_ SLC7A14 NM_ NM_ // DCLRE1B // DNA cross-link repair B (PSO2 homolog, S. cerevisiae) // 1p13. DCLRE1B NM_ NM_ // SPATA7 // spermatogenesis associated 7 // 14q31.3 // /// NM NM_ // GSTCD // glutathione S- transferase, C-terminal domain containing // 4q2 SPATA7 NM_ GSTCD NM_

103 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // ERAP1 // endoplasmic reticulum ERAP1 NM_ aminopeptidase 1 // 5q NM_ // NCAM2 // neural cell adhesion molecule 2 // 21q21.1 // NCAM2 NM_ /// ENST NM_ // RFC4 // replication factor C (activator 1) 4, 37kDa // 3q27 // 5984 /// NM RFC4 NM_ NM_ // DARS2 // aspartyl-trna synthetase 2, mitochondrial // 1q25.1 // DARS2 NM_ NR_ // LOC // adenylate cyclase 10 pseudogene // 6p21.1 // /// LOC NR_ NM_ // CENPN // centromere protein N // 16q23.2 // /// NM CENPN NM_ AY // UNQ6484 // ISPF6484 // 16q22.2 // /// ENST // UNQ6484 UNQ6484 AY NM_ // TDO2 // tryptophan 2,3- dioxygenase // 4q31-q32 // 6999 /// NM_ // ARSJ // arylsulfatase family, member J // 4q26 // /// NM_ // NPTX1 // neuronal pentraxin I // 17q25.1-q25.2 // 4884 /// ENST AK // DPY19L2P1 // dpy-19-like 2 pseudogene 1 (C. elegans) // 7p14.2 // TDO2 NM_ ARSJ NM_ NPTX1 NM_ DPY19L2P1 AK

104 Column # Transcript NM_ // KIF22 // kinesin family member 22 // 16p11.2 // 3835 /// ENST / Ratio(shR RM2B -mut) Change(s hrrm2b KIF22 NM_ AK // FLJ44838 // hypothetical protein LOC // --- // /// ENST FLJ44838 AK NM_ // PARP4 // poly (ADP-ribose) polymerase family, member 4 // 13q11 // 143 NM_ // GPR56 // G protein-coupled receptor 56 // 16q12.2- q21 // 9289 /// NM NM_ // MCM10 // minichromosome maintenance complex component 10 // 10p13 // NM_ // SACS // spastic ataxia of Charlevoix-Saguenay (sacsin) // 13q12 // NM_ // TRAF5 // TNF receptor-associated factor 5 // 1q32 // 7188 /// NM // PARP4 NM_ GPR56 NM_ MCM10 NM_ SACS NM_ TRAF5 NM_ NM_ // NFYB // nuclear transcription factor Y, beta // 12q22- q23 // 4801 /// ENST NM_ // PRPS2 // phosphoribosyl pyrophosphate synthetase 2 // Xp22.3- NFYB NM_ PRPS2 NM_

105 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // PRR16 // proline rich 16 // 5q23.1 // /// ENST // PRR16 / PRR16 NM_ NR_ // SNORA // small nucleolar RNA, SNORA29 H/ACA box 29 // 6q25.3 // NR_ NM_ // MED1 // mediator complex subunit 1 // 17q12-q21.1 // 5469 /// NM_ // LOXL3 // lysyl oxidase-like 3 // 2p13 // /// ENST // NM_ // KHDRBS3 // KH domain containing, RNA binding, signal transduction associat NM_ // GINS1 // GINS complex subunit 1 (Psf1 homolog) // 20p11.21 // 9837 /// ENS NM_ // SPATA6 // spermatogenesis associated 6 // 1p33 // /// MED1 NM_ LOXL3 NM_ KHDRBS3 NM_ GINS1 NM_ SPATA6 NM_ NR_ // KGFLP2 // keratinocyte growth factor-like protein 2 // 9p12 // /// KGFLP2 NR_ XM_ // LOC // similar to hcg // 17q11.2 // LOC XM_

106 Column # Transcript NM_ // UHRF1 // ubiquitin-like with PHD and ring finger domains 1 // 19p13.3 / Ratio(shR RM2B -mut) Change(s hrrm2b UHRF1 NM_ AB // EIF4A2 // eukaryotic translation initiation factor 4A, isoform 2 // 3q28 // EIF4A2 AB NM_ // NARG1L // NMDA receptor regulated 1-like // 13q14.11 // /// NARG1L NM_ NM_ // CCDC110 // coiled-coil domain containing 110 // 4q35.1 // /// NM 00 CCDC110 NM_ NM_ // RTTN // rotatin // 18q22.2 // /// ENST // RTTN NM_ ENST // RIMBP3B // RIMS binding protein 3B // 22q11.21 // /// RIMBP3B ENST NM_ // HIST1H2AE // histone cluster 1, H2ae // 6p22.2- p21.1 // 3012 /// HIST1H2AE NM_ NR_ // SCARNA15 // small Cajal SCARNA15 body-specific RNA 15 // NR_ q25.2 // /// NM_ // PDS5B // PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae PDS5B NM_

107 Column # Transcript NM_ // OBFC1 // oligonucleotide/oligosacc haride-binding fold containing 1 // 10q2 Ratio(shR RM2B -mut) Change(s hrrm2b OBFC1 NM_ NM_ // MCAM // melanoma cell adhesion molecule // 11q23.3 // 4162 /// ENST MCAM NM_ NM_ // ABI3BP // ABI family, member 3 (NESH) binding protein // 3q12 // /// ABI3BP NM_ AF // C9orf38 // chromosome 9 open reading frame 38 // 9p24.1 // C9orf38 AF NM_ // PARP3 // poly (ADPribose) polymerase family, member 3 // NM_ // STOM // stomatin // 9q34.1 // 2040 /// NM_ // STOM // stomatin // 9q PARP3 NM_ STOM NM_ NM_ // UTS2D // urotensin 2 domain containing // 3q28 // /// UTS2D NM_ NM_ // MASP1 // mannan-binding lectin serine peptidase 1 (C4/C2 activating MASP1 NM_ NM_ // OXCT1 // 3-oxoacid CoA transferase 1 // 5p13.1 // 5019 /// OXCT1 NM_

108 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // RBMX // RNA binding motif protein, X-linked // RBMX NM_ Xq26.3 // /// NM_ // M1 // midline 1 (Opitz/BBB syndrome) // Xp22 // M1 NM_ /// NM // MI NM_ // HIST1H2AI // histone cluster 1, H2ai // 6p22- HIST1H2AI NM_ p21.3 // 8329 /// NR_ // SNORA5A // small nucleolar RNA, H/ACA box 5A // 7p13 // SNORA5A NR_ NM_ // CXCL10 // chemokine (C-X-C motif) ligand 10 // 4q21 // 3627 CXCL10 NM_ /// ENST NM_ // CAPS2 // calcyphosine 2 // q21.1-q21.2 // CAPS2 NM_ /// ENST // NM_ // GEN1 // Gen homolog 1, endonuclease GEN1 NM_ (Drosophila) // 2p24.2 // NM_ // RAD51 // RAD51 homolog (RecA homolog, E. coli) (S. RAD51 NM_ cerevisiae) // 15q

109 Column # Transcript NM_ // HLA-DMA // major histocompatibility complex, class II, DM alpha // 6p21.3 Ratio(shR RM2B -mut) Change(s hrrm2b HLA-DMA NM_ NM_ // PHF11 // PHD finger protein 11 // 13q14.2 // /// NM PHF11 NM_ NM_ // MMP16 // matrix metallopeptidase 16 (membrane-inserted) // 8q21.3 // 4325 NM_ // CDCA5 // cell division cycle associated 5 // 11q12.1 // /// ENST000 MMP16 NM_ CDCA5 NM_ NM_ // DDX21 // DEAD (Asp-Glu-Ala-Asp) DDX21 box polypeptide 21 // NM_ q21 // 9188 /// EN NM_ // HIST4H // histone cluster 4, H4 // HIST4H4 NM_ p12.3 // NM_ // ING3 // inhibitor of growth family, member 3 // 7q31 // /// NM ING3 NM_ NM_ // EDNRA // endothelin receptor type A // 4q31.22 // 1909 /// ENST EDNRA NM_ NR_ // SNORD26 // small nucleolar RNA, C/D box 26 // 11q13 // 9302 /// AK / SNORD26 NR_ NM_ // SLC38A5 // solute carrier family 38, SLC38A5 member 5 // Xp11.23 // NM_ /// ENST

110 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // ZNF100 // zinc finger protein 100 // p12 // /// ZNF100 NM_ ENST / NM_ // LRIG3 // leucine-rich repeats and immunoglobulin-like LRIG3 NM_ domains 3 // 12q NM_ // SLC26A2 // solute carrier family (sulfate transporter), SLC26A2 NM_ member 2 // 5q NM_ // ZNF429 // zinc finger protein 429 // 19p13.1 // /// ZNF429 NM_ NM_ // DZIP3 // DAZ interacting protein DZIP3 3, zinc finger // 3q13.13 // NM_ /// ENS NM_ // PION // pigeon homolog (Drosophila) // 7q11.23 // PION NM_ /// NM_ // GPR125 // G protein-coupled receptor 125 // 4p15.2 // GPR125 NM_ /// ENST NM_ // LRIG1 // leucine-rich repeats and immunoglobulin-like LRIG1 NM_ domains 1 // 3p14 // NM_ // KIF22 // kinesin family member // 16p11.2 // 3835 /// KIF22 NM_ ENST /

111 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 7942 NM_ // C10orf55 // chromosome open reading frame C10orf55 NM_ // 10q22.2 // // NM_ // GLRB // glycine receptor, beta // q31.3 // 2743 /// GLRB NM_ ENST // GL NM_ // CRLF3 // cytokine receptor-like factor 3 // 17q11.2 // /// ENST00000 CRLF3 NM_ NM_ // ZNF678 // zinc finger protein 678 // 1q42.13 // /// ENST NM_ // HIST1H2BL // histone cluster 1, H2bl // 6p22- p21.3 // 8340 /// ZNF678 NM_ HIST1H2BL NM_ NM_ // C5 // complement component // 9q33-q34 // 727 /// ENST // C5 C5 NM_ NM_ // TNFRSF1B // tumor necrosis factor receptor superfamily, member 1B NM_ // TRIM14 // tripartite motif-containing 14 // 9q22.33 // 9830 /// NM TNFRSF1B NM_ TRIM14 NM_ NM_ // CNTNAP1 // contactin associated CNTNAP1 protein 1 // 17q21 // 8506 NM_ /// ENST

