Supplementary Information for. RRM2B Suppresses Activation of the Oxidative Stress Pathway and is. Up-regulated by P53 During Senescence

Supplementary Information for RRM2B Suppresses Activation of the Oxidative Stress Pathway and is Up-regulated by P53 During Senescence Mei-Ling Kuo 1,**, Alexander J. Sy 1, Lijun Xue 1, Martin Chi 1, Michelle T.-C. Lee 1, Terence Yen 1, Mei-Iok Chiang 1, Lufen Chang 1, Peiguo Chu 2 & Yun Yen 1,* 1 Department of Molecular Pharmacology, Beckman Research Institute, City of Hope, Duarte, CA 91010, USA. 2 Department of Pathology, City of Hope, Duarte, CA 91010, USA. * Corresponding Author: Yun Yen, M.D., Ph.D. 1500 E. Duarte Rd., Duarte, CA 91010, USA Tel: (626) 256-4673, ext. 65707 yyen@coh.org ** Co-Corresponding Author: Mei-Ling Kuo, Ph.D. 1500 E. Duarte Rd., Duarte, CA 91010, USA Tel: (626) 256-4673, ext. 63775 mkuo@coh.org

Supplementary Materials and Methods Generation of tetracycline-inducible in the ptripz lentiviral vector and the pmscvhyg-rrm2b retroviral expression vector. Sense and antisense oligonucleotide pairs were designed to generate shrnas that target four different regions of RRM2B. Polymerase chain reactions (PCR) were performed using common forward and reverse primers. The 50-µl PCR mixture contained 10 pmol of each sense and antisense oligonucleotide, 0.5 pmol of each common forward primer and reverse primer, 200 μm of each dntp, 0.5 μl of Pfu Turbo and 1x Pfu buffer (20 mm Tris-HCl ph 8.8, 2 mm MgSO 4, 100 mm KCl, 10 mm (NH 4 ) 2 SO 4, 0.1% Triton X-100). PCR was performed using the following program: 94 C for 30 sec, 25 cycles at 94 C for 30 sec, 54 C for 30 sec and 72 C for 1 min and the ends were extended at 72 C for 10 min. The PCR products were digested with EcoRI and XhoI and then inserted to the ptripz vector (Thermo Fisher Scientific, Huntsville, AL, USA). ptripz-shns was purchased from Thermo Fisher Scientific. The oligonucleotide sequences are listed in Table S1. pmscvhyg (Clontech, Mountain View, CA, USA) was first modified by inserting annealed oligonucleotides (5 -gatctgcggccgcggatccagtgtggtggtacgtac and 5 -tcg agtacgtaccaccacactggatccgcggccgca) between the BglII and XhoI 2

sites to introduce more cloning sites. RRM2B cdna was synthesized by PCR and inserted into the BamHI and XhoI sites in the modified MSCVhyg vector. The PCR primer sequences are listed in Table S1. Lentiviral production and transduction. ptripz lentiviruses were produced as described 1. IMR90 cells were transduced with ptripz lentiviruses expressing vector, shns or -A, -B, -C and D. Infected cells were selected with puromycin (2 μg/ml) 2 days following infection for additional two days. Puromycin-resistant cells were treated with doxycyclin (1μg/ml) to induce the expression of shrna before analysis. For sequential infection, ptripz-transduced cells were reseeded and infected with the pmscvhyg retrovirus. Two days following the second infection, the cells were selected with 100 μg/ml hygromycin. Cell cycle analysis. Cells were harvested by trypsinization, collected by centrifugation and washed with PBS. Cells were then suspended in staining solution containing 0.05 mg/ml propidium iodide, 0.1 % (w/v) sodium citrate and 0.1 % (v/v) Triton X-100 followed by RNAse A digestion (2 μg/ml) at room temperature for 30 minutes and analyzed by flow cytometry. The percentage 3

of cells in each phase was analyzed by ModFit LT TM (Verity Software House, Inc, Topsham, ME, USA). Antibodies. Antibodies against HMW KARATIN (Dako corporation, Carpinteria, CA, USA) and p63 (Zeta Corporation, Sierra Madre, CA, USA) were used for IHC analysis of human prostate tissue samples. An antibody against Phospho-MAPKAPK-2 (T334) for Western blot analysis was purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Mitochondrial DNA (mtdna) content analysis. This procedure was performed as described previously 2. The levels of the mitochondrial COX-1 gene and nuclear β-globin gene were quantified by qpcr. The relative COX-1 DNA content was calculated from the ratio of the level of the COX-1 to that of the β-globin gene. Microarray and bioinformatics analysis. IMR90 cells were infected with psuper.retro.puro- or -mut, selected with puromycin for two days and allowed to culture for 3 weeks. Total RNA from the infected IMR90 cells was isolated using TRIzol reagent (Invitrogen). The Affymetrix 4

GeneChip Human Gene 1.0 ST Array (Affymetrix, Santa Clara, CA, USA) was used to detect the expression profiles of the samples. cdna synthesis, crna labeling, hybridization and the scanning of the GeneChips were performed by the Microarray Core at City of Hope according to the manufacturer s protocol. Microarray samples were RMA normalized 3 using Partek Genomics Suite TM (Version 6.6, revision 6.11.1114; Partek, Inc., St. Louis, MO, USA), and genes were defined as differentially expressed if they showed at least a 1.5-fold change ( -mut). For system-level analysis, Gene Ontology (GO) 4 enrichment was carried on the lists of the up- and down-regulated genes using Partek Genomics Suite TM. Statistical significance for GO enrichment was determined using Fisher s exact test. Supplementary References 46. Nguyen, H.V. et al. SUMOylation attenuates sensitivity toward hypoxiaor desferroxamine-induced injury by modulating adaptive responses in salivary epithelial cells. Am. J. Pathol. 168, 1452-1463 (2006). 47. Wang, X. et al. Ribonucleotide reductase subunit p53r2 regulates mitochondria homeostasis and function in KB and PC-3 cancer cells. Biochem. Biophys. Res. Commun. 410, 102-107 (2011). 48. Irizarry, R.A. et al. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4, 249-264 (2003). 49. Ashburner, M. et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 25, 25-29 (2000). 5

Supplementary Table S1. Oligo sequences for generation of shrna and synthesis of RRM2B cdna. Vector Oligo Sequence psuper. retro.puro -A sense 5 -GATCCCCCATCAGAGATCCCAAGAAATTCAAG AGATTTCTTGGGATCTCTGATGTTTTTA psuper. retro.puro -A 5 -AGCTTAAAAACATCAGAGATCCCAAGAAATCTC TTGAATTTCTTGGGATCTCTGATGGGG antisense psuper. retro.puro -B sense 5 -GATCCCCGGGAAAGAGTGGTGGCCTTTTCAA GAGAAAGGCCACCACTCTTTCCCTTTTTA psuper. retro.puro -B 5 -AGCTTAAAAAGGGAAAGAGTGGTGGCCTTTCT CTTGAAAAGGCCACCACTCTTTCCCGGG antisense psuper. retro.puro -C sense 5 -GATCCCCCAGCAGAGATGAAGGACTTTTCAAG AGAAAGTCCTTCATCTCTGCTGTTTTTA psuper. retro.puro -C 5 -AGCTTAAAAACAGCAGAGATGAAGGACTTTCT CTTGAAAAGTCCTTCATCTCTGCTGGGG antisense psuper. retro.puro -C-mut 5 -GATCCCCCAGCAGAGCGCAAGGACTTTTCAAG AGAAAGTCCTTGCGCTCTGCTGTTTTTA sense psuper. retro.puro -C-mut 5 -AGCTTAAAAACAGCAGAGCGCAAGGACTTTCT CTTGAAAAGTCCTTGCGCTCTGCTGGGG antisense psuper. retro.puro shtp53-a sense 5 -GATCCCCGAAATTTGCGTGTGGAGTATTCAAG AGATACTCCACACGCAAATTTCTTTTTA psuper. retro.puro shtp53-a antisense 5 -AGCTTAAAAAGAAATTTGCGTGTGGAGTATCTC TTGAATACTCCACACGCAAATTTCGGG psuper. retro.puro shtp53-b sense 5 -GATCCCCGCGCACAGAGGAAGAGAATTTCAAG AGAATTCTCTTCCTCTGTGCGCTTTTTA psuper. retro.puro shtp53-b antisense 5 -AGCTTAAAAAGCGCACAGAGGAAGAGAATTCT CTTGAAATTCTCTTCCTCTGTGCGCGGG psuper. retro.puro shtp53-c sense 5 -GATCCCCGCACAGAGGAAGAGAATCTTTCAAG AGAAGATTCTCTTCCTCTGTGCTTTTTA psuper. retro.puro shtp53-c antisense 5 -AGCTTAAAAAGCACAGAGGAAGAGAATCTTCT CTTGAAAGATTCTCTTCCTCTGTGCGGG psuper. shrb1-a 5 -GATCCCCGCTCAAAGAACCATATAAATTCAAGA

retro.puro sense GATTTATATGGTTCTTTGAGCTTTTTA psuper. retro.puro shrb1-a antisense 5 -AGCTTAAAAAGCTCAAAGAACCATATAAATCTC TTGAATTTATATGGTTCTTTGAGCGGG psuper. retro.puro shrb1-b sense 5 -GATCCCCGAACAGGAGTGCACGGATATTCAAG AGATATCCGTGCACTCCTGTTCTTTTTA psuper. retro.puro shrb1-b antisense 5 -AGCTTAAAAAGAACAGGAGTGCACGGATATCT CTTGAATATCCGTGCACTCCTGTTCGGG psuper. retro.puro shrb1-c sense 5 -GATCCCCTGTAAGATCTCCAAAGAAATTCAAGA GATTTCTTTGGAGATCTTACATTTTTA psuper. retro.puro shrb1-c antisense 5 -AGCTTAAAAATGTAAGATCTCCAAAGAAATCTC TTGAATTTCTTTGGAGATCTTACAGGG psuper. retro.puro shns sense 5 -GATCCCCCATGCCTGATCCGCTAGTCTTCAAG AGAGACTAGCGGATCAGGCATGTTTTTA psuper. retro.puro shns antisense 5 -AGCTTAAAAACATGCCTGATCCGCTAGTCTCTC TTGAAGACTAGCGGATCAGGCATGGGG ptripz -A sense 5 -TGCTGTTGACAGTGAGCGCTACATCAGAGATC CCAAGAAATAGTGAAGCCACAGATGTA ptripz -A antisense 5 ATTCCGAGGCAGTAGGCATTACATCAGAGATCC CAAGAAATACATCTGTGGCTTCACTA ptripz -B sense 5 TGCTGTTGACAGTGAGCGCTGGGGAAAGAGTG GTGGCCTTTAGTGAAGCCACAGATGTA ptripz -B anti sense 5 ATTCCGAGGCAGTAGGCATTGGGGAAAGAGTG GTGGCCTTTACATCTGTGGCTTCACTA ptripz -C sense 5 TGCTGTTGACAGTGAGCGAATCAGCAGAGATG AAGGACTTTAGTGAAGCCACAGATGTA ptripz -C antisense 5 ATTCCGAGGCAGTAGGCACATCAGCAGAGATG AAGGACTTTACATCTGTGGCTTCACTA ptripz -D sense 5 TGCTGTTGACAGTGAGCGCCAGAAGAAAGGGT CAGGGAGATAGTGAAGCCACAGATGTA ptripz -D antisense 5 ATTCCGAGGCAGTAGGCATCAGAAGAAAGGGT CAGGGAGATACATCTGTGGCTTCACTA ptripz Common forward primer 5 -CAGAAGGCTCGAGAAGGTATATTGCTGTTGAC AGTGAGCG

ptripz pmscv hyg pmscv hyg Common reverse primer RRM2B forward primer RRM2B reverse primer 5 -CTAAAGTAGCCCCTTGAATTCCGAGGCAGTAG GCA AAAGGATCCGCCACCATGGGCGACCCGGAAAGG CC AAAACTCGAGTTAAAAATCTGCATCCAAGGTGAA GACG

Supplementary Table S2. Primer sequences for q-rt-pcr. Gene Sequence RRM2B sense 5 -CCTTGCGATGGATAGCAGATAG RRM2B antisense 5 -GCCAGAATATAG CAGCAA AAGATC GAPDH sense 5 -GGGAAGGTGAGTCGGAGTC GAPDH antisense GATGGCAACAATATCCACTTTACC β-actin sense AGAGATGGCCACGGCTGCTT β-actin antisense GCCACAGGACTCCATGCCCA

Supplementary Table S3. List of up-regulated genes by silencing of RRM2B in IMR90 cells. Ratio(sh Column # Transcript RRM2B Change(shR RM2B shrrm2 mut) B-mut) 4108 7896630 --- --- 7.03215 7.03215 25645 NM_006727 // CDH10 // cadherin 10, type 2 (T2-8111255 cadherin) // 5p14-p13 // CDH10 NM_006727 5.55086 5.55086 1008 /// ENST000 2630 7895142 --- --- 5.3297 5.3297 3711 7896229 --- --- 4.21041 4.21041 2849 7895361 --- --- 3.4519 3.4519 1117 7893615 --- --- 3.45008 3.45008 3787 7896305 --- --- 3.37453 3.37453 234 7892730 --- --- 3.15277 3.15277 637 7893135 --- --- 3.15223 3.15223 1589 7894090 --- --- 3.08442 3.08442 1512 7894013 --- --- 3.04407 3.04407 2209 7894718 --- --- 3.04129 3.04129 2359 7894870 --- --- 2.97918 2.97918 2438 7894949 --- --- 2.92314 2.92314 2936 7895449 --- --- 2.89811 2.89811 30594 NR_024168 // TLR4 // toll-like receptor 4 // 8157524 9q32-q33 // 7099 /// TLR4 NR_024168 2.80197 2.80197 NM 138554 // TLR4 // 820 7893318 --- --- 2.79335 2.79335 1505 7894006 --- --- 2.77805 2.77805 24467 8099922 --- --- 2.73658 2.73658 153 7892649 --- --- 2.7331 2.7331 13716 7991501 --- --- 2.70491 2.70491 3470 7895986 --- --- 2.61095 2.61095 32781 NR_001574 // RBMY2EP // RNA binding motif 8177277 protein, Y-linked, family RBMY2EP NR_001574 2.56581 2.56581 2, member E pseudog 17633 NM_001145014 // RFPL4A // ret finger 8031573 protein-like 4A // RFPL4A NM_001145014 2.55876 2.55876 19q13.42 // 342931 /// 3493 7896009 --- --- 2.51366 2.51366 28006 NR_002955 // SNORA14A // small 8133688 nucleolar RNA, H/ACA SNORA14A NR_002955 2.50171 2.50171 box 14A // 7q11.23 // 17632 NM_001145014 // RFPL4A // ret finger 8031570 protein-like 4A // RFPL4A NM_001145014 2.48866 2.48866 19q13.42 // 342931 /// 2596 7895108 --- --- 2.46176 2.46176 1724 7894227 --- --- 2.44163 2.44163

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 71 7892566 --- --- 2.44076 2.44076 57 7892552 --- --- 2.43018 2.43018 2239 7894749 --- --- 2.42296 2.42296 4042 7896564 --- --- 2.41638 2.41638 16575 8021169 NM_006033 // LIPG // lipase, endothelial // 18q21.1 // 9388 /// ENST00000261292 // LIPG NM_006033 2.39579 2.39579 3120 7895633 --- --- 2.38413 2.38413 4107 7896629 --- --- 2.36211 2.36211 2242 7894752 --- --- 2.36107 2.36107 3271 7895785 --- --- 2.34411 2.34411 4114 7896636 --- --- 2.33802 2.33802 5828 7912882 --- --- 2.3203 2.3203 18208 8037298 24073 8096301 NM_020406 // CD177 // CD177 molecule // 19q13.2 // 57126 /// ENST00000457794 // CD177 / NM_001040058 // SPP1 // secreted phosphoprotein 1 // 4q21-q25 // 6696 /// CD177 NM_020406 2.30995 2.30995 SPP1 NM_001040058 2.30817 2.30817 1168 7893666 --- --- 2.25652 2.25652 12423 7978626 --- --- 2.24065 2.24065 2225 7894735 --- --- 2.23851 2.23851 10664 7960919 NM_003480 // MFAP5 // microfibrillar associated protein 5 // 12p13.1- p12.3 // 8076 /// MFAP5 NM_003480 2.2374 2.2374 396 7892892 --- --- 2.22956 2.22956 4005 7896524 --- --- 2.21905 2.21905 1705 7894208 --- --- 2.21158 2.21158 2547 7895058 --- --- 2.20625 2.20625 7996 7934979 NM_014391 // ANKRD1 // ankyrin repeat domain 1 (cardiac muscle) // 10q23.31 // 27063 // ANKRD1 NM_014391 2.19076 2.19076 4088 7896610 --- --- 2.17841 2.17841 12748 7981779 --- --- 2.17783 2.17783 3944 7896463 --- --- 2.17349 2.17349 3766 7896284 --- --- 2.15056 2.15056 2947 7895460 --- --- 2.14625 2.14625 12834 7982084 NR_003303 // SNORD115-11 // small nucleolar RNA, C/D box 115-11 // 15q11.2 // SNORD115-11 NR_003303 2.13119 2.13119 1600 7894101 --- --- 2.12522 2.12522

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 2160 7894667 --- --- 2.12393 2.12393 10780 7962137 --- --- 2.12119 2.12119 1902 7894407 --- --- 2.12005 2.12005 28611 8139488 NM_001013398 // IGFBP3 // insulin-like growth factor binding protein 3 // 7p13-p12 // 3 IGFBP3 NM_001013398 2.11964 2.11964 3587 7896105 --- --- 2.11363 2.11363 935 7893433 --- --- 2.11326 2.11326 327 7892823 --- --- 2.10348 2.10348 32312 8173600 NM_021963 // NAP1L2 // nucleosome assembly protein 1-like 2 // Xq13 // 4674 /// ENST000 NAP1L2 NM_021963 2.10294 2.10294 1919 7894425 --- --- 2.09884 2.09884 986 7893484 --- --- 2.09358 2.09358 3461 7895977 --- --- 2.08321 2.08321 830 7893328 --- --- 2.08077 2.08077 26872 8122724 NM_025218 // ULBP1 // UL16 binding protein 1 // 6q25 // 80329 /// ENST00000229708 // UL ULBP1 NM_025218 2.07843 2.07843 3377 7895891 --- --- 2.07751 2.07751 399 7892895 --- --- 2.0748 2.0748 3189 7895702 --- --- 2.07198 2.07198 2048 7894554 --- --- 2.06773 2.06773 524 7893021 --- --- 2.06602 2.06602 1010 7893508 --- --- 2.0636 2.0636 16625 8021623 NM_003784 // SERPINB7 // serpin peptidase inhibitor, clade B (ovalbumin), member 7 SERPINB7 NM_003784 2.06193 2.06193 29689 8149281 --- --- 2.03842 2.03842 4029 7896550 --- --- 2.03265 2.03265 2003 7894509 --- --- 2.02755 2.02755 1578 7894079 --- --- 2.02752 2.02752 31701 8168345 NM_052957 // ACRC // acidic repeat containing // Xq13.1 // 93953 /// ENST00000373696 // ACRC NM_052957 2.02529 2.02529 1039 7893537 --- --- 2.02501 2.02501 2399 7894910 --- --- 2.0229 2.0229 975 7893473 --- --- 2.01048 2.01048 21962 8074734 AK128837 // LOC284861 // hypothetical LOC284861 // 22q11.21 LOC284861 AK128837 2.00405 2.00405

Column # Transcript 17169 8027002 NM_004864 // GDF15 // growth differentiation factor 15 // 19p13.11 // 9518 /// ENST0000 Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) GDF15 NM_004864 1.99408 1.99408 3797 7896315 --- --- 1.99001 1.99001 22848 NM_001122752 // SERPINI1 // serpin 8083779 SERPINI1 peptidase inhibitor, clade NM_001122752 1.98887 1.98887 I (neuroserpin), member 15628 8011415 NM_002561 // P2RX5 // purinergic receptor P2X, ligand-gated ion channel, 5 // 17p13.3 / P2RX5 NM_002561 1.98475 1.98475 4873 7903455 --- --- 1.98031 1.98031 13128 7985032 --- --- 1.97954 1.97954 634 7893132 --- --- 1.97886 1.97886 378 7892874 --- --- 1.97719 1.97719 24687 8101992 NM_022154 // SLC39A8 // solute carrier family 39 (zinc transporter), member 8 // 4q22-q SLC39A8 NM_022154 1.97048 1.97048 3598 7896116 --- --- 1.96617 1.96617 3835 7896353 --- --- 1.95767 1.95767 2325 7894835 --- --- 1.95035 1.95035 2109 7894616 --- --- 1.94614 1.94614 1098 7893596 --- --- 1.94569 1.94569 22240 8077366 NM_020873 // LRRN1 // leucine rich repeat neuronal 1 // 3p26.2 // 57633 /// ENST0000031 LRRN1 NM_020873 1.94397 1.94397 2308 7894818 --- --- 1.94287 1.94287 27759 NM_014399 // TSPAN13 // tetraspanin 13 // 8131600 7p21.1 // 27075 /// ENST00000262067 // TSPAN1 TSPAN13 NM_014399 1.93983 1.93983 2754 7895266 --- --- 1.93502 1.93502 12833 NR_003353 // SNORD115-38 // small 7982082 nucleolar RNA, C/D box 115-38 // 15q11.2 // SNORD115-38 NR_003353 1.93346 1.93346 1649 7894151 --- --- 1.9293 1.9293 5656 NM_001005471 // OR2T6 // olfactory 7911276 receptor, family 2, subfamily T, member 6 // OR2T6 NM_001005471 1.92926 1.92926 1694 7894197 --- --- 1.92402 1.92402 1242 7893741 --- --- 1.92354 1.92354

Ratio(sh Column # Transcript RRM2B Change(shR RM2B shrrm2 mut) B-mut) 4056 7896578 --- --- 1.91495 1.91495 12607 7980401 --- --- 1.91298 1.91298 12817 NR_003303 // SNORD115-11 // small 7982050 nucleolar RNA, C/D box SNORD115-11 NR_003303 1.9094 1.9094 115-11 // 15q11.2 // 949 7893447 --- --- 1.90729 1.90729 3600 7896118 --- --- 1.90281 1.90281 3765 7896283 --- --- 1.89728 1.89728 1502 7894003 --- --- 1.89547 1.89547 27011 8124057 --- --- 1.88993 1.88993 20810 8063534 --- --- 1.88954 1.88954 NM_021013 // KRT34 // 15997 keratin 34 // 17q12-q21 // 8015268 KRT34 3885 /// NM_021013 1.8818 1.8818 ENST00000251648 // 31413 8165709 --- --- 1.88141 1.88141 2435 7894946 --- --- 1.87393 1.87393 311 7892807 --- --- 1.87327 1.87327 NM_001005353 // AK3L1 10785 // adenylate kinase 3-like 7962183 1 // 1p31.3 // 205 /// NM 013410 // AK AK3L1 NM_001005353 1.87143 1.87143 ENST00000414268 // FMN1 // formin 1 // 13347 7987163 15q13.3 // 342184 /// ENST00000320930 // FMN1 // FMN1 ENST00000414268 1.86584 1.86584 2587 7895099 --- --- 1.86316 1.86316 26039 8114898 --- --- 1.86208 1.86208 3873 7896391 --- --- 1.85889 1.85889 3916 7896435 --- --- 1.85758 1.85758 20579 NM_006363 // SEC23B // Sec23 homolog B (S. 8061186 cerevisiae) // 20p11.23 // SEC23B NM_006363 1.8561 1.8561 10483 /// NM 0329 745 7893243 --- --- 1.85414 1.85414 12504 NM_021136 // RTN1 // reticulon 1 // 14q23.1 // 7979455 6252 /// NM_206852 // RTN1 NM_021136 1.84798 1.84798 RTN1 // reticulon 21752 8072575 --- --- 1.84643 1.84643 22317 8078284 --- --- 1.84566 1.84566 1936 7894442 --- --- 1.84559 1.84559 26779 8121747 --- --- 1.84494 1.84494

Column # Transcript 12818 7982052 NR_022010 // PAR4 // Prader-Willi/Angelman region gene 4 // 15q11.2 // 347745 /// NR 00 Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) PAR4 NR_022010 1.84474 1.84474 2020 7894526 --- --- 1.84364 1.84364 1725 7894228 --- --- 1.84294 1.84294 31819 NM_198465 // NRK // Nik related kinase // Xq22.3 8169115 // 203447 /// ENST00000424861 // NRK / NRK NM_198465 1.84232 1.84232 2169 7894676 --- --- 1.8423 1.8423 5214 NM_021181 // SLAMF7 // SLAM family member 7 // 7906613 SLAMF7 1q23.1-q24.1 // 57823 /// NM_021181 1.83895 1.83895 ENST0000036804 541 7893038 --- --- 1.83887 1.83887 12200 NM_001085 // SERPINA3 // serpin 7976496 SERPINA3 peptidase inhibitor, clade NM_001085 1.83448 1.83448 A (alpha-1 28312 8136930 NM_177437 // TAS2R60 // taste receptor, type 2, member 60 // 7q35 // 338398 /// ENST000 TAS2R60 NM_177437 1.83219 1.83219 3645 7896163 --- --- 1.83115 1.83115 1771 7894275 --- --- 1.83044 1.83044 12806 NR_003303 // SNORD115-11 // small 7982028 nucleolar RNA, C/D box 115-11 // 15q11.2 // SNORD115-11 NR_003303 1.82927 1.82927 12821 7982058 12824 7982064 12831 7982078 12838 7982092 NR_003343 // SNORD115-26 // small nucleolar RNA, C/D box 115-26 // 15q11.2 // NR_003303 // SNORD115-11 // small nucleolar RNA, C/D box 115-11 // 15q11.2 // NR_003303 // SNORD115-11 // small nucleolar RNA, C/D box 115-11 // 15q11.2 // NR_003303 // SNORD115-11 // small nucleolar RNA, C/D box 115-11 // 15q11.2 // SNORD115-26 NR_003343 1.82927 1.82927 SNORD115-11 NR_003303 1.82927 1.82927 SNORD115-11 NR_003303 1.82927 1.82927 SNORD115-11 NR_003303 1.82927 1.82927 939 7893437 --- --- 1.823 1.823

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 17344 NM_013268 // LGALS13 // lectin, galactosidebinding, soluble, 13 // 8028737 19q13.1 // 29124 // LGALS13 NM_013268 1.81802 1.81802 ENST00000456165 // 10305 PRO2268 // hypothetical 7956987 protein PRO2268 // 12q14.3 // 55390 PRO2268 ENST00000456165 1.81089 1.81089 1822 7894326 --- --- 1.80828 1.80828 18204 NM_031246 // PSG2 // pregnancy specific beta- 8037267 1-glycoprotein 2 // 19q13.1-q13.2 // 5670 PSG2 NM_031246 1.80772 1.80772 12800 7982016 12804 7982024 12807 7982030 16531 8020717 NR_003304 // SNORD115-12 // small nucleolar RNA, C/D box 115-12 // 15q11.2 // NR_003304 // SNORD115-12 // small nucleolar RNA, C/D box 115-12 // 15q11.2 // NR_003304 // SNORD115-12 // small nucleolar RNA, C/D box 115-12 // 15q11.2 // AK055069 // C18orf16 // chromosome 18 open reading frame 16 // 18q11.2 // 147429 SNORD115-12 NR_003304 1.80673 1.80673 SNORD115-12 NR_003304 1.80673 1.80673 SNORD115-12 NR_003304 1.80673 1.80673 C18orf16 AK055069 1.80477 1.80477 100 7892595 --- --- 1.80333 1.80333 4182 7896704 --- --- 1.80208 1.80208 942 7893440 --- --- 1.80031 1.80031 40 7892534 --- --- 1.79806 1.79806 2134 7894641 --- --- 1.7939 1.7939 7060 7925607 --- --- 1.79347 1.79347 3479 7895995 --- --- 1.78905 1.78905 12837 7982090 NR_003357 // SNORD115-42 // small nucleolar RNA, C/D box 115-42 // 15q11.2 // SNORD115-42 NR_003357 1.78312 1.78312 21273 8068014 --- --- 1.78051 1.78051 32347 8173928 --- --- 1.77875 1.77875 16723 8022506 --- --- 1.77479 1.77479 3230 7895743 --- --- 1.77453 1.77453 1873 7894378 --- --- 1.7734 1.7734

Column # Transcript 32322 8173647 NM_144969 // ZDHHC15 // zinc finger, DHHC-type containing 15 // Xq13.3 // 158866 /// NM Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) ZDHHC15 NM_144969 1.77311 1.77311 13616 7990652 --- --- 1.77303 1.77303 564 7893062 --- --- 1.77224 1.77224 5376 NM_021023 // CFHR3 // complement factor H- 7908481 CFHR3 related 3 // 1q32 // 10878 NM_021023 1.77039 1.77039 /// ENST0000036742 32996 8179322 NM_005345 // HSPA1A // heat shock 70kDa protein 1A // 6p21.3 // 3303 /// BC002453 // HS HSPA1A NM_005345 1.76905 1.76905 30127 8153041 --- --- 1.76709 1.76709 32015 NM_020061 // OPN1LW // opsin 1 (cone 8170811 pigments), long-wavesensitive // Xq28 // 5956 OPN1LW NM_020061 1.7668 1.7668 27092 8124604 --- --- 1.76405 1.76405 26439 NM_005345 // HSPA1A // heat shock 70kDa 8118310 protein 1A // 6p21.3 // 3303 /// BC002453 // HS HSPA1A NM_005345 1.7635 1.7635 9553 7949742 --- --- 1.76308 1.76308 22998 AK128398 // LOC440944 // hypothetical 8085193 LOC440944 // 3p25.3 // 440944 /// LOC440944 AK128398 1.76221 1.76221 238 7892734 --- --- 1.76203 1.76203 12815 NR_003312 // SNORD115-20 // small 7982046 nucleolar RNA, C/D box 115-20 // 15q11.2 // SNORD115-20 NR_003312 1.76106 1.76106 297 7892793 --- --- 1.76054 1.76054 5605 7910948 --- --- 1.76009 1.76009 15988 NM_033059 // KRTAP4-11 // keratin associated 8015230 protein 4-11 // 17q21.2 // 653240 /// ENST KRTAP4-11 NM_033059 1.75548 1.75548 11839 7972977 --- --- 1.75477 1.75477 15985 NM_031960 // KRTAP4-8 // keratin associated 8015218 protein 4-8 // 17q21.2 // 728224 /// NM 033 KRTAP4-8 NM_031960 1.75417 1.75417

Column # Transcript 12801 7982018 NR_003298 // SNORD115-6 // small nucleolar RNA, C/D box 115-6 // 15q11.2 // Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) SNORD115-6 NR_003298 1.75331 1.75331 27510 8129069 --- --- 1.75217 1.75217 2354 7894865 --- --- 1.75154 1.75154 355 7892851 --- --- 1.74627 1.74627 12976 7983478 31509 8166593 NM_032413 // C15orf48 // chromosome 15 open reading frame 48 // 15q21.1 // 84419 /// NM NM_014271 // IL1RAPL1 // interleukin 1 receptor accessory protein-like 1 // Xp22.1-p21. C15orf48 NM_032413 1.74613 1.74613 IL1RAPL1 NM_014271 1.74579 1.74579 11692 7971642 --- --- 1.74345 1.74345 7591 NM_001030059 // PPAPDC1A // 7930980 phosphatidic acid phosphatase type 2 PPAPDC1A NM_001030059 1.74274 1.74274 1839 7894343 --- --- 1.74211 1.74211 1251 7893750 --- --- 1.74132 1.74132 13293 7986627 --- --- 1.74014 1.74014 29558 8148331 --- --- 1.73934 1.73934 29437 8147145 8503 7939971 5428 7909027 NM_152565 // ATP6V0D2 // ATPase, H+ transporting, lysosomal 38kDa, V0 NM_001005492 // OR5J2 // olfactory receptor, family 5, subfamily J, member 2 // NM_001005388 // NFASC // neurofascin homolog (chicken) // 1q32.1 // 23114 /// ATP6V0D2 NM_152565 1.73898 1.73898 OR5J2 NM_001005492 1.7367 1.7367 NFASC NM_001005388 1.73454 1.73454 2991 7895504 --- --- 1.733 1.733 32164 8172195 --- --- 1.73078 1.73078 31646 NM_207339 // PAGE2 // P antigen family, 8167866 member 2 (prostate associated) // Xp11.21 // PAGE2 NM_207339 1.72997 1.72997 2705 7895217 --- --- 1.72786 1.72786 30087 8152640 --- --- 1.72324 1.72324 24082 8096413 --- --- 1.72256 1.72256

Column # Transcript 19678 8051696 NM_001009565 // CDKL4 // cyclindependent kinase-like 4 // 2p22.1 // 344387 /// Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) CDKL4 NM_001009565 1.72228 1.72228 12935 7982955 --- --- 1.72177 1.72177 ENST00000298249 // REEP3 // receptor 7298 7927799 accessory protein 3 // 10q21.3 // 221035 /// BC018 REEP3 ENST00000298249 1.71981 1.71981 20394 8059339 --- --- 1.71943 1.71943 28801 8141146 --- --- 1.71943 1.71943 2386 7894897 --- --- 1.71695 1.71695 32069 8171248 32864 8178086 32997 8179324 26440 8118314 NM_000216 // KAL1 // Kallmann syndrome 1 sequence // Xp22.32 // 3730 /// NM_005346 // HSPA1B // heat shock 70kDa protein 1B // 6p21.3 // 3304 /// NM 005345 // H NM_005346 // HSPA1B // heat shock 70kDa protein 1B // 6p21.3 // 3304 /// NM 005345 // H NM_005346 // HSPA1B // heat shock 70kDa protein 1B // 6p21.3 // 3304 /// NM 005345 // H KAL1 NM_000216 1.71647 1.71647 HSPA1B NM_005346 1.71584 1.71584 HSPA1B NM_005346 1.71584 1.71584 HSPA1B NM_005346 1.71385 1.71385 2025 7894531 --- --- 1.71344 1.71344 3331 7895845 --- --- 1.71189 1.71189 6055 AK096139 // LOC100131756 // 7915498 hypothetical LOC100131756 // 1p34.2 // 100131756 LOC100131756 AK096139 1.70991 1.70991 149 7892645 --- --- 1.70874 1.70874 3730 7896248 --- --- 1.70871 1.70871 2434 7894945 --- --- 1.70725 1.70725 26 7892519 --- --- 1.70521 1.70521 30279 8154719 --- --- 1.70445 1.70445 9038 7945158 --- --- 1.70345 1.70345 18460 8039607 NM_006210 // PEG3 // paternally expressed 3 // 19q13.4 // 5178 /// NM 001146184 // PEG3 PEG3 NM_006210 1.70319 1.70319

Column # Transcript 7000 7925031 AK054992 // FLJ30430 // hypothetical protein FLJ30430 // 1q42.2 // 149373 Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) FLJ30430 AK054992 1.70153 1.70153 2672 7895184 --- --- 1.70144 1.70144 32343 NM_004538 // NAP1L3 // nucleosome assembly 8173917 NAP1L3 protein 1-like 3 // Xq21.3- NM_004538 1.69528 1.69528 q22 // 4675 /// E 259 7892755 --- --- 1.69187 1.69187 14477 NM_001192 // TNFRSF17 // tumor 7999547 necrosis factor receptor superfamily, member 17 TNFRSF17 NM_001192 1.68881 1.68881 30590 8157487 29186 8144701 NM_002581 // PAPPA // pregnancy-associated plasma protein A, pappalysin 1 // 9q33.2 // AK092544 // LOC100131581 // hypothetical LOC100131581 // 8p23.1 // 100131581 PAPPA NM_002581 1.68688 1.68688 LOC100131581 AK092544 1.68677 1.68677 3897 7896415 --- --- 1.68675 1.68675 2834 7895346 --- --- 1.68616 1.68616 20178 8056568 --- --- 1.68425 1.68425 24878 8103695 10747 7961626 8676 7941583 NM_021647 // MFAP3L // microfibrillar-associated protein 3-like // 4q32.3 // 9848 /// N NM_134431 // SLCO1A2 // solute carrier organic anion transporter family, member 1A2 // NM_030981 // RAB1B // RAB1B, member RAS oncogene family // 11q12 // 81876 /// ENST00000 MFAP3L NM_021647 1.684 1.684 SLCO1A2 NM_134431 1.6813 1.6813 RAB1B NM_030981 1.68098 1.68098 1027 7893525 --- --- 1.6799 1.6799 30541 8157018 --- --- 1.67987 1.67987 31497 AY736017 // FAM48B1 // family with sequence 8166509 similarity 48, member B1 // Xp22.11 // 1001 FAM48B1 AY736017 1.67839 1.67839 32126 8171844 AY736017 // FAM48B1 // family with sequence similarity 48, member B1 // Xp22.11 // 1001 FAM48B1 AY736017 1.67839 1.67839

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 2076 7894582 --- --- 1.67837 1.67837 2060 7894566 --- --- 1.67812 1.67812 26338 8117561 --- --- 1.67783 1.67783 28544 8138948 --- --- 1.67714 1.67714 22014 8075057 --- --- 1.67567 1.67567 5881 7913694 NM_000147 // FUCA1 // fucosidase, alpha-l- 1, tissue // 1p34 // 2517 /// ENST0000037447 FUCA1 NM_000147 1.6755 1.6755 7694 7932130 --- --- 1.67541 1.67541 2272 7894782 --- --- 1.67531 1.67531 28969 8142882 --- --- 1.6699 1.6699 415 7892911 --- --- 1.66921 1.66921 7391 7928750 --- --- 1.6667 1.6667 10495 7959102 NM_014365 // HSPB8 // heat shock 22kDa protein 8 // 12q24.23 // 26353 /// HSPB8 NM_014365 1.6667 1.6667 3750 7896268 --- --- 1.66631 1.66631 15820 8013529 --- --- 1.66495 1.66495 21284 NM_020152 // C21orf7 // chromosome 21 open 8068083 reading frame 7 // 21q22.3 // 56911 /// C21orf7 NM_020152 1.66131 1.66131 27229 8126086 31925 8170135 15987 8015223 16390 8019565 12327 7977609 15986 8015221 NM_145316 // TMEM217 // transmembrane protein 217 // 6p21.2 // 221468 /// NM 001162900 NM_153834 // GPR112 // G protein-coupled receptor 112 // Xq26.3 // 139378 /// ENST00000 NM_031854 // KRTAP4-12 // keratin associated protein 4-12 // 17q12-q21 // 83755 /// NM NM_031854 // KRTAP4-12 // keratin associated protein 4-12 // 17q12-q21 // 83755 /// NM NM_001001968 // OR6S1 // olfactory receptor, family 6, subfamily S, member 1 // NM_033059 // KRTAP4-11 // keratin associated protein 4-11 // 17q21.2 // 653240 /// NM 0 TMEM217 NM_145316 1.66054 1.66054 GPR112 NM_153834 1.65981 1.65981 KRTAP4-12 NM_031854 1.65939 1.65939 KRTAP4-12 NM_031854 1.65939 1.65939 OR6S1 NM_001001968 1.65933 1.65933 KRTAP4-11 NM_033059 1.658 1.658