112 Column # Transcript NR_ // LRRC37A4 // leucine rich repeat containing 37, member A4 Ratio(shR RM2B -mut) Change(s hrrm2b LRRC37A4 NR_ NM_ // EHD3 // EH-domain containing 3 // 2p21 // /// ENST // NM_ // SALL1 // sal-like 1 (Drosophila) // 16q12.1 // 6299 /// NM // SA NM_ // PKIA // protein kinase (campdependent, catalytic) inhibitor alpha // 8q21 EHD3 NM_ SALL1 NM_ PKIA NM_ ENST // OR5H14 // olfactory receptor, family 5, subfamily H, member 14 // 3q OR5H14 ENST NR_ // SNORD1B // small nucleolar RNA, C/D box 1B // 17q25.1 // SNORD1B NR_ NM_ // TNS3 // tensin 3 // 7p12.3 // /// ENST // TNS3 NM_ NM_ // SNRPG // small nuclear ribonucleoprotein polypeptide G // 2p13.3 // 6637 / SNRPG NM_

113 Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) NM_ // TRIM59 // tripartite motif-containing // 3q25.33 // TRIM59 NM_ /// ENST NM_ // WHSC1 // Wolf-Hirschhorn syndrome candidate 1 // WHSC1 NM_ p16.3 // 7468 /// NR_ // SNORD31 // small nucleolar RNA, C/D box 31 // 11q13 // SNORD31 NR_ /// AK / NM_ // DBF4B // DBF4 homolog B (S cerevisiae) // DBF4B NM_ q q21 // /// NM 7866 NM_ // ZWINT // ZW10 interactor // q21-q22 // /// ZWINT NM_ NM // ZWINT // NM_ // SCN7A // sodium channel, voltagegated, type VII, alpha // SCN7A NM_ q21-q23 // 633 NM_ // HNRNPA1 // heterogeneous nuclear ribonucleoprotein A1 // HNRNPA1 NM_ NM_ // HIST1H3E // histone HIST1H3E cluster 1, H3e // 6p21.3 // NM_ /// CR // NM_ // GLTSCR // glioma tumor suppressor candidate region gene 2 // 19q13.3 GLTSCR2 NM_ NM_ // KLHL13 // kelch-like 13 (Drosophila) KLHL13 // Xq23-q24 // /// NM_ ENST

114 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b NM_ // EPB41L2 // erythrocyte membrane protein band 4.1-like 2 // EPB41L2 NM_ q23 // 2037 // NM_ // ZRANB3 // zinc finger, RANbinding domain ZRANB3 NM_ containing 3 // 2q21.3 // 9830 NM_ // BL // BH3-like motif containing, cell death inducer // 11q24.1 // 414 BL NM_ NR_ // HSD17B7P2 // hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7P2 NR_ NM_ // CCDC111 // coiled-coil domain containing 111 // 4q35.1 // /// NM 02 CCDC111 NM_ NM_ // PCMTD1 // protein-l-isoaspartate (D-aspartate) O- methyltransferase PCMTD1 NM_ NR_ // LSM5 // LSM5 homolog, U6 small LSM5 nuclear RNA associated NR_ (S. cerevisiae) // NR_ // SNORA69 // small nucleolar RNA, H/ACA box 69 // Xq22- q24 // SNORA69 NR_ AK // FBXO9 // F box protein 9 // 6p12.3- FBXO9 AK p11.2 // NM_ // F3 // coagulation factor III (thromboplastin, tissue factor) // 1p22-p21 / F3 NM_

115 Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b AK // LOC // hypothetical protein LOC // 9q21.33 // / LOC AK NM_ // BRD7 // bromodomain containing // 16q12 // /// BRD7 NM_ ENST // NM_ // KIAA1429 // KIAA1429 // 8q22.1 // /// NM_ // KIAA1429 // KIAA1 KIAA1429 NM_ AF // SLC25A37 // solute carrier family 25, member 37 // 8p21.2 // /// ENST NM_ // CDC45L // CDC45 cell division cycle 45-like (S. cerevisiae) // 22q11.21 // NM_ // ARNTL2 // aryl hydrocarbon receptor nuclear translocator-like 2 // SLC25A37 AF CDC45L NM_ ARNTL2 NM_ NM_ // PCOTH // prostate collagen triple helix // 13q12 // /// PCOTH NM_ NM_ // TNFAIP3 // tumor necrosis factor, alpha-induced protein 3 // 6q23 // 7128 NM_ // SPRR2A // small proline-rich protein 2A // 1q21-q22 // 6700 /// ENST TNFAIP3 NM_ SPRR2A NM_ BC // DHFR // dihydrofolate reductase // DHFR BC q11.2-q13.2 // 1719 Highlighted: Down-regulation of protein expression was demonstrated by Western blotting.

116 Supplementary Table S5. GO enrichment analysis of up-regulated genes by silencing of RRM2B in IMR90 cells. % genes in Enrichmen Enrichmen that are in list, in list, in in list, list, not neg log function type t Score t p-value present in GO p-value B cell proliferation biological process E lymphocyte proliferation biological process E natural killer cell biological process leukocyte activation biological process detection of lipopolysaccharide biological process cell migration biological process receptor activity molecular function lymphocyte activation biological process cell growth biological process lipopolysaccharide receptor activity molecular function cell motion biological process immune system process biological process nucleosome assembly biological process anti-apoptosis biological process extracellular region cellular component chromatin assembly complex cellular component retinol metabolic process biological process cellular component biological process regulation of cell motion biological process defense response to Gram-negative bacterium biological process stress-activated protein kinase signaling pathway biological process pattern recognition receptor activity molecular function signal transducer activity molecular function molecular transducer activity molecular function membrane part cellular component beta-amyloid binding molecular function negative regulation of cellular process biological process negative regulation of apoptosis biological process negative regulation of programmed cell death biological process negative regulation of cell death biological process serine-type endopeptidase inhibitor molecular function high-density lipoprotein particle remodeling biological process lipid metabolic process biological process reverse cholesterol transport biological process negative regulation of phosphorylation biological process response to lipopolysaccharide biological process fibroblast proliferation biological process negative regulation of phosphate metabolic process biological process platelet activation biological process calcium-mediated biological process

117 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO regulation of fibroblast proliferation biological process response to chemical stimulus biological process regulation of cell proliferation biological process endopeptidase inhibitor activity molecular function peptidase inhibitor activity molecular function response to molecule of bacterial origin biological process macromolecular complex remodeling biological process protein-lipid complex remodeling biological process plasma lipoprotein particle remodeling biological process multi-organism process biological process unfolded protein binding molecular function embryonic development biological process transmembrane receptor activity molecular function phospholipase activity molecular function cell activation biological process developmental process biological process regulation of localization biological process sterol transport biological process cholesterol transport biological process cholesterol homeostasis biological process sterol homeostasis biological process leukocyte chemotaxis biological process regulation of cellular process biological process cellular process biological process cellular hormone metabolic process biological process regulation of transport biological process aminoglycan metabolic process biological process glycosaminoglycan metabolic process biological process cell chemotaxis biological process angiogenesis biological process integral to plasma membrane cellular component response to fungus biological process platelet activation biological process cell activation biological process phospholipid catabolic process biological process negative regulation of smooth muscle cell migration biological process insulin-like growth factor binding protein complex cellular component phosphatase activator activity molecular function myoblast differentiation biological process muscle cell differentiation biological process chondroitin 4- sulfotransferase activity molecular function

118 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO ribose phosphate diphosphokinase activity molecular function purine nucleotide biosynthetic process biological process nucleotide biosynthetic process biological process diphosphotransferase activity molecular function phagocytosis, recognition biological process endothelial cell migration biological process regulation of cholesterol storage biological process cholesterol storage biological process apolipoprotein A-I binding molecular function adhesion to other organism during biological process adhesion to symbiont biological process interleukin-12 production biological process SMAD protein nuclear translocation biological process salivary gland morphogenesis biological process menstrual cycle phase biological process gland morphogenesis biological process stress-activated MAPK biological process regulation of epidermis development biological process generation of neurons biological process cardiac epithelial to mesenchymal transition biological process pathway-restricted SMAD protein phosphorylation biological process aminoacylase activity molecular function endocytosis biological process sodium ion homeostasis biological process chromatin remodeling complex cellular component epidermis development biological process response to wounding biological process intrinsic to plasma membrane cellular component defense response to bacterium biological process lipase activity molecular function macromolecular complex subunit organization biological process enzyme inhibitor activity molecular function tissue development biological process regulation of stressactivated protein kinase signaling pathway biological process regulation of programmed cell death biological process regulation of cell death biological process transforming growth factor beta receptor signaling pathway biological process lipopolysaccharide receptor complex cellular component negative regulation of protein amino acid phosphorylation biological process

119 % genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO ion channel activity molecular function natural killer cell mediated cytotoxicity biological process phosphatidylserine molecular function innate immune response biological process protein-hormone receptor activity molecular function lymphocyte chemotaxis biological process glial cell migration biological process response to progesterone stimulus biological process regulation of transforming growth factor-beta2 production biological process neuron apoptosis biological process GPI anchor biosynthetic process biological process smooth muscle biological process sodium channel regulator activity molecular function lipid homeostasis biological process calmodulin binding molecular function apoptosis biological process regulation of cellular response to stress biological process heterocycle metabolic process biological process programmed cell death biological process response to external stimulus biological process chemotaxis biological process taxis biological process tumor necrosis factor biosynthetic process biological process negative regulation of osteoclast differentiation biological process phospholipid homeostasis biological process insulin-like growth factor I binding molecular function lysophospholipase molecular function bile acid transmembrane transporter activity molecular function glycosaminoglycan catabolic process biological process N-acetylgalactosamine 4- O-sulfotransferase molecular function chondroitin sulfotransferase activity molecular function sequestering of metal ion biological process nucleobase metabolic process biological process neuromuscular junction development biological process eye development biological process muscle contraction biological process response to bacterium biological process lipid transport biological process cytokine activity molecular function amine metabolic process biological process

120 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO anatomical structure formation involved in morphogenesis biological process regulation of response to stress biological process protein-dna complex assembly biological process plasma membrane part cellular component inflammatory response biological process regulation of biological process biological process response to other biological process locomotion biological process T-helper 1 type immune response biological process interleukin-8 biosynthetic process biological process decidualization biological process calcium ion transport into cytosol biological process calcium-mediated biological process sensory perception of biological process vacuolar protontransporting V-type cellular component JNK cascade biological process high-density lipoprotein particle clearance biological process regulation of biological process negative regulation of viral reproduction biological process cyclosporin A binding molecular function regulation of interleukin- 12 production biological process type II transforming growth factor beta molecular function epithelial to mesenchymal transition biological process cell morphogenesis involved in differentiation biological process heart contraction biological process negative regulation of immune response biological process mitotic cell cycle biological process female pregnancy biological process multicellular organismal process biological process membrane raft cellular component induction of apoptosis biological process response to metal ion biological process enzyme linked receptor protein signaling pathway biological process sensory perception of chemical stimulus biological process response to inorganic substance biological process regulation of cytokine production biological process cognition biological process

121 % genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO macrophage activation biological process regulation of tumor necrosis factor biological process regulation of osteoclast differentiation biological process cholesterol transport biological process negative regulation of smooth muscle cell proliferation biological process ATP-gated cation channel activity molecular function photoreceptor activity molecular function organic anion transmembrane transporter activity molecular function chondroitin sulfate metabolic process biological process chondroitin sulfate biosynthetic process biological process lipoprotein receptor molecular function viral reproduction biological process immune response biological process calcium-dependent phospholipid binding molecular function regulation of phosphoinositide 3- kinase cascade biological process phosphoinositide 3- kinase cascade biological process neurogenesis biological process signal transduction biological process cell communication biological process cyclin-dependent protein kinase inhibitor activity molecular function cellular response to extracellular stimulus biological process nitrogen compound metabolic process biological process regulation of immune response biological process system process biological process integral to membrane cellular component regulation of interleukin-8 biosynthetic process biological process response to vitamin D biological process purinergic nucleotide receptor activity molecular function nucleotide receptor molecular function regulation of calciummediated signaling biological process neuron differentiation biological process tumor necrosis factor receptor activity molecular function nitric-oxide synthase biological process triglyceride homeostasis biological process interferon-alpha/beta receptor binding molecular function bacterial binding molecular function nuclear outer membrane cellular component

122 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO GTP-dependent protein binding molecular function sensory organ biological process negative regulation of epithelial cell proliferation biological process sodium:potassiumexchanging ATPase molecular function regulation of multicellular organismal process biological process intrinsic to membrane cellular component anatomical structure development biological process neurological system process biological process insulin-like growth factor binding molecular function negative regulation of signal transduction biological process negative regulation of cell communication biological process peripheral nervous system development biological process tumor necrosis factor binding molecular function regulation of lipid storage biological process response to interferongamma biological process cation channel activity molecular function extracellular matrix structural constituent molecular function protein heterodimerization molecular function embryo implantation biological process low-density lipoprotein binding molecular function apolipoprotein binding molecular function scavenger receptor molecular function response to tumor necrosis factor biological process epithelial to mesenchymal transition biological process protein biological process phosphoinositide biosynthetic process biological process regulation of developmental process biological process cell motion biological process transmembrane receptor protein serine/threonine kinase signaling pathway biological process negative regulation of cell growth biological process ion transmembrane transporter activity molecular function cellular lipid catabolic process biological process substrate specific channel activity molecular function calcium ion transport biological process organic anion transport biological process regulation of nitric-oxide synthase activity biological process cell morphogenesis involved in differentiation biological process neutrophil chemotaxis biological process

123 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO regulation of neuron apoptosis biological process negative regulation of hydrolase activity biological process extrinsic to membrane cellular component mannosyltransferase activity molecular function angiogenesis biological process extracellular structure organization biological process muscle organ biological process G-protein coupled receptor activity molecular function extracellular region part cellular component regulation of muscle cell differentiation biological process monocarboxylic acid transmembrane transporter activity molecular function odontogenesis biological process ATPase activity, coupled to transmembrane movement of ions, phosphorylative molecular function protein serine/threonine kinase inhibitor activity molecular function hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides molecular function cell cycle biological process cell migration biological process metal ion transmembrane transporter activity molecular function adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains biological process carbonate dehydratase activity molecular function nucleosome cellular component tumor necrosis factor receptor superfamily molecular function sphingoid metabolic process biological process biological regulation biological process signal transduction biological process cell death biological process death biological process extracellular matrix cellular component voltage-gated cation channel activity molecular function adaptive immune biological process phospholipid metabolic process biological process cytochrome-c oxidase activity molecular function oxidoreductase activity, acting on heme of donors molecular function oxidoreductase activity, acting on heme of donors, oxygen as molecular function

124 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO inactivation of MAPK activity biological process response to reactive oxygen species biological process caveola cellular component transforming growth factor beta receptor molecular function transmembrane receptor protein serine/threonine kinase binding molecular function G2/M transition of mitotic cell cycle biological process induction of apoptosis by intracellular signals biological process macromolecular complex assembly biological process membrane cellular component sensory perception biological process regulation of lipid biological process regulation of sterol biological process regulation of cholesterol transport biological process regulation of smooth muscle cell proliferation biological process phosphatidylinositol molecular function lipoprotein particle clearance biological process receptor serine/threonine kinase binding molecular function extracellular space cellular component regulation of response to stimulus biological process phospholipid binding molecular function cation transmembrane transporter activity molecular function myeloid leukocyte activation biological process MHC class I receptor activity molecular function learning or memory biological process cholesterol efflux biological process single fertilization biological process regulation of macromolecule biological process protein import into nucleus, translocation biological process collagen fibril biological process protein oligomerization biological process enzyme regulator activity molecular function cell motility biological process wound healing biological process regulation of viral reproduction biological process cytokine receptor activity molecular function monovalent inorganic cation homeostasis biological process cytokine binding molecular function response to stimulus biological process regulation of cellular component organization biological process regulation of monooxygenase activity biological process fertilization biological process cell morphogenesis biological process protein tetramerization biological process cation binding molecular function metal ion binding molecular function

125 % genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO primary metabolic biological process response to vitamin biological process mrna catabolic process biological process negative regulation of MAP kinase activity biological process voltage-gated calcium channel complex cellular component biological_process biological process intracellular cellular component structural molecule molecular function leukocyte adhesion biological process cell adhesion biological process negative regulation of transport biological process regulation of protein catabolic process biological process generation of precursor metabolites and energy biological process ion binding molecular function regulation of MAP kinase activity biological process macromolecular complex disassembly biological process regulation of epithelial cell proliferation biological process regulation of biomineral formation biological process sphingolipid metabolic process biological process biological adhesion biological process I-kappaB kinase/nfkappab cascade biological process integral to endoplasmic reticulum membrane cellular component keratinocyte biological process voltage-gated calcium channel activity molecular function cell-cell junction organization biological process glycerophospholipid biosynthetic process biological process protein complex biological process substrate-specific transporter activity molecular function regulation of phosphate metabolic process biological process regulation of phosphorus metabolic process biological process multicellular organismal process biological process regulation of metal ion transport biological process regulation of calcium ion transport biological process lipoprotein binding molecular function protein kinase inhibitor activity molecular function endoplasmic reticulum cellular component axon guidance biological process hematopoietin/interferonclass (D200-domain) cytokine receptor binding molecular function membrane lipid metabolic process biological process

126 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO transmembrane receptor protein tyrosine kinase signaling pathway biological process cell surface receptor linked signal transduction biological process regulation of ion transport biological process cell recognition biological process protein secretion biological process muscle contraction biological process response to unfolded protein biological process regulation of G-protein coupled receptor protein signaling pathway biological process receptor signaling protein serine/threonine kinase activity molecular function protein transport biological process ATPase activity, coupled to transmembrane movement of ions molecular function protein biological process hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds molecular function voltage-gated potassium channel activity molecular function plasma membrane cellular component transporter activity molecular function NFkappaB transcription factor activity biological process regulation of endocytosis biological process synapse organization biological process transcription corepressor activity molecular function muscle system process biological process organ development biological process regulation of cellular metabolic process biological process negative regulation of cell migration biological process vacuolar part cellular component oxidoreductase activity, acting on the CH-CH of donors molecular function phospholipid biosynthetic process biological process transcription repressor activity molecular function multicellular organismal development biological process cellular component organization biological process vesicle-mediated biological process substrate-specific transmembrane transporter activity molecular function response to protein stimulus biological process maintenance of location biological process regulation of vesiclemediated transport biological process G1/S transition of mitotic cell cycle biological process

127 % genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO cell-cell signaling biological process membrane fraction cellular component external side of plasma membrane cellular component extracellular matrix organization biological process cell junction organization biological process sodium ion transport biological process defense response biological process protein phosphatase regulator activity molecular function negative regulation of cell motion biological process hydro-lyase activity molecular function phosphoinositide binding molecular function platelet alpha granule cellular component regulation of signal transduction biological process regulation of cell communication biological process cell communication biological process response to nutrient biological process phosphatase regulator activity molecular function apical plasma membrane cellular component regulation of oxidoreductase activity biological process lipid transporter activity molecular function insoluble fraction cellular component apoptosis biological process growth factor binding molecular function receptor-mediated endocytosis biological process response to steroid hormone stimulus biological process cytoplasmic membranebounded vesicle lumen cellular component olfactory receptor activity molecular function visual perception biological process sensory perception of light stimulus biological process protein dimerization molecular function sulfotransferase activity molecular function channel regulator activity molecular function cellular_component cellular component programmed cell death biological process regulation of myeloid leukocyte differentiation biological process response to cytokine stimulus biological process cellular lipid metabolic process biological process carbon-oxygen lyase activity molecular function sensory perception of biological process cellular macromolecular complex assembly biological process lipid binding molecular function transcription factor biological process excretion biological process receptor binding molecular function auxiliary transport protein activity molecular function second-messengermediated signaling biological process

128 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO hydrolase activity, hydrolyzing O-glycosyl compounds molecular function activation of caspase activity biological process chemokine activity molecular function voltage-gated potassium channel complex cellular component protein homodimerization activity molecular function regulation of lipid metabolic process biological process transferase activity, transferring sulfurcontaining s molecular function cell development biological process innate immune response biological process activation of protein kinase activity biological process chemokine receptor molecular function anion transport biological process carboxylic acid transmembrane transporter activity molecular function ATPase activity, coupled to transmembrane movement of substances molecular function chemical homeostasis biological process organic acid transmembrane transporter activity molecular function caspase activity biological process developmental process biological process calcium ion binding molecular function regulation of cytokine biosynthetic process biological process anion transmembrane transporter activity molecular function cellular component morphogenesis biological process protein kinase regulator activity molecular function regulation of protein kinase cascade biological process Golgi apparatus cellular component response to hypoxia biological process cell adhesion biological process regulation of protein kinase activity biological process regulation of myeloid cell differentiation biological process metallopeptidase activity molecular function regulation of protein transport biological process regulation of hydrolase activity biological process cellular developmental process biological process regulation of kinase biological process ATPase activity, coupled to movement of molecular function secretion biological process cell differentiation biological process cell fraction cellular component hydrolase activity, acting on glycosyl bonds molecular function

129 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO cell-substrate adherens junction cellular component focal adhesion cellular component response to oxygen levels biological process metal ion transport biological process response to hormone stimulus biological process regulation of establishment of protein biological process cell-substrate junction cellular component kinase regulator activity molecular function cell proliferation biological process system development biological process ion transport biological process regulation of cell biological process peroxisome cellular component microbody cellular component response to virus biological process regulation of protein localization biological process regulation of caspase activity biological process kinase activity molecular function regulation of transferase activity biological process proteinaceous extracellular matrix cellular component G-protein coupled receptor protein signaling biological process cellular defense response biological process regulation of endopeptidase activity biological process microtubule associated complex cellular component intrinsic to organelle membrane cellular component integral to organelle membrane cellular component regulation of apoptosis biological process G-protein-coupled receptor binding molecular function response to oxidative biological process regulation of peptidase activity biological process GTPase activator activity molecular function electron carrier activity molecular function reproductive process biological process peptide binding molecular function cell cycle arrest biological process potassium ion transport biological process zinc ion binding molecular function endocytosis biological process protein folding biological process magnesium ion binding molecular function protein ubiquitination biological process regulation of transcription factor activity biological process cytoplasmic vesicle part cellular component central nervous system development biological process soluble fraction cellular component negative regulation of cell proliferation biological process regulation of molecular function biological process channel activity molecular function