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 798 7893296 --- --- 1.65639 1.65639 329 7892825 --- --- 1.65587 1.65587 877 7893375 --- --- 1.65445 1.65445 7770 7932909 --- --- 1.65172 1.65172 26584 8120057 --- --- 1.65169 1.65169 10419 7958202 18462 8039635 18092 8036284 NM_018413 // CHST11 // carbohydrate (chondroitin 4) sulfotransferase 11 // 12q NM_001012729 // DUXA // double homeobox A // 19q13.43 // 503835 /// ENST00000376239 // NM_001864 // COX7A1 // cytochrome c oxidase subunit VIIa polypeptide 1 (muscle) // 19q1 CHST11 NM_018413 1.65095 1.65095 DUXA NM_001012729 1.65004 1.65004 COX7A1 NM_001864 1.64756 1.64756 2081 7894588 --- --- 1.6471 1.6471 22645 NM_017699 // ST1 // S1 transmembrane 8081710 family, member 1 // 3q13.2 // 54847 /// ST1 NM_017699 1.64611 1.64611 1224 7893723 --- --- 1.64362 1.64362 584 7893082 --- --- 1.64316 1.64316 30933 8161171 --- --- 1.64003 1.64003 3996 7896515 --- --- 1.63866 1.63866 3805 7896323 --- --- 1.63719 1.63719 3033 7895546 --- --- 1.63699 1.63699 712 7893210 --- --- 1.63678 1.63678 14929 8004219 --- --- 1.63627 1.63627 472 7892968 --- --- 1.63589 1.63589 29882 8150978 12796 7982008 12808 7982032 12811 7982038 NM_004056 // CA8 // carbonic anhydrase VIII // 8q11-q12 // 767 /// ENST00000317995 // C NR_001291 // SNORD115-1 // small nucleolar RNA, C/D box 115-1 // 15q11.2 // NR_001291 // SNORD115-1 // small nucleolar RNA, C/D box 115-1 // 15q11.2 // NR_001291 // SNORD115-1 // small nucleolar RNA, C/D box 115-1 // 15q11.2 // CA8 NM_004056 1.63555 1.63555 SNORD115-1 NR_001291 1.63439 1.63439 SNORD115-1 NR_001291 1.63439 1.63439 SNORD115-1 NR_001291 1.63439 1.63439 857 7893355 --- --- 1.63137 1.63137

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 11801 7972663 --- --- 1.6294 1.6294 5315 7907655 --- --- 1.62924 1.62924 3279 7895793 --- --- 1.62804 1.62804 5660 7911285 5269 7907092 NM_001004697 // OR2T5 // olfactory receptor, family 2, subfamily T, member 5 // NM_003953 // MPZL1 // myelin protein zero-like 1 // 1q24.2 // 9019 /// NM 024569 // MPZ OR2T5 NM_001004697 1.62799 1.62799 MPZL1 NM_003953 1.62754 1.62754 4103 7896625 --- --- 1.62696 1.62696 4875 NM_001113226 // NTNG1 // netrin G1 // 7903461 1p13.3 // 22854 /// NM 001113228 // NTNG1 NM_001113226 1.6266 1.6266 14858 8003566 12143 7975932 NM_001214 // C16orf3 // chromosome 16 open reading frame 3 // 16q24.3 // 750 /// NM_020431 // TMEM63C // transmembrane protein 63C // 14q24.3 // 57156 C16orf3 NM_001214 1.62601 1.62601 TMEM63C NM_020431 1.62322 1.62322 2024 7894530 --- --- 1.62085 1.62085 22298 8078134 --- --- 1.61969 1.61969 5246 NM_001102445 // RGS4 // regulator of G-protein 7906919 signaling 4 // 1q23.3 // 5999 /// NM 005 RGS4 NM_001102445 1.61952 1.61952 24497 8100227 --- --- 1.61893 1.61893 16626 NM_001143818 // SERPINB2 // serpin 8021635 SERPINB2 peptidase inhibitor, clade NM_001143818 1.61817 1.61817 B (ovalbumin), member 2 1065 7893563 --- --- 1.61764 1.61764 1915 7894420 --- --- 1.61627 1.61627 6546 NM_002963 // S100A7 // S100 calcium binding 7920252 S100A7 protein A7 // 1q21 // 6278 NM_002963 1.61582 1.61582 /// ENST00000368 9279 7947268 --- --- 1.61518 1.61518 2608 7895120 --- --- 1.6137 1.6137 9139 NM_001004748 // OR51A2 // olfactory 7946017 receptor, family 51, subfamily A, member 2 // OR51A2 NM_001004748 1.61107 1.61107

Column # Transcript 32277 8173299 NM_021783 // EDA2R // ectodysplasin A2 receptor // Xq12 // 60401 /// ENST00000374719 // Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) EDA2R NM_021783 1.6078 1.6078 29103 8144117 --- --- 1.60674 1.60674 3671 7896189 --- --- 1.60658 1.60658 3200 7895713 --- --- 1.6065 1.6065 24195 8097476 --- --- 1.60642 1.60642 426 7892922 --- --- 1.60596 1.60596 NM_207414 // FLJ43860 // FLJ43860 protein // 29572 8148512 8q24.3 // 389690 6853 7923516 NM_016243 // CYB5R1 // cytochrome b5 reductase 1 // 1p36.13-q41 // 51706 /// ENST000003 FLJ43860 NM_207414 1.60553 1.60553 CYB5R1 NM_016243 1.60494 1.60494 2775 7895287 --- --- 1.60465 1.60465 31212 NM_002581 // PAPPA // pregnancy-associated 8163672 plasma protein A, pappalysin 1 // 9q33.2 // PAPPA NM_002581 1.60375 1.60375 31831 8169240 NM_002764 // PRPS1 // phosphoribosyl pyrophosphate synthetase 1 // Xq21.32- PRPS1 NM_002764 1.60365 1.60365 3010 7895523 --- --- 1.60359 1.60359 15223 NM_001146041 // KRTAP4-9 // keratin 8007112 associated protein 4-9 // 17q21.2 // 100132386 /// KRTAP4-9 NM_001146041 1.60326 1.60326 24419 8099471 15224 8007115 NM_031950 // FGFBP2 // fibroblast growth factor binding protein 2 // 4p16 // 83888 /// NM_001146041 // KRTAP4-9 // keratin associated protein 4-9 // 17q21.2 // 100132386 /// FGFBP2 NM_031950 1.6029 1.6029 KRTAP4-9 NM_001146041 1.60181 1.60181 27760 8131612 --- --- 1.60002 1.60002 29278 8145774 --- --- 1.59691 1.59691 1892 7894397 --- --- 1.59673 1.59673 162 7892658 --- --- 1.59668 1.59668 6063 7915565 --- --- 1.59629 1.59629 5749 7912209 --- --- 1.59625 1.59625 11147 7966026 NM_014840 // NUAK1 // NUAK family, SNF1-like kinase, 1 // 12q23.3 // 9891 /// ENST00000 NUAK1 NM_014840 1.596 1.596

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 24860 NM_001012414 // TRIM61 // tripartite motifcontaining 61 // 4q32.3 // 8103520 391712 /// ENST00 TRIM61 NM_001012414 1.59466 1.59466 NM_001128424 // 24844 C4orf18 // chromosome 4 8103415 C4orf18 open reading frame 18 // NM_001128424 1.59453 1.59453 4q32.1 // 51313 /// NM 3808 7896326 --- --- 1.59428 1.59428 NM_139173 // NHEDC1 32757 // Na+/H+ exchanger 8177130 domain containing 1 // 4q24 // 150159 /// NM 00 NHEDC1 NM_139173 1.5936 1.5936 11276 7967544 NM_005505 // SCARB1 // scavenger receptor class B, member 1 // 12q24.31 // 949 /// NM 0 SCARB1 NM_005505 1.59296 1.59296 1675 7894178 --- --- 1.59289 1.59289 12750 NM_001005241 // OR4N4 // olfactory 7981783 receptor, family 4, subfamily N, member 4 // OR4N4 NM_001005241 1.59243 1.59243 6477 7919637 NM_003528 // HIST2H2BE // histone cluster 2, H2be // 1q21- q23 // 8349 /// HIST2H2BE NM_003528 1.59226 1.59226 3215 7895728 --- --- 1.59209 1.59209 12093 NM_003813 // ADAM21 // ADAM 7975406 ADAM21 metallopeptidase domain NM_003813 1.59206 1.59206 21 // 14q24.1 // 8747 /// 31608 8167575 NM_001127345 // GAGE12B // G antigen 12B // Xp11.23 // 729428 /// NM 001098408 // GAGE12B NM_001127345 1.59153 1.59153 1433 7893934 --- --- 1.59074 1.59074 3395 7895910 --- --- 1.58752 1.58752 5165 NM_144627 // C1orf182 // chromosome 1 open 7906154 reading frame 182 // 1q22 // 128229 /// ENST C1orf182 NM_144627 1.58699 1.58699 17361 8028950 ENST00000252909 // CYP2G1P // cytochrome P450, family 2, subfamily G, polypeptide 1 pse CYP2G1P ENST00000252909 1.58631 1.58631

Column # Transcript 22532 8080911 NM_032505 // KBTBD8 // kelch repeat and BTB (POZ) domain containing 8 // 3p14 // 84541 Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) KBTBD8 NM_032505 1.58589 1.58589 1823 7894327 --- --- 1.58538 1.58538 907 7893405 --- --- 1.58526 1.58526 1348 7893847 --- --- 1.58503 1.58503 26269 8117045 23091 8086216 21264 8067955 NM_001143942 // RBM24 // RNA binding motif protein 24 // 6p22.3 // 221662 /// NM 153020 AK127051 // ACAA1 // acetyl-coenzyme A acyltransferase 1 // 3p23- p22 // 30 NM_001338 // CXADR // coxsackie virus and adenovirus receptor // 21q21.1 // 1525 /// EN RBM24 NM_001143942 1.58434 1.58434 ACAA1 AK127051 1.58331 1.58331 CXADR NM_001338 1.58268 1.58268 27349 8127362 --- --- 1.58264 1.58264 29959 NM_001010893 // SLC10A5 // solute carrier 8151559 SLC10A5 family 10 (sodium/bile NM_001010893 1.58243 1.58243 acid cotransporter fam 555 7893052 --- --- 1.58085 1.58085 1454 7893955 --- --- 1.58065 1.58065 30846 NM_002176 // IFNB1 // interferon, beta 1, 8160360 fibroblast // 9p21 // 3456 /// ENST0000038023 IFNB1 NM_002176 1.58035 1.58035 3373 7895887 --- --- 1.57933 1.57933 3920 7896439 --- --- 1.57871 1.57871 20165 NM_014900 // COBLL1 // COBL-like 1 // 2q24.3 // 8056343 22837 /// ENST00000342193 // COBLL1 // COBLL1 NM_014900 1.57835 1.57835 19266 8047172 --- --- 1.57798 1.57798 2896 7895408 --- --- 1.57788 1.57788 13675 7991153 --- --- 1.57769 1.57769 15981 8015206 15982 8015208 NM_001123387 // KRTAP2-1 // keratin associated protein 2-1 // 17q12-q21 // 81872 /// NM_001123387 // KRTAP2-1 // keratin associated protein 2-1 // 17q12-q21 // 81872 /// KRTAP2-1 NM_001123387 1.57657 1.57657 KRTAP2-1 NM_001123387 1.57657 1.57657

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 5781 NM_004753 // DHRS3 // dehydrogenase/reductas 7912537 DHRS3 e (SDR family) member 3 NM_004753 1.57648 1.57648 // 1p36.1 // 9249 / NM_021244 // RRAGD // 27431 Ras-related GTP binding 8128123 D // 6q15-q16 // 58528 /// RRAGD NM_021244 1.57581 1.57581 ENST0000036941 27039 8124329 --- --- 1.5757 1.5757 NM_024717 // MCTP1 // 25852 multiple C2 domains, 8113130 MCTP1 transmembrane 1 // 5q15 NM_024717 1.5756 1.5756 // 79772 /// NM 0010 24699 8102160 --- --- 1.57504 1.57504 527 7893024 --- --- 1.57469 1.57469 27799 8132034 --- --- 1.5744 1.5744 7773 7932960 --- --- 1.57425 1.57425 574 7893072 --- --- 1.57422 1.57422 24555 8100701 NM_182502 // TMPRSS11B // transmembrane protease, serine 11B // 4q13.2 // 132724 /// EN TMPRSS11B NM_182502 1.57413 1.57413 687 7893185 --- --- 1.57396 1.57396 10209 7955987 --- --- 1.57371 1.57371 30337 8155248 --- --- 1.57349 1.57349 14128 7995838 NM_005952 // MT1X // metallothionein 1X // 16q13 // 4501 /// ENST00000394485 // MT1X // MT1X NM_005952 1.57342 1.57342 2062 7894568 --- --- 1.57329 1.57329 2741 7895253 --- --- 1.57288 1.57288 2769 7895281 --- --- 1.57118 1.57118 25924 8113726 NM_000943 // PPIC // peptidylprolyl isomerase C (cyclophilin C) // 5q23.2 // 5480 /// E PPIC NM_000943 1.57106 1.57106 24906 8103892 --- --- 1.57098 1.57098 10598 7960355 --- --- 1.57088 1.57088 4761 7902365 --- --- 1.57028 1.57028 24550 8100655 NM_000406 // GNRHR // gonadotropin-releasing hormone receptor // 4q21.2 // 2798 /// NM GNRHR NM_000406 1.56961 1.56961 26265 8117018 --- --- 1.56938 1.56938 2194 7894703 --- --- 1.56787 1.56787

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 31930 NM_000074 // CD40LG // CD40 ligand // Xq26 // 8170187 959 /// CD40LG NM_000074 1.56779 1.56779 ENST00000370629 // 27051 NM_005323 // HIST1H1T // histone cluster 1, H1t // 8124402 6p21.3 // 3010 /// HIST1H1T NM_005323 1.56718 1.56718 ENST00000338379 / 22515 8080683 --- --- 1.56557 1.56557 21123 NM_020398 // SPINLW1 // serine peptidase 8066542 inhibitor-like, with Kunitz and WAP domains 1 SPINLW1 NM_020398 1.56509 1.56509 10248 7956279 --- --- 1.56496 1.56496 6470 AK092418 // HIST2H2BF 7919604 // histone cluster 2, H2bf HIST2H2BF AK092418 1.5649 1.5649 // 1q21.2 // 440689 1340 7893839 --- --- 1.56481 1.56481 12646 NM_001128596 // TC2N // tandem C2 domains, 7980891 nuclear // 14q32.12 // 123036 /// NM 152332 TC2N NM_001128596 1.56471 1.56471 1278 7893777 --- --- 1.56428 1.56428 7040 7925446 --- --- 1.56412 1.56412 2540 7895051 --- --- 1.56381 1.56381 25897 8113512 5633 7911207 25477 8109629 15642 8011713 NM_022140 // EPB41L4A // erythrocyte membrane protein band 4.1 like 4A // 5q22.1- NM_001001915 // OR2G2 // olfactory receptor, family 2, subfamily G, member 2 // NM_001040442 // FABP6 // fatty acid binding protein 6, ileal // 5q33.3-q34 // 2172 /// NM_022059 // CXCL16 // chemokine (C-X-C motif) ligand 16 // 17p13 // 58191 /// NM 00110 EPB41L4A NM_022140 1.56377 1.56377 OR2G2 NM_001001915 1.56354 1.56354 FABP6 NM_001040442 1.56353 1.56353 CXCL16 NM_022059 1.56247 1.56247 2233 7894743 --- --- 1.56217 1.56217 15475 NM_022036 // GPRC5C // G protein-coupled 8009639 receptor, family C, 5, member C // 17q25 GPRC5C NM_022036 1.56195 1.56195

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 11157 NM_003006 // SELPLG // selectin P ligand // 12q24 7966127 SELPLG // 6404 /// NM_003006 1.56147 1.56147 ENST00000388962 // NM_020633 // VN1R1 // 18463 vomeronasal 1 receptor 8039642 1 // 19q13.4 // 57191 /// VN1R1 NM_020633 1.5596 1.5596 ENST00000321039 2283 7894793 --- --- 1.55957 1.55957 12526 7979696 --- --- 1.55917 1.55917 9292 7947421 --- --- 1.5586 1.5586 33124 8180238 --- --- 1.5586 1.5586 12555 7979904 NM_003813 // ADAM21 // ADAM metallopeptidase domain 21 // 14q24.1 // 8747 /// ADAM21 NM_003813 1.55779 1.55779 9728 7951335 --- --- 1.55774 1.55774 1807 7894311 --- --- 1.55769 1.55769 7158 NM_201596 // CACNB2 // calcium channel, 7926506 voltage-dependent, beta 2 subunit // 10p12 // 7 CACNB2 NM_201596 1.55639 1.55639 2082 7894589 --- --- 1.5549 1.5549 26463 8118632 --- --- 1.55474 1.55474 7013 AF193050 // PP2672 // hypothetical 7925170 LOC100130249 // 1q42.3 PP2672 AF193050 1.55463 1.55463 // 100130249 /// ENST00000444 13895 7993265 NM_015914 // TXNDC11 // thioredoxin domain containing 11 // 16p13.13 // 51061 /// ENST0 TXNDC11 NM_015914 1.55456 1.55456 7459 7929536 --- --- 1.55409 1.55409 17578 8031031 --- --- 1.55409 1.55409 13159 7985257 --- --- 1.55337 1.55337 3420 7895935 --- --- 1.55326 1.55326 6670 7921667 23613 8091867 NM_001778 // CD48 // CD48 molecule // 1q21.3-q22 // 962 /// ENST00000368046 // CD48 // NM_000055 // BCHE // butyrylcholinesterase // 3q26.1-q26.2 // 590 /// ENST00000264381 / CD48 NM_001778 1.55324 1.55324 BCHE NM_000055 1.55295 1.55295 2669 7895181 --- --- 1.55289 1.55289

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 21482 NM_144659 // TCP10L // t-complex 10 (mouse)- 8069987 TCP10L like // 21q22.11 // 140290 NM_144659 1.55286 1.55286 /// BC027970 // NM_152489 // UBE2U // 4731 ubiquitin-conjugating 7901982 enzyme E2U (putative) // UBE2U NM_152489 1.55277 1.55277 1p31.3 // 148581 / 5486 NM_001017425 // KCNK2 // potassium 7909730 channel, subfamily K, member 2 // 1q41 // 3776 KCNK2 NM_001017425 1.55272 1.55272 17536 8030796 7100 7925846 29745 8149749 19854 8053406 NR_002804 // SIGLECP3 // sialic acid binding Ig-like lectin, pseudogene 3 // 19q13.3 NR_024628 // C10orf110 // chromosome 10 open reading frame 110 // 10p15.3 // 55853 /// NM_003840 // TNFRSF10D // tumor necrosis factor receptor superfamily, member NM_017750 // RETSAT // retinol saturase (alltrans-retinol 13,14- reductase) // 2p11.2 / SIGLECP3 NR_002804 1.55272 1.55272 C10orf110 NR_024628 1.55256 1.55256 TNFRSF10D NM_003840 1.55195 1.55195 RETSAT NM_017750 1.55176 1.55176 9710 7951159 --- --- 1.55102 1.55102 29631 8149065 --- --- 1.55056 1.55056 8254 7937957 --- --- 1.55008 1.55008 31405 8165692 --- --- 1.5498 1.5498 20410 8059549 --- --- 1.54949 1.54949 22740 8082767 29772 8150002 NM_023943 // TMEM108 // transmembrane protein 108 // 3q21 // 66000 /// NM 001136469 // NM_172366 // FBXO16 // F-box protein 16 // 8p21.1 // 157574 /// ENST00000380254 // FBXO TMEM108 NM_023943 1.54944 1.54944 FBXO16 NM_172366 1.54898 1.54898 31580 8167251 --- --- 1.54887 1.54887 2693 7895205 --- --- 1.54871 1.54871 26331 8117529 --- --- 1.54807 1.54807

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 30414 NM_153267 // MAMDC2 // MAM domain 8155754 containing 2 // 9q21.12 // 256691 /// MAMDC2 NM_153267 1.5476 1.5476 ENST00000321688 // OR2AP1 // olfactory 10218 7956005 receptor, family 2, subfamily AP, member 1 // 12 OR2AP1 ENST00000321688 1.54737 1.54737 2320 7894830 --- --- 1.54685 1.54685 8140 NM_015892 // CHST15 // carbohydrate (Nacetylgalactosamine 4-7936856 sulfate 6-O) sulfotransfer CHST15 NM_015892 1.54668 1.54668 7049 7925509 --- --- 1.54632 1.54632 22757 NM_012219 // MRAS // muscle RAS oncogene 8082965 homolog // 3q22.3 // 22808 /// NM 001085049 MRAS NM_012219 1.54555 1.54555 3446 7895962 --- --- 1.54438 1.54438 1463 7893964 --- --- 1.54307 1.54307 22321 8078310 --- --- 1.5429 1.5429 4317 7897964 --- --- 1.54214 1.54214 24096 8096536 --- --- 1.54119 1.54119 4777 7902493 --- --- 1.54099 1.54099 2276 7894786 --- --- 1.54007 1.54007 1249 7893748 --- --- 1.5381 1.5381 20441 8059832 NM_001001394 // DNAJB3 // DnaJ (Hsp40) homolog, subfamily B, member 3 // 2q37 // DNAJB3 NM_001001394 1.53697 1.53697 1942 7894448 --- --- 1.53688 1.53688 2972 7895485 --- --- 1.53636 1.53636 2636 7895148 --- --- 1.53575 1.53575 28159 8135361 --- --- 1.53545 1.53545 9821 7952225 --- --- 1.53514 1.53514 19997 8054798 --- --- 1.53458 1.53458 5491 7909789 NM_001135599 // TGFB2 // transforming growth factor, beta 2 // 1q41 // 7042 /// NM 0032 TGFB2 NM_001135599 1.53357 1.53357 3896 7896414 --- --- 1.53354 1.53354 2806 7895318 --- --- 1.53287 1.53287 9780 7951715 --- --- 1.5326 1.5326

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 23730 NM_001647 // APOD // apolipoprotein D // 8092970 3q26.2-qter // 347 /// APOD NM_001647 1.53234 1.53234 ENST00000343267 // APOD 26375 NM_001005216 // OR2J3 // olfactory 8117718 receptor, family 2, OR2J3 NM_001005216 1.53154 1.53154 subfamily J, member 3 // 16814 8023375 --- --- 1.53082 1.53082 24562 NM_001074 // UGT2B7 // UDP 8100758 glucuronosyltransferase 2 family, polypeptide B7 // 4q13 // UGT2B7 NM_001074 1.53079 1.53079 7315 7927964 NM_002727 // SRGN // serglycin // 10q22.1 // 5552 /// ENST00000242465 // SRGN NM_002727 1.53017 1.53017 29646 8149146 --- --- 1.53014 1.53014 29376 NR_027378 // LOC643763 // 8146633 hypothetical LOC643763 // 8q12.3 // 643763 /// LOC643763 NR_027378 1.52862 1.52862 5011 7904923 --- --- 1.52855 1.52855 4091 7896613 --- --- 1.52789 1.52789 3476 7895992 --- --- 1.52689 1.52689 27598 8130011 --- --- 1.52684 1.52684 1935 7894441 --- --- 1.52636 1.52636 28925 8142452 22904 8084284 9929 7953211 NM_012252 // TFEC // transcription factor EC // 7q31.2 // 22797 /// NM 001018058 // TFE NM_182589 // HTR3E // 5-hydroxytryptamine (serotonin) receptor 3, family member E // 3q NM_020375 // C12orf5 // chromosome 12 open reading frame 5 // 12p13.3 // 57103 /// TFEC NM_012252 1.52581 1.52581 HTR3E NM_182589 1.5253 1.5253 C12orf5 NM_020375 1.52526 1.52526 23408 8089757 --- --- 1.52513 1.52513 5112 NM_176823 // S100A7A // S100 calcium binding 7905576 protein A7A // 1q21.3 // 338324 /// ENST00 S100A7A NM_176823 1.52473 1.52473 2517 7895028 --- --- 1.52463 1.52463 1548 7894049 --- --- 1.52366 1.52366

Ratio(sh RRM2B Change(shR RM2B shrrm2 mut) B-mut) 1395 7893895 --- --- 1.52351 1.52351 Column # Transcript 16509 8020455 NM_005257 // GATA6 // GATA binding protein 6 // 18q11.1-q11.2 // 2627 /// ENST000002692 GATA6 NM_005257 1.52317 1.52317 1640 7894142 --- --- 1.5223 1.5223 8933 NM_001680 // FXYD2 // FXYD domain containing 7944147 ion transport regulator 2 // 11q23 // 486 FXYD2 NM_001680 1.52163 1.52163 15748 8012951 NM_006382 // CDRT1 // CMT1A duplicated region transcript 1 // 17p12 // 374286 /// ENST0 CDRT1 NM_006382 1.52064 1.52064 31982 8170466 --- --- 1.52009 1.52009 29732 NM_001495 // GFRA2 // GDNF family receptor 8149629 alpha 2 // 8p21.3 // 2675 /// ENST0000030679 GFRA2 NM_001495 1.51983 1.51983 28731 8140358 NM_006072 // CCL26 // chemokine (C-C motif) ligand 26 // 7q11.23 // 10344 /// ENST00000 CCL26 NM_006072 1.51964 1.51964 4156 7896678 --- --- 1.51963 1.51963 30918 BC004406 // KIAA1539 // KIAA1539 // 9p13.3 // 8160981 80256 /// AB040972 // KIAA1539 // KIAA153 KIAA1539 BC004406 1.5195 1.5195 22942 8084766 NM_003722 // TP63 // tumor protein p63 // 3q28 // 8626 /// NM 001114978 // TP63 TP63 NM_003722 1.51939 1.51939 2700 7895212 --- --- 1.51927 1.51927 9771 NM_001885 // CRYAB // crystallin, alpha B // 7951662 11q22.3-q23.1 // 1410 /// ENST00000227251 CRYAB NM_001885 1.51899 1.51899 23752 8093166 6357 7918747 NM_025163 // PIGZ // phosphatidylinositol glycan anchor biosynthesis, class Z // BC063894 // DENND2C // DENN/MADD domain containing 2C // 1p13.2 // 163259 PIGZ NM_025163 1.51869 1.51869 DENND2C BC063894 1.518 1.518 31579 8167249 --- --- 1.518 1.518 21776 8072775 --- --- 1.51767 1.51767 24593 8101011 --- --- 1.51751 1.51751

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 26504 NM_078467 // CDKN1A // cyclin-dependent 8119088 kinase inhibitor 1A (p21, CDKN1A NM_078467 1.5175 1.5175 Cip1) // 6p21.2 // 10 4755 NM_001902 // CTH // cystathionase 7902290 (cystathionine gammalyase) CTH NM_001902 1.51744 1.51744 // 1p31.1 // 1491 /// NM 31833 NM_012216 // M2 // midline 2 // Xq22.3 // 8169249 11043 /// NM_052817 // M2 // midline 2 // M2 NM_012216 1.51629 1.51629 26278 8117126 --- --- 1.5156 1.5156 16688 8022275 --- --- 1.51482 1.51482 3166 7895679 --- --- 1.51372 1.51372 31750 8168622 NM_019117 // KLHL4 // kelch-like 4 (Drosophila) // Xq21.3 // 56062 /// NM 057162 // KLH KLHL4 NM_019117 1.51303 1.51303 1851 7894356 --- --- 1.51285 1.51285 15616 NM_002548 // OR1D2 // olfactory receptor, family 8011322 1, subfamily D, member 2 // 17p13-p12 OR1D2 NM_002548 1.51267 1.51267 22490 8080168 8714 7942007 15511 8010061 31150 8162936 NM_000666 // ACY1 // aminoacylase 1 // 3p21.1 // 95 /// ENST00000404366 // NM_002335 // LRP5 // low density lipoprotein receptor-related protein 5 // 11q13.4 // 4 NM_182965 // SPHK1 // sphingosine kinase 1 // 17q25.2 // 8877 /// NM 021972 // SPHK1 // NM_001004481 // OR13C2 // olfactory receptor, family 13, subfamily C, member 2 // ACY1 NM_000666 1.5125 1.5125 LRP5 NM_002335 1.51218 1.51218 SPHK1 NM_182965 1.51146 1.51146 OR13C2 NM_001004481 1.51121 1.51121 1369 7893869 --- --- 1.51117 1.51117 30015 NM_033512 // TSPYL5 // TSPY-like 5 // 8q22.1 // 8151931 85453 /// ENST00000322128 // TSPYL5 // TSPYL5 NM_033512 1.51112 1.51112 12905 7982591 --- --- 1.51043 1.51043

Column # Transcript Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) 27097 NM_030903 // OR2W1 // olfactory receptor, family 8124630 2, subfamily W, member OR2W1 NM_030903 1.51043 1.51043 1 // 6p21.33-p2 32884 NM_030903 // OR2W1 // olfactory receptor, family 8178283 2, subfamily W, member OR2W1 NM_030903 1.51043 1.51043 1 // 6p21.33-p2 33019 NM_030903 // OR2W1 // olfactory receptor, family 8179587 2, subfamily W, member 1 // 6p21.33-p2 OR2W1 NM_030903 1.51043 1.51043 19106 8045497 --- --- 1.51039 1.51039 1768 7894272 --- --- 1.51012 1.51012 31120 AY358791 // UNQ5836 // HSAL5836 // 9q22.33 // 8162664 100130916 /// ENST00000442689 // UNQ5836 UNQ5836 AY358791 1.50929 1.50929 18771 8042637 NM_001130978 // DYSF // dysferlin, limb girdle muscular dystrophy 2B (autosomal recessi DYSF NM_001130978 1.50921 1.50921 646 7893144 --- --- 1.50919 1.50919 33238 8180352 --- --- 1.50911 1.50911 2417 7894928 --- --- 1.50871 1.50871 18334 8038547 NR_002798 // NAPSB // napsin B aspartic peptidase pseudogene // 19q13.33 // 256236 /// NAPSB NR_002798 1.50821 1.50821 3737 7896255 --- --- 1.50737 1.50737 3078 7895591 --- --- 1.50704 1.50704 28215 NM_032599 // FAM71F1 // family with sequence 8135945 similarity 71, member F1 // 7q32.1 // 8469 FAM71F1 NM_032599 1.50624 1.50624 17143 8026696 --- --- 1.50565 1.50565 8363 S56770 // KCNC1 // potassium voltage-gated 7938741 channel, Shaw-related subfamily, member 1 // KCNC1 S56770 1.50494 1.50494 3777 7896295 --- --- 1.50442 1.50442 3672 7896190 --- --- 1.50257 1.50257 1801 7894305 --- --- 1.50159 1.50159 28466 8138308 --- --- 1.50157 1.50157 301 7892797 --- --- 1.50154 1.50154

Column # Transcript 11856 7973028 NM_001005503 // OR11G2 // olfactory receptor, family 11, subfamily G, member 2 // Ratio(sh RRM2B shrrm2 B-mut) Change(shR RM2B mut) OR11G2 NM_001005503 1.50111 1.50111 22155 8076382 --- --- 1.50074 1.50074 2454 7894965 --- --- 1.50058 1.50058 16600 NM_001144967 // NEDD4L // neural 8021376 NEDD4L precursor cell expressed, NM_001144967 1.50001 1.50001 developmentally down- Highlighted: Up-regulation of protein expression was demonstrated by Western blotting.

Supplementary Table S4. List of down-regulated genes by silencing of RRM2B in IMR90 cells. Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 29927 NM_007332 // TRPA1 // transient receptor 8151341 potential cation channel, TRPA1 NM_007332 0.076019-13.1545 subfamily A, member 1016 7893514 --- --- 0.144344-6.9279 6190 NM_001114120 // DEPDC1 // DEP domain 7916898 containing 1 // 1p31.2 // DEPDC1 NM_001114120 0.155018-6.45087 55635 /// NM 017779 // 1818 7894322 --- --- 0.155147-6.44549 1854 7894359 --- --- 0.155564-6.42822 1553 7894054 --- --- 0.168848-5.92248 4199 7896721 --- --- 0.172433-5.79937 3985 7896504 --- --- 0.180036-5.55444 486 7892982 --- --- 0.182493-5.47965 954 7893452 --- --- 0.182561-5.47761 12486 NM_014750 // DLGAP5 // discs, large 7979307 (Drosophila) homologassociated DLGAP5 NM_014750 0.183254-5.45689 protein 5 // 2634 7895146 --- --- 0.183993-5.435 3781 7896299 --- --- 0.18482-5.41067 7288 NM_001786 // CDC2 // cell division cycle 2, G1 7927710 to S and G2 to M // CDC2 NM_001786 0.187978-5.31976 10q21.1 // 983 /// N 1175 7893673 --- --- 0.203002-4.92607 3582 7896100 --- --- 0.204553-4.88871 21804 NM_004900 // APOBEC3B // 8073062 apolipoprotein B mrna APOBEC3B NM_004900 0.204983-4.87846 editing enzyme, catalytic 30039 NM_015713 // RRM2B // ribonucleotide reductase 8152133 M2 B (TP53 inducible) // RRM2B NM_015713 0.206396-4.84506 8q23.1 // 50484 26657 NM_003318 // TTK // TTK protein kinase // 8120838 6q13-q21 // 7272 /// TTK NM_003318 0.208166-4.80386 ENST00000369798 // 3941 7896460 --- --- 0.213154-4.69144 23050 NM_001012410 // SGOL1 // shugoshin-like 8085754 1 (S. pombe) // 3p24.3 // SGOL1 NM_001012410 0.218738-4.57169 151648 /// NM 0010124 2689 7895201 --- --- 0.219345-4.55903

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 27079 NM_003533 // HIST1H3I // histone cluster 1, H3i // 8124531 6p22-p21.3 // 8354 /// HIST1H3I NM_003533 0.221435-4.51599 BC066884 // H 15956 NM_001067 // TOP2A // topoisomerase (DNA) II 8014974 alpha 170kDa // 17q21- TOP2A NM_001067 0.225929-4.42618 q22 // 7153 /// ENST 4143 7896665 --- --- 0.226021-4.42438 878 7893376 --- --- 0.226267-4.41956 29768 NM_018492 // PBK // PDZ binding kinase // 8149955 8p21.2 // 55872 /// ENST00000301905 // PBK // PBK NM_018492 0.227535-4.39493 26314 8117395 9740 7951397 NM_003522 // HIST1H2BF // histone cluster 1, H2bf // 6p21.3 // 8343 /// BC056264 // NM_033292 // CASP1 // caspase 1, apoptosisrelated cysteine peptidase (interleukin 1, HIST1H2BF NM_003522 0.228045-4.3851 CASP1 NM_033292 0.229167-4.36362 113 7892609 --- --- 0.229931-4.34913 11694 NR_002612 // DLEU2 // deleted in lymphocytic 7971653 leukemia 2 (non-protein coding) // 13q14.3 DLEU2 NR_002612 0.2307-4.33463 2518 7895029 --- --- 0.231273-4.3239 2094 7894601 --- --- 0.231802-4.31402 3795 7896313 --- --- 0.232513-4.30084 10637 7960744 NM_001733 // C1R // complement component 1, r subcomponent // 12p13 // 715 /// C1R NM_001733 0.233373-4.28498 409 7892905 --- --- 0.234199-4.26988 994 7893492 --- --- 0.234552-4.26344 12930 NM_016359 // NUSAP1 // nucleolar and spindle 7982889 associated protein 1 // 15q15.1 // 51203 / NUSAP1 NM_016359 0.235832-4.24031 10246 7956269 --- --- 0.235892-4.23922 12919 NM_170589 // CASC5 // cancer susceptibility 7982757 candidate 5 // 15q14 // 57082 /// NM 144508 CASC5 NM_170589 0.236923-4.22078 1439 7893940 --- --- 0.239245-4.17981 1385 7893885 --- --- 0.239492-4.17551

Column # Transcript 22825 8083594 NM_002852 // PTX3 // pentraxin-related gene, rapidly induced by IL-1 beta // 3q25 // 58 Ratio(shR RM2B -mut) Change(s hrrm2b PTX3 NM_002852 0.2415-4.14078 3503 7896019 --- --- 0.246016-4.06478 1259 7893758 --- --- 0.248364-4.02635 32371 NM_021992 // TMSB15A // thymosin beta 15a // 8174189 Xq21.33-q22.3 // 11013 /// D82345 // TMSB1 TMSB15A NM_021992 0.250249-3.99601 12012 7974404 25344 8108301 27080 8124534 14634 8001133 NM_005192 // CDKN3 // cyclin-dependent kinase inhibitor 3 // 14q22 // 1033 /// NM 00113 NM_005733 // KIF20A // kinesin family member 20A // 5q31 // 10112 /// ENST00000394894 / NM_003546 // HIST1H4L // histone cluster 1, H4l // 6p22-p21.3 // 8368 /// BC069392 // H NM_024745 // SHCBP1 // SHC SH2-domain binding protein 1 // 16q11.2 // 79801 /// CDKN3 NM_005192 0.253031-3.95209 KIF20A NM_005733 0.258656-3.86614 HIST1H4L NM_003546 0.262294-3.81251 SHCBP1 NM_024745 0.262744-3.80599 1495 7893996 --- --- 0.264173-3.7854 16579 NM_001039535 // SKA1 // spindle and 8021187 kinetochore associated complex subunit 1 // SKA1 NM_001039535 0.265348-3.76864 13025 7983969 12961 7983306 26309 8117368 NM_004701 // CCNB2 // cyclin B2 // 15q22.2 // 9133 /// ENST00000288207 // NM_024908 // WDR76 // WD repeat domain 76 // 15q15.3 // 79968 /// ENST00000263795 // NM_003542 // HIST1H4C // histone cluster 1, H4c // 6p21.3 // 8364 /// BC130558 // CCNB2 NM_004701 0.266088-3.75816 WDR76 NM_024908 0.266426-3.75338 HIST1H4C NM_003542 0.266736-3.74902 289 7892785 --- --- 0.2678-3.73413 28754 NM_000601 // HGF // hepatocyte growth factor 8140556 (hepapoietin A; scatter factor) // 7q21.1 HGF NM_000601 0.269556-3.70981