130 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO passive transmembrane transporter activity molecular function transport biological process nucleotide binding molecular function homeostatic process biological process regulation of DNA binding biological process immune response biological process regulation of primary metabolic process biological process regulation of cell differentiation biological process lyase activity molecular function cation transport biological process perinuclear region of cytoplasm cellular component Ras protein signal transduction biological process actin cytoskeleton organization biological process ubiquitin-protein ligase activity molecular function nervous system development biological process nucleobase, nucleoside and nucleotide metabolic process biological process oxidation reduction biological process I- kappab kinase/nfkappab cascade biological process regulation of catalytic activity biological process ATP binding molecular function regulation of cellular biosynthetic process biological process receptor signaling protein activity molecular function intracellular protein transport biological process transition metal ion molecular function regulation of biological quality biological process transferase activity, transferring hexosyl molecular function adenyl ribonucleotide binding molecular function cell part cellular component small conjugating protein ligase activity molecular function regulation of I-kappaB kinase/nf-kappab biological process spermatogenesis biological process male gamete generation biological process actin filament-based process biological process protein kinase activity biological process response to stress biological process regulation of binding biological process identical protein binding molecular function cellular process biological process endoplasmic reticulum membrane cellular component chromosomal part cellular component cellular response to stimulus biological process

131 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO acid-amino acid ligase activity molecular function organ morphogenesis biological process cell cycle process biological process cell-cell adhesion biological process gamete generation biological process intracellular signaling cascade biological process small GTPase mediated signal transduction biological process cell proliferation biological process cell junction cellular component ATPase activity, coupled molecular function metabolic process biological process transcription factor molecular function ligase activity, forming carbon-nitrogen bonds molecular function endoplasmic reticulum cellular component cellular biosynthetic process biological process transcription activator activity molecular function nucleobase, nucleoside, nucleotide and nucleic acid metabolic process biological process transmembrane transporter activity molecular function DNA binding molecular function protein kinase cascade biological process cytoplasm cellular component transferase activity, transferring glycosyl molecular function GTPase activity molecular function cation homeostasis biological process ribonucleotide binding molecular function purine ribonucleotide binding molecular function GTPase regulator activity molecular function ion homeostasis biological process nucleosidetriphosphatase regulator molecular function phosphotransferase activity, alcohol as molecular function synaptic transmission biological process regulation of cell cycle biological process transferase activity, transferring phosphoruscontaining s molecular function regulation of protein metabolic process biological process mitochondrion cellular component enzyme binding molecular function ATPase activity molecular function mrna metabolic process biological process ligase activity molecular function protein binding molecular function negative regulation of transcription, DNAdependent biological process molecular_function molecular function hydrolase activity, acting on ester bonds molecular function negative regulation of RNA metabolic process biological process hydrolase activity molecular function transcription coactivator activity molecular function

132 % genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO cytoplasmic part cellular component oxidoreductase activity molecular function nucleosidetriphosphatase activity molecular function protein serine/threonine kinase activity molecular function cytosol cellular component pyrophosphatase activity molecular function transcription, DNAdependent biological process hydrolase activity, acting on acid anhydrides molecular function hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides molecular function RNA metabolic process biological process establishment of localization biological process transferase activity molecular function peptidase activity, acting on L-amino acid peptides molecular function cytoskeleton cellular component cytoskeletal part cellular component peptidase activity molecular function protein amino acid phosphorylation biological process protein kinase activity molecular function anatomical structure morphogenesis biological process binding molecular function nucleic acid binding molecular function intracellular transport biological process intracellular nonmembrane-bounded cellular component cellular metabolic biological process catalytic activity molecular function post-translational protein modification biological process RNA metabolic process biological process regulation of transcription, DNA-dependent biological process regulation of metabolic process biological process intracellular membranebounded organelle cellular component establishment of localization in cell biological process nucleoplasm cellular component nucleus cellular component intracellular organelle cellular component regulation of macromolecule metabolic biological process protein modification biological process regulation of RNA metabolic process biological process cellular protein metabolic process biological process transcription factor molecular function transcription regulator activity molecular function intracellular organelle part cellular component cellular biopolymer metabolic process biological process intracellular part cellular component

133 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO cellular macromolecule metabolic process biological process nuclear part cellular component

134 Supplementary Table S6. GO enrichment analysis of down-regulated genes by silencing of RRM2B in IMR90 cells. % genes in in list, Enrichmen Enrichmen that are in list, in list, in list, not GO neg log function type t Score t p-value present in p-value chromosomal part cellular component E nucleoplasm cellular component E cell cycle process biological process E DNA replication biological process E cell cycle phase biological process E nuclear part cellular component E part cellular component E cellular response to DNA damage stimulus biological process E organization biological process E DNA metabolic process biological process E DNA repair biological process E mitosis biological process E stress biological process E regulation of cell cycle biological process E microtubule motor activity molecular function E condensation biological process E regulation of mitotic cell cycle biological process E mitotic chromosome condensation biological process E spindle organization biological process E cellular biopolymer biosynthetic process biological process E biopolymer biosynthetic process biological process E outer kinetochore of condensed chromosome cellular component E DNA binding molecular function E spindle microtubule cellular component E microtubule cellular component E intracellular organelle cellular component E nucleus cellular component E mitotic cell cycle checkpoint biological process E cellular response to stimulus biological process E intracellular membranebounded organelle cellular component E chromosome segregation biological process E regulation of cyclindependent protein kinase activity biological process E phosphoinositidemediated signaling biological process E biopolymer metabolic process biological process E cytoskeletal part cellular component E double-strand break repair via homologous recombination biological process E organelle organization biological process E motor activity molecular function E macromolecule metabolic process biological process E DNA strand elongation during DNA replication biological process E DNA primase activity molecular function E establishment of chromosome localization biological process chromosome, centromeric region cellular component

135 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value nucleic acid binding molecular function repair biological process cell cycle biological process cohesin complex cellular component metaphase plate congression biological process kinetochore organization biological process condensin complex cellular component DNA strand elongation biological process nucleotide-excision repair, DNA gap filling biological process DNA replication initiation biological process G2 phase of mitotic cell cycle biological process G2 phase biological process process biological process intracellular part cellular component microtubule cytoskeleton organization biological process process biological process nucleosome assembly biological process DNA replication factor C complex cellular component response to DNA damage stimulus biological process nucleosome cellular component kinesin complex cellular component division biological process spindle pole cellular component regulation of organelle organization biological process centrosome cellular component mitotic sister chromatid segregation biological process DNA geometric change biological process DNA duplex unwinding biological process establishment of organelle localization biological process regulation of DNA metabolic process biological process cell proliferation biological process spindle cellular component chromatin binding molecular function chromatin cellular component DNA-directed DNA polymerase activity molecular function mitotic cell cycle spindle assembly checkpoint biological process negative regulation of mitotic metaphase/anaphase transition biological process sister chromatid segregation biological process negative regulation of mitosis biological process negative regulation of nuclear division biological process DNA synthesis during DNA repair biological process chromosome movement towards spindle pole biological process

136 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type regulation of microtubule polymerization or depolymerization biological process mitotic metaphase biological process mitotic metaphase plate congression biological process kinetochore binding molecular function kinetochore assembly biological process centrosome duplication biological process DNA replication, synthesis of RNA primer biological process alpha DNA polymerase:primase complex cellular component second-messengermediated signaling biological process nuclear chromosome part cellular component histone binding molecular function G2/M transition DNA damage checkpoint biological process checkpoint biological process structure-specific DNA binding molecular function microtubule associated complex cellular component regulation of ubiquitinprotein ligase activity biological process DNA polymerase activity molecular function cellular_component cellular component activity biological process single-stranded DNA binding molecular function regulation of DNA replication biological process regulation of cellular component organization biological process transferase activity, transferring phosphoruscontaining s molecular function metaphase biological process response to insecticide biological process response to organophosphorus biological process DNA unwinding during replication biological process traversing start control point of mitotic cell cycle biological process leukocyte tethering or rolling biological process DNA damage response, signal transduction biological process binding molecular function extracellular matrix cellular component protein binding molecular function DNA damage checkpoint biological process nuclear ubiquitin ligase complex cellular component extracellular matrix structural constituent molecular function membrane to membrane docking biological process lamin binding molecular function response to lipopolysaccharide biological process

137 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value PML body cellular component pyrophosphatase activity molecular function proteinaceous extracellular matrix cellular component hydrolase activity, acting on acid anhydrides molecular function hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides molecular function DNA-dependent ATPase activity molecular function protein serine/threonine kinase activity molecular function cytokinesis during cell cycle biological process checkpoint biological process negative regulation of DNA replication initiation biological process gamma-tubulin binding molecular function BRCA1-A complex cellular component regulation of DNA recombination biological process nitric oxide metabolic process biological process regulation of cell proliferation biological process cell division biological process response to toxin biological process levels biological process process biological process intracellular nonmembrane-bounded cellular component nucleosidetriphosphatase activity molecular function phosphoric diester hydrolase activity molecular function catalytic activity molecular function nucleotidyltransferase activity molecular function double-stranded DNA binding molecular function negative regulation of transcription factor biological process cellular component organization biological process nuclear body cellular component DNA ligation biological process negative regulation of smooth muscle cell proliferation biological process sulfate transport biological process DNA damage response, signal transduction resulting in induction of biological process double-strand break repair via nonhomologous end biological process anaphase-promoting complex-dependent proteasomal ubiquitindependent protein catabolic process biological process microtubule organizing center organization biological process

138 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value hydrolase activity molecular function ubiquitin-protein ligase activity during mitotic cell cycle biological process nuclear envelope cellular component nucleolus cellular component chromosome cellular component response to molecule of bacterial origin biological process reciprocal meiotic recombination biological process telomere maintenance biological process cyclin-dependent protein kinase activity molecular function regulation of microtubule cytoskeleton organization biological process regulation of exit from mitosis biological process regulation of cell cycle process biological process regulation of DNA replication initiation biological process tumor necrosis factor receptor activity molecular function ubiquitin-protein ligase activity biological process protein kinase activity molecular function cell part cellular component extracellular region cellular component response to ionizing radiation biological process DNA-directed RNA polymerase activity molecular function RNA polymerase activity molecular function anchoring collagen cellular component tumor necrosis factor binding molecular function telomere maintenance via telomerase biological process extracellular region part cellular component nuclear matrix cellular component cellular process biological process organization biological process nuclear chromosome cellular component endodeoxyribonuclease activity molecular function telomere maintenance via telomere lengthening biological process dioxygenase activity molecular function caspase regulator activity molecular function cytokinesis biological process cellular process biological process transcription cofactor activity molecular function negative regulation of DNA replication biological process sex differentiation biological process kinetochore cellular component regulation of innate immune response biological process fat cell differentiation biological process