Column # Transcript 26311 8117377 NM_005321 // HIST1H1E // histone cluster 1, H1e // 6p21.3 // 3008 /// Ratio(shR RM2B -mut) Change(s hrrm2b HIST1H1E NM_005321 0.270498-3.69688 2852 7895364 --- --- 0.270823-3.69245 8540 NM_198947 // FAM111B // family with sequence 7940147 similarity 111, member B // 11q12.1 // 374 FAM111B NM_198947 0.270843-3.69217 21276 8068022 NR_001458 // MIR155HG // MIR155 host gene (non-protein coding) // --- // 114614 MIR155HG NR_001458 0.271868-3.67825 2228 7894738 --- --- 0.27207-3.67553 12882 NM_014783 // ARHGAP11A // Rho 7982358 GTPase activating protein 11A // 15q13.2 // 9824 /// NM 1 ARHGAP11A NM_014783 0.273525-3.65597 25488 8109712 5247 7906930 16692 8022283 NM_001142556 // HMMR // hyaluronanmediated motility receptor (RHAMM) // NM_145697 // NUF2 // NUF2, NDC80 kinetochore complex component, homolog (S. HMMR NM_001142556 0.273601-3.65496 NUF2 NM_145697 0.27399-3.64977 17 7892510 --- --- 0.274505-3.64292 AK302764 // FAM38B // family with sequence FAM38B similarity 38, member B // AK302764 0.275012-3.63621 18p11.22 // 63895 4133 7896655 --- --- 0.275591-3.62857 24695 NM_001813 // CENPE // centromere protein E, 8102076 312kDa // 4q24-q25 // 1062 /// ENST00000265 CENPE NM_001813 0.275852-3.62513 27829 8132318 NM_018685 // ANLN // anillin, actin binding protein // 7p15-p14 // 54443 /// ENST000002 ANLN NM_018685 0.276026-3.62285 133 7892629 --- --- 0.276369-3.61835 3942 7896461 --- --- 0.277147-3.60819 27622 NM_012177 // FBXO5 // F-box protein 5 // 6q25.2 8130374 // 26271 /// NM 001142522 // FBXO5 NM_012177 0.27911-3.58282

Column # Transcript 23858 8094278 NM_022346 // NCAPG // non-smc condensin I complex, subunit G // 4p15.33 // 64151 /// NM Ratio(shR RM2B -mut) Change(s hrrm2b NCAPG NM_022346 0.282218-3.54336 3418 7895933 --- --- 0.282469-3.54021 11566 NM_145061 // SKA3 // spindle and kinetochore 7970513 associated complex subunit 3 // 13q12.11 / SKA3 NM_145061 0.283771-3.52397 4069 7896591 --- --- 0.2842-3.51865 414 7892910 --- --- 0.28422-3.51841 1552 7894053 --- --- 0.284408-3.51607 6816 7923086 13530 7989647 NM_018136 // ASPM // asp (abnormal spindle) homolog, microcephaly associated (Drosophil NM_014736 // KIAA0101 // KIAA0101 // 15q22.31 // 9768 /// NM 001029989 // ASPM NM_018136 0.284946-3.50944 KIAA0101 NM_014736 0.286448-3.49104 11739 7972016 --- --- 0.28684-3.48627 24178 NM_014264 // PLK4 // polo-like kinase 4 8097356 (Drosophila) // 4q28 // 10733 /// PLK4 NM_014264 0.286945-3.48498 2945 7895458 --- --- 0.288125-3.47072 13705 NM_003981 // PRC1 // protein regulator of 7991406 PRC1 cytokinesis 1 // 15q26.1 // NM_003981 0.288189-3.46995 9055 /// NM 19941 45 7892539 --- --- 0.288292-3.4687 NM_001017420 // ESCO2 // establishment of cohesion 1 homolog 2 ESCO2 NM_001017420 0.288347-3.46804 (S. cerevisiae) // 8p21. 29257 8145570 2537 7895048 --- --- 0.289147-3.45845 2935 7895448 --- --- 0.289826-3.45035 358 7892854 --- --- 0.29103-3.43608 2445 7894956 --- --- 0.291146-3.4347 3696 7896214 --- --- 0.292132-3.42311 28114 8134869 18532 8040223 NM_002593 // PCOLCE // procollagen C- endopeptidase enhancer // 7q22 // 5118 /// PCOLCE NM_002593 0.29216-3.42278 NM_001034 // RRM2 // ribonucleotide reductase RRM2 M2 // 2p25-p24 // 6241 /// NM_001034 0.292873-3.41445 ENST0000036056

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 1931 7894437 --- --- 0.293626-3.40569 19977 NM_004336 // BUB1 // budding uninhibited by 8054580 benzimidazoles 1 BUB1 NM_004336 0.296384-3.374 homolog (yeast) // 2q14 3538 7896056 --- --- 0.296804-3.36923 5375 NM_000186 // CFH // complement factor H // 7908459 1q32 // 3075 /// CFH NM_000186 0.298629-3.34864 NM_001014975 // CFH // comp 3933 7896452 --- --- 0.298925-3.34532 29246 NM_152562 // CDCA2 // cell division cycle 8145418 associated 2 // 8p21.2 // CDCA2 NM_152562 0.299001-3.34447 157313 /// ENST0000 3938 7896457 --- --- 0.299113-3.34322 7427 NM_016195 // KIF20B // kinesin family member 7929078 20B // 10q23.31 // 9585 KIF20B NM_016195 0.29966-3.33712 /// ENST0000026075 3826 7896344 --- --- 0.299955-3.33384 7444 NM_018131 // CEP55 // centrosomal protein 7929334 55kDa // 10q23.33 // CEP55 NM_018131 0.300296-3.33005 55165 /// NM 001127182 6067 M77840 // RNU5F // RNA, U5F small nuclear 7915592 // 1p34.1 // 26828 /// RNU5F M77840 0.300343-3.32953 M77840 // RNU5F // RNA 1450 7893951 --- --- 0.303697-3.29276 8161 NM_002417 // MKI67 // antigen identified by 7937020 monoclonal antibody Ki- MKI67 NM_002417 0.303697-3.29276 67 // 10q25-qter // 3132 7895645 --- --- 0.304223-3.28706 10394 NM_174942 // GAS2L3 // growth arrest-specific 2 7957850 like 3 // 12q23.1 // GAS2L3 NM_174942 0.306892-3.25847 283431 /// ENST000 1814 7894318 --- --- 0.308112-3.24557 NM_003537 // 27047 HIST1H3B // histone 8124388 HIST1H3B cluster 1, H3b // 6p21.3 // NM_003537 0.309517-3.23084 8358 /// BC099630 // 1776 7894280 --- --- 0.310361-3.22206

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 22837 NM_005496 // SMC4 // structural maintenance of 8083709 SMC4 chromosomes 4 // 3q26.1 NM_005496 0.313117-3.1937 // 10051 /// NM NM_001130862 // RAD51AP1 // RAD51 9930 7953218 associated protein 1 // RAD51AP1 NM_001130862 0.314464-3.18001 12p13.2-p13.1 // 10635 /// NM 5473 NM_016448 // DTL // denticleless homolog 7909568 (Drosophila) // 1q32.1- q32.2 // 51514 /// ENST DTL NM_016448 0.316889-3.15568 8801 7942832 NM_145018 // C11orf82 // chromosome 11 open reading frame 82 // 11q14.1 // 220042 /// E C11orf82 NM_145018 0.31827-3.14198 724 7893222 --- --- 0.318824-3.13653 13963 NM_005030 // PLK1 // polo-like kinase 1 7994109 (Drosophila) // 16p12.2 // 5347 /// ENST0000030 PLK1 NM_005030 0.319074-3.13406 11944 7973869 --- --- 0.319428-3.1306 3893 7896411 --- --- 0.320087-3.12415 6827 NM_014875 // KIF14 // kinesin family member 7923189 14 // 1q32.1 // 9928 /// ENST00000367350 // KIF14 NM_014875 0.320171-3.12333 3482 7895998 --- --- 0.321288-3.11247 3563 7896081 --- --- 0.321297-3.11239 19983 NM_152515 // CKAP2L // cytoskeleton associated 8054702 protein 2-like // 2q13 // 150468 /// ENS CKAP2L NM_152515 0.323772-3.08859 531 7893028 --- --- 0.324733-3.07945 27078 NM_005322 // HIST1H1B // histone 8124527 cluster 1, H1b // 6p22- p21.3 // 3009 /// HIST1H1B NM_005322 0.326787-3.06009 2958 7895471 --- --- 0.327843-3.05024 5988 AY605064 // LOC100289612 // 7914878 arsenic transactivated protein 1 // 1p34.3 // LOC100289612 AY605064 0.330441-3.02626 5485 7909708 NM_016343 // CENPF // centromere protein F, 350/400ka (mitosin) // 1q32-q41 // 1063 /// CENPF NM_016343 0.332295-3.00938

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 2960 7895473 --- --- 0.332547-3.00709 323 7892819 --- --- 0.333124-3.00188 2302 7894812 --- --- 0.333817-2.99565 10156 7955441 NM_014033 // METTL7A // methyltransferase like 7A // 12q13.12 // 25840 /// ENST00000332 METTL7A NM_014033 0.334844-2.98646 2375 7894886 --- --- 0.335622-2.97954 26348 NM_003521 // HIST1H2BM // histone 8117594 cluster 1, H2bm // 6p22- p21.3 // 8342 /// HIST1H2BM NM_003521 0.336533-2.97148 2326 7894836 --- --- 0.337046-2.96696 22414 NM_020242 // KIF15 // kinesin family member 8079237 15 // 3p21.31 // 56992 /// ENST00000326047 KIF15 NM_020242 0.337196-2.96564 1848 7894353 --- --- 0.338504-2.95417 2270 7894780 --- --- 0.342639-2.91852 20 7892513 --- --- 0.343908-2.90775 2992 7895505 --- --- 0.344152-2.90569 946 7893444 --- --- 0.344348-2.90404 214 7892710 --- --- 0.344441-2.90326 24748 8102643 19131 8045688 NM_001237 // CCNA2 // cyclin A2 // 4q25-q31 // 890 /// ENST00000274026 // NM_007115 // TNFAIP6 // tumor necrosis factor, alpha-induced protein 6 // 2q23.3 // 713 CCNA2 NM_001237 0.344732-2.9008 TNFAIP6 NM_007115 0.346201-2.88849 518 7893014 --- --- 0.347714-2.87592 1863 7894368 --- --- 0.348115-2.87261 7438 NM_004523 // KIF11 // kinesin family member 7929258 11 // 10q24.1 // 3832 /// ENST00000260731 / KIF11 NM_004523 0.348906-2.8661 2426 7894937 --- --- 0.34923-2.86344 26319 NM_003524 // HIST1H2BH // histone 8117426 cluster 1, H2bh // 6p21.3 // 8345 /// HIST1H2BH NM_003524 0.349703-2.85957 961 7893459 --- --- 0.351502-2.84493 20180 NM_020675 // SPC25 // SPC25, NDC80 8056572 kinetochore complex component, homolog (S. cerevisia SPC25 NM_020675 0.351733-2.84307

Column # Transcript 24944 8104234 NM_004237 // TRIP13 // thyroid hormone receptor interactor 13 // 5p15.33 // 9319 /// EN Ratio(shR RM2B -mut) Change(s hrrm2b TRIP13 NM_004237 0.352628-2.83585 1663 7894166 --- --- 0.354385-2.82179 91 7892586 --- --- 0.355986-2.8091 3076 7895589 --- --- 0.357185-2.79967 15837 8013671 26351 8117608 NM_006461 // SPAG5 // sperm associated antigen 5 // 17q11.2 // 10615 /// NM_003511 // HIST1H2AL // histone cluster 1, H2al // 6p22- p21.3 // 8332 /// SPAG5 NM_006461 0.35751-2.79712 HIST1H2AL NM_003511 0.357785-2.79498 2271 7894781 --- --- 0.357825-2.79467 2956 7895469 --- --- 0.359418-2.78227 1327 7893826 --- --- 0.360497-2.77395 16441 8019857 NM_006101 // NDC80 // NDC80 homolog, kinetochore complex component (S. cerevisiae) // 1 NDC80 NM_006101 0.361346-2.76743 3320 7895834 --- --- 0.361452-2.76662 3990 7896509 --- --- 0.361888-2.76329 3802 7896320 --- --- 0.362305-2.7601 32301 8173506 NM_017669 // ERCC6L // excision repair crosscomplementing rodent repair deficiency, co ERCC6L NM_017669 0.362517-2.75849 1034 7893532 --- --- 0.363108-2.754 1426 7893927 --- --- 0.363407-2.75173 25748 NM_022145 // CENPK // centromere protein K // 8112376 5p15.2-q12.3 // 64105 /// ENST00000396679 CENPK NM_022145 0.363438-2.7515 25107 8105842 28260 8136448 NM_022909 // CENPH // centromere protein H // 5p15.2 // 64946 /// ENST00000283006 // CE NM_001006630 // CHRM2 // cholinergic receptor, muscarinic 2 // 7q31-q35 // 1129 /// NM CENPH NM_022909 0.363745-2.74918 CHRM2 NM_001006630 0.364988-2.73982

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 24770 NM_019035 // PCDH18 // protocadherin 18 // 8102792 4q31 // 54510 /// ENST00000344876 // PCDH18 PCDH18 NM_019035 0.3652-2.73823 NM_001128588 // 16564 SLC14A1 // solute carrier 8021081 SLC14A1 family 14 (urea NM_001128588 0.365251-2.73784 transporter), member 1 336 7892832 --- --- 0.365279-2.73764 3171 7895684 --- --- 0.365812-2.73364 3746 7896264 --- --- 0.366939-2.72525 20623 8061579 NM_012112 // TPX2 // TPX2, microtubuleassociated, homolog (Xenopus laevis) // TPX2 NM_012112 0.36729-2.72264 970 7893468 --- --- 0.371021-2.69526 1889 7894394 --- --- 0.372039-2.68789 874 7893372 --- --- 0.372194-2.68677 3611 7896129 --- --- 0.372607-2.6838 10281 7956741 --- --- 0.372904-2.68165 12007 7974366 31688 8168146 26992 8123920 16201 8017262 27076 8124521 16439 8019842 NM_000956 // PTGER2 // prostaglandin E receptor 2 (subtype EP2), 53kDa // 14q22 // NM_012310 // KIF4A // kinesin family member 4A // Xq13.1 // 24137 /// ENST00000374403 / NM_017770 // ELOVL2 // elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, NM_032043 // BRIP1 // BRCA1 interacting protein C-terminal helicase 1 // 17q22-q24 // NM_003541 // HIST1H4K // histone cluster 1, H4k // 6p22- p21.3 // 8362 /// NM_001071 // TYMS // thymidylate synthetase // 18p11.32 // 7298 /// ENST00000323274 // PTGER2 NM_000956 0.373364-2.67835 KIF4A NM_012310 0.374511-2.67015 ELOVL2 NM_017770 0.375026-2.66648 BRIP1 NM_032043 0.375442-2.66353 HIST1H4K NM_003541 0.375581-2.66254 TYMS NM_001071 0.376-2.65957

Column # Transcript 4609 7900699 NM_001255 // CDC20 // cell division cycle 20 homolog (S. cerevisiae) // 1p34.1 // 991 / Ratio(shR RM2B -mut) Change(s hrrm2b CDC20 NM_001255 0.376401-2.65674 1728 7894231 --- --- 0.378366-2.64294 6478 NM_175065 // HIST2H2AB // histone 7919642 cluster 2, H2ab // 1q21 // 317772 /// HIST2H2AB NM_175065 0.378642-2.64102 3158 7895671 --- --- 0.379269-2.63665 18816 AK293146 // DHFR // dihydrofolate reductase // 8043036 DHFR 5q11.2-q13.2 // 1719 /// AK293146 0.379269-2.63665 J00146 // LOC17 4557 7900167 24738 8102560 NM_018101 // CDCA8 // cell division cycle associated 8 // 1p34.3 // 55143 /// ENST00000 NM_002358 // MAD2L1 // MAD2 mitotic arrest deficient-like 1 (yeast) // 4q27 // 4085 /// CDCA8 NM_018101 0.379593-2.6344 MAD2L1 NM_002358 0.380454-2.62844 3052 7895565 --- --- 0.382234-2.6162 26318 NM_003540 // HIST1H4F // histone cluster 1, H4f // 8117422 6p21.3 // 8361 /// BC093763 // HIST1 HIST1H4F NM_003540 0.383665-2.60644 1442 7893943 --- --- 0.383802-2.60551 1099 7893597 --- --- 0.383958-2.60445 5377 NM_002113 // CFHR1 // complement factor H- 7908488 related 1 // 1q32 // 3078 /// BC107771 // CFH CFHR1 NM_002113 0.384369-2.60166 2779 7895291 --- --- 0.384771-2.59895 1900 7894405 --- --- 0.386098-2.59002 3237 7895750 --- --- 0.386533-2.5871 9192 7946328 --- --- 0.38813-2.57645 12454 7978846 NM_002692 // POLE2 // polymerase (DNA directed), epsilon 2 (p59 subunit) // 14q21-q22 / POLE2 NM_002692 0.388219-2.57587 1852 7894357 --- --- 0.388318-2.57521 24912 NM_024629 // MLF1IP // MLF1 interacting protein 8103932 // 4q35.1 // 79682 /// ENST00000281453 MLF1IP NM_024629 0.388674-2.57285 123 7892619 --- --- 0.389193-2.56942 1171 7893669 --- --- 0.389929-2.56457

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 116 7892612 --- --- 0.390821-2.55872 145 7892641 --- --- 0.391215-2.55614 15396 NM_018304 // PRR11 // proline rich 11 // 17q22 // 8008784 55771 /// PRR11 NM_018304 0.391689-2.55305 ENST00000262293 // PRR11 // 27075 NM_021066 // 8124518 HIST1H2AJ // histone HIST1H2AJ NM_021066 0.391793-2.55237 cluster 1, H2aj // 6p22-3415 7895930 --- --- 0.391866-2.55189 3714 7896232 --- --- 0.392961-2.54478 3951 7896470 --- --- 0.393264-2.54282 3684 7896202 --- --- 0.393277-2.54274 10597 NM_202002 // FOXM1 // forkhead box M1 // 7960340 12p13 // 2305 /// FOXM1 NM_202002 0.39348-2.54143 NM 021953 // FOXM1 // 2783 7895295 --- --- 0.394069-2.53763 7230 NR_026693 // ZNF487 // zinc finger protein 487 // 7927169 10q11.21 // 642819 /// ZNF487 NR_026693 0.394113-2.53734 AK302442 // ZN 157 7892653 --- --- 0.395126-2.53084 28784 NM_017654 // SAMD9 // sterile alpha motif 8140967 domain containing 9 // SAMD9 NM_017654 0.395402-2.52907 7q21.2 // 54809 /// EN 28830 NM_005916 // MCM7 // minichromosome 8141395 maintenance complex MCM7 NM_005916 0.395586-2.52789 component 7 // 7q21.3- q22.1 // 13231 NM_000057 // BLM // Bloom syndrome, RecQ 7986068 helicase-like // 15q26.1 // BLM NM_000057 0.396523-2.52192 641 /// ENST000003 33141 8180255 --- --- 0.3969-2.51953 33207 8180321 --- --- 0.3969-2.51953 5379 NM_005666 // CFHR2 // complement factor H- 7908496 related 2 // 1q31-q32.1 // CFHR2 NM_005666 0.398079-2.51206 3080 /// BC022283 9738 NM_033306 // CASP4 // caspase 4, apoptosisrelated cysteine 7951372 CASP4 NM_033306 0.398516-2.50931 peptidase // 11q22.2-2987 7895500 --- --- 0.398563-2.50901

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 16320 NM_003258 // TK1 // thymidine kinase 1, 8018849 soluble // 17q23.2-q25.3 TK1 NM_003258 0.398913-2.50681 // 7083 /// ENST000003 10296 NM_007199 // IRAK3 // interleukin-1 receptorassociated kinase 3 // 7956878 IRAK3 NM_007199 0.399225-2.50485 12q14.3 // 11213 // 27049 NM_021062 // HIST1H2BB // histone 8124394 cluster 1, H2bb // 6p21.3 HIST1H2BB NM_021062 0.399333-2.50418 // 3018 /// 3995 7896514 --- --- 0.399559-2.50276 NM_005325 // 27045 HIST1H1A // histone 8124380 HIST1H1A cluster 1, H1a // 6p21.3 // NM_005325 0.400153-2.49904 3024 /// 3111 7895624 --- --- 0.400551-2.49656 387 7892883 --- --- 0.401436-2.49106 6479 NM_014849 // SV2A // synaptic vesicle 7919645 SV2A glycoprotein 2A // 1q21.2 NM_014849 0.401765-2.48902 // 9900 /// ENST0000036 170 7892666 --- --- 0.402288-2.48578 20788 8063408 --- --- 0.402956-2.48166 6464 AB096683 // FAM72D // family with sequence 7919591 similarity 72, member D // 1q21.1 // 728833 FAM72D AB096683 0.403073-2.48094 3071 7895584 --- --- 0.403286-2.47963 18598 NM_001809 // CENPA // centromere protein A // 8040712 2p24-p21 // 1058 /// NM 001042426 // CENP CENPA NM_001809 0.40428-2.47353 20074 8055323 28883 8141950 27058 8124437 NM_207363 // NCKAP5 // NCK-associated protein 5 // 2q21.2 // 344148 /// NM 207481 // NM_005045 // RELN // reelin // 7q22 // 5649 /// NM_173054 // RELN // reelin // 7q22 // NM_021018 // HIST1H3F // histone cluster 1, H3f // 6p22.2 // 8968 /// BC096131 // HIST1 NCKAP5 NM_207363 0.404465-2.4724 RELN NM_005045 0.404576-2.47172 HIST1H3F NM_021018 0.404642-2.47132

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 4836 NM_001024948 // FNBP1L // formin binding 7903092 FNBP1L protein 1-like // 1p22.1 // NM_001024948 0.405151-2.46822 54874 /// NM 01773 NM_005602 // CLDN11 // claudin 11 // 3q26.2-22861 8083887 q26.3 // 5010 /// CLDN11 NM_005602 0.405415-2.46661 ENST00000064724 // CLDN11 4075 7896597 --- --- 0.405798-2.46428 1067 7893565 --- --- 0.406036-2.46284 1028 7893526 --- --- 0.406068-2.46264 20357 8058857 NM_000599 // IGFBP5 // insulin-like growth factor binding protein 5 // 2q33- q36 // 3488 IGFBP5 NM_000599 0.407164-2.45601 3716 7896234 --- --- 0.40719-2.45586 3959 7896478 --- --- 0.407536-2.45377 1697 7894200 --- --- 0.407791-2.45224 1170 7893668 --- --- 0.408905-2.44555 3653 7896171 --- --- 0.409102-2.44438 3721 7896239 --- --- 0.409617-2.4413 26092 8115443 --- --- 0.409796-2.44024 1373 7893873 --- --- 0.409977-2.43916 7451 7929438 NM_018063 // HELLS // helicase, lymphoidspecific // 10q24.2 // 3070 /// HELLS NM_018063 0.410017-2.43892 446 7892942 --- --- 0.410305-2.43721 15892 NM_001104587 // SLFN11 // schlafen 8014233 family member 11 // 17q12 // 91607 /// SLFN11 NM_001104587 0.410529-2.43588 833 7893331 --- --- 0.41075-2.43457 2124 7894631 --- --- 0.411126-2.43235 30603 NM_000962 // PTGS1 // prostaglandinendoperoxide synthase 1 8157650 PTGS1 NM_000962 0.411197-2.43193 (prostaglandin G/H 25793 8112731 NM_004101 // F2RL2 // coagulation factor II (thrombin) receptor-like 2 // 5q13 // 2151 F2RL2 NM_004101 0.411605-2.42951 2170 7894677 --- --- 0.413032-2.42112 3311 7895825 --- --- 0.413035-2.4211 1841 7894345 --- --- 0.414092-2.41492 779 7893277 --- --- 0.414457-2.4128 353 7892849 --- --- 0.414665-2.41158

Column # Transcript 27046 8124385 NM_003544 // HIST1H4B // histone cluster 1, H4b // 6p21.3 // 8366 /// BC069467 // Ratio(shR RM2B -mut) Change(s hrrm2b HIST1H4B NM_003544 0.414719-2.41127 2790 7895302 --- --- 0.415171-2.40865 24882 NM_001130688 // HMGB2 // high-mobility 8103728 box 2 // 4q31 // 3148 /// NM 002129 // HMGB2 NM_001130688 0.415221-2.40836 5389 7908597 12910 7982663 NM_205860 // NR5A2 // nuclear receptor subfamily 5, A, member 2 // 1q32.1 // NM_001211 // BUB1B // budding uninhibited by benzimidazoles 1 homolog beta (yeast) // 1 NR5A2 NM_205860 0.415313-2.40782 BUB1B NM_001211 0.415358-2.40756 992 7893490 --- --- 0.415567-2.40635 981 7893479 --- --- 0.41633-2.40194 6472 NM_001123375 // HIST2H3D // histone 7919612 HIST2H3D cluster 2, H3d // 1q21.2 // NM_001123375 0.416621-2.40026 653604 /// 28997 8143144 NM_002825 // PTN // pleiotrophin // 7q33-q34 // 5764 /// ENST00000348225 // PTN NM_002825 0.416919-2.39855 1619 7894120 --- --- 0.417422-2.39566 33017 NM_002263 // KIFC1 // kinesin family member 8179564 C1 // 6p21.3 // 3833 /// ENST00000374523 // KIFC1 NM_002263 0.417904-2.39289 14334 7998117 NM_207366 // SEPT14 // septin 14 // 7p11.2 // 346288 /// ENST00000388975 // SEPT14 // s 14-Sep NM_207366 0.419232-2.38532 2455 7894966 --- --- 0.419284-2.38502 29108 NM_017760 // NCAPG2 // non-smc condensin II 8144153 complex, subunit G2 // 7q36.3 // 54892 /// NCAPG2 NM_017760 0.419438-2.38414 11484 7969613 NM_005708 // GPC6 // glypican 6 // 13q32 // 10082 /// ENST00000377047 // GPC6 // glypic GPC6 NM_005708 0.419905-2.38149

Column # Transcript 30084 8152617 NM_005328 // HAS2 // hyaluronan synthase 2 // 8q24.12 // 3037 /// ENST00000303924 // HA Ratio(shR RM2B -mut) Change(s hrrm2b HAS2 NM_005328 0.420655-2.37724 3768 7896286 --- --- 0.421422-2.37292 3825 7896343 --- --- 0.421584-2.372 25106 NM_031966 // CCNB1 // cyclin B1 // 5q12 // 891 /// 8105828 CCNB1 ENST00000256442 // NM_031966 0.42177-2.37096 CCNB1 // cyclin B 15219 8007071 18039 8035838 17212 8027348 30006 8151871 11223 7966878 NM_001254 // CDC6 // cell division cycle 6 homolog (S. cerevisiae) // 17q21.3 // 990 // AK301230 // ZNF724P // zinc finger protein 724 pseudogene // 19p12 // 440519 AK131472 // ZNF730 // zinc finger protein 730 // 19p12 // 100129543 /// ENST00000327867 NM_057749 // CCNE2 // cyclin E2 // 8q22.1 // 9134 /// ENST00000308108 // NM_007174 // CIT // citron (rho-interacting, serine/threonine kinase 21) // 12q24 // 11 CDC6 NM_001254 0.422165-2.36874 ZNF724P AK301230 0.422593-2.36634 ZNF730 AK131472 0.423675-2.3603 CCNE2 NM_057749 0.424114-2.35785 CIT NM_007174 0.424169-2.35755 3157 7895670 --- --- 0.424459-2.35594 4031 7896552 --- --- 0.425078-2.35251 32003 NM_001711 // BGN // biglycan // Xq28 // 633 /// 8170648 ENST00000331595 // BGN // biglycan // X BGN NM_001711 0.426305-2.34574 26469 8118669 NM_002263 // KIFC1 // kinesin family member C1 // 6p21.3 // 3833 /// ENST00000448818 // KIFC1 NM_002263 0.42634-2.34555 743 7893241 --- --- 0.427192-2.34087 22680 NM_138287 // DTX3L // deltex 3-like (Drosophila) 8082075 // 3q21.1 // 151636 /// ENST0000029616 DTX3L NM_138287 0.428127-2.33575

Column # Transcript 16693 8022295 ENST00000383408 // FAM38B2 // family with sequence similarity 38, member B2 // 18p11.22 Ratio(shR RM2B -mut) Change(s hrrm2b FAM38B2 ENST0000038340 0.428382-2.33436 2815 7895327 --- --- 0.428591-2.33322 10763 NM_001145728 // IFLTD1 // intermediate 7961875 filament tail domain containing 1 // 12p12.1 // IFLTD1 NM_001145728 0.429129-2.3303 431 7892927 --- --- 0.430193-2.32454 1359 7893859 --- --- 0.430199-2.32451 3956 7896475 --- --- 0.430726-2.32166 3623 7896141 --- --- 0.431004-2.32016 28039 8133976 21767 8072710 20236 8057506 NM_006716 // DBF4 // DBF4 homolog (S. cerevisiae) // 7q21.3 // 10926 /// NM_030641 // APOL6 // apolipoprotein L, 6 // 22q12.3 // 80830 /// ENST00000409652 // AP NM_001463 // FRZB // frizzled-related protein // 2qter // 2487 /// ENST00000295113 // F DBF4 NM_006716 0.431109-2.3196 APOL6 NM_030641 0.431846-2.31564 FRZB NM_001463 0.432257-2.31344 2249 7894759 --- --- 0.432463-2.31234 233 7892729 --- --- 0.432771-2.31069 10527 NM_014708 // KNTC1 // kinetochore associated 1 7959408 // 12q24.31 // 9735 /// ENST00000333479 KNTC1 NM_014708 0.433351-2.3076 567 7893065 --- --- 0.433608-2.30623 26315 NM_003545 // HIST1H4E // histone 8117402 HIST1H4E cluster 1, H4e // 6p21.3 // NM_003545 0.434417-2.30193 8367 /// CR542180 // 3931 7896450 --- --- 0.434563-2.30116 3685 7896203 --- --- 0.434593-2.301 6104 7916016 --- --- 0.435145-2.29809 12004 7974341 4822 7902977 NM_053064 // GNG2 // guanine nucleotide binding protein (G protein), gamma 2 // NM_015237 // KIAA1107 // KIAA1107 // 1p22.1 // 23285 /// ENST00000370378 // KIAA1107 // GNG2 NM_053064 0.435721-2.29505 KIAA1107 NM_015237 0.436182-2.29262

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 5672 7911339 --- --- 0.436234-2.29235 31408 8165698 --- --- 0.436234-2.29235 29432 NM_033402 // LRRCC1 // leucine rich repeat and 8147079 coiled-coil domain LRRCC1 NM_033402 0.436512-2.29089 containing 1 // 8q21. 22981 8085052 --- --- 0.436825-2.28925 9277 NM_031217 // KIF18A // kinesin family member 7947248 18A // 11p14.1 // 81930 KIF18A NM_031217 0.436888-2.28892 /// ENST0000026318 4053 7896575 --- --- 0.436909-2.28881 3077 7895590 --- --- 0.437107-2.28777 26717 NM_001624 // AIM1 // absent in melanoma 1 // 8121277 6q21 // 202 /// AIM1 NM_001624 0.437471-2.28587 ENST00000369066 // AIM1 // 3054 7895567 --- --- 0.438105-2.28256 10395 NM_178826 // ANO4 // anoctamin 4 // 12q23.1 // 7957861 121601 /// ANO4 NM_178826 0.439997-2.27274 ENST00000392979 // ANO4 // an 3486 7896002 --- --- 0.440309-2.27113 718 7893216 --- --- 0.44043-2.27051 30845 NM_001010915 // PTPLAD2 // protein 8160346 tyrosine phosphataselike PTPLAD2 NM_001010915 0.440789-2.26866 A domain containing 1948 7894454 --- --- 0.442243-2.2612 26796 NM_001012507 // C6orf173 // chromosome 8121911 6 open reading frame C6orf173 NM_001012507 0.443045-2.25711 173 // 6q22.32 // 387103 2485 7894996 --- --- 0.443385-2.25538 NM_022045 // MTBP // 29530 Mdm2, transformed 3T3 8148124 MTBP cell double minute 2, p53 NM_022045 0.443645-2.25406 binding protein (m 4011 7896530 --- --- 0.443938-2.25257 NM_001078 // VCAM1 // 4861 vascular cell adhesion 7903358 molecule 1 // 1p32-p31 // VCAM1 NM_001078 0.44428-2.25083 7412 /// NM 0806 1959 7894465 --- --- 0.444511-2.24966 3463 7895979 --- --- 0.445595-2.24419 578 7893076 --- --- 0.446046-2.24192

Column # Transcript 9966 7953603 NM_201442 // C1S // complement component 1, s subcomponent // 12p13 // 716 /// Ratio(shR RM2B -mut) Change(s hrrm2b C1S NM_201442 0.446221-2.24104 7035 7925436 --- --- 0.446305-2.24062 26069 NM_052860 // ZNF300 // zinc finger protein 300 // 8115196 5q33.1 // 91975 /// ENST00000274599 / ZNF300 NM_052860 0.44729-2.23569 29094 8144036 NM_005431 // XRCC2 // X-ray repair complementing defective repair in Chinese XRCC2 NM_005431 0.447513-2.23457 3688 7896206 --- --- 0.447534-2.23447 13211 NM_001113378 // FANCI // Fanconi anemia, 7985829 complementation I // 15q26.1 // 55215 // FANCI NM_001113378 0.447562-2.23433 18887 8043502 --- --- 0.448104-2.23162 23636 NM_001099645 // RPL22L1 // ribosomal 8092067 protein L22-like 1 // 3q26.2 // 200916 /// RPL22L1 NM_001099645 0.448888-2.22773 3515 7896031 --- --- 0.449339-2.22549 377 7892873 --- --- 0.449631-2.22404 28950 NM_005302 // GPR37 // G protein-coupled 8142687 receptor 37 (endothelin receptor type B-like) / GPR37 NM_005302 0.450593-2.2193 31210 8163637 31776 8168794 NM_002160 // TNC // tenascin C // 9q33 // 3371 /// ENST00000350763 // NM_006733 // CENPI // centromere protein I // Xq22.1 // 2491 /// ENST00000423383 // TNC NM_002160 0.451-2.2173 CENPI NM_006733 0.451188-2.21637 4149 7896671 --- --- 0.451203-2.2163 24356 NM_012445 // SPON2 // spondin 2, extracellular 8098870 matrix protein // 4p16.3 // 10417 /// NM SPON2 NM_012445 0.451311-2.21577 18900 8043602 NM_015341 // NCAPH // non-smc condensin I complex, subunit H // 2q11.2 // 23397 /// ENS NCAPH NM_015341 0.451321-2.21572

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 4937 NM_020190 // OLFML3 // olfactomedin-like 3 // 7904158 1p13.2 // 56944 /// OLFML3 NM_020190 0.451493-2.21487 ENST00000320334 // OL 11760 NM_032229 // SLITRK6 // SLIT and NTRK-like 7972239 family, member 6 // SLITRK6 NM_032229 0.451536-2.21466 13q31.1 // 84189 /// ENS 2553 7895064 --- --- 0.451579-2.21445 585 7893083 --- --- 0.451934-2.21271 559 7893057 --- --- 0.45217-2.21156 25699 8111960 BC036867 // C5orf34 // chromosome 5 open reading frame 34 // 5p12 // 375444 /// NM 1985 C5orf34 BC036867 0.452715-2.2089 3434 7895950 --- --- 0.452729-2.20883 2206 7894715 --- --- 0.453273-2.20617 1003 7893501 --- --- 0.453678-2.20421 1520 7894021 --- --- 0.454719-2.19916 27077 8124524 NM_003510 // HIST1H2AK // histone cluster 1, H2ak // 6p22- p21.3 // 8330 /// NR_003939 // SNORD79 6745 7922406 // small nucleolar RNA, C/D box 79 // 1q25.1 // 4833 7903049 9755 7951535 NM_206886 // CCDC18 // coiled-coil domain containing 18 // 1p22.1 // 343099 /// ENST000 NM_153705 // KDELC2 // KDEL (Lys-Asp-Glu-Leu) containing 2 // 11q22.3 // 143888 /// ENS HIST1H2AK NM_003510 0.455508-2.19535 SNORD79 NR_003939 0.456247-2.19179 CCDC18 NM_206886 0.456366-2.19122 KDELC2 NM_153705 0.456825-2.18902 4004 7896523 --- --- 0.456909-2.18862 1878 7894383 --- --- 0.456997-2.1882 12629 NM_183387 // EML5 // echinoderm microtubule 7980636 associated protein like 5 // 14q31.3 // 161 EML5 NM_183387 0.457204-2.18721 2791 7895303 --- --- 0.457336-2.18658 98 7892593 --- --- 0.457725-2.18472 288 7892784 --- --- 0.457907-2.18385 2243 7894753 --- --- 0.457974-2.18353 1623 7894124 --- --- 0.457991-2.18345

Column # Transcript 9477 7948906 NR_002563 // SNORD27 // small nucleolar RNA, C/D box 27 // 11q13 // 9301 /// AK095849 / Ratio(shR RM2B -mut) Change(s hrrm2b SNORD27 NR_002563 0.458854-2.17934 1638 7894140 --- --- 0.459041-2.17846 14875 NM_002615 // SERPINF1 // serpin 8003667 SERPINF1 peptidase inhibitor, clade NM_002615 0.459301-2.17722 F (alpha-2 antiplasmin, 12990 7983630 29523 8148029 22265 8077731 NM_002009 // FGF7 // fibroblast growth factor 7 (keratinocyte growth factor) // 15q15-q NM_006438 // COLEC10 // collectin sub-family member 10 (C-type lectin) // 8q23-q24.1 // NM_033084 // FANCD2 // Fanconi anemia, complementation D2 // 3p26 // 2177 /// FGF7 NM_002009 0.459706-2.17531 COLEC10 NM_006438 0.460439-2.17184 FANCD2 NM_033084 0.460527-2.17142 1826 7894330 --- --- 0.461388-2.16737 24242 NM_032117 // MND1 // meiotic nuclear divisions 8097857 1 homolog (S. cerevisiae) // 4q31.3 // 8 MND1 NM_032117 0.461992-2.16454 1910 7894415 --- --- 0.462055-2.16424 25815 8112894 --- --- 0.462207-2.16353 2859 7895371 --- --- 0.462333-2.16294 714 7893212 --- --- 0.462556-2.1619 4046 7896568 --- --- 0.462753-2.16098 392 7892888 --- --- 0.463075-2.15948 2519 7895030 --- --- 0.463631-2.15689 2780 7895292 --- --- 0.463832-2.15595 27052 8124406 NM_003526 // HIST1H2BC // histone cluster 1, H2bc // 6p21.3 // 8347 /// BC105595 // HIST1H2BC NM_003526 0.464242-2.15405 3923 7896442 --- --- 0.464841-2.15127 23372 NM_020890 // KIAA1524 // KIAA1524 // 3q13.13 // 8089372 57650 /// ENST00000295746 // KIAA1524 / KIAA1524 NM_020890 0.467199-2.14042 28033 8133902 --- --- 0.467245-2.1402 2560 7895071 --- --- 0.467619-2.13849

Column # Transcript 26349 8117598 NM_021968 // HIST1H4J // histone cluster 1, H4j // 6p22-p21.3 // 8363 /// NM 003541 // Ratio(shR RM2B -mut) Change(s hrrm2b HIST1H4J NM_021968 0.467669-2.13826 1781 7894285 --- --- 0.469042-2.132 3459 7895975 --- --- 0.469134-2.13159 ENST00000302079 // 16694 C18orf58 // chromosome 8022310 18 open reading frame 58 // 18p11.22-p11.21 / C18orf58 ENST0000030207 0.469609-2.12943 2695 7895207 --- --- 0.4702-2.12676 13080 NM_138555 // KIF23 // kinesin family member 7984540 23 // 15q23 // 9493 /// NM 004856 // KIF23 KIF23 NM_138555 0.471025-2.12303 2393 7894904 --- --- 0.471223-2.12214 25133 8106120 --- --- 0.471273-2.12191 24306 NM_018248 // NEIL3 // nei endonuclease VIIIlike 3 (E. coli) // 4q34.3 // 8098423 55247 /// ENS NEIL3 NM_018248 0.471455-2.12109 1865 7894370 --- --- 0.471947-2.11888 3056 7895569 --- --- 0.472061-2.11837 12 7892505 --- --- 0.472253-2.11751 29254 8145555 30334 8155214 4626 7901010 NM_016240 // SCARA3 // scavenger receptor class A, member 3 // 8p21 // 51435 /// NM 182 NM_014791 // MELK // maternal embryonic leucine zipper kinase // 9p13.2 // 9833 /// ENS NM_006845 // KIF2C // kinesin family member 2C // 1p34.1 // 11004 /// ENST00000372224 / SCARA3 NM_016240 0.472686-2.11557 MELK NM_014791 0.472762-2.11523 KIF2C NM_006845 0.47318-2.11336 2901 7895413 --- --- 0.473392-2.11241 2717 7895229 --- --- 0.474793-2.10618 8190 NM_003641 // IFITM1 // interferon induced 7937335 IFITM1 transmembrane protein 1 NM_003641 0.47548-2.10314 (9-27) // 11p15.5 // 3518 7896034 --- --- 0.475674-2.10228 11102 NM_032147 // USP44 // ubiquitin specific 7965565 peptidase 44 // 12q22 // 84101 /// NM 00104240 USP44 NM_032147 0.475724-2.10206 3261 7895775 --- --- 0.475776-2.10183

Column # Transcript 4783 7902553 NM_006417 // IFI44 // interferon-induced protein 44 // 1p31.1 // 10561 /// ENST00000370 Ratio(shR RM2B -mut) Change(s hrrm2b IFI44 NM_006417 0.47586-2.10146 2732 7895244 --- --- 0.476137-2.10024 11365 NM_000059 // BRCA2 // breast cancer 2, early 7968484 onset // 13q12.3 // 675 /// ENST0000038015 BRCA2 NM_000059 0.477028-2.09631 11791 7972561 --- --- 0.478588-2.08948 27120 8124846 --- --- 0.479039-2.08751 32085 NM_001018113 // FANCB // Fanconi 8171381 anemia, complementation FANCB NM_001018113 0.479069-2.08738 1817 7894321 --- --- 0.479495-2.08553 3757 7896275 --- --- 0.47975-2.08442 20442 NM_018410 // HJURP // Holliday junction 8059838 recognition protein // 2q37.1 // 55355 /// ENST HJURP NM_018410 0.480043-2.08315 11351 7968295 --- --- 0.481276-2.07781 27059 NM_003534 // 8124440 HIST1H3G // histone HIST1H3G NM_003534 0.481519-2.07676 cluster 1, H3g // 6p21.3 // 22572 8081113 --- --- 0.48164-2.07624 3708 7896226 --- --- 0.481816-2.07548 9736 NM_025208 // PDGFD // platelet derived growth 7951351 factor D // 11q22.3 // 80310 /// NM 03313 PDGFD NM_025208 0.483225-2.06943 8866 7943413 NM_001165 // BIRC3 // baculoviral IAP repeatcontaining 3 // 11q22 // 330 /// NM 182962 BIRC3 NM_001165 0.48347-2.06838 3319 7895833 --- --- 0.483538-2.06809 16587 NM_173529 // C18orf54 // chromosome 18 open 8021286 reading frame 54 // 18q21.2 // 162681 /// E C18orf54 NM_173529 0.483984-2.06618 1622 7894123 --- --- 0.484167-2.0654 31466 NM_005314 // GRPR // gastrin-releasing peptide 8166202 receptor // Xp22.2- p22.13 // 2925 /// EN GRPR NM_005314 0.48457-2.06369 715 7893213 --- --- 0.4846-2.06356 2414 7894925 --- --- 0.484945-2.06209

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 20132 NM_006186 // NR4A2 // nuclear receptor 8055952 subfamily 4, A, NR4A2 NM_006186 0.485147-2.06123 member 2 // 2q22-q23 // 31393 AK172782 // GPAM // glycerol-3-phosphate 8165663 acyltransferase, GPAM AK172782 0.48535-2.06037 mitochondrial // 10q25.2 // 5 31507 AK057304 // FLJ32742 // hypothetical locus 8166585 FLJ32742 // Xp21.3 // FLJ32742 AK057304 0.485677-2.05898 439944 9021 NM_001274 // CHEK1 // CHK1 checkpoint 7945014 homolog (S. pombe) // CHEK1 NM_001274 0.485709-2.05885 11q24-q24 // 1111 /// 29895 NM_001080416 // MYBL1 // v-myb 8151101 myeloblastosis viral MYBL1 NM_001080416 0.486055-2.05738 oncogene homolog 3344 7895858 --- --- 0.486855-2.054 19492 NM_001137550 // LRRFIP1 // leucine rich 8049542 repeat (in FLII) interacting protein 1 // LRRFIP1 NM_001137550 0.487006-2.05336 1770 7894274 --- --- 0.487013-2.05333 26042 NM_001387 // DPYSL3 // dihydropyrimidinase-like 8114920 3 // 5q32 // 1809 /// ENST00000398514 / DPYSL3 NM_001387 0.488129-2.04864 368 7892864 --- --- 0.488258-2.0481 3206 7895719 --- --- 0.488523-2.04699 30077 NM_006209 // ENPP2 // ectonucleotide 8152522 ENPP2 pyrophosphatase/phosph NM_006209 0.48903-2.04486 odiesterase 2 // 8q24.1 // 30372 8155487 30969 8161423 NR_003674 // KGFLP1 // keratinocyte growth factor-like protein 1 // 9p11.2 // 387628 // NR_003674 // KGFLP1 // keratinocyte growth factor-like protein 1 // 9p11.2 // 387628 // KGFLP1 NR_003674 0.489428-2.0432 KGFLP1 NR_003674 0.489428-2.0432

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 30980 NR_003674 // KGFLP1 // keratinocyte growth 8161455 factor-like protein 1 // KGFLP1 NR_003674 0.489428-2.0432 9p11.2 // 387628 // 5360 NM_031935 // HMCN1 // hemicentin 1 // 1q25.3-7908204 q31.1 // 83872 /// HMCN1 NM_031935 0.489561-2.04265 ENST00000271588 // HMCN 4884 NM_013296 // GPSM2 // G-protein signaling 7903565 modulator 2 (AGS3-like, C. elegans) // 1p13.3 GPSM2 NM_013296 0.489704-2.04205 29879 8150962 11369 7968563 NM_014729 // TOX // thymocyte selectionassociated high mobility box // 8q12.1 // NM_002915 // RFC3 // replication factor C (activator 1) 3, 38kDa // 13q12.3-q13 // 5983 TOX NM_014729 0.489757-2.04183 RFC3 NM_002915 0.489797-2.04166 19879 8053646 --- --- 0.489897-2.04125 10385 NM_001032283 // TMPO // thymopoietin // 12q22 // 7957737 TMPO 7112 /// NM_001032284 NM_001032283 0.490624-2.03822 // TMPO // thymo 20708 8062571 NM_030919 // FAM83D // family with sequence similarity 83, member D // 20q11.22-q12 // FAM83D NM_030919 0.490788-2.03754 2782 7895294 --- --- 0.490933-2.03694 3338 7895852 --- --- 0.490948-2.03688 1362 7893862 --- --- 0.491086-2.0363 24281 8098193 --- --- 0.49161-2.03413 3334 7895848 --- --- 0.491907-2.0329 3753 7896271 --- --- 0.492084-2.03217 794 7893292 --- --- 0.49225-2.03149 11069 7965206 21073 8066136 NM_182767 // SLC6A15 // solute carrier family 6 (neutral amino acid transporter), membe NM_002895 // RBL1 // retinoblastoma-like 1 (p107) // 20q11.2 // 5933 /// NM 183404 // R SLC6A15 NM_182767 0.492351-2.03107 RBL1 NM_002895 0.492608-2.03001 666 7893164 --- --- 0.493168-2.02771

Column # Transcript 20538 8060813 NM_032485 // MCM8 // minichromosome maintenance complex component 8 // 20p12.3 // 84515 Ratio(shR RM2B -mut) Change(s hrrm2b MCM8 NM_032485 0.493486-2.0264 37 7892531 --- --- 0.49352-2.02626 1735 7894238 --- --- 0.493691-2.02556 1377 7893877 --- --- 0.493793-2.02514 3209 7895722 --- --- 0.493885-2.02476 29403 8146863 5280 7907222 NM_001128205 // SULF1 // sulfatase 1 // 8q13.2-q13.3 // 23213 /// NM 015170 // SULF1 // NM_006902 // PRRX1 // paired related homeobox 1 // 1q24 // 5396 /// NM 022716 // PRRX1 SULF1 NM_001128205 0.493993-2.02432 PRRX1 NM_006902 0.494617-2.02177 2273 7894783 --- --- 0.4947-2.02143 30076 NM_002546 // TNFRSF11B // tumor 8152512 necrosis factor receptor superfamily, member 11b TNFRSF11B NM_002546 0.494878-2.0207 5987 7914851 20120 8055702 NM_022111 // CLSPN // claspin homolog (Xenopus laevis) // 1p34.2 // 63967 /// NM_004688 // NMI // N- myc (and STAT) interactor // 2q23 // 9111 /// ENST00000243346 // CLSPN NM_022111 0.495292-2.01901 NMI NM_004688 0.495387-2.01862 1840 7894344 --- --- 0.495437-2.01842 665 7893163 --- --- 0.495717-2.01728 4216 AK172782 // GPAM // glycerol-3-phosphate 7896750 acyltransferase, mitochondrial // 10q25.2 // 5 GPAM AK172782 0.495762-2.0171 2925 7895438 --- --- 0.496405-2.01449 15134 NM_024857 // ATAD5 // ATPase family, AAA 8006187 domain containing 5 // 17q11.2 // 79915 /// EN ATAD5 NM_024857 0.496599-2.0137 6246 7917532 NM_004120 // GBP2 // guanylate binding protein GBP2 2, interferon-inducible // NM_004120 0.49669-2.01333 1p22.2 // 263

Column # Transcript 11438 7969263 NM_001011724 // HNRNPA1L2 // heterogeneous nuclear ribonucleoprotein A1-like 2 // 13q14 Ratio(shR RM2B -mut) Change(s hrrm2b HNRNPA1L2 NM_001011724 0.496767-2.01301 1501 7894002 --- --- 0.496949-2.01228 3387 7895902 --- --- 0.497022-2.01198 24297 NM_017423 // GALNT7 // UDP-N-acetyl-alpha-Dgalactosamine:polypeptid 8098328 GALNT7 NM_017423 0.497191-2.0113 e N-acetylgalactosa 4121 7896643 --- --- 0.497219-2.01119 20083 NM_005915 // MCM6 // minichromosome 8055426 maintenance complex component 6 // 2q21 // 4175 /// MCM6 NM_005915 0.497343-2.01068 10228 7956076 16737 8022640 NM_001798 // CDK2 // cyclin-dependent kinase 2 // 12q13 // 1017 /// NM 052827 // CDK2 / NM_000791 // DHFR // dihydrofolate reductase // 5q11.2-q13.2 // 1719 /// NM 000791 // D CDK2 NM_001798 0.497432-2.01033 DHFR NM_000791 0.497525-2.00995 3293 7895807 --- --- 0.498747-2.00503 12617 NM_152446 // C14orf145 // chromosome 14 open 7980496 reading frame 145 // 14q31.1 // 145508 /// C14orf145 NM_152446 0.49875-2.00501 1124 7893622 --- --- 0.499224-2.00311 1744 7894247 --- --- 0.49973-2.00108 14991 NM_001146312 // MYOCD // myocardin // 8005048 17p11.2 // 93649 /// NM 153604 // MYOCD // MYOCD NM_001146312 0.499795-2.00082 22647 8081758 NM_017577 // GRAMD1C // GRAM domain containing 1C // 3q13.31 // 54762 /// GRAMD1C NM_017577 0.499991-2.00003 4104 7896626 --- --- 0.501115-1.99555 15741 8012906 --- --- 0.501782-1.9929 25452 8109436 --- --- 0.501811-1.99278 15816 8013521 --- --- 0.501972-1.99214 23036 8085579 --- --- 0.502341-1.99068

Column # Transcript 26626 8120411 NM_000947 // PRIM2 // primase, DNA, polypeptide 2 (58kDa) // 6p12-p11.1 // 5558 /// Ratio(shR RM2B -mut) Change(s hrrm2b PRIM2 NM_000947 0.502928-1.98836 3187 7895700 --- --- 0.503051-1.98787 5608 NM_130398 // EXO1 // exonuclease 1 // 1q42-7910997 q43 // 9156 /// NM 006027 // EXO1 // EXO1 NM_130398 0.503141-1.98752 1594 7894095 --- --- 0.503492-1.98613 499 7892995 --- --- 0.503555-1.98588 5210 NR_002190 // SUMO1P3 7906574 // SUMO1 pseudogene 3 SUMO1P3 NR_002190 0.503673-1.98541 // 1q22 // 474338 31207 8163616 --- --- 0.503747-1.98512 6957 7924603 19147 8045816 NM_002296 // LBR // lamin B receptor // 1q42.1 // 3930 /// NM 194442 // LBR // NM_001083112 // GPD2 // glycerol-3-phosphate dehydrogenase 2 (mitochondrial) // 2q24.1 LBR NM_002296 0.504323-1.98286 GPD2 NM_001083112 0.504411-1.98251 12635 7980718 --- --- 0.504535-1.98202 1982 7894488 --- --- 0.504945-1.98041 28785 NM_152703 // SAMD9L // sterile alpha motif 8140971 domain containing 9-like // 7q21.2 // 219285 SAMD9L NM_152703 0.505012-1.98015 9349 7948037 --- --- 0.505501-1.97823 25817 NM_000791 // DHFR // dihydrofolate reductase // 8112902 DHFR 5q11.2-q13.2 // 1719 /// NM_000791 0.50554-1.97808 ENST0000043921 27048 8124391 NM_003513 // HIST1H2AB // histone cluster 1, H2ab // 6p21.3 // 8335 /// BC125140 // HIST1H2AB NM_003513 0.505584-1.97791 2315 7894825 --- --- 0.506072-1.976 3090 7895603 --- --- 0.506303-1.9751 3699 7896217 --- --- 0.506705-1.97354 6071 7915612 27082 8124540 ENST00000438067 // PTCH2 // patched homolog 2 (Drosophila) // 1p33-p34 // 8643 NM_003514 // HIST1H2AM // histone cluster 1, H2am // 6p22- PTCH2 ENST0000043806 0.507191-1.97164 HIST1H2AM NM_003514 0.507443-1.97067

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 20350 NM_000465 // BARD1 // BRCA1 associated RING 8058695 BARD1 domain 1 // 2q34-q35 // NM_000465 0.507632-1.96993 580 /// ENST0000026 NM_003535 // HIST1H3J 27081 8124537 // histone cluster 1, H3j // 6p22-p21.3 // 8356 HIST1H3J NM_003535 0.508127-1.96801 NM_003530 // 27054 HIST1H3D // histone 8124416 HIST1H3D cluster 1, H3d // 6p21.3 // NM_003530 0.508147-1.96794 8351 /// NM 021065 // 28489 8138527 10870 7963157 BC066301 // MGC87042 // STEAP family protein MGC87042 // 7p15.3 // 256227 /// ENST00000 NM_013277 // RACGAP1 // Rac GTPase activating protein 1 // 12q13.12 // MGC87042 BC066301 0.508509-1.96654 RACGAP1 NM_013277 0.509193-1.96389 822 7893320 --- --- 0.509397-1.96311 9669 NM_206927 // SYTL2 // synaptotagmin-like 2 // 7950810 11q14 // 54843 /// NM 206928 // SYTL2 // SYTL2 NM_206927 0.509742-1.96178 4212 7896742 5676 7911347 6952 7924549 9055 7945342 17698 8031990 NM_207366 // SEPT14 // septin 14 // 7p11.2 // 346288 /// ENST00000388975 // SEPT14 // s NM_207366 // SEPT14 // septin 14 // 7p11.2 // 346288 /// ENST00000388975 // SEPT14 // s BC032332 // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase NM_207366 // SEPT14 // septin 14 // 7p11.2 // 346288 /// ENST00000388975 // SEPT14 // s NM_207366 // SEPT14 // septin 14 // 7p11.2 // 346288 /// ENST00000388975 // SEPT14 // s 14-Sep NM_207366 0.509928-1.96106 14-Sep NM_207366 0.509928-1.96106 PCMTD2 BC032332 0.509928-1.96106 14-Sep NM_207366 0.509928-1.96106 14-Sep NM_207366 0.509928-1.96106

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 19531 BC032332 // PCMTD2 // protein-l-isoaspartate 8049963 (D-aspartate) O- methyltransferase PCMTD2 BC032332 0.509928-1.96106 NM_207366 // SEPT14 // septin 14 // 7p11.2 // 22982 8085054 346288 /// 14-Sep NM_207366 0.509928-1.96106 ENST00000388975 // SEPT14 // s 25583 NM_207366 // SEPT14 // septin 14 // 7p11.2 // 8110670 346288 /// ENST00000388975 // SEPT14 // s 14-Sep NM_207366 0.509928-1.96106 28404 8137666 29623 8148964 NM_207366 // SEPT14 // septin 14 // 7p11.2 // 346288 /// ENST00000388975 // SEPT14 // s NM_207366 // SEPT14 // septin 14 // 7p11.2 // 346288 /// ENST00000388975 // SEPT14 // s 14-Sep NM_207366 0.509928-1.96106 14-Sep NM_207366 0.509928-1.96106 2699 7895211 --- --- 0.509956-1.96095 479 7892975 --- --- 0.5101-1.9604 3967 7896486 --- --- 0.510201-1.96001 24722 8102389 BC044799 // C4orf21 // chromosome 4 open reading frame 21 // 4q25 // 55345 /// AK299831 C4orf21 BC044799 0.510322-1.95955 1247 7893746 --- --- 0.510647-1.9583 19080 8045287 --- --- 0.51128-1.95588 2568 7895080 --- --- 0.511428-1.95531 6496 7919815 14256 7997336 NM_000396 // CTSK // cathepsin K // 1q21 // 1513 /// ENST00000271651 // NM_020927 // VAT1L // vesicle amine transport protein 1 homolog (T. californica)-like / CTSK NM_000396 0.511445-1.95525 VAT1L NM_020927 0.511545-1.95486 2747 7895259 --- --- 0.511718-1.9542 2255 7894765 --- --- 0.511921-1.95343 13166 NM_018689 // KIAA1199 // KIAA1199 // 15q24 // 7985317 57214 /// ENST00000394685 // KIAA1199 NM_018689 0.51206-1.9529

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 24979 8104607 --- --- 0.512345-1.95181 1102 7893600 --- --- 0.512715-1.9504 24 7892517 --- --- 0.513021-1.94924 2721 7895233 --- --- 0.513139-1.94879 1155 7893653 --- --- 0.513364-1.94793 25674 8111666 --- --- 0.513853-1.94608 11070 7965224 --- --- 0.513872-1.94601 330 7892826 --- --- 0.514455-1.94381 1441 7893942 --- --- 0.514885-1.94218 418 7892914 --- --- 0.514903-1.94211 2532 7895043 --- --- 0.515232-1.94087 6293 7917954 NM_001013660 // FRRS1 // ferric-chelate reductase 1 // 1p21.2 // 391059 /// ENST0000028 FRRS1 NM_001013660 0.515404-1.94023 15794 8013354 --- --- 0.515653-1.93929 2557 7895068 --- --- 0.516302-1.93685 21947 NM_017414 // USP18 // ubiquitin specific 8074606 peptidase 18 // 22q11.21 // 11274 /// ENST0000 USP18 NM_017414 0.516319-1.93679 BX641032 // WEE1 // 8326 7938364 WEE1 homolog (S. pombe) // 11p15.3-p15.1 WEE1 BX641032 0.516455-1.93628 2738 7895250 --- --- 0.516504-1.9361 2341 7894852 --- --- 0.516993-1.93426 3329 7895843 --- --- 0.517381-1.93281 23353 8089203 26818 8122150 NM_020654 // SENP7 // SUMO1/sentrin specific peptidase 7 // 3q12 // 57337 /// NM 001077 NM_004100 // EYA4 // eyes absent homolog 4 (Drosophila) // 6q23 // 2070 /// NM 172105 / SENP7 NM_020654 0.517525-1.93227 EYA4 NM_004100 0.518008-1.93047 2310 7894820 --- --- 0.518036-1.93037 28058 NM_004126 // GNG11 // guanine nucleotide 8134257 binding protein (G protein), gamma 11 // GNG11 NM_004126 0.518133-1.93 203 7892699 --- --- 0.518281-1.92946 1419 7893920 --- --- 0.518692-1.92793 3063 7895576 --- --- 0.518725-1.9278 6296 7917976 NM_194292 // SASS6 // spindle assembly 6 homolog (C. elegans) // 1p21.2 // 163786 /// E SASS6 NM_194292 0.519364-1.92543 1074 7893572 --- --- 0.519638-1.92442

Column # Transcript 8243 7937915 NM_001033 // RRM1 // ribonucleotide reductase M1 // 11p15.5 // 6240 /// ENST00000300738 Ratio(shR RM2B -mut) Change(s hrrm2b RRM1 NM_001033 0.519761-1.92396 4181 7896703 --- --- 0.520015-1.92302 28744 NM_006682 // FGL2 // fibrinogen-like 2 // 8140463 7q11.23 // 10875 /// ENST00000248598 // FGL2 NM_006682 0.520102-1.9227 2495 7895006 --- --- 0.520134-1.92258 19283 NM_152524 // SGOL2 // shugoshin-like 2 (S. 8047288 pombe) // 2q33.1 // 151246 /// SGOL2 NM_152524 0.520249-1.92216 1700 7894203 --- --- 0.520777-1.92021 2149 7894656 --- --- 0.521681-1.91688 2548 7895059 --- --- 0.521862-1.91621 27934 8133062 NR_003099 // ZNF273 // zinc finger protein 273 // 7q11.21 // 10793 /// NM 021148 // ZNF ZNF273 NR_003099 0.521921-1.916 1083 7893581 --- --- 0.522228-1.91487 8387 NM_031418 // ANO3 // anoctamin 3 // 11p14.2 // 7939024 63982 /// ENST00000256737 // ANO3 // ano ANO3 NM_031418 0.522455-1.91404 2955 7895468 --- --- 0.523007-1.91202 1967 7894473 --- --- 0.523058-1.91184 610 7893108 --- --- 0.523181-1.91138 10973 7964271 12445 7978776 NM_000946 // PRIM1 // primase, DNA, polypeptide 1 (49kDa) // 12q13 // 5557 /// NM_018353 // C14orf106 // chromosome 14 open reading frame 106 // 14q21.2 // 55320 /// PRIM1 NM_000946 0.523545-1.91006 C14orf106 NM_018353 0.523873-1.90886 4203 7896725 --- --- 0.523962-1.90854 22834 NM_000882 // IL12A // interleukin 12A (natural 8083690 killer cell stimulatory factor 1, cytoto IL12A NM_000882 0.523962-1.90854 10979 7964347 NM_001130963 // TMEM194A // transmembrane protein 194A // 12q13.3 // 23306 /// NM 01525 TMEM194A NM_001130963 0.524066-1.90816

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 2196 7894705 --- --- 0.524213-1.90762 12552 7979886 --- --- 0.5245-1.90658 22738 NM_178445 // CCRL1 // chemokine (C-C motif) 8082745 receptor-like 1 // 3q22 // CCRL1 NM_178445 0.524533-1.90646 51554 /// NM 016 2591 7895103 --- --- 0.524611-1.90617 3578 7896096 --- --- 0.525328-1.90357 22871 NM_014932 // NLGN1 // neuroligin 1 // 3q26.31 // 8083968 22871 /// NLGN1 NM_014932 0.525497-1.90296 ENST00000457714 // NLGN1 // 2882 7895394 --- --- 0.525572-1.90269 2919 7895432 --- --- 0.525663-1.90236 2366 7894877 --- --- 0.525804-1.90185 1462 7893963 --- --- 0.525854-1.90167 13489 7989144 --- --- 0.526135-1.90065 21245 NR_003674 // KGFLP1 // keratinocyte growth 8067839 factor-like protein 1 // KGFLP1 NR_003674 0.526184-1.90048 9p11.2 // 387628 // 16512 NM_002894 // RBBP8 // retinoblastoma binding 8020468 protein 8 // 18q11.2 // RBBP8 NM_002894 0.526201-1.90041 5932 /// NM 203291 3798 7896316 --- --- 0.526637-1.89884 11458 NM_024808 // C13orf34 // chromosome 13 open 7969374 reading frame 34 // C13orf34 NM_024808 0.527059-1.89732 13q22.1 // 79866 /// EN 9012 NM_025004 // CCDC15 // coiled-coil domain 7944913 containing 15 // 11q24.2 CCDC15 NM_025004 0.527063-1.89731 // 80071 /// ENST000 28746 NM_017439 // PION // pigeon homolog 8140478 (Drosophila) // 7q11.23 // 54103 /// PION NM_017439 0.527079-1.89725 NM_007086 // WDHD1 // 12485 WD repeat and HMG-box 7979281 WDHD1 DNA binding protein 1 // NM_007086 0.527384-1.89615 14q22.2 // 11169 / 3407 7895922 --- --- 0.527487-1.89578 NR_003943 // SNORD77 6748 7922412 // small nucleolar RNA, SNORD77 NR_003943 0.527502-1.89573 C/D box 77 // 1q25.1 // 4939 7904166 --- --- 0.527509-1.8957

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 1500 7894001 --- --- 0.528209-1.89319 3124 7895637 --- --- 0.528436-1.89238 9417 NM_145016 // GLYATL2 // glycine-nacyltransferase-like 2 // 7948354 GLYATL2 NM_145016 0.529086-1.89005 11q12.1 // 219970 /// 26595 NM_018132 // CENPQ // centromere protein Q // 8120165 6p12.3 // 55166 /// CENPQ NM_018132 0.529393-1.88896 ENST00000335783 // CE 3935 7896454 --- --- 0.52942-1.88886 19202 NM_031942 // CDCA7 // cell division cycle 8046488 associated 7 // 2q31 // CDCA7 NM_031942 0.529602-1.88821 83879 /// NM 145810 / 14456 NM_001424 // EMP2 // epithelial membrane 7999387 protein 2 // 16p13.2 // EMP2 NM_001424 0.529658-1.88801 2013 /// ENST000003595 32328 NM_015975 // TAF9B // TAF9B RNA polymerase 8173732 II, TATA box binding TAF9B NM_015975 0.530237-1.88595 protein (TBP)-associate 32634 NM_015975 // TAF9B // TAF9B RNA polymerase 8176263 II, TATA box binding TAF9B NM_015975 0.530237-1.88595 protein (TBP)-associate 16044 NR_027676 // BRCA1 // breast cancer 1, early 8015769 onset // 17q21 // 672 /// BRCA1 NR_027676 0.530595-1.88468 NM 007294 // BRC 24292 8098287 --- --- 0.530959-1.88338 20149 NM_014880 // CD302 // CD302 molecule // 8056102 2q24.2 // 9936 /// ENST00000259053 // CD302 // CD302 NM_014880 0.531163-1.88266 BC035031 // GABPA // 27929 GA binding protein 8133038 GABPA transcription factor, alpha BC035031 0.531325-1.88209 subunit 60kDa // 21 BC095522 // TAS2R5 // 28286 taste receptor, type 2, 8136654 member 5 // 7q31.3-q32 TAS2R5 BC095522 0.531325-1.88209 // 54429 3548 7896066 --- --- 0.531617-1.88105

Column # Transcript 16821 8023415 NM_001083962 // TCF4 // transcription factor 4 // 18q21.1 // 6925 /// NM 003199 // TCF4 Ratio(shR RM2B -mut) Change(s hrrm2b TCF4 NM_001083962 0.531704-1.88075 25971 8114213 --- --- 0.532198-1.879 2162 7894669 --- --- 0.532573-1.87768 510 7893006 --- --- 0.532856-1.87668 23627 8091998 --- --- 0.533101-1.87582 26325 8117476 NM_006994 // BTN3A3 // butyrophilin, subfamily 3, member A3 // 6p21.3 // 10384 /// NM 1 BTN3A3 NM_006994 0.533467-1.87453 2099 7894606 --- --- 0.533601-1.87406 23310 NM_020872 // CNTN3 // contactin 3 8088866 (plasmacytoma associated) // 3p26 // CNTN3 NM_020872 0.53375-1.87354 781 7893279 --- --- 0.533785-1.87341 19583 NM_002381 // MATN3 // matrilin 3 // 2p24-p23 // 8050537 4148 /// ENST00000407540 // MATN3 NM_002381 0.533907-1.87299 690 7893188 --- --- 0.53438-1.87133 8403 NM_001076786 // QSER1 // glutamine and 7939158 serine rich 1 // 11p13 // 79832 /// ENST00000399 QSER1 NM_001076786 0.53438-1.87133 1320 7893819 --- --- 0.534396-1.87127 1097 7893595 --- --- 0.53472-1.87014 20452 NM_004369 // COL6A3 // collagen, type VI, alpha 3 8059905 COL6A3 // 2q37 // 1293 /// NM_004369 0.534823-1.86978 NM 057167 // COL6 9472 7948896 NR_000008 // SNORD22 // small nucleolar RNA, C/D box 22 // 11q13 // 9304 /// AK095849 / SNORD22 NR_000008 0.535237-1.86833 1806 7894310 --- --- 0.535373-1.86786 24423 NM_001130834 // LDB2 // LIM domain binding 2 // 8099524 LDB2 4p16 // 9079 /// NM_001130834 0.535384-1.86782 NM 001290 // LDB2 // L 18500 8039928 AB096683 // FAM72D // family with sequence similarity 72, member D // 1q21.1 // 728833 FAM72D AB096683 0.535499-1.86742

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 31813 NM_194324 // TMSB15B // thymosin beta 15B // 8169073 Xq22.2 // 286527 /// TMSB15B NM_194324 0.535585-1.86712 NR 003238 // H2BFXP / 22870 NM_018098 // ECT2 // epithelial cell 8083941 transforming sequence 2 ECT2 NM_018098 0.535603-1.86706 oncogene // 3q26.1-11696 7971661 --- --- 0.535701-1.86671 2322 7894832 --- --- 0.535708-1.86669 24275 8098163 --- --- 0.535845-1.86621 2869 7895381 --- --- 0.53607-1.86543 229 7892725 --- --- 0.536632-1.86347 10303 7956949 NM_020401 // NUP107 // nucleoporin 107kDa // 12q15 // 57122 /// ENST00000229179 // NUP1 NUP107 NM_020401 0.537127-1.86176 2428 7894939 --- --- 0.537391-1.86084 28759 NM_152754 // SEMA3D // sema domain, 8140686 immunoglobulin domain (Ig), short basic domain, sec SEMA3D NM_152754 0.537676-1.85986 143 7892639 --- --- 0.539152-1.85477 1150 7893648 --- --- 0.539167-1.85471 27779 8131867 --- --- 0.539348-1.85409 24621 8101284 5438 7909146 NM_006259 // PRKG2 // protein kinase, cgmpdependent, type II // 4q13.1-q21.1 // 5593 / AB096683 // FAM72D // family with sequence similarity 72, member D // 1q21.1 // 728833 PRKG2 NM_006259 0.539581-1.85329 FAM72D AB096683 0.539934-1.85208 2112 7894619 --- --- 0.540349-1.85065 3122 7895635 --- --- 0.540711-1.84942 1882 7894387 --- --- 0.540743-1.84931 14899 8003857 --- --- 0.54084-1.84898 3040 7895553 --- --- 0.541151-1.84791 29794 8150163 --- --- 0.541152-1.84791 2516 7895027 --- --- 0.541174-1.84783 4844 7903162 NM_152487 // TMEM56 // transmembrane protein 56 // 1p21.3 // 148534 /// ENST00000370203 TMEM56 NM_152487 0.541525-1.84664 2839 7895351 --- --- 0.54174-1.8459 3878 7896396 --- --- 0.541822-1.84563

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 3575 7896093 --- --- 0.541912-1.84532 3207 7895720 --- --- 0.542078-1.84475 2773 7895285 --- --- 0.542288-1.84404 30093 8152668 21332 8068478 4967 7904452 NM_014109 // ATAD2 // ATPase family, AAA domain containing 2 // 8q24.13 // 29028 /// EN NM_005441 // CHAF1B // chromatin assembly factor 1, subunit B (p60) // 21q22.13 // 8208 AB096683 // FAM72D // family with sequence similarity 72, member D // 1q21.1 // 728833 ATAD2 NM_014109 0.54238-1.84373 CHAF1B NM_005441 0.542412-1.84362 FAM72D AB096683 0.54258-1.84305 664 7893162 --- --- 0.542885-1.84201 2291 7894801 --- --- 0.542964-1.84174 13213 NM_152259 // C15orf42 // chromosome 15 open 7985873 reading frame 42 // 15q26.1 // 90381 /// EN C15orf42 NM_152259 0.543226-1.84085 23593 8091678 8541 7940153 NM_024621 // VEPH1 // ventricular zone expressed PH domain homolog 1 (zebrafish) // NM_022074 // FAM111A // family with sequence similarity 111, member A // 11q12.1 // 639 VEPH1 NM_024621 0.543231-1.84084 FAM111A NM_022074 0.543236-1.84082 3810 7896328 --- --- 0.543384-1.84032 20207 NM_001822 // CHN1 // chimerin (chimaerin) 1 // 8056890 2q31.1 // 1123 /// NM 001025201 // CHN1 CHN1 NM_001822 0.543503-1.83992 29055 8143663 31516 8166632 18042 8035855 NM_004456 // EZH2 // enhancer of zeste homolog 2 (Drosophila) // 7q35-q36 // 2146 /// N NM_001128127 // GK // glycerol kinase // Xp21.3 // 2710 /// NM_203391 // GK // glycerol NM_138286 // ZNF681 // zinc finger protein 681 // 19p12 // 148213 /// ENST00000402377 / EZH2 NM_004456 0.543751-1.83908 GK NM_001128127 0.54389-1.83861 ZNF681 NM_138286 0.544256-1.83737

Column # Transcript 25851 8113124 NM_032290 // ANKRD32 // ankyrin repeat domain 32 // 5q15 // 84250 /// ENST00000265140 / Ratio(shR RM2B -mut) Change(s hrrm2b ANKRD32 NM_032290 0.544813-1.83549 342 7892838 --- --- 0.545214-1.83414 2851 7895363 --- --- 0.545548-1.83302 32364 NM_001128127 // GK // glycerol kinase // Xp21.3 8174103 // 2710 /// NM_000167 // GK // glycerol GK NM_001128127 0.545571-1.83294 11066 7965156 NM_004664 // LIN7A // lin-7 homolog A (C. elegans) // 12q21 // 8825 /// ENST00000261203 LIN7A NM_004664 0.545714-1.83246 2916 7895428 --- --- 0.545848-1.83201 26294 NM_015895 // GMNN // geminin, DNA replication 8117225 inhibitor // 6p22.3 // 51053 /// ENST0000 GMNN NM_015895 0.54588-1.8319 17214 8027354 13245 7986293 21869 8073775 23782 8093500 NR_003662 // RPSAP58 // ribosomal protein SA pseudogene 58 // 19p12 // 388524 /// BC071 NM_018349 // MCTP2 // multiple C2 domains, transmembrane 2 // 15q26.2 // 55784 /// NM_006486 // FBLN1 // fibulin 1 // 22q13.31 // 2192 /// NM_006485 // FBLN1 // fibulin 1 NM_006342 // TACC3 // transforming, acidic coiled-coil containing protein 3 // 4p16.3 / RPSAP58 NR_003662 0.54622-1.83076 MCTP2 NM_018349 0.546274-1.83058 FBLN1 NM_006486 0.546511-1.82979 TACC3 NM_006342 0.546816-1.82877 291 7892787 --- --- 0.54686-1.82862 23697 NM_052969 // RPL39L // ribosomal protein L39-8092654 like // 3q27 // 116832 /// ENST00000296277 RPL39L NM_052969 0.547068-1.82792 5667 7911329 NM_207366 // SEPT14 // septin 14 // 7p11.2 // 346288 /// ENST00000388975 // SEPT14 // s 14-Sep NM_207366 0.547084-1.82787 11189 7966425 --- --- 0.547175-1.82757