139 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type proteasomal protein catabolic process biological process proteasomal ubiquitindependent protein catabolic process biological process small conjugating protein binding molecular function ubiquitin binding molecular function binding molecular function anatomical structure homeostasis biological process negative regulation of transcription biological process ubiquitin-protein ligase activity molecular function midbody cellular component arylsulfatase activity molecular function skeletal system development biological process regulation of cellular process biological process phosphotransferase activity, alcohol as molecular function negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle biological process negative regulation of cellular metabolic biological process negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process biological process cell proliferation biological process metabolic process biological process caspase activator activity molecular function negative regulation of protein catabolic process biological process cell cycle checkpoint biological process meiosis biological process mismatch repair biological process telomeric DNA binding molecular function xenobiotic metabolic process biological process negative regulation of ubiquitin-protein ligase activity biological process gamete generation biological process response to radiation biological process nucleotide binding molecular function G1/S transition of mitotic cell cycle biological process ',5'-cyclic-nucleotide phosphodiesterase molecular function protein amino acid ADPribosylation biological process transferase activity molecular function ATP binding molecular function protein-dna complex assembly biological process response to stimulus biological process regulation of smooth muscle cell proliferation biological process

140 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type phosphoinositide phospholipase C activity molecular function centrosome organization biological process cyclic-nucleotide phosphodiesterase molecular function RNA catabolic process biological process heterogeneous nuclear ribonucleoprotein cellular component M phase of mitotic cell cycle biological process apoptotic chromosome condensation biological process cytokinesis after mitosis biological process contractile ring cellular component spindle pole body cellular component spindle pole body organization biological process activation of phospholipase C activity by muscarinic acetylcholine receptor biological process urea transport biological process amide transport biological process chromosome passenger complex cellular component bubble DNA binding molecular function binding molecular function regulation of immune system process biological process peptidoglycan biological process negative regulation of interleukin-12 production biological process negative regulation of smooth muscle cell migration biological process insulin-like growth factor binding protein complex cellular component generation of neurons biological process neurogenesis biological process histone exchange biological process glycerol-3-phosphate O- acyltransferase activity molecular function activity molecular function ribonuclease H activity molecular function flap endonuclease activity molecular function integral to nuclear inner membrane cellular component negative regulation of mrna processing biological process ferric-chelate reductase activity molecular function T cell mediated cytotoxicity biological process interferon-gamma production biological process smooth muscle cell apoptosis biological process negative regulation of fatty acid biosynthetic biological process glycerol kinase activity molecular function snrnp U2 cellular component

141 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type basic amino acid transmembrane transporter activity molecular function male meiosis biological process platelet dense granule membrane cellular component telomere maintenance via telomerase biological process polynucleotide kinase activity molecular function ATP-dependent polynucleotide kinase activity molecular function single-stranded DNA specific endodeoxyribonuclease activity molecular function lamin filament cellular component DNA damage response, signal transduction by p53 class mediator resulting in cell cycle biological process polysomal ribosome cellular component phosphofructokinase activity molecular function calmodulin-dependent cyclic-nucleotide phosphodiesterase molecular function negative regulation of anti-apoptosis biological process clathrin coat assembly biological process triglyceride catabolic process biological process cellular polysaccharide catabolic process biological process process biological process determination of anterior/posterior axis, embryo biological process anterior/posterior axis specification biological process antigen processing and presentation of endogenous peptide biological process antigen processing and presentation of endogenous peptide antigen via MHC class I biological process neuron adhesion biological process ribose phosphate diphosphokinase activity molecular function diphosphotransferase activity molecular function negative regulation of complement activation biological process single-stranded DNAdependent ATPase molecular function extracellular-glycinegated ion channel activity molecular function extracellular-glycinegated chloride channel molecular function camp-dependent protein kinase inhibitor activity molecular function regulation of circadian rhythm biological process

142 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value collagen cellular component small conjugating protein ligase activity molecular function proteolysis biological process phospholipase C activity molecular function condensed chromosome cellular component negative regulation of DNA metabolic process biological process membrane docking biological process sulfuric ester hydrolase activity molecular function organization biological process adenyl ribonucleotide binding molecular function spermatogenesis biological process male gamete generation biological process regulation of transcription from RNA polymerase II promoter biological process secretory granule cellular component regulation of mitosis biological process reproductive developmental process biological process activity molecular function reproductive process biological process biological_process biological process cytokine binding molecular function regulation of retroviral genome replication biological process establishment of spindle localization biological process protein tyrosine/serine/threonine phosphatase activity molecular function oxidoreductase activity, acting on CH or CH2 molecular function anterograde axon cargo transport biological process chromosome, telomeric region cellular component deoxynucleoside kinase activity molecular function MyD88-dependent tolllike receptor signaling biological process negative regulation of interleukin-6 production biological process interleukin-1-mediated signaling pathway biological process peptide receptor activity molecular function thrombin receptor activity molecular function DNA ligation during DNA repair biological process spindle midzone cellular component kinetochore microtubule cellular component ATP-dependent chromatin remodeling biological process activity molecular function cyclin-dependent protein kinase holoenzyme complex cellular component smooth muscle biological process regulation of smooth muscle cell differentiation biological process

143 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor molecular function protein complex biological process T cell mediated immunity biological process adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains biological process response to UV-B biological process gamma-tubulin large complex cellular component DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator biological process gamma-tubulin ring complex cellular component DNA damage response, signal transduction resulting in transcription biological process pyruvate dehydrogenase (acetyl-transferring) kinase activity molecular function telomere organization biological process telomere assembly biological process regulation of telomere maintenance via biological process negative regulation of telomere maintenance via telomerase biological process negative regulation of telomerase activity biological process regulation of immunoglobulin secretion biological process immunoglobulin secretion biological process S phase of mitotic cell cycle biological process S phase biological process U6 snrna binding molecular function nitrogen compound biosynthetic process biological process acylglycerol catabolic process biological process cotranslational protein targeting to membrane biological process alditol metabolic process biological process complex cellular component interleukin-6 receptor binding molecular function antigen processing and presentation of peptide antigen biological process CCAAT-binding factor complex cellular component artery smooth muscle contraction biological process extracellular ligand-gated ion channel activity molecular function

144 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type excitatory extracellular ligand-gated ion channel activity molecular function regulation of cytoskeleton organization biological process metalloendopeptidase activity molecular function spliceosome cellular component transport vesicle cellular component hydrolase activity, acting on ester bonds molecular function protein catabolic process biological process biological regulation biological process acid-amino acid ligase activity molecular function proteolysis involved in cellular protein catabolic process biological process negative regulation of protein metabolic process biological process blood coagulation biological process coagulation biological process ribonucleotide binding molecular function purine ribonucleotide binding molecular function cellular protein catabolic process biological process biopolymer catabolic process biological process tubulin binding molecular function mitosis biological process nuclear division biological process leukocyte adhesion biological process negative regulation of gene-specific biological process M phase biological process dynein binding molecular function muscarinic acetylcholine receptor activity molecular function prostaglandin E receptor activity molecular function response to X-ray biological process insulin-like growth factor I binding molecular function hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides molecular function regulation of lipid kinase activity biological process muscle contraction biological process oxidoreductase activity, oxidizing metal ions molecular function regulation of interferongamma production biological process regulation of smooth muscle cell apoptosis biological process chemosensory behavior biological process UDP-galactose:beta-Nacetylglucosamine beta- 1,3-galactosyltransferase activity molecular function

145 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value spermatid development biological process helicase activity biological process regulation of telomerase activity biological process cytochrome-b5 reductase activity molecular function nitric oxide biosynthetic process biological process cellular carbohydrate catabolic process biological process ubiquinone biosynthetic process biological process quinone cofactor biosynthetic process biological process sister chromatid cohesion biological process complement activation, lectin pathway biological process mitotic recombination biological process vascular smooth muscle contraction biological process blood coagulation, extrinsic pathway biological process molecular_function molecular function nuclear pore cellular component ubiquitin ligase complex cellular component cell cortex part cellular component regulation of epithelial cell proliferation biological process DNA recombination biological process multicellular organismal process biological process regulation of biological process biological process membrane raft cellular component response to estrogen stimulus biological process exonuclease activity molecular function differentiation biological process chemotaxis biological process taxis biological process regulation of viral genome replication biological process mitotic anaphase biological process anaphase biological process hyaluronic acid binding molecular function axon cargo transport biological process regulation of cell division biological process pattern recognition receptor signaling biological process toll-like receptor signaling pathway biological process regulation of interleukin- 12 production biological process negative regulation of immune response biological process transmembrane receptor protein tyrosine phosphatase signaling pathway biological process regulation of S phase biological process triglyceride biosynthetic process biological process

146 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value transport biological process heparan sulfate proteoglycan metabolic process biological process exodeoxyribonuclease activity, producing 5'- phosphomonoesters molecular function tissue homeostasis biological process regulation of adaptive immune response biological process regulation of adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains biological process natural killer cell mediated cytotoxicity directed against tumor biological process regulation of muscle cell apoptosis biological process postreplication repair biological process negative regulation of lipid biosynthetic process biological process taste biological process nucleocytoplasmic transporter activity molecular function chromatin assembly complex cellular component ',5'-cyclic-AMP phosphodiesterase molecular function beta-1,3- galactosyltransferase activity molecular function hormone biosynthetic process biological process FACIT collagen cellular component extracellular matrix structural constituent conferring tensile molecular function phagocytosis, engulfment biological process membrane invagination biological process cytoplasmic microtubule cellular component ER overload response biological process oxidoreductase activity, acting on NADH or NADPH, heme protein as molecular function glycerolipid catabolic process biological process quinone cofactor metabolic process biological process oxidoreductase activity, acting on the CH-NH2 of donors, oxygen as acceptor molecular function vasoconstriction biological process glycine binding molecular function neuromuscular process biological process blood coagulation biological process coagulation biological process ATPase activity, coupled molecular function endonuclease activity molecular function

147 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type peptidase activity, acting on L-amino acid peptides molecular function nuclease activity molecular function regulation of transcription factor activity biological process small nuclear ribonucleoprotein cellular component pore complex cellular component regulation of immune response biological process enzyme activator activity molecular function cellular macromolecule catabolic process biological process nitrogen compound metabolic process biological process ligase activity, forming carbon-nitrogen bonds molecular function phosphoric ester hydrolase activity molecular function oxidoreductase activity, acting on the CH-NH of donors, NAD or NADP as acceptor molecular function DNA secondary structure binding molecular function immune responseactivating signal biological process innate immune responseactivating signal transduction biological process immune responseregulating signal transduction biological process negative regulation of tumor necrosis factor biological process negative regulation of protein complex disassembly biological process regulation of insulin-like growth factor receptor signaling pathway biological process general transcriptional repressor activity molecular function neurogenesis biological process microvillus cellular component apical part of cell cellular component cellular response to extracellular stimulus biological process nucleotide diphosphatase activity molecular function alpha-tubulin binding molecular function fibrinogen complex cellular component regulation of transcription from RNA polymerase III promoter biological process calcium-dependent phospholipid binding molecular function leukocyte migration biological process complex cellular component axoneme part cellular component regulation of telomere maintenance biological process regulation of protein secretion biological process Cajal body cellular component