Column # Transcript 26949 8123520 BC118988 // C20orf69 // chromosome 20 open reading frame 69 // --- // 140849 /// ENST00 Ratio(shR RM2B -mut) Change(s hrrm2b C20orf69 BC118988 0.547359-1.82696 3484 7896000 --- --- 0.547393-1.82684 737 7893235 --- --- 0.547585-1.8262 8275 NM_001003819 // TRIM6-TRIM34 // 7938012 TRIM6-TRIM34 readthrough transcript // TRIM6-TRIM34 NM_001003819 0.548122-1.82441 12980 7983512 25180 8106660 NM_021199 // SQRDL // sulfide quinone reductase-like (yeast) // 15q15 // 58472 /// ENST NM_006909 // RASGRF2 // Ras protein-specific guanine nucleotidereleasing factor 2 // 5 SQRDL NM_021199 0.548146-1.82433 RASGRF2 NM_006909 0.548253-1.82398 10875 7963206 --- --- 0.548757-1.8223 2482 7894993 --- --- 0.549258-1.82064 24713 NM_001226 // CASP6 // caspase 6, apoptosisrelated cysteine 8102311 peptidase // 4q25 // 839 // CASP6 NM_001226 0.549554-1.81966 4969 7904465 NR_027337 // HIST2H2BA // histone cluster 2, H2ba // 1p12- p11.2 // 337875 /// HIST2H2BA NR_027337 0.549614-1.81946 2843 7895355 --- --- 0.550015-1.81813 7430 7929130 --- --- 0.550048-1.81802 3741 7896259 --- --- 0.550223-1.81745 2593 7895105 --- --- 0.550228-1.81743 1167 7893665 --- --- 0.550617-1.81615 2161 7894668 --- --- 0.550784-1.81559 210 7892706 --- --- 0.551643-1.81277 24229 8097773 NM_006439 // MAB21L2 // mab-21-like 2 (C. elegans) // 4q31 // 10586 /// ENST00000317605 MAB21L2 NM_006439 0.551721-1.81251 1196 7893695 --- --- 0.552263-1.81073 7991 NR_026835 // FLJ37201 // tigger transposable 7934961 element derived 2 pseudogene // 10q23.31 FLJ37201 NR_026835 0.552266-1.81072 20073 8055314 NM_144586 // LYPD1 // LY6/PLAUR domain containing 1 // 2q21.2 // LYPD1 NM_144586 0.552662-1.80943 116372 /// NM 00107742

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 2564 7895075 --- --- 0.552756-1.80912 26827 NM_018945 // PDE7B // phosphodiesterase 7B // 8122222 6q23-q24 // 27115 /// PDE7B NM_018945 0.552778-1.80905 ENST00000308191 // 317 7892813 --- --- 0.55301-1.80829 5084 7905481 --- --- 0.554004-1.80504 19200 NM_007023 // RAPGEF4 // Rap guanine 8046428 nucleotide exchange RAPGEF4 NM_007023 0.554035-1.80494 factor (GEF) 4 // 2q31-2697 7895209 --- --- 0.554473-1.80351 1645 7894147 --- --- 0.554723-1.8027 11324 NM_148957 // TNFRSF19 // tumor 7968015 necrosis factor receptor TNFRSF19 NM_148957 0.554895-1.80214 superfamily, member 19 1324 7893823 --- --- 0.555088-1.80152 3351 7895865 --- --- 0.555818-1.79915 24124 NM_017918 // CCDC109B // coiled-coil 8096808 domain containing 109B CCDC109B NM_017918 0.555818-1.79915 // 4q25 // 55013 /// 382 7892878 --- --- 0.555897-1.79889 351 7892847 --- --- 0.555917-1.79883 5365 NM_024420 // PLA2G4A // phospholipase A2, 7908351 IVA (cytosolic, PLA2G4A NM_024420 0.556108-1.79821 calcium-dependent) // 1 6810 NM_003783 // B3GALT2 // UDP-Gal:betaGlcNAc 7923034 beta 1,3- B3GALT2 NM_003783 0.556563-1.79674 galactosyltransferase, 973 7893471 --- --- 0.556649-1.79646 22637 NM_018394 // ABHD10 // abhydrolase domain 8081612 containing 10 // 3q13.2 // ABHD10 NM_018394 0.557095-1.79503 55347 /// ENST0000 2903 7895415 --- --- 0.557289-1.7944 23334 NM_000313 // PROS1 // protein S (alpha) // 8089011 3q11.2 // 5627 /// PROS1 NM_000313 0.557345-1.79422 ENST00000394236 // PROS1 23597 NM_020169 // LXN // latexin // 3q25.32 // 8091715 56925 /// ENST00000264265 // LXN NM_020169 0.557376-1.79412

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 29505 NM_012082 // ZFPM2 // zinc finger protein, 8147837 multitype 2 // 8q23 // ZFPM2 NM_012082 0.557599-1.7934 23414 /// ENST0000040 28026 NM_002069 // GNAI1 // guanine nucleotide 8133860 binding protein (G GNAI1 NM_002069 0.557633-1.7933 protein), alpha inhibiting 23433 NM_031458 // PARP9 // poly (ADP-ribose) 8090018 polymerase family, PARP9 NM_031458 0.557943-1.7923 member 9 // 3q21 // 6096 NM_001048166 // STIL // SCL/TAL1 interrupting 7915926 locus // 1q32 1p32 // STIL NM_001048166 0.558214-1.79143 6491 /// NM 003035 2892 7895404 --- --- 0.558359-1.79096 1716 7894219 --- --- 0.558428-1.79074 2788 7895300 --- --- 0.558709-1.78984 6557 7920333 --- --- 0.558826-1.78947 6843 7923426 NM_014176 // UBE2T // ubiquitin-conjugating enzyme E2T (putative) // 1q32.1 // 29089 // UBE2T NM_014176 0.558997-1.78892 2244 7894754 --- --- 0.559502-1.7873 2776 7895288 --- --- 0.559504-1.7873 12614 7980477 --- --- 0.559647-1.78684 25479 8109639 27574 8129763 NM_004219 // PTTG1 // pituitary tumortransforming 1 // 5q35.1 // 9232 /// NM_001099286 // FAM54A // family with sequence similarity 54, member A // 6q23.3 // PTTG1 NM_004219 0.559744-1.78653 FAM54A NM_001099286 0.559758-1.78649 1831 7894335 --- --- 0.55993-1.78594 2121 7894628 --- --- 0.560034-1.78561 12215 NM_003384 // VRK1 // vaccinia related kinase 1 7976621 // 14q32 // 7443 /// ENST00000216639 // VRK1 NM_003384 0.560151-1.78523 3272 7895786 --- --- 0.560603-1.78379 1713 7894216 --- --- 0.560741-1.78335 148 7892644 --- --- 0.561293-1.7816 22303 8078155 NM_054110 // GALNTL2 // UDP-N-acetyl-alpha-Dgalactosamine:polypeptid GALNTL2 NM_054110 0.561428-1.78117 e N-acetylgalactos

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 23322 8088952 --- --- 0.561433-1.78116 4988 NM_006472 // TXNIP // thioredoxin interacting 7904726 TXNIP protein // 1q21.1 // 10628 NM_006472 0.561615-1.78058 /// ENST000003 NM_001827 // CKS2 // 30469 CDC28 protein kinase 8156290 regulatory subunit 2 // CKS2 NM_001827 0.561996-1.77937 9q22 // 1164 /// ENST 4137 7896659 --- --- 0.562269-1.77851 19259 NM_017694 // MFSD6 // major facilitator 8047078 superfamily domain MFSD6 NM_017694 0.56239-1.77812 containing 6 // 2q32.2 // 14827 NM_016095 // GINS2 // GINS complex subunit 2 8003204 (Psf2 homolog) // GINS2 NM_016095 0.562664-1.77726 16q24.1 // 51659 /// ENS 2944 7895457 --- --- 0.562807-1.77681 20562 NM_003092 // SNRPB2 // small nuclear 8061075 ribonucleoprotein polypeptide B'' // 20p12.2-p11.2 SNRPB2 NM_003092 0.562953-1.77635 NR_003081 // GSTTP1 // 22005 glutathione S-transferase 8074988 GSTTP1 theta pseudogene 1 // NR_003081 0.562997-1.77621 22q12 // 25774 / 14743 8002264 --- --- 0.563399-1.77494 NM_172174 // IL15 // 24205 interleukin 15 // 4q31 // 8097553 3600 /// NM_000585 // IL15 NM_172174 0.563407-1.77492 IL15 // interleuki 25348 NM_001964 // EGR1 // early growth response 1 8108370 // 5q31.1 // 1958 /// EGR1 NM_001964 0.563867-1.77347 ENST00000239938 // E 16443 NM_015295 // SMCHD1 // structural maintenance 8019877 of chromosomes flexible SMCHD1 NM_015295 0.564227-1.77233 hinge domain cont 19487 NM_001137550 // LRRFIP1 // leucine rich 8049532 repeat (in FLII) interacting protein 1 // LRRFIP1 NM_001137550 0.565295-1.76899

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 7198 NM_001826 // CKS1B // CDC28 protein kinase 7926896 regulatory subunit 1B // CKS1B NM_001826 0.565375-1.76874 1q21.2 // 1163 /// 20262 NM_016192 // TMEFF2 // transmembrane protein 8057803 with EGF-like and two TMEFF2 NM_016192 0.5654-1.76866 follistatin-like dom 1858 7894363 --- --- 0.565713-1.76768 23964 NM_015236 // LPHN3 // latrophilin 3 // 4q13.1 // 8095303 23284 /// ENST00000280009 // LPHN3 // LPHN3 NM_015236 0.565783-1.76746 11005 7964640 --- --- 0.566254-1.76599 46 7892540 --- --- 0.566525-1.76515 2282 7894792 --- --- 0.566672-1.76469 807 7893305 --- --- 0.567255-1.76288 2702 7895214 --- --- 0.567589-1.76184 8 7892501 --- --- 0.567631-1.76171 4897 7903742 21251 8067864 NM_000850 // GSTM4 // glutathione S-transferase mu 4 // 1p13.3 // 2948 /// NR 024538 // NR_003366 // ANKRD20B // ankyrin repeat domain 20B // 2q11.1 // 729171 /// GSTM4 NM_000850 0.567671-1.76158 ANKRD20B NR_003366 0.567977-1.76063 30013 8151927 --- --- 0.568552-1.75886 25741 NM_001826 // CKS1B // CDC28 protein kinase 8112327 regulatory subunit 1B // 1q21.2 // 1163 /// CKS1B NM_001826 0.568978-1.75754 12866 7982287 14108 7995681 29199 8144786 NM_001039841 // ARHGAP11B // Rho GTPase activating protein 11B // 15q13.2 // NM_004530 // MMP2 // matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa t NM_003046 // SLC7A2 // solute carrier family 7 (cationic amino acid transporter, y+ sys ARHGAP11B NM_001039841 0.569065-1.75727 MMP2 NM_004530 0.569074-1.75724 SLC7A2 NM_003046 0.56972-1.75525 3021 7895534 --- --- 0.569725-1.75523 293 7892789 --- --- 0.569818-1.75495 3715 7896233 --- --- 0.570056-1.75421

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 19198 NM_002610 // PDK1 // pyruvate dehydrogenase 8046408 kinase, isozyme 1 // PDK1 NM_002610 0.570154-1.75391 2q31.1 // 5163 /// ENS 22682 NM_017554 // PARP14 // poly (ADP-ribose) 8082100 polymerase family, PARP14 NM_017554 0.570193-1.75379 member 14 // 3q21.1 // 706 7893204 --- --- 0.57026-1.75359 NM_194318 // B3GALTL 11361 // beta 1,3-7968370 B3GALTL galactosyltransferase-like NM_194318 0.570442-1.75303 // 13q12.3 // 145173 /// 5251 7906954 22636 8081590 28758 8140668 NM_002585 // PBX1 // pre-b-cell leukemia homeobox 1 // 1q23 // 5087 /// NM_001134439 // PHLDB2 // pleckstrin homology-like domain, family B, member 2 // NM_006080 // SEMA3A // sema domain, immunoglobulin domain (Ig), short basic domain, sec PBX1 NM_002585 0.570598-1.75255 PHLDB2 NM_001134439 0.570869-1.75171 SEMA3A NM_006080 0.571259-1.75052 466 7892962 --- --- 0.57134-1.75027 9831 7952313 --- --- 0.571423-1.75002 12784 NR_003333 // SNORD116-18 // small 7981984 nucleolar RNA, C/D box 116-18 // 15q11.2 // SNORD116-18 NR_003333 0.571534-1.74968 856 7893354 --- --- 0.571695-1.74918 5603 7910944 --- --- 0.571838-1.74875 27412 NR_003044 // SNORD50B // small 8127989 nucleolar RNA, C/D box 50B // 6q14.3 // 692088 SNORD50B NR_003044 0.57238-1.74709 17505 8030383 16435 8019804 NM_020650 // RCN3 // reticulocalbin 3, EF-hand calcium binding domain // 19q13.33 // 57 BC041849 // ROCK1 // Rho-associated, coiledcoil containing protein kinase 1 // 18q11.1 RCN3 NM_020650 0.572482-1.74678 ROCK1 BC041849 0.572605-1.7464 13854 7992893 --- --- 0.572735-1.74601 24987 8104625 --- --- 0.572798-1.74582

Column # Transcript 16444 8019885 NM_015295 // SMCHD1 // structural maintenance of chromosomes flexible hinge domain cont Ratio(shR RM2B -mut) Change(s hrrm2b SMCHD1 NM_015295 0.572872-1.74559 29 7892522 --- --- 0.57291-1.74547 22357 8078688 --- --- 0.573022-1.74513 ENST00000308855 // 14924 FAM64A // family with 8004167 sequence similarity 64, member A // 17p13.2 // FAM64A ENST0000030885 0.573143-1.74476 7220 7927095 32713 8176865 32803 8177460 12066 7975076 6241 7917503 BC032332 // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase BC032332 // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase BC032332 // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase NM_021979 // HSPA2 // heat shock 70kDa protein 2 // 14q24.1 // 3306 /// NM_018284 // GBP3 // guanylate binding protein 3 // 1p22.2 // 2635 /// ENST00000370481 PCMTD2 BC032332 0.573351-1.74413 PCMTD2 BC032332 0.573351-1.74413 PCMTD2 BC032332 0.573351-1.74413 HSPA2 NM_021979 0.573804-1.74275 GBP3 NM_018284 0.573828-1.74268 3050 7895563 --- --- 0.574553-1.74048 32427 NM_000640 // IL13RA2 // interleukin 13 receptor, 8174598 alpha 2 // Xq13.1-q28 // 3598 /// ENST IL13RA2 NM_000640 0.574671-1.74013 14095 7995523 --- --- 0.574859-1.73956 26312 NM_021063 // HIST1H2BD // histone 8117382 cluster 1, H2bd // 6p21.3 // 3017 /// NM 138720 // HIST1H2BD NM_021063 0.574918-1.73938 2823 7895335 --- --- 0.575084-1.73888 31777 NM_001939 // DRP2 // dystrophin related protein 8168817 DRP2 2 // Xq22 // 1821 /// NM_001939 0.575551-1.73746 ENST00000395209 / 3661 7896179 --- --- 0.57572-1.73696 1766 7894270 --- --- 0.575852-1.73656 1345 7893844 --- --- 0.575859-1.73654

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 12994 7983661 --- --- 0.576155-1.73565 32268 8173206 --- --- 0.576251-1.73536 32056 NM_015419 // MXRA5 // matrix-remodelling 8171172 MXRA5 associated 5 // Xp22.33 // NM_015419 0.576372-1.73499 25878 /// ENST00000 44 7892538 --- --- 0.57639-1.73494 29514 8147988 --- --- 0.576524-1.73453 11063 7965150 --- --- 0.576878-1.73347 NM_001145664 // hcg_1645516 // 19953 8054344 hypothetical protein hcg_1645516 NM_001145664 0.576916-1.73335 LOC731220 // 2q11.2 // 731220 /// E 562 7893060 --- --- 0.576998-1.73311 30569 8157231 --- --- 0.577242-1.73238 4118 7896640 --- --- 0.577638-1.73119 NM_018154 // ASF1B // 17937 ASF1 anti-silencing 8034772 function 1 homolog B (S. cerevisiae) // 19p13 ASF1B NM_018154 0.577687-1.73104 NM_001099677 // 29189 C8orf79 // chromosome 8 8144712 C8orf79 open reading frame 79 // NM_001099677 0.577745-1.73087 8p22 // 57604 /// NM 0 747 7893245 --- --- 0.577817-1.73065 28285 8136652 --- --- 0.578126-1.72973 ENST00000433145 // 15138 LOC400590 // 8006237 hypothetical LOC400590 // 17q11.2 // 400590 LOC400590 ENST0000043314 0.579034-1.72701 6823 7923175 --- --- 0.579471-1.72571 2100 7894607 --- --- 0.579742-1.7249 23919 NM_000812 // GABRB1 // gamma-aminobutyric 8094901 acid (GABA) A receptor, GABRB1 NM_000812 0.579929-1.72435 beta 1 // 4p12 // 256 4059 7896581 --- --- 0.580437-1.72284 4556 NM_003462 // DNALI1 // dynein, axonemal, light 7900159 intermediate chain 1 // DNALI1 NM_003462 0.580564-1.72246 1p35.1 // 7802 / 2899 7895411 --- --- 0.580665-1.72216 814 7893312 --- --- 0.580787-1.7218 1221 7893720 --- --- 0.580989-1.7212 1966 7894472 --- --- 0.581066-1.72097

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 9209 NM_030962 // SBF2 // SET binding factor 2 // 7946516 11p15.4 // 81846 /// SBF2 NM_030962 0.581068-1.72097 ENST00000256190 // SB 25456 NM_001099293 // KIF4B // kinesin family member 8109484 4B // 5q33.1 // 285643 /// KIF4B NM_001099293 0.581192-1.7206 NM 012310 // 10408 AK302724 // C12orf48 // chromosome 12 open 7958031 reading frame 48 // 12q23.2 // 55010 /// AK3 C12orf48 AK302724 0.581434-1.71989 24325 8098581 10247 7956271 NM_031953 // SNX25 // sorting nexin 25 // 4q35.1 // 83891 /// ENST00000264694 // SNX25 NM_003725 // HSD17B6 // hydroxysteroid (17- beta) dehydrogenase 6 homolog (mouse) // 12q SNX25 NM_031953 0.581475-1.71976 HSD17B6 NM_003725 0.581499-1.71969 3094 7895607 --- --- 0.581784-1.71885 13065 NR_003105 // ZWILCH // Zwilch, kinetochore 7984330 associated, homolog (Drosophila) // 15q22.31 ZWILCH NR_003105 0.582133-1.71782 2296 7894806 --- --- 0.582164-1.71773 25146 8106278 --- --- 0.582298-1.71733 11771 NM_005845 // ABCC4 // ATP-binding cassette, 7972297 sub-family C (CFTR/MRP), member 4 ABCC4 NM_005845 0.582754-1.71599 10 7892503 --- --- 0.582861-1.71567 8758 NM_006591 // POLD3 // polymerase (DNAdirected), delta 3, 7942527 accessory subunit // POLD3 NM_006591 0.58312-1.71491 7746 7932703 NM_145698 // ACBD5 // acyl-coenzyme A binding domain containing 5 // 10p12.1 // ACBD5 NM_145698 0.583308-1.71436 90 7892585 --- --- 0.583459-1.71392 9479 NR_002565 // SNORD25 // small nucleolar RNA, 7948910 C/D box 25 // 11q13 // 9303 /// AK095849 / SNORD25 NR_002565 0.583469-1.71389 2374 7894885 --- --- 0.583588-1.71354 22838 8083737 --- --- 0.583747-1.71307

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 1023 7893521 --- --- 0.584022-1.71226 1206 7893705 --- --- 0.584027-1.71225 14079 NM_014321 // ORC6L // origin recognition 7995354 complex, subunit 6 like (yeast) // 16q12 // 23 ORC6L NM_014321 0.584191-1.71177 NM_001042517 // 11718 DIAPH3 // diaphanous 7971866 DIAPH3 homolog 3 (Drosophila) // NM_001042517 0.58423-1.71165 13q21.2 // 81624 /// NM 6245 7917530 --- --- 0.584287-1.71149 6965 NM_173083 // LIN9 // lin- 9 homolog (C. elegans) // 7924712 LIN9 1q42.12 // 286826 /// NM_173083 0.584729-1.71019 ENST0000032820 3866 7896384 --- --- 0.584927-1.70962 3889 7896407 --- --- 0.585116-1.70906 NM_018843 // 28767 SLC25A40 // solute 8140814 carrier family 25, member 40 // 7q21.12 // SLC25A40 NM_018843 0.585127-1.70903 NM_017631 // DDX60 // 24869 DEAD (Asp-Glu-Ala-Asp) 8103563 DDX60 box polypeptide 60 // NM_017631 0.585562-1.70776 4q32.3 // 55601 /// 2913 7895425 --- --- 0.58557-1.70774 NR_003102 // POT1 // 28952 POT1 protection of 8142697 telomeres 1 homolog (S. POT1 NR_003102 0.58587-1.70686 pombe) // 7q31.33 // 25 30278 NM_000459 // TEK // TEK tyrosine kinase, 8154692 endothelial // 9p21 // TEK NM_000459 0.58604-1.70637 7010 /// 19101 NR_002973 // SNORA40 // small nucleolar RNA, 8045423 H/ACA box 40 // 11q21 // SNORA40 NR_002973 0.586461-1.70514 677822 /// AK1280 600 7893098 --- --- 0.586702-1.70444 3155 7895668 --- --- 0.587121-1.70323 9943 NM_014865 // NCAPD2 // non-smc condensin I 7953351 complex, subunit D2 // NCAPD2 NM_014865 0.587156-1.70313 12p13.3 // 9918 /// E 6167 NM_014288 // ITGB3BP // integrin beta 3 binding 7916727 protein (beta3- endonexin) // 1p31.3 // ITGB3BP NM_014288 0.587303-1.7027

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 890 7893388 --- --- 0.587992-1.7007 7877 NM_145307 // RTKN2 // rhotekin 2 // 10q21.2 // 7933855 219790 /// RTKN2 NM_145307 0.588001-1.70068 ENST00000373789 // RTKN2 // r 30354 NM_033655 // CNTNAP3 // contactin associated 8155359 protein-like 3 // 9p13.1 // CNTNAP3 NM_033655 0.588087-1.70043 79937 /// AF33 11436 NM_018204 // CKAP2 // cytoskeleton associated 7969243 protein 2 // 13q14 // CKAP2 NM_018204 0.5881-1.70039 26586 /// NM 001098 1509 7894010 --- --- 0.588178-1.70017 30 7892524 --- --- 0.58826-1.69993 3017 7895530 --- --- 0.588468-1.69933 13589 NM_003612 // SEMA7A // semaphorin 7A, GPI 7990345 membrane anchor (John Milton Hagen blood grou SEMA7A NM_003612 0.588535-1.69914 NM_032199 // AR5B // 7290 AT rich interactive 7927732 AR5B domain 5B (MRF1-like) // NM_032199 0.589125-1.69743 10q21.2 // 84159 // 31472 8166264 --- --- 0.589139-1.69739 NM_004370 // COL12A1 27378 // collagen, type XII, 8127563 alpha 1 // 6q12-q13 // COL12A1 NM_004370 0.589155-1.69735 1303 /// NM 080645 / 18781 NM_001615 // ACTG2 // actin, gamma 2, smooth 8042788 muscle, enteric // 2p13.1 ACTG2 NM_001615 0.589157-1.69734 // 72 /// ENST00 30388 NM_033655 // CNTNAP3 // contactin associated 8155540 protein-like 3 // 9p13.1 // CNTNAP3 NM_033655 0.589334-1.69683 79937 /// AF33 30982 NM_033655 // CNTNAP3 // contactin associated 8161460 protein-like 3 // 9p13.1 // CNTNAP3 NM_033655 0.589334-1.69683 79937 /// AF33 19249 NM_016315 // GULP1 // GULP, engulfment 8046906 adaptor PTB domain GULP1 NM_016315 0.589493-1.69637 containing 1 // 2q32.3-810 7893308 --- --- 0.589829-1.69541

Column # Transcript 11139 7965918 NM_001031701 // NT5DC3 // 5'- nucleotidase domain containing 3 // 12q22- Ratio(shR RM2B -mut) Change(s hrrm2b NT5DC3 NM_001031701 0.589991-1.69494 30222 8154215 --- --- 0.590046-1.69478 33185 8180299 --- --- 0.590059-1.69475 18667 8041642 --- --- 0.590104-1.69462 2180 7894688 --- --- 0.590219-1.69429 NR_000013 // 15108 8005951 SNORD42B // small nucleolar RNA, C/D box SNORD42B NR_000013 0.590273-1.69413 315 7892811 --- --- 0.590282-1.69411 1583 7894084 --- --- 0.590293-1.69407 15464 8009515 --- --- 0.590296-1.69407 20521 8060675 NM_021873 // CDC25B // cell division cycle 25 homolog B (S. pombe) // 20p13 // 994 /// CDC25B NM_021873 0.590343-1.69393 1477 7893978 --- --- 0.590394-1.69379 25309 8107940 --- --- 0.590537-1.69337 24721 NM_001099776 // C4orf21 // chromosome 4 8102371 C4orf21 open reading frame 21 // NM_001099776 0.591072-1.69184 4q25 // 55345 /// BX64 1029 7893527 --- --- 0.591598-1.69034 7043 NM_022469 // GREM2 // gremlin 2, cysteine knot 7925452 superfamily, homolog (Xenopus laevis) // GREM2 NM_022469 0.591643-1.69021 16185 8017133 NM_182620 // SKA2 // spindle and kinetochore associated complex subunit 2 // 17q22 // 3 SKA2 NM_182620 0.592053-1.68904 880 7893378 --- --- 0.59243-1.68796 15368 NM_005486 // TOM1L1 // target of myb1 (chicken)- 8008547 like 1 // 17q23.2 // 10040 /// ENST0000 TOM1L1 NM_005486 0.59289-1.68665 17875 8034122 NM_182513 // SPC24 // SPC24, NDC80 kinetochore complex component, homolog (S. cerevisia SPC24 NM_182513 0.592933-1.68653 31656 8167910 --- --- 0.593146-1.68593 29112 AK094159 // FLJ36840 // 8144228 hypothetical LOC645524 FLJ36840 AK094159 0.593565-1.68473 // --- // 645524 248 7892744 --- --- 0.593778-1.68413

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 5673 7911341 --- --- 0.593816-1.68402 1312 7893811 --- --- 0.594218-1.68288 11933 NM_017769 // G2E3 // G2/M-phase specific E3 7973756 ubiquitin ligase // 14q12 G2E3 NM_017769 0.594499-1.68209 // 55632 /// ENST 7189 NM_032844 // MASTL // microtubule associated 7926821 serine/threonine kinaselike MASTL NM_032844 0.594857-1.68108 // 10p12.1 // 20276 NM_144629 // RFTN2 // raftlin family member 2 // 8058063 2q33.1 // 130132 /// RFTN2 NM_144629 0.594872-1.68103 ENST00000295049 / 8877 NM_000829 // GRIA4 // glutamate receptor, 7943530 ionotrophic, AMPA 4 // GRIA4 NM_000829 0.595103-1.68038 11q22 // 2893 /// NM 0 3451 7895967 --- --- 0.595118-1.68034 3185 7895698 --- --- 0.596002-1.67785 24566 NM_021139 // UGT2B4 // UDP 8100784 glucuronosyltransferase UGT2B4 NM_021139 0.596211-1.67726 2 family, polypeptide B4 // 4q13 // 22692 8082240 --- --- 0.59625-1.67715 5277 BC091516 // C1orf112 // chromosome 1 open 7907183 reading frame 112 // C1orf112 BC091516 0.596293-1.67703 1q24.2 // 55732 /// NM 0 28701 8140035 --- --- 0.596774-1.67568 17409 8029435 --- --- 0.596869-1.67541 2690 7895202 --- --- 0.596956-1.67517 NM_001123375 // 6463 HIST2H3D // histone 7919589 HIST2H3D cluster 2, H3d // 1q21.2 // NM_001123375 0.597001-1.67504 653604 /// NM_016831 // PER3 // 4274 period homolog 3 7897378 (Drosophila) // 1p36.23 // PER3 NM_016831 0.59714-1.67465 8863 /// ENST000003619 1631 7894133 --- --- 0.597276-1.67427 2748 7895260 --- --- 0.597333-1.67411 480 7892976 --- --- 0.597376-1.67399 2203 7894712 --- --- 0.597473-1.67371 2000 7894506 --- --- 0.597535-1.67354 1860 7894365 --- --- 0.597545-1.67351

Column # Transcript 25734 8112260 NM_018369 // DEPDC1B // DEP domain containing 1B // 5q12.1 // 55789 /// NM 001145208 // Ratio(shR RM2B -mut) Change(s hrrm2b DEPDC1B NM_018369 0.597716-1.67304 11130 7965842 --- --- 0.597763-1.6729 73 7892568 --- --- 0.598386-1.67116 1914 7894419 --- --- 0.598475-1.67091 1534 7894035 --- --- 0.598525-1.67077 23899 8094719 9697 7951046 NM_018177 // N4BP2 // NEDD4 binding protein 2 // 4p14 // 55728 /// ENST00000261435 // N NM_005591 // MRE11A // MRE11 meiotic recombination 11 homolog A (S. N4BP2 NM_018177 0.598621-1.67051 MRE11A NM_005591 0.598676-1.67035 2563 7895074 --- --- 0.598701-1.67028 13449 NM_014985 // CEP152 // centrosomal protein 7988537 152kDa // 15q21.1 // 22995 /// CEP152 NM_014985 0.59911-1.66914 2449 7894960 --- --- 0.599117-1.66912 2664 7895176 --- --- 0.599269-1.6687 1091 7893589 --- --- 0.599328-1.66853 23422 8089875 25288 8107706 NM_199420 // POLQ // polymerase (DNA directed), theta // 3q13.33 // 10721 /// NM_005573 // LMNB1 // lamin B1 // 5q23.3-q31.1 // 4001 /// ENST00000261366 // POLQ NM_199420 0.599463-1.66816 LMNB1 NM_005573 0.599496-1.66807 1344 7893843 --- --- 0.599544-1.66793 6736 NM_003326 // TNFSF4 // tumor necrosis factor 7922343 (ligand) superfamily, member 4 // 1q25 // TNFSF4 NM_003326 0.599835-1.66712 2416 7894927 --- --- 0.600087-1.66642 2172 7894679 --- --- 0.600201-1.66611 21876 NM_016426 // GTSE1 // G-2 and S-phase 8073858 expressed 1 // 22q13.2- q13.3 // 51512 /// GTSE1 NM_016426 0.600277-1.6659 7349 7928367 --- --- 0.600349-1.6657 13032 7984008 --- --- 0.600364-1.66566

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 24761 NM_144643 // SCLT1 // sodium channel and 8102751 clathrin linker 1 // 4q28.2 SCLT1 NM_144643 0.600491-1.6653 // 132320 /// ENST 4851 NM_014839 // LPPR4 // plasticity related gene 1 7903214 // 1p21.2 // 9890 /// LPPR4 NM_014839 0.600584-1.66505 ENST00000370185 / 29904 8151207 --- --- 0.600656-1.66485 NM_006820 // IFI44L // 4782 interferon-induced 7902541 IFI44L protein 44-like // 1p31.1 // NM_006820 0.600974-1.66397 10964 /// ENST00 26734 8121416 --- --- 0.60102-1.66384 3095 7895608 --- --- 0.601101-1.66361 498 7892994 --- --- 0.601148-1.66348 523 7893019 --- --- 0.601333-1.66297 31966 8170326 NM_002024 // FMR1 // fragile X mental retardation 1 // Xq27.3 // 2332 /// ENST000003704 FMR1 NM_002024 0.601434-1.66269 2213 7894722 --- --- 0.601524-1.66245 25728 8112196 --- --- 0.601665-1.66206 27927 8133034 --- --- 0.601778-1.66174 3822 7896340 --- --- 0.602106-1.66084 18112 8036418 --- --- 0.602118-1.6608 3093 7895606 --- --- 0.602242-1.66046 27326 8127031 10819 7962487 NM_002388 // MCM3 // minichromosome maintenance complex component 3 // 6p12 // 4172 /// NR_026583 // RACGAP1P // Rac GTPase activating protein 1 pseudogene // MCM3 NM_002388 0.602422-1.65997 RACGAP1P NR_026583 0.602519-1.6597 2390 7894901 --- --- 0.603065-1.6582 2389 7894900 --- --- 0.603422-1.65722 1056 7893554 --- --- 0.603721-1.65639 3053 7895566 --- --- 0.603773-1.65625 2450 7894961 --- --- 0.603807-1.65616 2365 7894876 --- --- 0.603826-1.65611 332 7892828 --- --- 0.603857-1.65602 29111 8144226 --- --- 0.603871-1.65598 3242 7895755 --- --- 0.603895-1.65592

Column # Transcript 26763 8121632 NM_002269 // KPNA5 // karyopherin alpha 5 (importin alpha 6) // 6q22.1 // 3841 /// ENST Ratio(shR RM2B -mut) Change(s hrrm2b KPNA5 NM_002269 0.603903-1.65589 1013 7893511 --- --- 0.604141-1.65524 2130 7894637 --- --- 0.604224-1.65502 13935 7993774 --- --- 0.604263-1.65491 25248 8107307 NM_001744 // CAMK4 // calcium/calmodulindependent protein kinase IV // 5q21.3 // 814 / CAMK4 NM_001744 0.604882-1.65322 3647 7896165 --- --- 0.60516-1.65246 2924 7895437 --- --- 0.605295-1.65209 27882 NM_017645 // HAUS6 // HAUS augmin-like 8132843 complex, subunit 6 // 9p22.1 // 54801 /// HAUS6 NM_017645 0.605483-1.65157 3400 7895915 --- --- 0.605551-1.65139 2002 7894508 --- --- 0.605555-1.65138 24835 8103372 --- --- 0.605834-1.65062 16252 8017885 22931 8084708 NM_007168 // ABCA8 // ATP-binding cassette, sub-family A (ABC1), member 8 // 17q24 // 1 NR_002588 // SNORA4 // small nucleolar RNA, H/ACA box 4 // 3q27 // 619568 /// AK296279 ABCA8 NM_007168 0.605887-1.65047 SNORA4 NR_002588 0.605887-1.65047 482 7892978 --- --- 0.605903-1.65043 1543 7894044 --- --- 0.606038-1.65006 31499 NM_016937 // POLA1 // polymerase (DNA 8166525 directed), alpha 1, catalytic subunit // POLA1 NM_016937 0.606198-1.64963 13389 7987636 28918 8142424 10161 7955469 NM_007280 // OIP5 // Opa interacting protein 5 // 15q15.1 // 11339 /// ENST00000220514 NM_001146265 // GPR85 // G proteincoupled receptor 85 // 7q31 // 54329 /// NM_001039960 // SLC4A8 // solute carrier family 4, sodium bicarbonate OIP5 NM_007280 0.606201-1.64962 GPR85 NM_001146265 0.606259-1.64946 SLC4A8 NM_001039960 0.606374-1.64915 6905 7924069 --- --- 0.606712-1.64823 2707 7895219 --- --- 0.606835-1.6479

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 25052 8105300 --- --- 0.606883-1.64776 3275 7895789 --- --- 0.607028-1.64737 2789 7895301 --- --- 0.607274-1.6467 6363 7918759 NM_005872 // BCAS2 // breast carcinoma amplified sequence 2 // 1p21-p13.3 // 10286 /// BCAS2 NM_005872 0.607766-1.64537 6429 7919324 --- --- 0.608115-1.64443 645 7893143 --- --- 0.608192-1.64422 7104 NM_002627 // PFKP // phosphofructokinase, 7925876 platelet // 10p15.3-p15.2 // 5214 /// ENST000 PFKP NM_002627 0.608236-1.6441 3910 7896429 --- --- 0.608804-1.64257 4477 7899375 --- --- 0.609133-1.64168 9114 7945894 --- --- 0.609158-1.64161 7223 7927106 --- --- 0.609471-1.64077 13490 7989146 NM_018365 // MNS1 // meiosis-specific nuclear structural 1 // 15q21.3 // 55329 /// ENST MNS1 NM_018365 0.60965-1.64029 2452 7894963 --- --- 0.609965-1.63944 5776 7912525 --- --- 0.610132-1.63899 13751 NM_001008393 // C4orf46 // chromosome 4 7991777 C4orf46 open reading frame 46 // NM_001008393 0.61026-1.63865 4q32.1 // 201725 /// E 1554 7894055 --- --- 0.610404-1.63826 28537 NM_005020 // PDE1C // phosphodiesterase 1C, 8138888 calmodulin-dependent 70kDa // 7p14.3 // 513 PDE1C NM_005020 0.610403-1.63826 27151 8125125 32924 8178641 33048 8179839 30512 8156706 NM_021177 // LSM2 // LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) // 6 NM_021177 // LSM2 // LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) // 6 NM_021177 // LSM2 // LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) // 6 NM_003275 // TMOD1 // tropomodulin 1 // 9q22.3 // 7111 /// ENST00000259365 // LSM2 NM_021177 0.610471-1.63808 LSM2 NM_021177 0.610471-1.63808 LSM2 NM_021177 0.610471-1.63808 TMOD1 NM_003275 0.610489-1.63803

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 1773 7894277 --- --- 0.610571-1.63781 2300 7894810 --- --- 0.610757-1.63731 2005 7894511 --- --- 0.610869-1.63701 21730 8072344 --- --- 0.611-1.63666 213 7892709 --- --- 0.611188-1.63616 2059 7894565 --- --- 0.611256-1.63598 386 7892882 --- --- 0.611305-1.63584 3160 7895673 --- --- 0.611396-1.6356 32253 8173156 --- --- 0.611405-1.63558 11376 7968658 NM_181503 // EXOSC8 // exosome component 8 // 13q13.1 // 11340 /// NM 001014286 // FAM4 EXOSC8 NM_181503 0.61145-1.63546 1050 7893548 --- --- 0.611481-1.63537 29381 8146647 --- --- 0.611499-1.63533 1078 7893576 --- --- 0.611621-1.635 10715 7961365 NM_018050 // MANSC1 // MANSC domain containing 1 // 12p13.2 // 54682 /// MANSC1 NM_018050 0.6117-1.63479 1407 7893908 --- --- 0.611715-1.63475 29716 NM_139167 // SGCZ // sarcoglycan zeta // 8p22 8149438 // 137868 /// ENST00000382080 // SGCZ // SGCZ NM_139167 0.611781-1.63457 1350 7893849 --- --- 0.612009-1.63396 5867 7913556 --- --- 0.612211-1.63342 1475 7893976 --- --- 0.612376-1.63298 33081 8180195 --- --- 0.612539-1.63255 5061 7905220 19491 8049540 NM_004425 // ECM1 // extracellular matrix protein 1 // 1q21 // 1893 /// NM 022664 // EC NM_001137550 // LRRFIP1 // leucine rich repeat (in FLII) interacting protein 1 // ECM1 NM_004425 0.612834-1.63176 LRRFIP1 NM_001137550 0.612869-1.63167 25088 8105605 --- --- 0.613226-1.63072 27180 NM_004159 // PSMB8 // proteasome (prosome, 8125500 macropain) subunit, beta type, 8 (large mult PSMB8 NM_004159 0.613228-1.63071 32944 8178855 NM_004159 // PSMB8 // proteasome (prosome, macropain) subunit, beta type, 8 (large mult PSMB8 NM_004159 0.613228-1.63071

Column # Transcript 33065 8180049 NM_004159 // PSMB8 // proteasome (prosome, macropain) subunit, beta type, 8 (large mult Ratio(shR RM2B -mut) Change(s hrrm2b PSMB8 NM_004159 0.613228-1.63071 2241 7894751 --- --- 0.613423-1.6302 19315 8047563 --- --- 0.613689-1.62949 9759 NM_020809 // ARHGAP20 // Rho 7951565 GTPase activating protein 20 // 11q23.1 // ARHGAP20 NM_020809 0.613801-1.62919 5983 7914807 --- --- 0.613896-1.62894 ENST00000287660 // 12928 7982876 FAM92A2 // CG6405-PAlike FAM92A2 ENST0000028766 0.613948-1.6288 // 15q15.1 // 729073 1736 7894239 --- --- 0.613993-1.62868 757 7893255 --- --- 0.614086-1.62844 3657 7896175 --- --- 0.614178-1.62819 7440 7929288 NM_019053 // EXOC6 // exocyst complex component 6 // 10q23.33 // 54536 /// EXOC6 NM_019053 0.614191-1.62816 1297 7893796 --- --- 0.614339-1.62776 XM_001724690 // 26214 LOC100128372 // similar 8116593 LOC100128372 XM_001724690 to hcg2040192 // 6p25.2 0.614399-1.62761 // 100128372 12787 7981990 25183 8106709 NR_003335 // SNORD116-21 // small nucleolar RNA, C/D box 116-21 // 15q11.2 // NM_031482 // ATG10 // ATG10 autophagy related 10 homolog (S. cerevisiae) // 5q14.1-q14. SNORD116-21 NR_003335 0.614402-1.6276 ATG10 NM_031482 0.614494-1.62736 793 7893291 --- --- 0.614792-1.62657 6794 NM_052966 // FAM129A // family with sequence 7922846 similarity 129, member A // 1q25 // 116496 FAM129A NM_052966 0.614888-1.62631 9476 NR_002562 // SNORD28 7948904 // small nucleolar RNA, SNORD28 NR_002562 0.615219-1.62544 C/D box 28 // 11q13 // 3736 7896254 --- --- 0.615459-1.6248 3745 7896263 --- --- 0.615472-1.62477 22235 8077270 NM_006614 // CHL1 // cell adhesion molecule with homology to L1CAM (close homolog of L1 CHL1 NM_006614 0.615796-1.62392

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 31033 8161852 --- --- 0.615948-1.62351 7716 NM_182543 // NSUN6 // NOL1/NOP2/Sun domain 7932433 NSUN6 family, member 6 // NM_182543 0.616055-1.62323 10p12.31 // 221078 /// E 5514 7910010 --- --- 0.616718-1.62149 NM_021080 // DAB1 // 6148 disabled homolog 1 7916541 (Drosophila) // 1p32-p31 DAB1 NM_021080 0.61678-1.62132 // 1600 /// ENST000003 1364 7893864 --- --- 0.617171-1.6203 18168 8036954 --- --- 0.617221-1.62016 1326 7893825 --- --- 0.617342-1.61985 25158 NM_001882 // CRHBP // corticotropin releasing 8106418 hormone binding protein CRHBP NM_001882 0.617489-1.61946 // 5q11.2-q13.3 / 2157 7894664 --- --- 0.617511-1.61941 6612 NM_178229 // IQGAP3 // IQ motif containing 7921033 GTPase activating IQGAP3 NM_178229 0.617655-1.61903 protein 3 // 1q22-q23.1 // 26320 NM_003525 // HIST1H2BI // histone 8117429 cluster 1, H2bi // 6p21.3 HIST1H2BI NM_003525 0.617667-1.61899 // 8346 /// BC101653 // 9742 NM_001007232 // CARD17 // caspase 7951413 recruitment domain CARD17 NM_001007232 0.617691-1.61893 family, member 17 // 19834 8053276 --- --- 0.617691-1.61893 3068 7895581 --- --- 0.617814-1.61861 11462 7969426 --- --- 0.617921-1.61833 NM_003529 // 26305 HIST1H3A // histone 8117330 HIST1H3A cluster 1, H3a // 6p21.3 // NM_003529 0.61815-1.61773 8350 /// BC066245 // NM_001130966 // 28270 TBXAS1 // thromboxane 8136557 A synthase 1 (platelet) // TBXAS1 NM_001130966 0.6184-1.61708 7q34-q35 // 6916 /// N 2861 7895373 --- --- 0.618433-1.61699 31397 L23320 // RFC1 // replication factor C 8165672 (activator 1) 1, 145kDa // 4p14-p13 // 5981 RFC1 L23320 0.618668-1.61638

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 11084 NM_002345 // LUM // lumican // 12q21.3-q22 // 7965403 4060 /// LUM NM_002345 0.618788-1.61606 ENST00000266718 // 4812 NM_032270 // LRRC8C // leucine rich repeat 7902874 containing 8 family, LRRC8C NM_032270 0.618818-1.61598 member C // 1p22.2 // 8 2461 7894972 --- --- 0.619052-1.61537 25622 8111099 --- --- 0.619206-1.61497 30943 NM_033412 // MCART1 // mitochondrial carrier 8161249 triple repeat 1 // 9p13.3- p12 // 92014 /// MCART1 NM_033412 0.61922-1.61493 7713 7932407 NM_001004470 // ST8SIA6 // ST8 alpha-nacetyl-neuraminide alpha-2,8- ST8SIA6 NM_001004470 0.619364-1.61456 413 7892909 --- --- 0.619457-1.61432 2857 7895369 --- --- 0.619728-1.61361 1985 7894491 --- --- 0.619777-1.61348 24319 8098547 --- --- 0.619797-1.61343 239 7892735 --- --- 0.61986-1.61327 25020 8104901 17076 8026051 NM_002185 // IL7R // interleukin 7 receptor // 5p13 // 3575 /// ENST00000303115 // NM_006397 // RNASEH2A // ribonuclease H2, subunit A // 19p13.2 // 10535 /// IL7R NM_002185 0.619936-1.61307 RNASEH2A NM_006397 0.620448-1.61174 576 7893074 --- --- 0.620473-1.61167 3439 7895955 --- --- 0.620522-1.61155 6584 NM_007112 // THBS3 // thrombospondin 3 // 7920664 1q21 // 7059 /// ENST00000368378 // THBS3 NM_007112 0.620675-1.61115 24042 8095986 25260 8107408 NM_005139 // ANXA3 // annexin A3 // 4q13-q22 // 306 /// ENST00000264908 // NM_021614 // KCNN2 // potassium intermediate/small conductance calciumactivated channe ANXA3 NM_005139 0.62074-1.61098 KCNN2 NM_021614 0.621012-1.61028

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 23153 NM_001789 // CDC25A // cell division cycle 25 8086880 homolog A (S. pombe) // CDC25A NM_001789 0.621134-1.60996 3p21 // 993 /// N 10096 NM_001013620 // ALG10B // asparaginelinked glycosylation 10, 7954789 ALG10B NM_001013620 0.621148-1.60992 alpha-1,2-glucosyltransfe 1225 7893724 --- --- 0.621288-1.60956 3104 7895617 --- --- 0.621439-1.60917 2437 7894948 --- --- 0.621605-1.60874 27447 8128329 24152 8097064 NM_198468 // C6orf167 // chromosome 6 open reading frame 167 // 6q16.1 // 253714 /// EN BC032332 // PCMTD2 // protein-l-isoaspartate (D-aspartate) O- methyltransferase C6orf167 NM_198468 0.621612-1.60872 PCMTD2 BC032332 0.621711-1.60847 3706 7896224 --- --- 0.62199-1.60774 17872 8034099 --- --- 0.622471-1.6065 10969 NR_002737 // SNORD59A // small 7964248 nucleolar RNA, C/D box 59A // 12p13-qter // SNORD59A NR_002737 0.622608-1.60615 24624 8101324 29724 8149551 24464 8099897 NM_031370 // HNRNPD // heterogeneous nuclear ribonucleoprotein D (AUrich element RNA b NM_015310 // PSD3 // pleckstrin and Sec7 domain containing 3 // 8pter-p23.3 // 23362 // NM_003359 // UGDH // UDP-glucose dehydrogenase // 4p15.1 // 7358 /// ENST00000316423 // HNRNPD NM_031370 0.622789-1.60568 PSD3 NM_015310 0.622816-1.60561 UGDH NM_003359 0.623034-1.60505 854 7893352 --- --- 0.623097-1.60489 1612 7894113 --- --- 0.623131-1.6048 3500 7896016 --- --- 0.623154-1.60474 3468 7895984 --- --- 0.623495-1.60386 25269 8107520 NM_014350 // TNFAIP8 // tumor necrosis factor, alpha-induced protein 8 // 5q23.1 // 258 TNFAIP8 NM_014350 0.623675-1.6034 1905 7894410 --- --- 0.623701-1.60333 1598 7894099 --- --- 0.623903-1.60281

Column # Transcript 16248 8017840 BC036760 // C17orf58 // chromosome 17 open reading frame 58 // 17q24.2 // 284018 /// EN Ratio(shR RM2B -mut) Change(s hrrm2b C17orf58 BC036760 0.623936-1.60273 3868 7896386 --- --- 0.624091-1.60233 7355 NM_002658 // PLAU // plasminogen activator, 7928429 urokinase // 10q24 // 5328 /// NM 001145031 PLAU NM_002658 0.624126-1.60224 14750 8002303 19133 8045697 11427 7969171 8004 7935027 28729 8140319 25621 8111019 NM_000903 // NQO1 // NAD(P)H dehydrogenase, quinone 1 // 16q22.1 // 1728 /// NM_018151 // RIF1 // RAP1 interacting factor homolog (yeast) // 2q23.3 // 55183 /// ENS NR_002605 // DLEU1 // deleted in lymphocytic leukemia 1 (non-protein coding) // 13q14.3 NM_004969 // E // insulin-degrading enzyme // 10q23-q25 // 3416 /// NM_005338 // HIP1 // huntingtin interacting protein 1 // 7q11.23 // 3092 /// ENST000003 NM_001369 // DNAH5 // dynein, axonemal, heavy chain 5 // 5p15.2 // 1767 /// ENST0000026 NQO1 NM_000903 0.624657-1.60088 RIF1 NM_018151 0.624723-1.60071 DLEU1 NR_002605 0.624753-1.60063 E NM_004969 0.625211-1.59946 HIP1 NM_005338 0.625355-1.59909 DNAH5 NM_001369 0.625446-1.59886 3346 7895860 --- --- 0.625973-1.59751 3101 7895614 --- --- 0.6261-1.59719 6746 NR_003944 // SNORD78 7922408 // small nucleolar RNA, C/D box 78 // 1q25.1 // SNORD78 NR_003944 0.626128-1.59712 3986 7896505 --- --- 0.626198-1.59694 168 7892664 --- --- 0.626392-1.59644 3322 7895836 --- --- 0.626754-1.59552 338 7892834 --- --- 0.627283-1.59418 18658 8041561 NM_001145450 // MORN2 // MORN repeat containing 2 // 2p22.1 // 729967 /// MORN2 NM_001145450 0.627493-1.59364

Column # Transcript 19354 8048026 NM_001875 // CPS1 // carbamoyl-phosphate synthetase 1, mitochondrial // 2q35 // Ratio(shR RM2B -mut) Change(s hrrm2b CPS1 NM_001875 0.627552-1.59349 29677 8149248 --- --- 0.627553-1.59349 11985 NM_152329 // PPIL5 // peptidylprolyl isomerase 7974198 (cyclophilin)-like 5 // 14q21.3 // 12276 PPIL5 NM_152329 0.627575-1.59343 643 7893141 --- --- 0.627672-1.59319 3121 7895634 --- --- 0.627777-1.59292 10917 7963588 --- --- 0.627815-1.59283 32104 8171561 NM_006089 // SCML2 // sex comb on midleg-like 2 (Drosophila) // Xp22 // 10389 /// ENST0 SCML2 NM_006089 0.627817-1.59282 3540 7896058 --- --- 0.627909-1.59259 11627 NM_006475 // POSTN // periostin, osteoblast 7971077 specific factor // 13q13.3 // 10631 /// NM POSTN NM_006475 0.627972-1.59243 3243 7895756 --- --- 0.627975-1.59242 6601 NM_003145 // SSR2 // signal sequence 7920903 receptor, beta (translocon-associated SSR2 NM_003145 0.628274-1.59166 3511 7896027 --- --- 0.628369-1.59142 2731 7895243 --- --- 0.628384-1.59138 1951 7894457 --- --- 0.628622-1.59078 7696 7932160 10092 7954777 BC072452 // FAM107B // family with sequence similarity 107, member B // 10p13 // 83641 NM_032834 // ALG10 // asparagine-linked glycosylation 10, alpha- 1,2-glucosyltransferase FAM107B BC072452 0.628851-1.5902 ALG10 NM_032834 0.628981-1.58987 1885 7894390 --- --- 0.629095-1.58958 3060 7895573 --- --- 0.629419-1.58877 26690 8121130 --- --- 0.62952-1.58851 3081 7895594 --- --- 0.629873-1.58762 7308 7927876 NM_030625 // TET1 // tet oncogene 1 // 10q21 // 80312 /// ENST00000373644 // TET1 // te TET1 NM_030625 0.630177-1.58686

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 6921 NM_144567 // ANGEL2 // angel homolog 2 7924190 (Drosophila) // 1q32.3 // ANGEL2 NM_144567 0.63019-1.58682 90806 /// ENST00000366 24648 NM_016245 // HSD17B11 // 8101648 hydroxysteroid (17-beta) HSD17B11 NM_016245 0.630361-1.58639 dehydrogenase 11 // 2192 7894701 --- --- 0.630461-1.58614 824 7893322 --- --- 0.630503-1.58603 2887 7895399 --- --- 0.630575-1.58585 9678 7950899 27450 8128383 NM_022337 // RAB38 // RAB38, member RAS oncogene family // 11q14 // 23682 /// ENST00000 NM_017421 // COQ3 // coenzyme Q3 homolog, methyltransferase (S. cerevisiae) // 6q16.2 / RAB38 NM_022337 0.630621-1.58574 COQ3 NM_017421 0.631167-1.58437 6062 7915563 --- --- 0.6313-1.58403 23357 8089247 --- --- 0.631455-1.58364 22736 NM_001099 // ACPP // acid phosphatase, 8082673 ACPP prostate // 3q21-q23 // 55 NM_001099 0.631564-1.58337 /// NM 001134194 // A 20725 8062766 NM_002466 // MYBL2 // v-myb myeloblastosis viral oncogene homolog (avian)-like 2 // 20q MYBL2 NM_002466 0.631579-1.58333 1792 7894296 --- --- 0.631708-1.58301 26523 8119241 --- --- 0.631958-1.58238 24755 NM_020337 // ANKRD50 // ankyrin repeat domain 8102720 50 // 4q28.1 // 57182 /// ENST00000281131 ANKRD50 NM_020337 0.63217-1.58185 9692 7951032 29342 8146357 NR_003026 // SNORA1 // small nucleolar RNA, H/ACA box 1 // 11q21 // 677792 NM_005914 // MCM4 // minichromosome maintenance complex component 4 // 8q11.2 // 4173 / SNORA1 NR_003026 0.632411-1.58125 MCM4 NM_005914 0.63265-1.58065 9592 7950062 --- --- 0.632681-1.58057

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 27018 NM_003472 // DEK // DEK oncogene // 6p22.3 8124144 // 7913 /// DEK NM_003472 0.632845-1.58017 NM 001134709 // DEK // 21070 NM_001145316 // DSN1 // DSN1, MIND 8066074 kinetochore complex DSN1 NM_001145316 0.633192-1.5793 component, homolog (S. 1285 7893784 --- --- 0.633391-1.5788 4206 7896728 --- --- 0.633411-1.57875 10379 NM_005230 // ELK3 // ELK3, ETS-domain 7957665 protein (SRF accessory protein 2) // 12q23 // 200 ELK3 NM_005230 0.634014-1.57725 25246 8107270 30837 8160284 29952 8151512 20119 8055697 NM_033035 // TSLP // thymic stromal lymphopoietin // 5q22.1 // 85480 /// NM 138551 // NM_017645 // HAUS6 // HAUS augmin-like complex, subunit 6 // 9p22.1 // 54801 /// NM_018440 // PAG1 // phosphoprotein associated with glycosphingolipid NM_198557 // RBM43 // RNA binding motif protein 43 // 2q23.3 // 375287 /// TSLP NM_033035 0.634226-1.57673 HAUS6 NM_017645 0.634264-1.57663 PAG1 NM_018440 0.634333-1.57646 RBM43 NM_198557 0.634544-1.57594 23366 8089291 --- --- 0.634653-1.57567 28470 NM_021029 // RPL36A // ribosomal protein L36a // 8138361 Xq22.1 // 6173 /// AY927233 // RPL36AP RPL36A NM_021029 0.634853-1.57517 22026 8075164 29316 8146130 23803 8093858 NM_001005735 // CHEK2 // CHK2 checkpoint homolog (S. pombe) // 22q11 22q12.1 NM_032336 // GINS4 // GINS complex subunit 4 (Sld5 homolog) // 8p11.21 // 84296 /// ENS NM_018401 // STK32B // serine/threonine kinase 32B // 4p16.2 // 55351 /// ENST000002829 CHEK2 NM_001005735 0.635291-1.57408 GINS4 NM_032336 0.635346-1.57394 STK32B NM_018401 0.635949-1.57245 54 7892549 --- --- 0.635953-1.57244

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 688 7893186 --- --- 0.636359-1.57144 9861 BC040288 // UNQ565 // 7952451 IGYY565 // 11q24.2 // UNQ565 BC040288 0.637197-1.56937 100130428 1775 7894279 --- --- 0.637227-1.5693 16445 8019908 --- --- 0.637385-1.56891 13902 7993335 --- --- 0.637438-1.56878 NM_006120 // HLA-DMA 32947 // major histocompatibility 8178884 HLA-DMA complex, class II, DM NM_006120 0.63757-1.56845 alpha // 6p21.3 33069 NM_006120 // HLA-DMA // major histocompatibility 8180086 HLA-DMA complex, class II, DM NM_006120 0.63757-1.56845 alpha // 6p21.3 20195 8056792 --- --- 0.637718-1.56809 19683 8051773 --- --- 0.637824-1.56783 5496 7909839 --- --- 0.637961-1.56749 NM_033213 // ZNF670 // 7065 zinc finger protein 670 // 7925672 1q44 // 93474 /// ZNF670 NM_033213 0.637961-1.56749 ENST00000366503 // 30450 NM_024945 // RMI1 // RMI1, RecQ mediated 8156126 genome instability 1, RMI1 NM_024945 0.637964-1.56749 homolog (S. cerevisiae) 33259 8180373 --- --- 0.638031-1.56732 865 7893363 --- --- 0.638047-1.56728 2265 7894775 --- --- 0.638379-1.56647 15685 8012218 --- --- 0.638481-1.56622 1393 7893893 --- --- 0.638567-1.56601 6116 NM_004153 // ORC1L // origin recognition 7916167 complex, subunit 1-like ORC1L NM_004153 0.638615-1.56589 (yeast) // 1p32 // 499 3593 7896111 --- --- 0.639017-1.5649 24183 NM_173487 // C4orf33 // chromosome 4 open 8097435 reading frame 33 // C4orf33 NM_173487 0.639071-1.56477 4q28.2 // 132321 /// 2339 7894850 --- --- 0.639079-1.56475 12867 7982290 --- --- 0.639183-1.5645 28659 NM_178558 // ZNF680 // zinc finger protein 680 // 8139820 7q11.21 // 340252 /// ZNF680 NM_178558 0.639251-1.56433 NM 001130022 // 33291 8180405 --- --- 0.63934-1.56411 2163 7894670 --- --- 0.639388-1.564

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 28957 8142763 --- --- 0.639455-1.56383 6258 7917647 --- --- 0.639557-1.56358 4127 7896649 --- --- 0.640096-1.56227 5677 7911349 --- --- 0.640176-1.56207 10825 7962559 10820 7962489 NM_018018 // SLC38A4 // solute carrier family 38, member 4 // 12q13 // 55089 /// NM 001 NM_015899 // PLEKHA9 // pleckstrin homology domain containing, family A (phosphoinositi SLC38A4 NM_018018 0.640265-1.56185 PLEKHA9 NM_015899 0.640408-1.5615 3349 7895863 --- --- 0.640469-1.56136 436 7892932 --- --- 0.64053-1.56121 23438 NM_053025 // MYLK // myosin light chain kinase 8090098 MYLK // 3q21 // 4638 /// NM_053025 0.64066-1.56089 NM 053026 // MYLK // 3142 7895655 --- --- 0.640867-1.56039 27577 NM_005923 // MAP3K5 // mitogen-activated 8129804 protein kinase kinase kinase 5 // 6q22.33 // 4 MAP3K5 NM_005923 0.640935-1.56022 20091 8055486 --- --- 0.641131-1.55974 717 7893215 --- --- 0.641267-1.55941 24151 8097062 --- --- 0.641322-1.55928 5047 7905088 23634 8092055 NM_003517 // HIST2H2AC // histone cluster 2, H2ac // 1q21- q23 // 8338 /// NM_020949 // SLC7A14 // solute carrier family 7 (cationic amino acid transporter, y+ sy HIST2H2AC NM_003517 0.641382-1.55913 SLC7A14 NM_020949 0.641394-1.5591 27801 8132043 --- --- 0.641478-1.5589 4935 NM_022836 // DCLRE1B // DNA cross-link repair 7904131 1B (PSO2 homolog, S. cerevisiae) // 1p13. DCLRE1B NM_022836 0.641842-1.55802 12164 7976084 24113 8096688 NM_018418 // SPATA7 // spermatogenesis associated 7 // 14q31.3 // 55812 /// NM 00104042 NM_001031720 // GSTCD // glutathione S- transferase, C-terminal domain containing // 4q2 SPATA7 NM_018418 0.641981-1.55768 GSTCD NM_001031720 0.642032-1.55755

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 25859 NM_001040458 // ERAP1 // endoplasmic 8113250 reticulum ERAP1 NM_001040458 0.642123-1.55733 aminopeptidase 1 // 5q15 21271 NM_004540 // NCAM2 // neural cell adhesion 8067985 molecule 2 // 21q21.1 // NCAM2 NM_004540 0.642216-1.55711 4685 /// ENST000004 23696 NM_002916 // RFC4 // replication factor C 8092640 (activator 1) 4, 37kDa // 3q27 // 5984 /// NM RFC4 NM_002916 0.642234-1.55706 5302 7907466 NM_018122 // DARS2 // aspartyl-trna synthetase 2, mitochondrial // 1q25.1 // DARS2 NM_018122 0.642261-1.557 1595 7894096 --- --- 0.642533-1.55634 17528 8030731 --- --- 0.642647-1.55606 26534 NR_026938 // LOC221442 // adenylate 8119423 cyclase 10 pseudogene // 6p21.1 // 221442 /// LOC221442 NR_026938 0.642705-1.55592 14261 7997381 NM_001100624 // CENPN // centromere protein N // 16q23.2 // 55839 /// NM 001100625 CENPN NM_001100624 0.642855-1.55556 22744 8082795 --- --- 0.642874-1.55552 14236 AY358233 // UNQ6484 // ISPF6484 // 16q22.2 // 7997166 100127951 /// ENST00000453263 // UNQ6484 UNQ6484 AY358233 0.642874-1.55551 24259 8097991 24728 8102440 16343 8019074 28549 8138988 NM_005651 // TDO2 // tryptophan 2,3- dioxygenase // 4q31-q32 // 6999 /// NM_024590 // ARSJ // arylsulfatase family, member J // 4q26 // 79642 /// NM_002522 // NPTX1 // neuronal pentraxin I // 17q25.1-q25.2 // 4884 /// ENST00000306773 AK304236 // DPY19L2P1 // dpy-19-like 2 pseudogene 1 (C. elegans) // 7p14.2 // TDO2 NM_005651 0.643222-1.55467 ARSJ NM_024590 0.643246-1.55462 NPTX1 NM_002522 0.643291-1.55451 DPY19L2P1 AK304236 0.643412-1.55421

Column # Transcript 14862 8003583 NM_007317 // KIF22 // kinesin family member 22 // 16p11.2 // 3835 /// ENST00000160827 / Ratio(shR RM2B -mut) Change(s hrrm2b KIF22 NM_007317 0.643492-1.55402 14504 7999884 --- --- 0.643757-1.55338 1833 7894337 --- --- 0.643965-1.55288 16426 AK126788 // FLJ44838 // hypothetical protein 8019751 LOC644767 // --- // 644767 /// ENST0000040 FLJ44838 AK126788 0.643988-1.55283 8839 7943191 --- --- 0.644154-1.55242 30220 8154211 --- --- 0.644239-1.55222 206 7892702 --- --- 0.644365-1.55191 11577 7970602 14144 7996081 7137 7926259 11573 7970569 5471 7909545 NM_006437 // PARP4 // poly (ADP-ribose) polymerase family, member 4 // 13q11 // 143 NM_201524 // GPR56 // G protein-coupled receptor 56 // 16q12.2- q21 // 9289 /// NM 20152 NM_182751 // MCM10 // minichromosome maintenance complex component 10 // 10p13 // 55388 NM_014363 // SACS // spastic ataxia of Charlevoix-Saguenay (sacsin) // 13q12 // 26278 NM_145759 // TRAF5 // TNF receptor-associated factor 5 // 1q32 // 7188 /// NM 004619 // PARP4 NM_006437 0.644393-1.55185 GPR56 NM_201524 0.644944-1.55052 MCM10 NM_182751 0.6453-1.54967 SACS NM_014363 0.64535-1.54955 TRAF5 NM_145759 0.645352-1.54954 16495 8020352 --- --- 0.645373-1.54949 26492 8118979 --- --- 0.645372-1.54949 15060 8005634 --- --- 0.645393-1.54944 23380 8089459 31449 8166049 NM_006166 // NFYB // nuclear transcription factor Y, beta // 12q22- q23 // 4801 /// ENST NM_001039091 // PRPS2 // phosphoribosyl pyrophosphate synthetase 2 // Xp22.3- NFYB NM_006166 0.645527-1.54912 PRPS2 NM_001039091 0.645582-1.54899

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 25273 NM_016644 // PRR16 // proline rich 16 // 5q23.1 // 8107563 51334 /// ENST00000379551 // PRR16 / PRR16 NM_016644 0.646108-1.54773 NR_002965 // SNORA29 27650 // small nucleolar RNA, 8130580 SNORA29 H/ACA box 29 // 6q25.3 // NR_002965 0.646137-1.54766 677812 3118 7895631 --- --- 0.646406-1.54702 2686 7895198 --- --- 0.646413-1.547 4007 7896526 --- --- 0.646424-1.54697 5052 7905129 --- --- 0.646461-1.54688 23864 8094359 --- --- 0.646471-1.54686 15943 8014841 19830 8053231 29564 8148448 20607 8061471 6099 7915955 NM_004774 // MED1 // mediator complex subunit 1 // 17q12-q21.1 // 5469 /// NM_032603 // LOXL3 // lysyl oxidase-like 3 // 2p13 // 84695 /// ENST00000264094 // NM_006558 // KHDRBS3 // KH domain containing, RNA binding, signal transduction associat NM_021067 // GINS1 // GINS complex subunit 1 (Psf1 homolog) // 20p11.21 // 9837 /// ENS NM_019073 // SPATA6 // spermatogenesis associated 6 // 1p33 // 54558 /// MED1 NM_004774 0.646513-1.54676 LOXL3 NM_032603 0.646531-1.54672 KHDRBS3 NM_006558 0.646536-1.54671 GINS1 NM_021067 0.646615-1.54651 SPATA6 NM_019073 0.646744-1.54621 3519 7896035 --- --- 0.647087-1.54539 30954 NR_003670 // KGFLP2 // keratinocyte growth 8161362 factor-like protein 2 // 9p12 // 654466 /// KGFLP2 NR_003670 0.64717-1.54519 4079 7896601 --- --- 0.647174-1.54518 7758 7932794 --- --- 0.64719-1.54514 15825 XM_002343504 // LOC100287009 // similar 8013570 to hcg1643102 // 17q11.2 // 100287009 LOC100287009 XM_002343504 0.647241-1.54502

Column # Transcript 16968 8024900 NM_001048201 // UHRF1 // ubiquitin-like with PHD and ring finger domains 1 // 19p13.3 / Ratio(shR RM2B -mut) Change(s hrrm2b UHRF1 NM_001048201 0.647309-1.54486 3742 7896260 --- --- 0.647357-1.54474 860 7893358 --- --- 0.647714-1.54389 22930 AB209021 // EIF4A2 // eukaryotic translation 8084704 initiation factor 4A, isoform 2 // 3q28 // EIF4A2 AB209021 0.647748-1.54381 503 7892999 --- --- 0.647927-1.54338 11385 NM_024561 // NARG1L // NMDA receptor 7968761 regulated 1-like // 13q14.11 // 79612 /// NARG1L NM_024561 0.647956-1.54331 24919 8104014 NM_152775 // CCDC110 // coiled-coil domain containing 110 // 4q35.1 // 256309 /// NM 00 CCDC110 NM_152775 0.648033-1.54313 6271 7917739 --- --- 0.648158-1.54283 16857 NM_173630 // RTTN // rotatin // 18q22.2 // 8023766 25914 /// ENST00000255674 // RTTN NM_173630 0.648176-1.54279 21944 8074591 ENST00000357029 // RIMBP3B // RIMS binding protein 3B // 22q11.21 // 440804 /// RIMBP3B ENST0000035702 0.648495-1.54203 3321 7895835 --- --- 0.648555-1.54189 13607 7990564 --- --- 0.648885-1.54111 2921 7895434 --- --- 0.649192-1.54038 31721 8168436 --- --- 0.649262-1.54021 26316 8117408 NM_021052 // HIST1H2AE // histone cluster 1, H2ae // 6p22.2- p21.1 // 3012 /// HIST1H2AE NM_021052 0.64929-1.54014 3583 7896101 --- --- 0.649311-1.54009 13182 NR_003011 // SCARNA15 // small Cajal 7985480 SCARNA15 body-specific RNA 15 // NR_003011 0.649527-1.53958 15q25.2 // 677778 /// 11367 7968516 NM_015032 // PDS5B // PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae PDS5B NM_015032 0.649592-1.53943 1844 7894349 --- --- 0.649606-1.53939 3210 7895723 --- --- 0.649606-1.53939

Column # Transcript 8088 7936134 NM_024928 // OBFC1 // oligonucleotide/oligosacc haride-binding fold containing 1 // 10q2 Ratio(shR RM2B -mut) Change(s hrrm2b OBFC1 NM_024928 0.649735-1.53909 1086 7893584 --- --- 0.649741-1.53907 9819 NM_006500 // MCAM // melanoma cell adhesion 7952205 molecule // 11q23.3 // 4162 /// ENST0000026 MCAM NM_006500 0.649978-1.53851 23351 8089145 NM_015429 // ABI3BP // ABI family, member 3 (NESH) binding protein // 3q12 // 25890 /// ABI3BP NM_015429 0.650351-1.53763 1576 7894077 --- --- 0.650393-1.53753 30816 AF090921 // C9orf38 // chromosome 9 open 8160020 reading frame 38 // 9p24.1 // 29044 C9orf38 AF090921 0.650505-1.53727 22487 8080144 31229 8163896 NM_001003931 // PARP3 // poly (ADPribose) polymerase family, member 3 // NM_004099 // STOM // stomatin // 9q34.1 // 2040 /// NM_198194 // STOM // stomatin // 9q PARP3 NM_001003931 0.650529-1.53721 STOM NM_004099 0.650542-1.53718 3666 7896184 --- --- 0.650689-1.53683 23708 NM_198152 // UTS2D // urotensin 2 domain 8092741 containing // 3q28 // 257313 /// UTS2D NM_198152 0.650691-1.53683 19093 8045341 --- --- 0.650775-1.53663 3499 7896015 --- --- 0.650785-1.53661 371 7892867 --- --- 0.650813-1.53654 2256 7894766 --- --- 0.650872-1.5364 32112 8171723 --- --- 0.650988-1.53613 901 7893399 --- --- 0.651133-1.53579 23698 8092661 NM_001879 // MASP1 // mannan-binding lectin serine peptidase 1 (C4/C2 activating MASP1 NM_001879 0.651229-1.53556 4001 7896520 --- --- 0.651292-1.53541 25690 NM_000436 // OXCT1 // 3-oxoacid CoA 8111892 transferase 1 // 5p13.1 // 5019 /// OXCT1 NM_000436 0.651312-1.53536 3196 7895709 --- --- 0.651315-1.53535 14472 7999476 --- --- 0.651408-1.53514

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 3667 7896185 --- --- 0.651413-1.53512 32535 NM_002139 // RBMX // RNA binding motif 8175420 protein, X-linked // RBMX NM_002139 0.651433-1.53508 Xq26.3 // 27316 /// 2606 7895118 --- --- 0.651525-1.53486 2720 7895232 --- --- 0.651655-1.53456 2224 7894734 --- --- 0.651673-1.53451 2293 7894803 --- --- 0.651677-1.5345 32074 NM_000381 // M1 // midline 1 (Opitz/BBB 8171297 syndrome) // Xp22 // M1 NM_000381 0.651699-1.53445 4281 /// NM 033290 // MI 26346 NM_003509 // HIST1H2AI // histone 8117583 cluster 1, H2ai // 6p22- HIST1H2AI NM_003509 0.651731-1.53437 p21.3 // 8329 /// 2360 7894871 --- --- 0.651963-1.53383 1054 7893552 --- --- 0.652007-1.53373 2470 7894981 --- --- 0.652342-1.53294 28608 NR_002919 // SNORA5A // small nucleolar RNA, 8139482 H/ACA box 5A // 7p13 // SNORA5A NR_002919 0.652398-1.53281 654319 24603 NM_001565 // CXCL10 // chemokine (C-X-C motif) 8101126 ligand 10 // 4q21 // 3627 CXCL10 NM_001565 0.652436-1.53272 /// ENST000003 1763 7894267 --- --- 0.65251-1.53254 596 7893094 --- --- 0.652516-1.53253 25904 8113614 --- --- 0.652591-1.53235 5174 7906233 --- --- 0.652602-1.53233 11049 NM_032606 // CAPS2 // calcyphosine 2 // 7964997 12q21.1-q21.2 // 84698 CAPS2 NM_032606 0.652713-1.53207 /// ENST00000409445 // 18560 NM_182625 // GEN1 // Gen homolog 1, 8040440 endonuclease GEN1 NM_182625 0.652915-1.53159 (Drosophila) // 2p24.2 // 12920 NM_002875 // RAD51 // RAD51 homolog (RecA 7982792 homolog, E. coli) (S. RAD51 NM_002875 0.653022-1.53134 cerevisiae) // 15q15.1 33262 8180376 --- --- 0.653105-1.53115

Column # Transcript 27184 8125537 NM_006120 // HLA-DMA // major histocompatibility complex, class II, DM alpha // 6p21.3 Ratio(shR RM2B -mut) Change(s hrrm2b HLA-DMA NM_006120 0.653174-1.53098 1876 7894381 --- --- 0.653234-1.53084 11421 NM_001040443 // PHF11 // PHD finger 7969129 protein 11 // 13q14.2 // 51131 /// NM 001040444 PHF11 NM_001040443 0.653319-1.53065 29987 8151686 9515 7949364 NM_005941 // MMP16 // matrix metallopeptidase 16 (membrane-inserted) // 8q21.3 // 4325 NM_080668 // CDCA5 // cell division cycle associated 5 // 11q12.1 // 113130 /// ENST000 MMP16 NM_005941 0.653335-1.53061 CDCA5 NM_080668 0.653422-1.53041 3705 7896223 --- --- 0.653512-1.53019 7313 NM_004728 // DDX21 // DEAD (Asp-Glu-Ala-Asp) 7927936 DDX21 box polypeptide 21 // NM_004728 0.653644-1.52988 10q21 // 9188 /// EN 2152 7894659 --- --- 0.65365-1.52987 10729 NM_175054 // HIST4H4 7961483 // histone cluster 4, H4 // HIST4H4 NM_175054 0.654046-1.52894 12p12.3 // 121504 28191 NM_019071 // ING3 // inhibitor of growth family, 8135718 member 3 // 7q31 // 54556 /// NM 19826 ING3 NM_019071 0.654096-1.52883 3218 7895731 --- --- 0.654146-1.52871 5620 7911108 --- --- 0.654191-1.5286 24221 NM_001957 // EDNRA // endothelin receptor type 8097692 A // 4q31.22 // 1909 /// ENST00000324300 EDNRA NM_001957 0.654308-1.52833 9478 7948908 NR_002564 // SNORD26 // small nucleolar RNA, C/D box 26 // 11q13 // 9302 /// AK095849 / SNORD26 NR_002564 0.654352-1.52823 1691 7894194 --- --- 0.654398-1.52812 32193 NM_033518 // SLC38A5 // solute carrier family 38, 8172425 SLC38A5 member 5 // Xp11.23 // NM_033518 0.654462-1.52797 92745 /// ENST 1838 7894342 --- --- 0.654558-1.52775 2580 7895092 --- --- 0.654605-1.52764 1267 7893766 --- --- 0.654628-1.52759