148 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type phosphofructokinase activity molecular function synaptic transmission, cholinergic biological process clathrin binding molecular function interleukin-1 receptor binding molecular function camp-dependent protein kinase regulator activity molecular function polyubiquitin binding molecular function protein heterodimerization molecular function response to wounding biological process SH3/SH2 adaptor activity molecular function metallopeptidase activity molecular function regulation of I-kappaB kinase/nf-kappab biological process locomotion biological process receptor signaling protein serine/threonine kinase activity molecular function peptide receptor activity, G-protein coupled molecular function inorganic anion transport biological process nuclear import biological process homooligomerization biological process nucleobase, nucleoside, nucleotide and nucleic acid metabolic process biological process macromolecular complex assembly biological process muscarinic acetylcholine receptor signaling biological process prostaglandin receptor activity molecular function transport biological process regulation of tumor necrosis factor production biological process response to interleukin-1 biological process filopodium cellular component mannose binding molecular function UV protection biological process negative regulation of epithelial cell proliferation biological process acylglycerol biosynthetic process biological process polypeptide N- acetylgalactosaminyltrans ferase activity molecular function natural killer cell mediated cytotoxicity biological process negative regulation of cytoskeleton organization biological process cysteine-type endopeptidase inhibitor activity molecular function myelination biological process '-5' exonuclease activity molecular function HAUS complex cellular component snrna binding molecular function calcium-activated potassium channel molecular function

149 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type receptor-mediated endocytosis biological process vasodilation biological process MAP kinase kinase kinase activity molecular function negative regulation of proteolysis biological process contraction biological process endothelial cell biological process protein kinase B signaling biological process negative regulation of I- kappab kinase/nfkappab cascade biological process extracellular space cellular component ribosome cellular component signal transduction biological process peptidase activity molecular function regulation of phosphorylation biological process endopeptidase inhibitor activity molecular function peptidase inhibitor activity molecular function chromatin remodeling complex cellular component nucleobase, nucleoside, nucleotide kinase activity molecular function histone acetyltransferase activity molecular function lysine N- acetyltransferase activity molecular function microtubule cytoskeleton cellular component activity molecular function activity molecular function negative regulation of signal transduction biological process negative regulation of cell communication biological process regulation of interleukin-6 production biological process insulin-like growth factor binding molecular function anaphase-promoting complex cellular component glycerol ether biosynthetic process biological process regulation of natural killer cell mediated immunity biological process regulation of natural killer cell mediated cytotoxicity biological process heterotrimeric G-protein complex cellular component GABA-A receptor activity molecular function ensheathment of neurons biological process axon ensheathment biological process nuclear telomere cap complex cellular component DNA-dependent DNA replication biological process ion gated channel activity molecular function nucleotide-sugar metabolic process biological process

150 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value caspase inhibitor activity molecular function axis specification biological process antigen processing and presentation biological process oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two molecular function oxidoreductase activity, acting on the CH-NH2 of donors molecular function eukaryotic translation initiation factor 4F cellular component regulation of tube size biological process regulation of blood vessel size biological process spectrin cellular component regulation of DNA binding biological process enzyme inhibitor activity molecular function response to protein stimulus biological process serine-type endopeptidase activity molecular function cytoplasmic membranebounded vesicle cellular component oxidoreductase activity molecular function G-protein coupled receptor protein signaling biological process response to abiotic stimulus biological process ATPase activity molecular function cytosol cellular component extracellular matrix organization biological process protein kinase C binding molecular function centriole cellular component DNA bending activity molecular function activity molecular function defense response to Gram-positive bacterium biological process gamma-tubulin complex cellular component iron ion binding molecular function NAD metabolic process biological process regulation of positive chemotaxis biological process positive chemotaxis biological process kinase activity molecular function cellular macromolecular complex assembly biological process intracellular signaling cascade biological process microtubule organizing center part cellular component pattern specification process biological process cysteine-type peptidase activity molecular function serine-type peptidase activity molecular function mrna processing biological process sequence-specific DNA binding molecular function

151 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value binding molecular function microtubule organizing center cellular component oxidoreductase activity, acting on the CH-NH of donors molecular function nucleoside kinase activity molecular function negative regulation of NF-kappaB transcription factor activity biological process T cell proliferation biological process condensed nuclear chromosome cellular component beta-tubulin binding molecular function protein ubiquitination biological process nucleosome organization biological process GABA receptor activity molecular function fibrillar collagen cellular component glycosaminoglycan biosynthetic process biological process NAD+ ADPribosyltransferase activity molecular function histone H2A acetylation biological process angiogenesis biological process response to external stimulus biological process cellular biopolymer metabolic process biological process regulation of protein kinase cascade biological process nuclear mrna splicing, via spliceosome biological process response to UV biological process response to steroid hormone stimulus biological process androgen receptor signaling pathway biological process cellular macromolecule metabolic process biological process I- kappab kinase/nfkappab cascade biological process signaling biological process pathway-restricted SMAD protein phosphorylation biological process ATP-dependent DNA helicase activity molecular function deoxyribonucleotide metabolic process biological process phosphoprotein phosphatase inhibitor activity molecular function nucleotide-excision repair biological process acetylgalactosaminyltrans ferase activity molecular function regulation of muscle cell differentiation biological process endoribonuclease activity, producing 5'- phosphomonoesters molecular function

152 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 5'- phosphomonoesters molecular function oxidoreductase activity, acting on the CH-CH of donors, NAD or NADP as acceptor molecular function protein catabolic process biological process ribonuclease activity molecular function carboxylic acid biosynthetic process biological process protein targeting to membrane biological process membrane protein ectodomain proteolysis biological process membrane protein proteolysis biological process NuA4 histone acetyltransferase cellular component H4/H2A histone acetyltransferase cellular component amino acid binding molecular function protein serine/threonine kinase inhibitor activity molecular function regulation of apoptosis biological process extracellular matrix part cellular component molecular adaptor activity molecular function identical protein binding molecular function macromolecular complex subunit organization biological process response to drug biological process binding molecular function assembly biological process cell migration biological process p53 binding molecular function phosphatase inhibitor activity molecular function heterophilic cell adhesion biological process epithelial cell proliferation biological process exonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 5'- phosphomonoesters molecular function transcription factor TFTC complex cellular component germ cell development biological process DNA damage response, signal transduction by p53 class mediator biological process NLS-bearing substrate import into nucleus biological process regulation of receptormediated endocytosis biological process pyridine nucleotide metabolic process biological process nicotinamide nucleotide metabolic process biological process binding molecular function regulation of protein kinase B signaling biological process

153 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value amine binding molecular function nucleoplasm part cellular component helicase activity molecular function cytokine activity molecular function response to bacterium biological process regulation of molecular function biological process cell cycle arrest biological process B cell differentiation biological process O-acyltransferase activity molecular function protein amino acid O- linked glycosylation biological process G2/M transition of mitotic cell cycle biological process protein modification biological process DNA repair biological process phospholipase A2 activity molecular function voltage-gated sodium channel activity molecular function enzyme regulator activity molecular function protein transport biological process response to light stimulus biological process DNA metabolic process biological process cellular biopolymer catabolic process biological process regulation of protein metabolic process biological process GTP binding molecular function protein ubiquitination biological process activation of caspase activity biological process chemokine activity molecular function regulation of pathwayrestricted SMAD protein phosphorylation biological process mast cell proliferation biological process lymphocyte activation biological process taste receptor activity molecular function histone methyltransferase complex cellular component process biological process SH2 domain binding molecular function RNA polymerase II transcription mediator activity molecular function activation of phospholipase C activity biological process phospholipase C activity biological process spliceosome assembly biological process nuclear export biological process cornified envelope cellular component regulation of catalytic activity biological process guanyl ribonucleotide binding molecular function cysteine-type endopeptidase activity molecular function cell development biological process

154 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type apoptosis biological process G-protein signaling, coupled to camp nucleotide second biological process negative regulation of translation biological process double-stranded RNA binding molecular function negative regulation of specific transcription from RNA polymerase II promoter biological process exocytosis biological process signaling biological process galactosyltransferase activity molecular function glutathione transferase activity molecular function single fertilization biological process secretory granule membrane cellular component glutamate signaling pathway biological process activity molecular function response to endoplasmic reticulum stress biological process learning or memory biological process viral genome replication biological process MAPKKK cascade biological process activation of JUN kinase activity biological process aminopeptidase activity molecular function regulation of translational initiation biological process activation of adenylate cyclase activity biological process phospholipase activity biological process protein polyubiquitination biological process single-stranded RNA binding molecular function binding molecular function regulation of binding biological process activity molecular function system development biological process inflammatory response biological process RNA biosynthetic process biological process establishment of protein localization biological process nucleoside phosphate metabolic process biological process nucleotide metabolic process biological process activity molecular function anion transport biological process channel activity molecular function passive transmembrane transporter activity molecular function regulation of programmed cell death biological process regulation of viral reproduction biological process JAK-STAT cascade biological process

155 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type tyrosine phosphorylation of STAT protein biological process transcription factor TFI complex cellular component cell growth biological process cytokine receptor activity molecular function negative regulation of biological process biological process mesoderm development biological process ATP-dependent RNA helicase activity molecular function histone H4 acetylation biological process protease binding molecular function protein maturation by peptide bond cleavage biological process phospholipid binding molecular function mrna metabolic process biological process programmed cell death biological process regulation of cell death biological process protein tyrosine phosphatase activity molecular function regulation of cytokine production biological process histone acetyltransferase complex cellular component caspase activity biological process regulation of transcription, DNA- biological process protein oligomerization biological process epidermis development biological process oxidoreductase activity, acting on CH-OH of donors molecular function N-acyltransferase activity molecular function protein kinase regulator activity molecular function acetylcholine receptor activity molecular function cytoskeleton-dependent intracellular transport biological process RNA polymerase II transcription factor activity, enhancer binding molecular function B cell activation biological process negative regulation of angiogenesis biological process fertilization biological process signal sequence binding molecular function RNA-dependent ATPase activity molecular function cell motility biological process ligase activity molecular function response to stress biological process protein homodimerization activity molecular function calcium ion binding molecular function protein tyrosine kinase activity molecular function acetylcholine binding molecular function DNA helicase activity molecular function