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 28261 8136457 --- --- 0.654625-1.52759 18032 NM_173531 // ZNF100 // zinc finger protein 100 // 8035808 19p12 // 163227 /// ZNF100 NM_173531 0.65506-1.52658 ENST00000358296 / 26731 8121390 --- --- 0.655312-1.52599 11000 NM_153377 // LRIG3 // leucine-rich repeats and 7964602 immunoglobulin-like LRIG3 NM_153377 0.655346-1.52591 domains 3 // 12q14.1 27878 8132830 --- --- 0.655345-1.52591 2494 7895005 --- --- 0.655621-1.52527 25430 NM_000112 // SLC26A2 // solute carrier family 26 8109194 (sulfate transporter), SLC26A2 NM_000112 0.655654-1.52519 member 2 // 5q3 677 7893175 --- --- 0.655726-1.52503 279 7892775 --- --- 0.655966-1.52447 17204 NM_001001415 // ZNF429 // zinc finger 8027312 protein 429 // 19p13.1 // 353088 /// ZNF429 NM_001001415 0.655976-1.52445 NM_014648 // DZIP3 // 22630 DAZ interacting protein 8081503 DZIP3 3, zinc finger // 3q13.13 // NM_014648 0.656032-1.52432 9666 /// ENS 11121 7965767 --- --- 0.656445-1.52336 1292 7893791 --- --- 0.656456-1.52333 NM_017439 // PION // 28745 pigeon homolog 8140468 (Drosophila) // 7q11.23 // PION NM_017439 0.656578-1.52305 54103 /// 752 7893250 --- --- 0.656604-1.52299 24433 NM_145290 // GPR125 // G protein-coupled 8099612 receptor 125 // 4p15.2 // GPR125 NM_145290 0.656709-1.52274 166647 /// ENST00000 23287 NM_015541 // LRIG1 // leucine-rich repeats and 8088642 immunoglobulin-like LRIG1 NM_015541 0.657148-1.52173 domains 1 // 3p14 // 14006 NM_007317 // KIF22 // kinesin family member 7994620 22 // 16p11.2 // 3835 /// KIF22 NM_007317 0.657404-1.52114 ENST00000160827 / 9301 7947510 --- --- 0.657453-1.52102

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 7942 NM_001001791 // C10orf55 // chromosome 7934505 10 open reading frame C10orf55 NM_001001791 0.657858-1.52009 55 // 10q22.2 // 414236 // 24261 NM_000824 // GLRB // glycine receptor, beta // 8098006 4q31.3 // 2743 /// GLRB NM_000824 0.658119-1.51948 ENST00000264428 // GL 15868 NM_015986 // CRLF3 // cytokine receptor-like 8014037 factor 3 // 17q11.2 // 51379 /// ENST00000 CRLF3 NM_015986 0.658152-1.51941 5534 7910190 27074 8124510 NM_178549 // ZNF678 // zinc finger protein 678 // 1q42.13 // 339500 /// ENST00000343776 NM_003519 // HIST1H2BL // histone cluster 1, H2bl // 6p22- p21.3 // 8340 /// ZNF678 NM_178549 0.658164-1.51938 HIST1H2BL NM_003519 0.658386-1.51887 12402 7978389 --- --- 0.658417-1.51879 31226 NM_001735 // C5 // complement component 8163839 5 // 9q33-q34 // 727 /// ENST00000223642 // C5 C5 NM_001735 0.658831-1.51784 4066 7896588 --- --- 0.658952-1.51756 11626 7971075 --- --- 0.659283-1.5168 19113 8045533 --- --- 0.659315-1.51673 298 7892794 --- --- 0.659369-1.5166 4312 7897877 31128 8162729 NM_001066 // TNFRSF1B // tumor necrosis factor receptor superfamily, member 1B NM_014788 // TRIM14 // tripartite motif-containing 14 // 9q22.33 // 9830 /// NM 033220 TNFRSF1B NM_001066 0.65941-1.51651 TRIM14 NM_014788 0.659573-1.51613 3999 7896518 --- --- 0.659578-1.51612 449 7892945 --- --- 0.659611-1.51605 15250 NM_003632 // CNTNAP1 // contactin associated 8007323 CNTNAP1 protein 1 // 17q21 // 8506 NM_003632 0.659748-1.51573 /// ENST0000026 28076 8134429 --- --- 0.659783-1.51565 31689 8168161 --- --- 0.659789-1.51564 3728 7896246 --- --- 0.659834-1.51553

Column # Transcript 15317 8007919 NR_002940 // LRRC37A4 // leucine rich repeat containing 37, member A4 Ratio(shR RM2B -mut) Change(s hrrm2b LRRC37A4 NR_002940 0.660076-1.51498 9571 7949894 --- --- 0.660193-1.51471 3830 7896348 --- --- 0.660266-1.51454 2066 7894572 --- --- 0.660303-1.51446 18635 8041225 14658 8001387 29423 8147012 NM_014600 // EHD3 // EH-domain containing 3 // 2p21 // 30845 /// ENST00000322054 // NM_002968 // SALL1 // sal-like 1 (Drosophila) // 16q12.1 // 6299 /// NM 001127892 // SA NM_006823 // PKIA // protein kinase (campdependent, catalytic) inhibitor alpha // 8q21 EHD3 NM_014600 0.660359-1.51433 SALL1 NM_002968 0.660429-1.51417 PKIA NM_006823 0.660475-1.51406 26716 8121275 --- --- 0.660567-1.51385 2266 7894776 --- --- 0.660648-1.51366 ENST00000341450 // OR5H14 // olfactory 22583 8081200 receptor, family 5, subfamily H, member 14 // 3q OR5H14 ENST0000034145 0.660848-1.51321 2940 7895453 --- --- 0.660889-1.51311 14213 7996917 --- --- 0.660892-1.51311 15514 NR_004396 // SNORD1B // small nucleolar RNA, 8010080 C/D box 1B // 17q25.1 // 677849 SNORD1B NR_004396 0.660952-1.51297 28612 8139500 NM_022748 // TNS3 // tensin 3 // 7p12.3 // 64759 /// ENST00000398879 // TNS3 NM_022748 0.660984-1.5129 15061 8005636 --- --- 0.660996-1.51287 2080 7894587 --- --- 0.661006-1.51285 1313 7893812 --- --- 0.661029-1.51279 17100 8026339 NM_003096 // SNRPG // small nuclear ribonucleoprotein polypeptide G // 2p13.3 // 6637 / SNRPG NM_003096 0.661116-1.51259 1476 7893977 --- --- 0.661135-1.51255 11306 7967870 --- --- 0.661397-1.51195 14605 8000930 --- --- 0.661403-1.51194 1183 7893682 --- --- 0.661466-1.51179

Column # Ratio(shR Transcript Change(s RM2B hrrm2b -mut) 3852 7896370 --- --- 0.661495-1.51173 23603 NM_173084 // TRIM59 // tripartite motif-containing 8091757 59 // 3q25.33 // 286827 TRIM59 NM_173084 0.661741-1.51117 /// ENST0000 23784 NM_133330 // WHSC1 // Wolf-Hirschhorn 8093539 syndrome candidate 1 // WHSC1 NM_133330 0.661957-1.51067 4p16.3 // 7468 /// 12678 7981215 --- --- 0.661972-1.51064 9473 NR_002560 // SNORD31 // small nucleolar RNA, 7948898 C/D box 31 // 11q13 // SNORD31 NR_002560 0.662163-1.5102 9298 /// AK095849 / 2753 7895265 --- --- 0.662204-1.51011 15288 NM_145663 // DBF4B // DBF4 homolog B (S. 8007651 cerevisiae) // DBF4B NM_145663 0.66235-1.50978 17q21.31 17q21 // 80174 /// NM 7866 NM_032997 // ZWINT // ZW10 interactor // 7933707 10q21-q22 // 11130 /// ZWINT NM_032997 0.662412-1.50964 NM 007057 // ZWINT // 1856 7894361 --- --- 0.662433-1.50959 629 7893127 --- --- 0.662434-1.50958 NM_002976 // SCN7A // 20175 sodium channel, voltagegated, type VII, alpha // 8056518 SCN7A NM_002976 0.662434-1.50958 2q21-q23 // 633 NM_002136 // 16756 HNRNPA1 // 8022814 heterogeneous nuclear ribonucleoprotein A1 // HNRNPA1 NM_002136 0.662443-1.50956 NM_003532 // 26317 HIST1H3E // histone 8117415 HIST1H3E cluster 1, H3e // 6p21.3 // NM_003532 0.662621-1.50916 8353 /// CR542014 // 2128 7894635 --- --- 0.662698-1.50898 NM_015710 // GLTSCR2 13246 // glioma tumor 7986323 suppressor candidate region gene 2 // 19q13.3 GLTSCR2 NM_015710 0.662837-1.50867 NM_033495 // KLHL13 // 32435 kelch-like 13 (Drosophila) 8174654 KLHL13 // Xq23-q24 // 90293 /// NM_033495 0.662895-1.50853 ENST00000262

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 27551 NM_001431 // EPB41L2 // erythrocyte membrane 8129497 protein band 4.1-like 2 // EPB41L2 NM_001431 0.663017-1.50826 6q23 // 2037 // 20078 NM_032143 // ZRANB3 // zinc finger, RANbinding domain 8055377 ZRANB3 NM_032143 0.663081-1.50811 containing 3 // 2q21.3 // 9830 NM_001001786 // BL // BH3-like motif 7952309 containing, cell death inducer // 11q24.1 // 414 BL NM_001001786 0.663169-1.50791 7217 7927082 NR_003086 // HSD17B7P2 // hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7P2 NR_003086 0.663228-1.50778 3386 7895901 --- --- 0.663318-1.50757 24322 NM_152683 // CCDC111 // coiled-coil domain 8098556 containing 111 // 4q35.1 // 201973 /// NM 02 CCDC111 NM_152683 0.663358-1.50748 15888 8014197 --- --- 0.66337-1.50745 2613 7895125 --- --- 0.663808-1.50646 7570 7930775 --- --- 0.664066-1.50587 8018 7935228 --- --- 0.664136-1.50571 29352 8146427 NM_052937 // PCMTD1 // protein-l-isoaspartate (D-aspartate) O- methyltransferase PCMTD1 NM_052937 0.664288-1.50537 1055 7893553 --- --- 0.664342-1.50525 28538 NR_024466 // LSM5 // LSM5 homolog, U6 small 8138912 LSM5 nuclear RNA associated NR_024466 0.664554-1.50477 (S. cerevisiae) // 7 32738 8177046 --- --- 0.664774-1.50427 32445 NR_002584 // SNORA69 // small nucleolar RNA, 8174715 H/ACA box 69 // Xq22- q24 // 26779 SNORA69 NR_002584 0.664899-1.50399 26610 AK095307 // FBXO9 // F- 8120271 box protein 9 // 6p12.3- FBXO9 AK095307 0.665074-1.50359 p11.2 // 26268 2181 7894689 --- --- 0.665106-1.50352 6282 7917875 NM_001993 // F3 // coagulation factor III (thromboplastin, tissue factor) // 1p22-p21 / F3 NM_001993 0.665282-1.50312

Column # Transcript Ratio(shR RM2B -mut) Change(s hrrm2b 30457 AK096255 // LOC100130433 // 8156194 hypothetical protein LOC100130433 // 9q21.33 // 100130433 / LOC100130433 AK096255 0.665302-1.50308 NM_013263 // BRD7 // 22835 bromodomain containing 8083704 7 // 16q12 // 29117 /// BRD7 NM_013263 0.665303-1.50307 ENST00000394688 // 30004 NM_015496 // KIAA1429 // KIAA1429 // 8q22.1 // 8151842 25962 /// NM_183009 // KIAA1429 // KIAA1 KIAA1429 NM_015496 0.66542-1.50281 29240 8145291 21611 8071212 10069 7954527 AF495725 // SLC25A37 // solute carrier family 25, member 37 // 8p21.2 // 51312 /// ENST NM_003504 // CDC45L // CDC45 cell division cycle 45-like (S. cerevisiae) // 22q11.21 // NM_020183 // ARNTL2 // aryl hydrocarbon receptor nuclear translocator-like 2 // SLC25A37 AF495725 0.665618-1.50236 CDC45L NM_003504 0.665653-1.50228 ARNTL2 NM_020183 0.665803-1.50195 753 7893251 --- --- 0.665807-1.50194 2954 7895467 --- --- 0.665874-1.50179 11325 NM_001014442 // PCOTH // prostate 7968029 collagen triple helix // 13q12 // 542767 /// PCOTH NM_001014442 0.665933-1.50165 26834 8122265 6537 7920205 NM_006290 // TNFAIP3 // tumor necrosis factor, alpha-induced protein 3 // 6q23 // 7128 NM_005988 // SPRR2A // small proline-rich protein 2A // 1q21-q22 // 6700 /// ENST000003 TNFAIP3 NM_006290 0.666017-1.50146 SPRR2A NM_005988 0.666178-1.5011 19054 8045153 --- --- 0.666264-1.50091 23341 8089038 --- --- 0.666342-1.50073 25818 BC000192 // DHFR // 8112914 dihydrofolate reductase // DHFR BC000192 0.666342-1.50073 5q11.2-q13.2 // 1719 Highlighted: Down-regulation of protein expression was demonstrated by Western blotting.

Supplementary Table S5. GO enrichment analysis of up-regulated genes by silencing of RRM2B in IMR90 cells. % genes in Enrichmen Enrichmen that are in list, in list, in in list, list, not neg log function type t Score t p-value present in GO p-value B cell proliferation biological process 11.6673 8.57E-06 60 3 2 95 10065 42100 5.067 lymphocyte proliferation biological process 9.56715 7.00E-05 33.3333 3 6 95 10061 46651 4.155 natural killer cell biological process 8.62539 0.0001795 25 3 9 95 10058 30101 3.746 leukocyte activation biological process 8.46903 0.0002099 6.74157 6 83 92 9984 45321 3.6781 detection of lipopolysaccharide biological process 8.20134 0.0002743 66.6667 2 1 96 10066 32497 3.5618 cell migration biological process 7.88149 0.0003777 11.1111 4 32 94 10035 30335 3.4229 receptor activity molecular function 7.74462 0.0004331 2.46914 16 632 82 9435 4872 3.3634 lymphocyte activation biological process 7.63195 0.0004847 7.35294 5 63 93 10004 46649 3.3145 cell growth biological process 7.53195 0.0005357 17.6471 3 14 95 10053 30307 3.2711 lipopolysaccharide receptor activity molecular function 7.5145 0.0005451 50 2 2 96 10065 1875 3.2635 cell motion biological process 7.47175 0.0005689 10 4 36 94 10031 51272 3.2449 immune system process biological process 7.18475 0.0007581 5.30973 6 107 92 9960 2376 3.1203 nucleosome assembly biological process 6.88908 0.0010189 14.2857 3 18 95 10049 6334 2.9919 anti-apoptosis biological process 6.78423 0.0011315 4.91803 6 116 92 9951 6916 2.9464 extracellular region cellular component 6.74387 0.0011781 3.0581 10 317 88 9750 5576 2.9288 chromatin assembly complex cellular component 6.61083 0.0013457 33.3333 2 4 96 10063 5678 2.871 retinol metabolic process biological process 6.61083 0.0013457 33.3333 2 4 96 10063 42572 2.871 cellular component biological process 6.49013 0.0015184 12.5 3 21 95 10046 51130 2.8186 regulation of cell motion biological process 6.40922 0.0016463 5.61798 5 84 93 9983 51270 2.7835 defense response to Gram-negative bacterium biological process 6.28065 0.0018722 28.5714 2 5 96 10062 50829 2.7277 stress-activated protein kinase signaling pathway biological process 6.28065 0.0018722 28.5714 2 5 96 10062 70304 2.7277 pattern recognition receptor activity molecular function 5.99927 0.0024806 25 2 6 96 10061 8329 2.6054 signal transducer activity molecular function 5.86192 0.0028458 2.00472 17 831 81 9236 4871 2.5458 molecular transducer activity molecular function 5.86192 0.0028458 2.00472 17 831 81 9236 60089 2.5458 membrane part cellular component 5.76569 0.0031332 1.59078 29 1794 69 8273 44425 2.504 beta-amyloid binding molecular function 5.53738 0.0039368 20 2 8 96 10059 1540 2.4049 negative regulation of cellular process biological process 5.50547 0.0040645 2.43363 11 441 87 9626 48523 2.391 negative regulation of apoptosis biological process 5.35911 0.0047051 3.7037 6 156 92 9911 43066 2.3274 negative regulation of programmed cell death biological process 5.2703 0.0051421 3.63636 6 159 92 9908 43069 2.2889 negative regulation of cell death biological process 5.2703 0.0051421 3.63636 6 159 92 9908 60548 2.2889 serine-type endopeptidase inhibitor molecular function 5.23541 0.0053247 8.10811 3 34 95 10033 4867 2.2737 high-density lipoprotein particle remodeling biological process 5.16695 0.005702 16.6667 2 10 96 10057 34375 2.244 lipid metabolic process biological process 5.04779 0.0064235 5.19481 4 73 94 9994 6629 2.1922 reverse cholesterol transport biological process 5.00616 0.0066965 15.3846 2 11 96 10056 43691 2.1741 negative regulation of phosphorylation biological process 5.00616 0.0066965 15.3846 2 11 96 10056 42326 2.1741 response to lipopolysaccharide biological process 4.85828 0.0077638 14.2857 2 12 96 10055 32496 2.1099 fibroblast proliferation biological process 4.85828 0.0077638 14.2857 2 12 96 10055 48146 2.1099 negative regulation of phosphate metabolic process biological process 4.72144 0.0089023 13.3333 2 13 96 10054 45936 2.0505 platelet activation biological process 4.72144 0.0089023 13.3333 2 13 96 10054 30168 2.0505 calcium-mediated biological process 4.59417 0.0101106 12.5 2 14 96 10053 19722 1.9952

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO regulation of fibroblast proliferation biological process 4.59417 0.0101106 12.5 2 14 96 10053 48145 1.9952 response to chemical stimulus biological process 4.56791 0.0103796 2.38727 9 368 89 9699 42221 1.9838 regulation of cell proliferation biological process 4.50682 0.0110335 4.44444 4 86 94 9981 42127 1.9573 endopeptidase inhibitor activity molecular function 4.45508 0.0116194 6.12245 3 46 95 10021 4866 1.9348 peptidase inhibitor activity molecular function 4.45508 0.0116194 6.12245 3 46 95 10021 30414 1.9348 response to molecule of bacterial origin biological process 4.25874 0.0141401 10.5263 2 17 96 10050 2237 1.8495 macromolecular complex remodeling biological process 4.25874 0.0141401 10.5263 2 17 96 10050 34367 1.8495 protein-lipid complex remodeling biological process 4.25874 0.0141401 10.5263 2 17 96 10050 34368 1.8495 plasma lipoprotein particle remodeling biological process 4.25874 0.0141401 10.5263 2 17 96 10050 34369 1.8495 multi-organism process biological process 4.15854 0.0156303 3.28947 5 147 93 9920 51704 1.806 unfolded protein binding molecular function 4.09483 0.0166585 5.35714 3 53 95 10014 51082 1.7784 embryonic development biological process 4.06577 0.0171498 9.52381 2 19 96 10048 9790 1.7657 transmembrane receptor activity molecular function 4.01921 0.0179671 2.06612 10 474 88 9593 4888 1.7455 phospholipase activity molecular function 3.97669 0.0187476 9.09091 2 20 96 10047 4620 1.7271 cell activation biological process 3.97669 0.0187476 9.09091 2 20 96 10047 1775 1.7271 developmental process biological process 3.97669 0.0187476 9.09091 2 20 96 10047 51094 1.7271 regulation of localization biological process 3.91042 0.0200321 3.08642 5 157 93 9910 32879 1.6983 sterol transport biological process 3.89194 0.0204057 8.69565 2 21 96 10046 15918 1.6902 cholesterol transport biological process 3.89194 0.0204057 8.69565 2 21 96 10046 30301 1.6902 cholesterol homeostasis biological process 3.89194 0.0204057 8.69565 2 21 96 10046 42632 1.6902 sterol homeostasis biological process 3.89194 0.0204057 8.69565 2 21 96 10046 55092 1.6902 leukocyte chemotaxis biological process 3.81115 0.0221227 8.33333 2 22 96 10045 30595 1.6552 regulation of cellular process biological process 3.77349 0.0229717 1.33441 33 2440 65 7627 50794 1.6388 cellular process biological process 3.77102 0.0230286 2.97619 5 163 93 9904 48522 1.6377 cellular hormone metabolic process biological process 3.73398 0.0238975 8 2 23 96 10044 34754 1.6216 regulation of transport biological process 3.69245 0.0249109 3.47826 4 111 94 9956 51049 1.6036 aminoglycan metabolic process biological process 3.66015 0.0257286 7.69231 2 24 96 10043 6022 1.5896 glycosaminoglycan metabolic process biological process 3.66015 0.0257286 7.69231 2 24 96 10043 30203 1.5896 cell chemotaxis biological process 3.66015 0.0257286 7.69231 2 24 96 10043 60326 1.5896 angiogenesis biological process 3.5894 0.027615 7.40741 2 25 96 10042 1525 1.5589 integral to plasma membrane cellular component 3.58473 0.0277442 1.64474 15 897 83 9170 5887 1.5568 response to fungus biological process 3.55269 0.0286476 33.3333 1 2 97 10065 9620 1.5429 platelet activation biological process 3.55269 0.0286476 33.3333 1 2 97 10065 10572 1.5429 cell activation biological process 3.55269 0.0286476 33.3333 1 2 97 10065 50867 1.5429 phospholipid catabolic process biological process 3.55269 0.0286476 33.3333 1 2 97 10065 9395 1.5429 negative regulation of smooth muscle cell migration biological process 3.55269 0.0286476 33.3333 1 2 97 10065 14912 1.5429 insulin-like growth factor binding protein complex cellular component 3.55269 0.0286476 33.3333 1 2 97 10065 16942 1.5429 phosphatase activator activity molecular function 3.55269 0.0286476 33.3333 1 2 97 10065 19211 1.5429 myoblast differentiation biological process 3.55269 0.0286476 33.3333 1 2 97 10065 45663 1.5429 muscle cell differentiation biological process 3.55269 0.0286476 33.3333 1 2 97 10065 51149 1.5429 chondroitin 4- sulfotransferase activity molecular function 3.55269 0.0286476 33.3333 1 2 97 10065 47756 1.5429

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO ribose phosphate diphosphokinase activity molecular function 3.55269 0.0286476 33.3333 1 2 97 10065 4749 1.5429 purine nucleotide biosynthetic process biological process 3.55269 0.0286476 33.3333 1 2 97 10065 6164 1.5429 nucleotide biosynthetic process biological process 3.55269 0.0286476 33.3333 1 2 97 10065 9165 1.5429 diphosphotransferase activity molecular function 3.55269 0.0286476 33.3333 1 2 97 10065 16778 1.5429 phagocytosis, recognition biological process 3.55269 0.0286476 33.3333 1 2 97 10065 6910 1.5429 endothelial cell migration biological process 3.55269 0.0286476 33.3333 1 2 97 10065 10595 1.5429 regulation of cholesterol storage biological process 3.55269 0.0286476 33.3333 1 2 97 10065 10885 1.5429 cholesterol storage biological process 3.55269 0.0286476 33.3333 1 2 97 10065 10886 1.5429 apolipoprotein A-I binding molecular function 3.55269 0.0286476 33.3333 1 2 97 10065 34186 1.5429 adhesion to other organism during biological process 3.55269 0.0286476 33.3333 1 2 97 10065 51825 1.5429 adhesion to symbiont biological process 3.55269 0.0286476 33.3333 1 2 97 10065 51856 1.5429 interleukin-12 production biological process 3.55269 0.0286476 33.3333 1 2 97 10065 32735 1.5429 SMAD protein nuclear translocation biological process 3.55269 0.0286476 33.3333 1 2 97 10065 7184 1.5429 salivary gland morphogenesis biological process 3.55269 0.0286476 33.3333 1 2 97 10065 7435 1.5429 menstrual cycle phase biological process 3.55269 0.0286476 33.3333 1 2 97 10065 22601 1.5429 gland morphogenesis biological process 3.55269 0.0286476 33.3333 1 2 97 10065 22612 1.5429 stress-activated MAPK biological process 3.55269 0.0286476 33.3333 1 2 97 10065 32874 1.5429 regulation of epidermis development biological process 3.55269 0.0286476 33.3333 1 2 97 10065 45682 1.5429 generation of neurons biological process 3.55269 0.0286476 33.3333 1 2 97 10065 48699 1.5429 cardiac epithelial to mesenchymal transition biological process 3.55269 0.0286476 33.3333 1 2 97 10065 60317 1.5429 pathway-restricted SMAD protein phosphorylation biological process 3.55269 0.0286476 33.3333 1 2 97 10065 60389 1.5429 aminoacylase activity molecular function 3.55269 0.0286476 33.3333 1 2 97 10065 4046 1.5429 endocytosis biological process 3.55269 0.0286476 33.3333 1 2 97 10065 45807 1.5429 sodium ion homeostasis biological process 3.55269 0.0286476 33.3333 1 2 97 10065 55078 1.5429 chromatin remodeling complex cellular component 3.52149 0.0295554 7.14286 2 26 96 10041 16585 1.5294 epidermis development biological process 3.51043 0.029884 4.28571 3 67 95 10000 8544 1.5246 response to wounding biological process 3.49061 0.0304824 2.76243 5 176 93 9891 9611 1.516 intrinsic to plasma membrane cellular component 3.45786 0.0314971 1.61812 15 912 83 9155 31226 1.5017 defense response to bacterium biological process 3.45623 0.0315486 6.89655 2 27 96 10040 42742 1.501 lipase activity molecular function 3.45623 0.0315486 6.89655 2 27 96 10040 16298 1.501 macromolecular complex subunit organization biological process 3.41175 0.0329833 2.06718 8 379 90 9688 43933 1.4817 enzyme inhibitor activity molecular function 3.40323 0.0332655 4.10959 3 70 95 9997 4857 1.478 tissue development biological process 3.40159 0.0333203 3.1746 4 122 94 9945 9888 1.4773 regulation of stressactivated protein kinase signaling pathway biological process 3.39343 0.0335934 6.66667 2 28 96 10039 70302 1.4737 regulation of programmed cell death biological process 3.36008 0.0347324 2.38095 6 246 92 9821 43067 1.4593 regulation of cell death biological process 3.3273 0.0358898 2.3622 6 248 92 9819 10941 1.445 transforming growth factor beta receptor signaling pathway biological process 3.27456 0.0378334 6.25 2 30 96 10037 7179 1.4221 lipopolysaccharide receptor complex cellular component 3.26977 0.0380151 25 1 3 97 10064 46696 1.42 negative regulation of protein amino acid phosphorylation biological process 3.26977 0.0380151 25 1 3 97 10064 1933 1.42

% genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO ion channel activity molecular function 3.26977 0.0380151 25 1 3 97 10064 5216 1.42 natural killer cell mediated cytotoxicity biological process 3.26977 0.0380151 25 1 3 97 10064 42267 1.42 phosphatidylserine molecular function 3.26977 0.0380151 25 1 3 97 10064 1786 1.42 innate immune response biological process 3.26977 0.0380151 25 1 3 97 10064 45089 1.42 protein-hormone receptor activity molecular function 3.26977 0.0380151 25 1 3 97 10064 16500 1.42 lymphocyte chemotaxis biological process 3.26977 0.0380151 25 1 3 97 10064 48247 1.42 glial cell migration biological process 3.26977 0.0380151 25 1 3 97 10064 8347 1.42 response to progesterone stimulus biological process 3.26977 0.0380151 25 1 3 97 10064 32570 1.42 regulation of transforming growth factor-beta2 production biological process 3.26977 0.0380151 25 1 3 97 10064 32909 1.42 neuron apoptosis biological process 3.26977 0.0380151 25 1 3 97 10064 43525 1.42 GPI anchor biosynthetic process biological process 3.26977 0.0380151 25 1 3 97 10064 6506 1.42 smooth muscle biological process 3.26977 0.0380151 25 1 3 97 10064 45987 1.42 sodium channel regulator activity molecular function 3.26977 0.0380151 25 1 3 97 10064 17080 1.42 lipid homeostasis biological process 3.21822 0.0400262 6.06061 2 31 96 10036 55088 1.3977 calmodulin binding molecular function 3.21822 0.0400262 6.06061 2 31 96 10036 5516 1.3977 apoptosis biological process 3.19933 0.0407896 2.55102 5 191 93 9876 43065 1.3895 regulation of cellular response to stress biological process 3.1111 0.0445521 5.71429 2 33 96 10034 80135 1.3511 heterocycle metabolic process biological process 3.1111 0.0445521 5.71429 2 33 96 10034 46483 1.3511 programmed cell death biological process 3.10904 0.0446438 2.48756 5 196 93 9871 43068 1.3502 response to external stimulus biological process 3.09136 0.0454401 2.47525 5 197 93 9870 9605 1.3426 chemotaxis biological process 3.08115 0.0459063 3.61446 3 80 95 9987 6935 1.3381 taxis biological process 3.08115 0.0459063 3.61446 3 80 95 9987 42330 1.3381 tumor necrosis factor biosynthetic process biological process 3.05139 0.0472932 20 1 4 97 10063 42535 1.3252 negative regulation of osteoclast differentiation biological process 3.05139 0.0472932 20 1 4 97 10063 45671 1.3252 phospholipid homeostasis biological process 3.05139 0.0472932 20 1 4 97 10063 55091 1.3252 insulin-like growth factor I binding molecular function 3.05139 0.0472932 20 1 4 97 10063 31994 1.3252 lysophospholipase molecular function 3.05139 0.0472932 20 1 4 97 10063 4622 1.3252 bile acid transmembrane transporter activity molecular function 3.05139 0.0472932 20 1 4 97 10063 15125 1.3252 glycosaminoglycan catabolic process biological process 3.05139 0.0472932 20 1 4 97 10063 6027 1.3252 N-acetylgalactosamine 4- O-sulfotransferase molecular function 3.05139 0.0472932 20 1 4 97 10063 1537 1.3252 chondroitin sulfotransferase activity molecular function 3.05139 0.0472932 20 1 4 97 10063 34481 1.3252 sequestering of metal ion biological process 3.05139 0.0472932 20 1 4 97 10063 51238 1.3252 nucleobase metabolic process biological process 3.05139 0.0472932 20 1 4 97 10063 9112 1.3252 neuromuscular junction development biological process 3.05139 0.0472932 20 1 4 97 10063 7528 1.3252 eye development biological process 3.05139 0.0472932 20 1 4 97 10063 1654 1.3252 muscle contraction biological process 3.05139 0.0472932 20 1 4 97 10063 45933 1.3252 response to bacterium biological process 3.01069 0.0492578 5.40541 2 35 96 10032 9617 1.3075 lipid transport biological process 3.01069 0.0492578 5.40541 2 35 96 10032 6869 1.3075 cytokine activity molecular function 3.01069 0.0492578 5.40541 2 35 96 10032 5125 1.3075 amine metabolic process biological process 3.01069 0.0492578 5.40541 2 35 96 10032 9308 1.3075

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO anatomical structure formation involved in morphogenesis biological process 3.01069 0.0492578 5.40541 2 35 96 10032 48646 1.3075 regulation of response to stress biological process 3.01069 0.0492578 5.40541 2 35 96 10032 80134 1.3075 protein-dna complex assembly biological process 2.99372 0.0501008 3.48837 3 83 95 9984 65004 1.3002 plasma membrane part cellular component 2.95551 0.0520521 1.43885 18 1233 80 8834 44459 1.2836 inflammatory response biological process 2.9489 0.0523973 2.73973 4 142 94 9925 6954 1.2807 regulation of biological process biological process 2.92186 0.0538334 1.21118 39 3181 59 6886 50789 1.2689 response to other biological process 2.91 0.054476 3.37079 3 86 95 9981 51707 1.2638 locomotion biological process 2.88287 0.0559741 3.33333 3 87 95 9980 40011 1.252 T-helper 1 type immune response biological process 2.87382 0.0564827 16.6667 1 5 97 10062 42088 1.2481 interleukin-8 biosynthetic process biological process 2.87382 0.0564827 16.6667 1 5 97 10062 45416 1.2481 decidualization biological process 2.87382 0.0564827 16.6667 1 5 97 10062 46697 1.2481 calcium ion transport into cytosol biological process 2.87382 0.0564827 16.6667 1 5 97 10062 10524 1.2481 calcium-mediated biological process 2.87382 0.0564827 16.6667 1 5 97 10062 50850 1.2481 sensory perception of biological process 2.87382 0.0564827 16.6667 1 5 97 10062 50909 1.2481 vacuolar protontransporting V-type cellular component 2.87382 0.0564827 16.6667 1 5 97 10062 16471 1.2481 JNK cascade biological process 2.87382 0.0564827 16.6667 1 5 97 10062 46330 1.2481 high-density lipoprotein particle clearance biological process 2.87382 0.0564827 16.6667 1 5 97 10062 34384 1.2481 regulation of biological process 2.87382 0.0564827 16.6667 1 5 97 10062 50764 1.2481 negative regulation of viral reproduction biological process 2.87382 0.0564827 16.6667 1 5 97 10062 48525 1.2481 cyclosporin A binding molecular function 2.87382 0.0564827 16.6667 1 5 97 10062 16018 1.2481 regulation of interleukin- 12 production biological process 2.87382 0.0564827 16.6667 1 5 97 10062 32655 1.2481 type II transforming growth factor beta molecular function 2.87382 0.0564827 16.6667 1 5 97 10062 5114 1.2481 epithelial to mesenchymal transition biological process 2.87382 0.0564827 16.6667 1 5 97 10062 10718 1.2481 cell morphogenesis involved in differentiation biological process 2.87382 0.0564827 16.6667 1 5 97 10062 10770 1.2481 heart contraction biological process 2.87382 0.0564827 16.6667 1 5 97 10062 45823 1.2481 negative regulation of immune response biological process 2.87382 0.0564827 16.6667 1 5 97 10062 50777 1.2481 mitotic cell cycle biological process 2.87382 0.0564827 16.6667 1 5 97 10062 45931 1.2481 female pregnancy biological process 2.87113 0.056635 5 2 38 96 10029 7565 1.2469 multicellular organismal process biological process 2.87113 0.056635 5 2 38 96 10029 51240 1.2469 membrane raft cellular component 2.82726 0.0591749 4.87805 2 39 96 10028 45121 1.2279 induction of apoptosis biological process 2.79038 0.0613978 2.5974 4 150 94 9917 6917 1.2118 response to metal ion biological process 2.7846 0.0617537 4.7619 2 40 96 10027 10038 1.2093 enzyme linked receptor protein signaling pathway biological process 2.75249 0.0637686 2.5641 4 152 94 9915 7167 1.1954 sensory perception of chemical stimulus biological process 2.7431 0.0643704 4.65116 2 41 96 10026 7606 1.1913 response to inorganic substance biological process 2.7431 0.0643704 4.65116 2 41 96 10026 10035 1.1913 regulation of cytokine production biological process 2.7431 0.0643704 4.65116 2 41 96 10026 1817 1.1913 cognition biological process 2.73154 0.065119 2.23214 5 219 93 9848 50890 1.1863

% genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO macrophage activation biological process 2.72442 0.0655844 14.2857 1 6 97 10061 42116 1.1832 regulation of tumor necrosis factor biological process 2.72442 0.0655844 14.2857 1 6 97 10061 42534 1.1832 regulation of osteoclast differentiation biological process 2.72442 0.0655844 14.2857 1 6 97 10061 45670 1.1832 cholesterol transport biological process 2.72442 0.0655844 14.2857 1 6 97 10061 32376 1.1832 negative regulation of smooth muscle cell proliferation biological process 2.72442 0.0655844 14.2857 1 6 97 10061 48662 1.1832 ATP-gated cation channel activity molecular function 2.72442 0.0655844 14.2857 1 6 97 10061 4931 1.1832 photoreceptor activity molecular function 2.72442 0.0655844 14.2857 1 6 97 10061 9881 1.1832 organic anion transmembrane transporter activity molecular function 2.72442 0.0655844 14.2857 1 6 97 10061 8514 1.1832 chondroitin sulfate metabolic process biological process 2.72442 0.0655844 14.2857 1 6 97 10061 30204 1.1832 chondroitin sulfate biosynthetic process biological process 2.72442 0.0655844 14.2857 1 6 97 10061 30206 1.1832 lipoprotein receptor molecular function 2.72442 0.0655844 14.2857 1 6 97 10061 30228 1.1832 viral reproduction biological process 2.72442 0.0655844 14.2857 1 6 97 10061 48524 1.1832 immune response biological process 2.72442 0.0655844 14.2857 1 6 97 10061 50778 1.1832 calcium-dependent phospholipid binding molecular function 2.72442 0.0655844 14.2857 1 6 97 10061 5544 1.1832 regulation of phosphoinositide 3- kinase cascade biological process 2.72442 0.0655844 14.2857 1 6 97 10061 14066 1.1832 phosphoinositide 3- kinase cascade biological process 2.72442 0.0655844 14.2857 1 6 97 10061 14068 1.1832 neurogenesis biological process 2.72442 0.0655844 14.2857 1 6 97 10061 22008 1.1832 signal transduction biological process 2.72442 0.0655844 14.2857 1 6 97 10061 9967 1.1832 cell communication biological process 2.72442 0.0655844 14.2857 1 6 97 10061 10647 1.1832 cyclin-dependent protein kinase inhibitor activity molecular function 2.72442 0.0655844 14.2857 1 6 97 10061 4861 1.1832 cellular response to extracellular stimulus biological process 2.72442 0.0655844 14.2857 1 6 97 10061 31668 1.1832 nitrogen compound metabolic process biological process 2.70271 0.0670239 4.54545 2 42 96 10025 6807 1.1738 regulation of immune response biological process 2.70271 0.0670239 4.54545 2 42 96 10025 50776 1.1738 system process biological process 2.67264 0.0690696 1.87166 7 367 91 9700 3008 1.1607 integral to membrane cellular component 2.60178 0.0741418 1.74672 8 450 90 9617 16021 1.1299 regulation of interleukin-8 biosynthetic process biological process 2.59562 0.0745993 12.5 1 7 97 10060 45414 1.1273 response to vitamin D biological process 2.59562 0.0745993 12.5 1 7 97 10060 33280 1.1273 purinergic nucleotide receptor activity molecular function 2.59562 0.0745993 12.5 1 7 97 10060 1614 1.1273 nucleotide receptor molecular function 2.59562 0.0745993 12.5 1 7 97 10060 16502 1.1273 regulation of calciummediated signaling biological process 2.59562 0.0745993 12.5 1 7 97 10060 50848 1.1273 neuron differentiation biological process 2.59562 0.0745993 12.5 1 7 97 10060 30182 1.1273 tumor necrosis factor receptor activity molecular function 2.59562 0.0745993 12.5 1 7 97 10060 5031 1.1273 nitric-oxide synthase biological process 2.59562 0.0745993 12.5 1 7 97 10060 51000 1.1273 triglyceride homeostasis biological process 2.59562 0.0745993 12.5 1 7 97 10060 70328 1.1273 interferon-alpha/beta receptor binding molecular function 2.59562 0.0745993 12.5 1 7 97 10060 5132 1.1273 bacterial binding molecular function 2.59562 0.0745993 12.5 1 7 97 10060 8367 1.1273 nuclear outer membrane cellular component 2.59562 0.0745993 12.5 1 7 97 10060 5640 1.1273