156 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type negative regulation of MAP kinase activity biological process regulation of mast cell proliferation biological process nucleus biological process mrna transport biological process cellular macromolecular complex subunit organization biological process hydrolase activity biological process regulation of JUN kinase activity biological process JUN kinase activity biological process ligand-dependent nuclear receptor transcription coactivator activity molecular function G-protein coupled receptor activity molecular function methyltransferase activity molecular function nucleocytoplasmic transport biological process gated channel activity molecular function phosphoprotein phosphatase activity molecular function negative regulation of cellular process biological process transferase activity, transferring one-carbon s molecular function nuclear transport biological process cellular biosynthetic process biological process RNA binding molecular function drug binding molecular function negative regulation of cellular component organization biological process cell adhesion molecule binding molecular function regulation of leukocyte proliferation biological process cellular component assembly biological process ubiquitin-specific protease activity molecular function cell adhesion biological process protein modification by small protein conjugation or removal biological process cascade biological process metalloexopeptidase activity molecular function mediator complex cellular component copper ion binding molecular function regulation of behavior biological process regulation of chemotaxis biological process RNA polymerase II transcription factor molecular function protein metabolic process biological process steroid hormone receptor signaling pathway biological process

157 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value camp-mediated signaling biological process regulation of MAP kinase activity biological process embryonic development biological process monosaccharide binding molecular function small conjugating proteinspecific protease activity molecular function SAGA-type complex cellular component regulation of lipid biosynthetic process biological process JNK cascade biological process icosanoid metabolic process biological process endoplasmic reticulum lumen cellular component thyroid hormone receptor binding molecular function calcium-dependent protein binding molecular function lipase activity biological process cell surface binding molecular function response to chemical stimulus biological process RNA splicing biological process cell differentiation biological process response to hormone stimulus biological process perinuclear region of cytoplasm cellular component growth factor activity molecular function phospholipase activity molecular function glycerophospholipid biosynthetic process biological process adenylate cyclase activity biological process developmental process biological process acyltransferase activity molecular function transferase activity, transferring acyl s other than amino-acyl s molecular function regulation of response to stimulus biological process complex cellular component kinase regulator activity molecular function cation binding molecular function metal ion binding molecular function negative regulation of protein transport biological process stress-activated protein kinase signaling pathway biological process DNA replication biological process neuropeptide signaling pathway biological process protein kinase inhibitor activity molecular function regulation of protein localization biological process nucleobase, nucleoside, nucleotide and nucleic acid metabolic process biological process

158 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type transcription biological process regulation of developmental process biological process regulation of caspase activity biological process axon guidance biological process cellular component biological process binding molecular function unsaturated fatty acid metabolic process biological process nucleus biological process RNA splicing factor activity, transesterification mechanism molecular function collagen binding molecular function antigen binding molecular function spliceosomal snrnp biogenesis biological process binding molecular function ubiquitin-dependent protein catabolic process biological process intracellular receptormediated signaling biological process regulation of macromolecule metabolic biological process negative regulation of cellular protein metabolic process biological process fibroblast growth factor receptor signaling biological process sulfur metabolic process biological process RNA transport biological process establishment of RNA localization biological process amino acid transmembrane molecular function cell recognition biological process lyase activity biological process cytoplasm cellular component receptor signaling protein activity molecular function regulation of phosphate metabolic process biological process regulation of phosphorus metabolic process biological process transcription from RNA polymerase II promoter biological process ion binding molecular function modification-dependent protein catabolic process biological process unfolded protein binding molecular function extracellular structure organization biological process regulation of endopeptidase activity biological process regulation of heart contraction biological process hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds molecular function

159 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type peptidyl-tyrosine phosphorylation biological process response to unfolded protein biological process cytoplasmic vesicle membrane cellular component damaged DNA binding molecular function aminoglycan metabolic process biological process glycosaminoglycan metabolic process biological process protein targeting biological process transferase activity, transferring pentosyl molecular function regulation of transferase activity biological process development biological process response biological process NFkappaB transcription factor activity biological process neurogenesis biological process Rho protein signal transduction biological process BMP signaling pathway biological process regulation of endocytosis biological process pressure biological process chromatin organization biological process G-protein-coupled receptor binding molecular function transcription repressor activity molecular function integral to membrane cellular component organism biological process nuclear hormone receptor binding molecular function regulation of peptidase activity biological process negative regulation of cell migration biological process oxidoreductase activity, acting on the CH-CH of donors molecular function phospholipid biosynthetic process biological process cell projection part cellular component mitochondrial nucleoid cellular component regulation of metabolic process biological process intrinsic to membrane cellular component cellular response to hormone stimulus biological process electron carrier activity molecular function transferase activity, transferring acyl s molecular function defense response to bacterium biological process lipase activity molecular function regulation of vesiclemediated transport biological process induction of apoptosis by extracellular signals biological process lumen cellular component

160 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value protein processing biological process cell motion biological process regulation of primary metabolic process biological process peptide binding molecular function regulation of cell growth biological process external side of plasma membrane cellular component negative regulation of developmental process biological process regulation of cell development biological process cell-matrix adhesion biological process regulation of stressactivated protein kinase signaling pathway biological process activity biological process sodium ion transport biological process regulation of signal transduction biological process regulation of cell communication biological process induction of apoptosis biological process negative regulation of cell motion biological process protein phosphatase regulator activity molecular function phosphorus metabolic process biological process phosphate metabolic process biological process nuclear membrane cellular component lumen cellular component phosphoinositide binding molecular function specific RNA polymerase II transcription factor molecular function translation initiation factor activity molecular function activity biological process transcription corepressor activity molecular function regulation of nitrogen compound metabolic process biological process nitrogen compound metabolic process biological process magnesium ion binding molecular function hormone receptor binding molecular function oxidoreductase activity, acting on the CH-OH of donors, NAD or NADP as acceptor molecular function tissue development biological process protein serine/threonine phosphatase activity molecular function phosphatase regulator activity molecular function cytoskeleton organization biological process chromatin remodeling biological process regulation of translation biological process cytoplasmic vesicle part cellular component transcription regulator activity molecular function

161 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type central nervous system development biological process cell surface receptor linked signal transduction biological process growth factor binding molecular function specific transcription from RNA polymerase II promoter biological process regulation of peptidyltyrosine phosphorylation biological process transferase activity, transferring alkyl or aryl (other than methyl) molecular function cytoplasmic membranebounded vesicle lumen cellular component activity molecular function Golgi apparatus cellular component protein amino acid glycosylation biological process zinc ion binding molecular function steroid hormone receptor binding molecular function general RNA polymerase II transcription factor molecular function regulation of hydrolase activity biological process negative regulation of apoptosis biological process cellular developmental process biological process activity biological process complex cellular component response to cytokine stimulus biological process regulation of lymphocyte activation biological process cytosolic large ribosomal subunit cellular component mrna binding molecular function viral reproductive process biological process regulation of cellular response to stress biological process ligand-gated ion channel activity molecular function ligand-gated channel activity molecular function protein maturation biological process cell-cell adhesion biological process cell adhesion biological process cellular protein complex assembly biological process biological adhesion biological process negative regulation of programmed cell death biological process negative regulation of cell death biological process soluble fraction cellular component regulation of transforming growth factor beta receptor signaling biological process cell migration biological process anatomical structure morphogenesis biological process

162 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type small GTPase mediated signal transduction biological process synaptic transmission biological process negative regulation of cell proliferation biological process anatomical structure formation involved in morphogenesis biological process transcription factor biological process serine-type endopeptidase inhibitor molecular function cell-substrate adhesion biological process amine metabolic process biological process process biological process regulation of response to stress biological process regulation of cellular protein metabolic process biological process blood circulation biological process histone acetylation biological process protein metabolic process biological process cytoskeleton cellular component microtubule binding molecular function cytokine-mediated signaling pathway biological process cellular protein metabolic biological process MAP kinase activity biological process oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen molecular function oxidoreductase activity, acting on NADH or NADPH, quinone or similar compound as molecular function glycerolipid metabolic process biological process regulation of multicellular organismal process biological process integrin binding molecular function regulation of lipid metabolic process biological process negative regulation of cell cycle biological process process biological process female pregnancy biological process brain development biological process transferase activity, transferring sulfurcontaining s molecular function process biological process ribonucleoprotein complex biogenesis biological process cell motion biological process transcription, DNAdependent biological process macromolecular complex cellular component protein complex cellular component regulation of cell differentiation biological process

163 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type transcription activator activity molecular function chromatin modification biological process innate immune response biological process carboxylic acid transmembrane transporter activity molecular function ATPase activity, coupled to transmembrane movement of substances molecular function ribonucleoprotein complex assembly biological process phosphatase activity molecular function anatomical structure development biological process lipid binding molecular function isomerase activity molecular function regulation of protein amino acid biological process sensory perception of chemical stimulus biological process organic acid transmembrane transporter activity molecular function exopeptidase activity molecular function cellular component biogenesis biological process nucleobase, nucleoside and nucleotide metabolic process biological process intracellular cellular component transmembrane transporter activity molecular function regulation of leukocyte activation biological process protein amino acid phosphorylation biological process multi-organism process biological process regulation of protein transport biological process translation factor activity, nucleic acid binding molecular function nervous system development biological process immune response biological process fatty acid metabolic process biological process ATPase activity, coupled to movement of molecular function anti-apoptosis biological process transferase activity, transferring glycosyl molecular function kinase binding molecular function transferase activity, transferring hexosyl molecular function endosome cellular component GTPase activity molecular function sugar binding molecular function regulation of lyase activity biological process negative regulation of RNA metabolic process biological process post-translational protein modification biological process regulation of cell motion biological process

164 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type regulation of establishment of protein biological process carboxylic acid metabolic process biological process cellular ketone metabolic process biological process process biological process binding molecular function developmental process biological process guanyl-nucleotide exchange factor activity molecular function elevation of cytosolic calcium ion concentration biological process regulation of RNA metabolic process biological process protein kinase activity biological process muscle contraction biological process binding molecular function response to virus biological process activation biological process peroxisome cellular component microbody cellular component cellular carbohydrate metabolic process biological process binding molecular function regulation of protein kinase activity biological process RNA processing biological process polysaccharide binding molecular function lytic vacuole cellular component lysosome cellular component muscle system process biological process response to organic substance biological process transmembrane receptor protein serine/threonine kinase signaling pathway biological process cytosolic calcium ion homeostasis biological process ion transport biological process transcription coactivator activity molecular function monosaccharide metabolic process biological process oxidoreductase activity, acting on NADH or molecular function process biological process secretion by cell biological process mitochondrial matrix cellular component intrinsic to organelle membrane cellular component integral to organelle membrane cellular component RNA metabolic process biological process stress biological process regulation of cellular localization biological process activity molecular function GTPase activator activity molecular function transcription initiation from RNA polymerase II promoter biological process carbohydrate binding molecular function

165 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value potassium ion transport biological process transcription from RNA polymerase II promoter biological process vacuole cellular component cyclic-nucleotidemediated signaling biological process protein folding biological process voltage-gated cation channel activity molecular function visual perception biological process sensory perception of light stimulus biological process cell surface cellular component regulation of system process biological process activity molecular function process biological process structural constituent of cytoskeleton molecular function transcription initiation biological process cell communication biological process lymphocyte activation biological process transcription, DNAdependent biological process cellular protein metabolic process biological process carbohydrate metabolic process biological process immune system process biological process process biological process negative regulation of transcription, DNAdependent biological process protein kinase binding molecular function histone modification biological process RNA metabolic process biological process cytoplasmic part cellular component enzyme linked receptor protein signaling pathway biological process establishment of localization biological process protein kinase cascade biological process plasma membrane cellular component regulation of localization biological process cellular amino acid metabolic process biological process cellular amine metabolic process biological process signal transducer activity molecular function molecular transducer activity molecular function neurological system process biological process transport biological process Ras protein signal transduction biological process actin cytoskeleton organization biological process cell fraction cellular component homeostatic process biological process mitochondrion cellular component

166 Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type regulation of biological quality biological process enzyme binding molecular function membrane organization biological process cell-cell signaling biological process membrane fraction cellular component transmembrane receptor activity molecular function cell death biological process death biological process GTPase regulator activity molecular function cellular calcium ion homeostasis biological process protein complex binding molecular function calcium ion homeostasis biological process organ development biological process membrane cellular component regulation of cellular metabolic process biological process nucleosidetriphosphatase regulator molecular function process biological process intracellular protein transport biological process insoluble fraction cellular component transmembrane receptor protein tyrosine kinase signaling pathway biological process metal ion transport biological process leukocyte activation biological process translational elongation biological process actin binding molecular function actin filament-based process biological process cognition biological process system process biological process transport biological process organ morphogenesis biological process cytosolic part cellular component multicellular organismal process biological process di-, tri-valent inorganic cation homeostasis biological process apoptosis biological process endoplasmic reticulum cellular component cell projection cellular component intrinsic to plasma membrane cellular component sensory perception biological process cation channel activity molecular function programmed cell death biological process receptor activity molecular function integral to plasma membrane cellular component establishment of localization in cell biological process regulation of transport biological process multicellular organismal development biological process metal ion transmembrane transporter activity molecular function cation homeostasis biological process cation transport biological process

167 function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value ion homeostasis biological process protein domain specific binding molecular function mitochondrial part cellular component intracellular transport biological process cation transmembrane transporter activity molecular function cellular lipid metabolic process biological process receptor binding molecular function ion transmembrane transporter activity molecular function transporter activity molecular function substrate-specific transmembrane transporter activity molecular function substrate-specific transporter activity molecular function membrane part cellular component chemical homeostasis biological process plasma membrane part cellular component 6.10E E-05

168 a Adr (µg/ml) RRM2B RRM2 RRM1 p53 MDM p21 CIP1 β-actin b shrna Adr p53 shtp53 None NS A B C c shrna Adr Cyclin E shrb1 None NS A B C p21 CIP1 CDK4 RRM2B RRM2B CDK4 p21 CIP1 β-actin β-actin Supplementary Figure S1. Acute induction of RRM2B by Adriamycin depends on p53. (a) Western blot analysis of proteins in IMR90 cells treated with various doses of Adriamycin (Adr) as indicated for 24 hours. (b, c) Western blot analysis of IMR90 cells expressing empty vector, scramble non-silencing (NS) shrna or three (b) shtp53s or (c) shrb1s. Transduced cells were treated with 0.2 µg/ml Adr for 24 hours (+) or left untreated (-) one week following retroviral infection.

169 a % SA-β-gal (+) p< EP LP b 0 EP LP 80 p< % SA-β-gal (+) Ctrl Adr c Ctrl p= Adr % SA-β-gal (+) Ctrl RAS- V12 0 Ctrl RASV12 Supplementary Figure S2. Induction of senescence in IMR90 cells. Senescence associated beta-galactosidase (SA-β-gal) activity was analyzed in (a) early passage (EP) or late passage (LP) IMR90 cells, (b) EP IMR90 cells that were treated with 0.1 µg/ml Adriamycin (Adr) for one week or left untreated (ctrl) or (c) EP IMR90 cells that were transduced with retroviruses expressing empty vector (Ctrl) or RASV12. SA-β-gal-positive cells from at least 100 cells were scored, and the values were plotted as the percentage of SA-β-gal-positive cells. The data are presented as the means±sem (n=3). Representative pictures from all samples are shown in the right panels.

170 MOI Virus p21 CIP1 Ctrl 1x 1/10 p21 CIP1 Ctrl p21 CIP1 RRM2B RRM2 RRM1 β-actin %S Supplementary Figure S3. RRM2B expression is fluenced by p21 CIP1 -induced cell cycle arrest. IMR90 cells were infected with either stock (1x) or diluted (1/10) retroviral supernatant. Four days following infection, cells expressing empty vector (Ctrl) or p21 CIP1 were harvested for immunoblotting and cell cycle analysis. Top: Western blots; bottom: percentage of cells in S phase. MOI: multiplicity of infection.

171 HMW KARATIN p µm 100 µm Supplementary Figure S4. Positive staining of cytoplasmic HMW KARATIN and nuclear p63 in the basal cell layer in PIN lesions. Immunocytochemistry for HMW KARATIN (left panel) and p63 (right panel) was performed to detect the intact basal cell layer surrounding the PIN lesion.

172 shrna - NS RRM2B-C RRM2B-C-mut RRM2B β-actin RRM2B-C RRM2B-C-mut CAGCAGAGATGAAGGACTT CAGCAGAGCGCAAGGACTT Supplementary Figure S5. Point mutations in prevent the silencing of RRM2B. IMR90 cells were infected with psuper.retro.puro retroviruses expressing empty vector (-), non-silencing (NS) shrna, -C or -C-mut. Top: Western blots, β-actin was used as a loading control; bottom: alignment of -C and -C-mut sense strand sequences. Mutated nucleotides in -C-mut are underlined.

173 a shrna +Dox (Days) - NS A B C D RRM2B β-actin b shrna Dox RRM2B RAS - NS RRM2B-D c % SA-β-gal (+) β-actin 0 DOX shrna NS NS RRM2B-D Supplementary Figure S6. Silencing of RRM2B does fluence RASV12-induced senescence. (a) Western blot analysis of RRM2B and β-actin in IMR90 cells transduced with ptripz lentiviruses expressing tetracycline-inducible non-silencing (NS) shrna, four different RRM2B shrnas or vector alone (-). Puromycin-resistant transduced cells were incubated with 1 µg/ml doxycyclin (Dox) and harvested from day 0-3. (b) Western blot analysis of RRM2B, RAS and β-actin in IMR90 cells transduced with ptripz lentiviruses expressing empty vector (-), shns or -D. Each cell strain was re-infected with retrovirus expressing RASV12. Two days following infection, cells were treated with 1 µg/ml Dox for 12 days. Immunoblotting confirmed the expression of RASV12 in all samples. Silencing of RRM2B was only detected in ptripz--d-infected cells that were treated with 1 µg/ml Dox. (c) SA-β-gal activity was measured in cultures as described in (b) (means±sem, n=3). There was no statistically significant difference between the RRM2B-silenced cells and any of the five non-silencing controls.

174 a Time (hr) RRM2B β-actin b 30 p= % SA-β-gal (+) Control H O 2 2 Supplementary Figure S7. Induction of RRM2B and senescence by transient treatment of IMR90 cells with H 2 O 2. (a) IMR90 cells were treated with 200 µm H 2 O 2 for two hours. Following treatment, cells were washed and fed with fresh media. Samples were harvested at time points up to 96 hours. Expression of RRM2B and β-actin was detected by immunoblotting. (b) SA-β-gal activity was measured five days following the transient treatment with H 2 O 2 (means±sem, n=3).

175 a shrna Dox RRM2B β-actin - NS RRM2B b 1.2 p= p= p= Relative mtdna content Dox shrna - NS RRM2B Supplementary Figure S8. Reduction of mtdna content by silencing of RRM2B. IMR90 cells were transduced with ptripz lentiviruses expressing vector alone, shns or (-C as described in Figure S6). Transduced cells were either cultured in doxycyclin (Dox) for 2 weeks (+) or left untreated (-). (a) Western blot analysis of RRM2B and the loading control β-actin. (b) Relative mtdna DNA content was quantified by comparing the level of the mitochondrial COX-1 gene relative to that of the nuclear β-globin gene using quantitative real-time PCR. The COX-1/β-GLOBIN DNA ratio in the Dox-treated samples (+) from each transduced cell strain was normalized to the ratio in the untreated controls (-) of the corresponding cell strain. The data are plotted as the means±sem (n=3).

176 a Medium DCF intensity (% of control) p= p= p= Vector RRM2B Vector RRM2B b H 2 O 2 p-p38mapk p38mapk p-mapkapk-2 MAPKAPK-2 RRM2B GAPDH Vector RRM2B Vector RRM2B H 2 O 2 + H O 2 2 Supplementary Figure S9. RRM2B overexpression suppresses ROS levels and attenuates the activation of p38mapk in response to hydrogen peroxide. (a) IMR90 cells were infected with MSCVhygro retroviruses expressing vector alone or RRM2B. One week following infection, transduced cells were treated with 400 µm H 2 O 2 for 90 minutes prior to CM-H2DCFDA staining. The DCF fluorescent intensity was analyzed by flow cytometry (means±sem, n=3). (b) Western blot analysis of proteins from the transduced IMR90 cells treated with 400 µm H 2 O 2 for 30 minutes (+) or left untreated (-).

177 150 Median DCF intensity (% of control) Adr-HU Adr+HU RASV12-HU RASV12+HU Supplementary Figure S10. Scavenging of the tyrosyl radical of RRM2B by hydroxyurea (HU) has no detectable effect on ROS levels. IMR90 cells were induced to enter senescence by chronic treatment with low dose Adriamycin (Adr, 0.1 µg/ml) or by transduction with pbabepuro retrovirus to express RASV12. One week after Adriamycin treatment or two weeks following RASV12 expression, senescent cells were incubated with HU for 18 hours before measurement of the ROS level by CM-H2DCFDA staining. The DCF fluorescent intensity was analyzed by flow cytometry (means±sem, n=3).

178 Rrm2b +/+ Rrm2b +/- Rrm2b -/- p6 p7 Supplementary Figure S11. Induction of premature senescence in Rrm2b +/- and Rrm2b -/- MEFs. A SA-β-gal activity assay was performed in MEFs with different Rrm2b genotypes at p6 and p7. The cell morphology and SA-β-gal staining of each strain were visualized by light microscopy, and representative pictures are shown.

179 a Rrm2b +/+ +/- -/- b Vector RAS C R C R C R 50 p=0.009 Rrm2b RRM1 RRM2 p19 Arf p53 * % SA-β-gal (+) p21 Cip1 Mdm2 10 p16 Ink4a p15 Ink4b β-actin 0 Vector C R C R C R Rrm2b +/+ +/- -/- Supplementary Figure S12. Acceleration of RASV12-induced premature senescence in Rrm2b +/- and Rrm2b -/- MEFs compared to their wild type counter parts. MEFs (p3) derived from three different Rrm2b genotypes as indicated were infected with retroviruses expressing either vector alone (C) or RASV12 (R). One week following retroviral infection, the cells were analyzed. (a) Western blot analysis of known senescence regulators in the transduced MEFs. *: non-specific bands; : Rrm2b-specific band. (b) SA-β-gal activity assays were performed to quantify the percentage of senescent cells (means±sem, n=3).