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO GTP-dependent protein binding molecular function 2.59562 0.0745993 12.5 1 7 97 10060 30742 1.1273 sensory organ biological process 2.59562 0.0745993 12.5 1 7 97 10060 7423 1.1273 negative regulation of epithelial cell proliferation biological process 2.59562 0.0745993 12.5 1 7 97 10060 50680 1.1273 sodium:potassiumexchanging ATPase molecular function 2.59562 0.0745993 12.5 1 7 97 10060 5391 1.1273 regulation of multicellular organismal process biological process 2.58457 0.0754284 2.13675 5 229 93 9838 51239 1.1225 intrinsic to membrane cellular component 2.57224 0.0763644 1.73536 8 453 90 9614 31224 1.1171 anatomical structure development biological process 2.54114 0.0787762 1.59744 10 616 88 9451 48856 1.1036 neurological system process biological process 2.52838 0.0797883 2.10084 5 233 93 9834 50877 1.0981 insulin-like growth factor binding molecular function 2.48257 0.083528 11.1111 1 8 97 10059 5520 1.0782 negative regulation of signal transduction biological process 2.48257 0.083528 11.1111 1 8 97 10059 9968 1.0782 negative regulation of cell communication biological process 2.48257 0.083528 11.1111 1 8 97 10059 10648 1.0782 peripheral nervous system development biological process 2.48257 0.083528 11.1111 1 8 97 10059 7422 1.0782 tumor necrosis factor binding molecular function 2.48257 0.083528 11.1111 1 8 97 10059 43120 1.0782 regulation of lipid storage biological process 2.48257 0.083528 11.1111 1 8 97 10059 10883 1.0782 response to interferongamma biological process 2.48257 0.083528 11.1111 1 8 97 10059 34341 1.0782 cation channel activity molecular function 2.45161 0.0861547 2.77778 3 105 95 9962 5261 1.0647 extracellular matrix structural constituent molecular function 2.41384 0.0894707 3.84615 2 50 96 10017 5201 1.0483 protein heterodimerization molecular function 2.38877 0.0917424 2.7027 3 108 95 9959 46982 1.0374 embryo implantation biological process 2.38194 0.0923715 10 1 9 97 10058 7566 1.0345 low-density lipoprotein binding molecular function 2.38194 0.0923715 10 1 9 97 10058 30169 1.0345 apolipoprotein binding molecular function 2.38194 0.0923715 10 1 9 97 10058 34185 1.0345 scavenger receptor molecular function 2.38194 0.0923715 10 1 9 97 10058 5044 1.0345 response to tumor necrosis factor biological process 2.38194 0.0923715 10 1 9 97 10058 34612 1.0345 epithelial to mesenchymal transition biological process 2.38194 0.0923715 10 1 9 97 10058 1837 1.0345 protein biological process 2.38194 0.0923715 10 1 9 97 10058 51289 1.0345 phosphoinositide biosynthetic process biological process 2.38194 0.0923715 10 1 9 97 10058 46489 1.0345 regulation of developmental process biological process 2.38146 0.0924158 3.77358 2 51 96 10016 50793 1.0343 cell motion biological process 2.34492 0.0958553 2.22222 4 176 94 9891 6928 1.0184 transmembrane receptor protein serine/threonine kinase signaling pathway biological process 2.31882 0.0983895 3.63636 2 53 96 10014 7178 1.0071 negative regulation of cell growth biological process 2.31882 0.0983895 3.63636 2 53 96 10014 30308 1.0071 ion transmembrane transporter activity molecular function 2.31445 0.0988208 2.1978 4 178 94 9889 15075 1.0052 cellular lipid catabolic process biological process 2.29135 0.10113 9.09091 1 10 97 10057 44242 0.9951 substrate specific channel activity molecular function 2.29135 0.10113 9.09091 1 10 97 10057 22838 0.9951 calcium ion transport biological process 2.29135 0.10113 9.09091 1 10 97 10057 51928 0.9951 organic anion transport biological process 2.29135 0.10113 9.09091 1 10 97 10057 15711 0.9951 regulation of nitric-oxide synthase activity biological process 2.29135 0.10113 9.09091 1 10 97 10057 50999 0.9951 cell morphogenesis involved in differentiation biological process 2.29135 0.10113 9.09091 1 10 97 10057 904 0.9951 neutrophil chemotaxis biological process 2.29135 0.10113 9.09091 1 10 97 10057 30593 0.9951

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO regulation of neuron apoptosis biological process 2.29135 0.10113 9.09091 1 10 97 10057 43523 0.9951 negative regulation of hydrolase activity biological process 2.29135 0.10113 9.09091 1 10 97 10057 51346 0.9951 extrinsic to membrane cellular component 2.29135 0.10113 9.09091 1 10 97 10057 19898 0.9951 mannosyltransferase activity molecular function 2.29135 0.10113 9.09091 1 10 97 10057 30 0.9951 angiogenesis biological process 2.29135 0.10113 9.09091 1 10 97 10057 45766 0.9951 extracellular structure organization biological process 2.28851 0.101417 3.57143 2 54 96 10013 43062 0.9939 muscle organ biological process 2.25886 0.104469 3.50877 2 55 96 10012 7517 0.981 G-protein coupled receptor activity molecular function 2.23115 0.107405 1.91571 5 256 93 9811 4930 0.969 extracellular region part cellular component 2.21276 0.109398 1.67064 7 412 91 9655 44421 0.961 regulation of muscle cell differentiation biological process 2.20904 0.109806 8.33333 1 11 97 10056 51147 0.9594 monocarboxylic acid transmembrane transporter activity molecular function 2.20904 0.109806 8.33333 1 11 97 10056 8028 0.9594 odontogenesis biological process 2.20904 0.109806 8.33333 1 11 97 10056 42476 0.9594 ATPase activity, coupled to transmembrane movement of ions, phosphorylative molecular function 2.20904 0.109806 8.33333 1 11 97 10056 15662 0.9594 protein serine/threonine kinase inhibitor activity molecular function 2.20904 0.109806 8.33333 1 11 97 10056 30291 0.9594 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides molecular function 2.20904 0.109806 8.33333 1 11 97 10056 16811 0.9594 cell cycle biological process 2.20904 0.109806 8.33333 1 11 97 10056 45787 0.9594 cell migration biological process 2.20139 0.110649 3.38983 2 57 96 10010 16477 0.9561 metal ion transmembrane transporter activity molecular function 2.14046 0.117601 2.41935 3 121 95 9946 46873 0.9296 adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains biological process 2.1337 0.118398 7.69231 1 12 97 10055 2460 0.9267 carbonate dehydratase activity molecular function 2.1337 0.118398 7.69231 1 12 97 10055 4089 0.9267 nucleosome cellular component 2.1337 0.118398 7.69231 1 12 97 10055 786 0.9267 tumor necrosis factor receptor superfamily molecular function 2.1337 0.118398 7.69231 1 12 97 10055 32813 0.9267 sphingoid metabolic process biological process 2.1337 0.118398 7.69231 1 12 97 10055 46519 0.9267 biological regulation biological process 2.12378 0.119579 1.1354 40 3483 58 6584 65007 0.9223 signal transduction biological process 2.11379 0.120779 1.26183 20 1565 78 8502 7165 0.918 cell death biological process 2.07104 0.126054 2.34375 3 125 95 9942 8219 0.8994 death biological process 2.07104 0.126054 2.34375 3 125 95 9942 16265 0.8994 extracellular matrix cellular component 2.06753 0.126498 3.125 2 62 96 10005 31012 0.8979 voltage-gated cation channel activity molecular function 2.06753 0.126498 3.125 2 62 96 10005 22843 0.8979 adaptive immune biological process 2.06428 0.126909 7.14286 1 13 97 10054 2250 0.8965 phospholipid metabolic process biological process 2.06428 0.126909 7.14286 1 13 97 10054 6644 0.8965 cytochrome-c oxidase activity molecular function 2.06428 0.126909 7.14286 1 13 97 10054 4129 0.8965 oxidoreductase activity, acting on heme of donors molecular function 2.06428 0.126909 7.14286 1 13 97 10054 16675 0.8965 oxidoreductase activity, acting on heme of donors, oxygen as molecular function 2.06428 0.126909 7.14286 1 13 97 10054 16676 0.8965

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO inactivation of MAPK activity biological process 2.06428 0.126909 7.14286 1 13 97 10054 188 0.8965 response to reactive oxygen species biological process 2.06428 0.126909 7.14286 1 13 97 10054 302 0.8965 caveola cellular component 2.06428 0.126909 7.14286 1 13 97 10054 5901 0.8965 transforming growth factor beta receptor molecular function 2.06428 0.126909 7.14286 1 13 97 10054 5160 0.8965 transmembrane receptor protein serine/threonine kinase binding molecular function 2.06428 0.126909 7.14286 1 13 97 10054 70696 0.8965 G2/M transition of mitotic cell cycle biological process 2.06428 0.126909 7.14286 1 13 97 10054 86 0.8965 induction of apoptosis by intracellular signals biological process 2.06428 0.126909 7.14286 1 13 97 10054 8629 0.8965 macromolecular complex assembly biological process 2.0484 0.128941 1.68539 6 350 92 9717 65003 0.8896 membrane cellular component 2.02596 0.131867 1.37773 12 859 86 9208 16020 0.8799 sensory perception biological process 2.00883 0.134146 1.96078 4 200 94 9867 7600 0.8724 regulation of lipid biological process 1.99998 0.135338 6.66667 1 14 97 10053 32368 0.8686 regulation of sterol biological process 1.99998 0.135338 6.66667 1 14 97 10053 32371 0.8686 regulation of cholesterol transport biological process 1.99998 0.135338 6.66667 1 14 97 10053 32374 0.8686 regulation of smooth muscle cell proliferation biological process 1.99998 0.135338 6.66667 1 14 97 10053 48660 0.8686 phosphatidylinositol molecular function 1.99998 0.135338 6.66667 1 14 97 10053 5545 0.8686 lipoprotein particle clearance biological process 1.99998 0.135338 6.66667 1 14 97 10053 34381 0.8686 receptor serine/threonine kinase binding molecular function 1.99998 0.135338 6.66667 1 14 97 10053 33612 0.8686 extracellular space cellular component 1.97243 0.139119 1.76056 5 279 93 9788 5615 0.8566 regulation of response to stimulus biological process 1.95648 0.141355 2.22222 3 132 95 9935 48583 0.8497 phospholipid binding molecular function 1.94598 0.142847 2.89855 2 67 96 10000 5543 0.8451 cation transmembrane transporter activity molecular function 1.94079 0.143591 2.20588 3 133 95 9934 8324 0.8429 myeloid leukocyte activation biological process 1.94012 0.143686 6.25 1 15 97 10052 2274 0.8426 MHC class I receptor activity molecular function 1.94012 0.143686 6.25 1 15 97 10052 32393 0.8426 learning or memory biological process 1.94012 0.143686 6.25 1 15 97 10052 7611 0.8426 cholesterol efflux biological process 1.94012 0.143686 6.25 1 15 97 10052 33344 0.8426 single fertilization biological process 1.94012 0.143686 6.25 1 15 97 10052 7338 0.8426 regulation of macromolecule biological process 1.94012 0.143686 6.25 1 15 97 10052 10556 0.8426 protein import into nucleus, translocation biological process 1.94012 0.143686 6.25 1 15 97 10052 60 0.8426 collagen fibril biological process 1.94012 0.143686 6.25 1 15 97 10052 30199 0.8426 protein oligomerization biological process 1.92299 0.146169 2.85714 2 68 96 9999 51259 0.8351 enzyme regulator activity molecular function 1.91891 0.146767 1.62162 6 364 92 9703 30234 0.8334 cell motility biological process 1.90041 0.149508 2.8169 2 69 96 9998 48870 0.8253 wound healing biological process 1.88417 0.151955 5.88235 1 16 97 10051 42060 0.8183 regulation of viral reproduction biological process 1.88417 0.151955 5.88235 1 16 97 10051 50792 0.8183 cytokine receptor activity molecular function 1.88417 0.151955 5.88235 1 16 97 10051 4896 0.8183 monovalent inorganic cation homeostasis biological process 1.88417 0.151955 5.88235 1 16 97 10051 55067 0.8183 cytokine binding molecular function 1.85642 0.156231 2.73973 2 71 96 9996 19955 0.8062 response to stimulus biological process 1.84828 0.157508 1.26084 16 1253 82 8814 50896 0.8027 regulation of cellular component organization biological process 1.83532 0.159562 2.0979 3 140 95 9927 51128 0.7971 regulation of monooxygenase activity biological process 1.83168 0.160144 5.55556 1 17 97 10050 32768 0.7955 fertilization biological process 1.83168 0.160144 5.55556 1 17 97 10050 9566 0.7955 cell morphogenesis biological process 1.83168 0.160144 5.55556 1 17 97 10050 902 0.7955 protein tetramerization biological process 1.83168 0.160144 5.55556 1 17 97 10050 51262 0.7955 cation binding molecular function 1.79779 0.165664 1.5625 6 378 92 9689 43169 0.7808 metal ion binding molecular function 1.79779 0.165664 1.5625 6 378 92 9689 46872 0.7808

% genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO primary metabolic biological process 1.78325 0.168091 1.65017 5 298 93 9769 44238 0.7745 response to vitamin biological process 1.78227 0.168256 5.26316 1 18 97 10049 33273 0.774 mrna catabolic process biological process 1.78227 0.168256 5.26316 1 18 97 10049 6402 0.774 negative regulation of MAP kinase activity biological process 1.78227 0.168256 5.26316 1 18 97 10049 43407 0.774 voltage-gated calcium channel complex cellular component 1.78227 0.168256 5.26316 1 18 97 10049 5891 0.774 biological_process biological process 1.77703 0.169139 1.02772 76 7319 22 2748 8150 0.7718 intracellular cellular component 1.76439 0.171291 2.02703 3 145 95 9922 5622 0.7663 structural molecule molecular function 1.73675 0.176091 1.62338 5 303 93 9764 5198 0.7543 leukocyte adhesion biological process 1.73562 0.17629 5 1 19 97 10048 7159 0.7538 cell adhesion biological process 1.73562 0.17629 5 1 19 97 10048 45785 0.7538 negative regulation of transport biological process 1.73562 0.17629 5 1 19 97 10048 51051 0.7538 regulation of protein catabolic process biological process 1.73562 0.17629 5 1 19 97 10048 42176 0.7538 generation of precursor metabolites and energy biological process 1.73317 0.176724 2.53165 2 77 96 9990 6091 0.7527 ion binding molecular function 1.70809 0.181212 1.51899 6 389 92 9678 43167 0.7418 regulation of MAP kinase activity biological process 1.69148 0.184247 4.7619 1 20 97 10047 43405 0.7346 macromolecular complex disassembly biological process 1.69148 0.184247 4.7619 1 20 97 10047 32984 0.7346 regulation of epithelial cell proliferation biological process 1.69148 0.184247 4.7619 1 20 97 10047 50678 0.7346 regulation of biomineral formation biological process 1.69148 0.184247 4.7619 1 20 97 10047 70167 0.7346 sphingolipid metabolic process biological process 1.69148 0.184247 4.7619 1 20 97 10047 6665 0.7346 biological adhesion biological process 1.68264 0.185882 1.59236 5 309 93 9758 22610 0.7308 I-kappaB kinase/nfkappab cascade biological process 1.6496 0.192127 4.54545 1 21 97 10046 7249 0.7164 integral to endoplasmic reticulum membrane cellular component 1.6496 0.192127 4.54545 1 21 97 10046 30176 0.7164 keratinocyte biological process 1.6496 0.192127 4.54545 1 21 97 10046 30216 0.7164 voltage-gated calcium channel activity molecular function 1.6496 0.192127 4.54545 1 21 97 10046 5245 0.7164 cell-cell junction organization biological process 1.6496 0.192127 4.54545 1 21 97 10046 45216 0.7164 glycerophospholipid biosynthetic process biological process 1.6496 0.192127 4.54545 1 21 97 10046 46474 0.7164 protein complex biological process 1.63245 0.195451 1.89873 3 155 95 9912 6461 0.709 substrate-specific transporter activity molecular function 1.62174 0.197555 1.55763 5 316 93 9751 22892 0.7043 regulation of phosphate metabolic process biological process 1.62144 0.197614 2.35294 2 83 96 9984 19220 0.7042 regulation of phosphorus metabolic process biological process 1.62144 0.197614 2.35294 2 83 96 9984 51174 0.7042 multicellular organismal process biological process 1.61558 0.198775 1.417 7 487 91 9580 32501 0.7016 regulation of metal ion transport biological process 1.60977 0.199933 4.34783 1 22 97 10045 10959 0.6991 regulation of calcium ion transport biological process 1.60977 0.199933 4.34783 1 22 97 10045 51924 0.6991 lipoprotein binding molecular function 1.60977 0.199933 4.34783 1 22 97 10045 8034 0.6991 protein kinase inhibitor activity molecular function 1.60977 0.199933 4.34783 1 22 97 10045 4860 0.6991 endoplasmic reticulum cellular component 1.5845 0.205051 1.65289 4 238 94 9829 5783 0.6881 axon guidance biological process 1.57183 0.207664 4.16667 1 23 97 10044 7411 0.6826 hematopoietin/interferonclass (D200-domain) cytokine receptor binding molecular function 1.57183 0.207664 4.16667 1 23 97 10044 5126 0.6826 membrane lipid metabolic process biological process 1.57183 0.207664 4.16667 1 23 97 10044 6643 0.6826

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO transmembrane receptor protein tyrosine kinase signaling pathway biological process 1.56939 0.208172 2.27273 2 86 96 9981 7169 0.6816 cell surface receptor linked signal transduction biological process 1.56289 0.209529 1.35364 8 583 90 9484 7166 0.6788 regulation of ion transport biological process 1.53563 0.215321 4 1 24 97 10043 43269 0.6669 cell recognition biological process 1.53563 0.215321 4 1 24 97 10043 8037 0.6669 protein secretion biological process 1.53563 0.215321 4 1 24 97 10043 50714 0.6669 muscle contraction biological process 1.51964 0.21879 2.1978 2 89 96 9978 6936 0.66 response to unfolded protein biological process 1.50101 0.222904 3.84615 1 25 97 10042 6986 0.6519 regulation of G-protein coupled receptor protein signaling pathway biological process 1.50101 0.222904 3.84615 1 25 97 10042 8277 0.6519 receptor signaling protein serine/threonine kinase activity molecular function 1.50101 0.222904 3.84615 1 25 97 10042 4702 0.6519 protein transport biological process 1.50101 0.222904 3.84615 1 25 97 10042 51222 0.6519 ATPase activity, coupled to transmembrane movement of ions molecular function 1.50101 0.222904 3.84615 1 25 97 10042 42625 0.6519 protein biological process 1.50101 0.222904 3.84615 1 25 97 10042 51260 0.6519 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds molecular function 1.50101 0.222904 3.84615 1 25 97 10042 16810 0.6519 voltage-gated potassium channel activity molecular function 1.50101 0.222904 3.84615 1 25 97 10042 5249 0.6519 plasma membrane cellular component 1.49225 0.224866 1.27226 10 776 88 9291 5886 0.6481 transporter activity molecular function 1.49114 0.225117 1.36452 7 506 91 9561 5215 0.6476 NFkappaB transcription factor activity biological process 1.46787 0.230416 3.7037 1 26 97 10041 51092 0.6375 regulation of endocytosis biological process 1.46787 0.230416 3.7037 1 26 97 10041 30100 0.6375 synapse organization biological process 1.46787 0.230416 3.7037 1 26 97 10041 50808 0.6375 transcription corepressor activity molecular function 1.45664 0.233018 2.10526 2 93 96 9974 3714 0.6326 muscle system process biological process 1.45664 0.233018 2.10526 2 93 96 9974 3012 0.6326 organ development biological process 1.45623 0.233114 1.7341 3 170 95 9897 48513 0.6324 regulation of cellular metabolic process biological process 1.44531 0.235673 1.72414 3 171 95 9896 31323 0.6277 negative regulation of cell migration biological process 1.43609 0.237855 3.57143 1 27 97 10040 30336 0.6237 vacuolar part cellular component 1.43609 0.237855 3.57143 1 27 97 10040 44437 0.6237 oxidoreductase activity, acting on the CH-CH of donors molecular function 1.43609 0.237855 3.57143 1 27 97 10040 16627 0.6237 phospholipid biosynthetic process biological process 1.43609 0.237855 3.57143 1 27 97 10040 8654 0.6237 transcription repressor activity molecular function 1.43449 0.238238 1.71429 3 172 95 9895 16564 0.623 multicellular organismal development biological process 1.42376 0.240808 1.70455 3 173 95 9894 7275 0.6183 cellular component organization biological process 1.41741 0.242341 1.24844 10 791 88 9276 16043 0.6156 vesicle-mediated biological process 1.4117 0.243728 2.04082 2 96 96 9971 16192 0.6131 substrate-specific transmembrane transporter activity molecular function 1.41058 0.244001 1.53257 4 257 94 9810 22891 0.6126 response to protein stimulus biological process 1.40559 0.245223 3.44828 1 28 97 10039 51789 0.6104 maintenance of location biological process 1.40559 0.245223 3.44828 1 28 97 10039 51235 0.6104 regulation of vesiclemediated transport biological process 1.40559 0.245223 3.44828 1 28 97 10039 60627 0.6104 G1/S transition of mitotic cell cycle biological process 1.40559 0.245223 3.44828 1 28 97 10039 82 0.6104

% genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO cell-cell signaling biological process 1.39276 0.24839 1.42857 5 345 93 9722 7267 0.6049 membrane fraction cellular component 1.39276 0.24839 1.42857 5 345 93 9722 5624 0.6049 external side of plasma membrane cellular component 1.37626 0.25252 3.33333 1 29 97 10038 9897 0.5977 extracellular matrix organization biological process 1.37626 0.25252 3.33333 1 29 97 10038 30198 0.5977 cell junction organization biological process 1.37626 0.25252 3.33333 1 29 97 10038 34330 0.5977 sodium ion transport biological process 1.37626 0.25252 3.33333 1 29 97 10038 6814 0.5977 defense response biological process 1.35464 0.25804 1.96078 2 100 96 9967 6952 0.5883 protein phosphatase regulator activity molecular function 1.34804 0.259748 3.22581 1 30 97 10037 19888 0.5854 negative regulation of cell motion biological process 1.34804 0.259748 3.22581 1 30 97 10037 51271 0.5854 hydro-lyase activity molecular function 1.34804 0.259748 3.22581 1 30 97 10037 16836 0.5854 phosphoinositide binding molecular function 1.34804 0.259748 3.22581 1 30 97 10037 35091 0.5854 platelet alpha granule cellular component 1.34804 0.259748 3.22581 1 30 97 10037 31093 0.5854 regulation of signal transduction biological process 1.34364 0.260893 1.48699 4 265 94 9802 9966 0.5835 regulation of cell communication biological process 1.34364 0.260893 1.48699 4 265 94 9802 10646 0.5835 cell communication biological process 1.34262 0.261161 1.40056 5 352 93 9715 7154 0.5831 response to nutrient biological process 1.32085 0.266907 3.125 1 31 97 10036 7584 0.5736 phosphatase regulator activity molecular function 1.32085 0.266907 3.125 1 31 97 10036 19208 0.5736 apical plasma membrane cellular component 1.32085 0.266907 3.125 1 31 97 10036 16324 0.5736 regulation of oxidoreductase activity biological process 1.32085 0.266907 3.125 1 31 97 10036 51341 0.5736 lipid transporter activity molecular function 1.32085 0.266907 3.125 1 31 97 10036 5319 0.5736 insoluble fraction cellular component 1.31479 0.268531 1.38504 5 356 93 9711 5626 0.571 apoptosis biological process 1.31384 0.268786 1.90476 2 103 96 9964 6915 0.5706 growth factor binding molecular function 1.29464 0.273997 3.0303 1 32 97 10035 19838 0.5623 receptor-mediated endocytosis biological process 1.29464 0.273997 3.0303 1 32 97 10035 6898 0.5623 response to steroid hormone stimulus biological process 1.29464 0.273997 3.0303 1 32 97 10035 48545 0.5623 cytoplasmic membranebounded vesicle lumen cellular component 1.29464 0.273997 3.0303 1 32 97 10035 60205 0.5623 olfactory receptor activity molecular function 1.29464 0.273997 3.0303 1 32 97 10035 4984 0.5623 visual perception biological process 1.28754 0.27595 1.86916 2 105 96 9962 7601 0.5592 sensory perception of light stimulus biological process 1.28754 0.27595 1.86916 2 105 96 9962 50953 0.5592 protein dimerization molecular function 1.28008 0.278014 1.44404 4 273 94 9794 46983 0.5559 sulfotransferase activity molecular function 1.26933 0.281019 2.94118 1 33 97 10034 8146 0.5513 channel regulator activity molecular function 1.26933 0.281019 2.94118 1 33 97 10034 16247 0.5513 cellular_component cellular component 1.26832 0.281304 1.00924 71 6964 27 3103 5575 0.5508 programmed cell death biological process 1.26192 0.283111 1.83486 2 107 96 9960 12501 0.548 regulation of myeloid leukocyte differentiation biological process 1.24489 0.287974 2.85714 1 34 97 10033 2761 0.5406 response to cytokine stimulus biological process 1.24489 0.287974 2.85714 1 34 97 10033 34097 0.5406 cellular lipid metabolic process biological process 1.22757 0.293004 1.53061 3 193 95 9874 44255 0.5331 carbon-oxygen lyase activity molecular function 1.22125 0.294862 2.77778 1 35 97 10032 16835 0.5304 sensory perception of biological process 1.22125 0.294862 2.77778 1 35 97 10032 7608 0.5304 cellular macromolecular complex assembly biological process 1.2186 0.295643 1.52284 3 194 95 9873 34622 0.5292 lipid binding molecular function 1.20069 0.300985 1.75439 2 112 96 9955 8289 0.5215 transcription factor biological process 1.19838 0.301684 2.7027 1 36 97 10031 51091 0.5204 excretion biological process 1.19838 0.301684 2.7027 1 36 97 10031 7588 0.5204 receptor binding molecular function 1.18154 0.306805 1.26582 6 468 92 9599 5102 0.5131 auxiliary transport protein activity molecular function 1.17622 0.308441 2.63158 1 37 97 10030 15457 0.5108 second-messengermediated signaling biological process 1.16578 0.311678 1.7094 2 115 96 9952 19932 0.5063

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO hydrolase activity, hydrolyzing O-glycosyl compounds molecular function 1.15476 0.315134 2.5641 1 38 97 10029 4553 0.5015 activation of caspase activity biological process 1.15476 0.315134 2.5641 1 38 97 10029 6919 0.5015 chemokine activity molecular function 1.15476 0.315134 2.5641 1 38 97 10029 8009 0.5015 voltage-gated potassium channel complex cellular component 1.15476 0.315134 2.5641 1 38 97 10029 8076 0.5015 protein homodimerization activity molecular function 1.14949 0.316798 1.46341 3 202 95 9865 42803 0.4992 regulation of lipid metabolic process biological process 1.13394 0.321762 2.5 1 39 97 10028 19216 0.4925 transferase activity, transferring sulfurcontaining s molecular function 1.13394 0.321762 2.5 1 39 97 10028 16782 0.4925 cell development biological process 1.13394 0.321762 2.5 1 39 97 10028 48468 0.4925 innate immune response biological process 1.11375 0.328327 2.43902 1 40 97 10027 45087 0.4837 activation of protein kinase activity biological process 1.11375 0.328327 2.43902 1 40 97 10027 32147 0.4837 chemokine receptor molecular function 1.11375 0.328327 2.43902 1 40 97 10027 42379 0.4837 anion transport biological process 1.09414 0.334828 2.38095 1 41 97 10026 6820 0.4752 carboxylic acid transmembrane transporter activity molecular function 1.09414 0.334828 2.38095 1 41 97 10026 46943 0.4752 ATPase activity, coupled to transmembrane movement of substances molecular function 1.09414 0.334828 2.38095 1 41 97 10026 42626 0.4752 chemical homeostasis biological process 1.07693 0.34064 1.40187 3 211 95 9856 48878 0.4677 organic acid transmembrane transporter activity molecular function 1.07509 0.341268 2.32558 1 42 97 10025 5342 0.4669 caspase activity biological process 1.07509 0.341268 2.32558 1 42 97 10025 43280 0.4669 developmental process biological process 1.07204 0.342308 1.10638 13 1162 85 8905 32502 0.4656 calcium ion binding molecular function 1.06847 0.343534 1.5873 2 124 96 9943 5509 0.464 regulation of cytokine biosynthetic process biological process 1.05657 0.347646 2.27273 1 43 97 10024 42035 0.4589 anion transmembrane transporter activity molecular function 1.05657 0.347646 2.27273 1 43 97 10024 8509 0.4589 cellular component morphogenesis biological process 1.05657 0.347646 2.27273 1 43 97 10024 32989 0.4589 protein kinase regulator activity molecular function 1.05657 0.347646 2.27273 1 43 97 10024 19887 0.4589 regulation of protein kinase cascade biological process 1.04823 0.350556 1.5625 2 126 96 9941 10627 0.4552 Golgi apparatus cellular component 1.03882 0.353872 1.36986 3 216 95 9851 5794 0.4512 response to hypoxia biological process 1.03857 0.353962 2.22222 1 44 97 10023 1666 0.451 cell adhesion biological process 1.03075 0.356741 1.27796 4 309 94 9758 7155 0.4476 regulation of protein kinase activity biological process 1.02847 0.357553 1.53846 2 128 96 9939 45859 0.4467 regulation of myeloid cell differentiation biological process 1.02105 0.360218 2.17391 1 45 97 10022 45637 0.4434 metallopeptidase activity molecular function 1.02105 0.360218 2.17391 1 45 97 10022 8237 0.4434 regulation of protein transport biological process 1.02105 0.360218 2.17391 1 45 97 10022 51223 0.4434 regulation of hydrolase activity biological process 1.01876 0.361041 1.52672 2 129 96 9938 51336 0.4424 cellular developmental process biological process 1.01667 0.361799 1.35135 3 219 95 9848 48869 0.4415 regulation of kinase biological process 1.00917 0.364523 1.51515 2 130 96 9937 43549 0.4383 ATPase activity, coupled to movement of molecular function 1.00399 0.366414 2.12766 1 46 97 10021 43492 0.436 secretion biological process 1.00399 0.366414 2.12766 1 46 97 10021 46903 0.436 cell differentiation biological process 0.999678 0.367998 1.50376 2 131 96 9936 30154 0.4342 cell fraction cellular component 0.997178 0.368919 1.17647 6 504 92 9563 267 0.4331 hydrolase activity, acting on glycosyl bonds molecular function 0.987381 0.372551 2.08333 1 47 97 10020 16798 0.4288

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO cell-substrate adherens junction cellular component 0.987381 0.372551 2.08333 1 47 97 10020 5924 0.4288 focal adhesion cellular component 0.987381 0.372551 2.08333 1 47 97 10020 5925 0.4288 response to oxygen levels biological process 0.987381 0.372551 2.08333 1 47 97 10020 70482 0.4288 metal ion transport biological process 0.971859 0.378379 1.47059 2 134 96 9933 30001 0.4221 response to hormone stimulus biological process 0.955424 0.384649 2 1 49 97 10018 9725 0.4149 regulation of establishment of protein biological process 0.955424 0.384649 2 1 49 97 10018 70201 0.4149 cell-substrate junction cellular component 0.940043 0.390611 1.96078 1 50 97 10017 30055 0.4083 kinase regulator activity molecular function 0.940043 0.390611 1.96078 1 50 97 10017 19207 0.4083 cell proliferation biological process 0.93621 0.392111 1.42857 2 138 96 9929 8284 0.4066 system development biological process 0.930955 0.394177 1.21212 4 326 94 9741 48731 0.4043 ion transport biological process 0.926442 0.39596 1.2766 3 232 95 9835 6811 0.4023 regulation of cell biological process 0.925041 0.396515 1.92308 1 51 97 10016 50865 0.4017 peroxisome cellular component 0.925041 0.396515 1.92308 1 51 97 10016 5777 0.4017 microbody cellular component 0.925041 0.396515 1.92308 1 51 97 10016 42579 0.4017 response to virus biological process 0.925041 0.396515 1.92308 1 51 97 10016 9615 0.4017 regulation of protein localization biological process 0.925041 0.396515 1.92308 1 51 97 10016 32880 0.4017 regulation of caspase activity biological process 0.910401 0.402363 1.88679 1 52 97 10015 43281 0.3954 kinase activity molecular function 0.910401 0.402363 1.88679 1 52 97 10015 16301 0.3954 regulation of transferase activity biological process 0.902119 0.405709 1.38889 2 142 96 9925 51338 0.3918 proteinaceous extracellular matrix cellular component 0.88215 0.413892 1.81818 1 54 97 10013 5578 0.3831 G-protein coupled receptor protein signaling biological process 0.875238 0.416763 1.23457 3 240 95 9827 7186 0.3801 cellular defense response biological process 0.868518 0.419573 1.78571 1 55 97 10012 6968 0.3772 regulation of endopeptidase activity biological process 0.868518 0.419573 1.78571 1 55 97 10012 52548 0.3772 microtubule associated complex cellular component 0.855196 0.4252 1.75439 1 56 97 10011 5875 0.3714 intrinsic to organelle membrane cellular component 0.842174 0.430773 1.72414 1 57 97 10010 31300 0.3658 integral to organelle membrane cellular component 0.842174 0.430773 1.72414 1 57 97 10010 31301 0.3658 regulation of apoptosis biological process 0.842174 0.430773 1.72414 1 57 97 10010 42981 0.3658 G-protein-coupled receptor binding molecular function 0.842174 0.430773 1.72414 1 57 97 10010 1664 0.3658 response to oxidative biological process 0.829444 0.436292 1.69492 1 58 97 10009 6979 0.3602 regulation of peptidase activity biological process 0.829444 0.436292 1.69492 1 58 97 10009 52547 0.3602 GTPase activator activity molecular function 0.816991 0.441759 1.66667 1 59 97 10008 5096 0.3548 electron carrier activity molecular function 0.816991 0.441759 1.66667 1 59 97 10008 9055 0.3548 reproductive process biological process 0.801029 0.448867 1.27389 2 155 96 9912 22414 0.3479 peptide binding molecular function 0.792892 0.452534 1.6129 1 61 97 10006 42277 0.3443 cell cycle arrest biological process 0.792892 0.452534 1.6129 1 61 97 10006 7050 0.3443 potassium ion transport biological process 0.792892 0.452534 1.6129 1 61 97 10006 6813 0.3443 zinc ion binding molecular function 0.772628 0.461798 1.24224 2 159 96 9908 8270 0.3355 endocytosis biological process 0.769804 0.463104 1.5625 1 63 97 10004 6897 0.3343 protein folding biological process 0.769804 0.463104 1.5625 1 63 97 10004 6457 0.3343 magnesium ion binding molecular function 0.769804 0.463104 1.5625 1 63 97 10004 287 0.3343 protein ubiquitination biological process 0.769804 0.463104 1.5625 1 63 97 10004 16567 0.3343 regulation of transcription factor activity biological process 0.758618 0.468313 1.53846 1 64 97 10003 51090 0.3295 cytoplasmic vesicle part cellular component 0.758618 0.468313 1.53846 1 64 97 10003 44433 0.3295 central nervous system development biological process 0.747663 0.473472 1.51515 1 65 97 10002 7417 0.3247 soluble fraction cellular component 0.74538 0.474554 1.21212 2 163 96 9904 5625 0.3237 negative regulation of cell proliferation biological process 0.732171 0.480864 1.1976 2 165 96 9902 8285 0.318 regulation of molecular function biological process 0.729257 0.482267 1.05708 5 468 93 9599 65009 0.3167 channel activity molecular function 0.72641 0.483642 1.47059 1 67 97 10000 15267 0.3155

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO passive transmembrane transporter activity molecular function 0.72641 0.483642 1.47059 1 67 97 10000 22803 0.3155 transport biological process 0.717702 0.487872 1.05042 5 471 93 9596 6810 0.3117 nucleotide binding molecular function 0.703408 0.494896 1.09489 3 271 95 9796 166 0.3055 homeostatic process biological process 0.693607 0.49977 1.08696 3 273 95 9794 42592 0.3012 regulation of DNA binding biological process 0.676835 0.508223 1.36986 1 72 97 9995 51101 0.2939 immune response biological process 0.669722 0.511851 1.06762 3 278 95 9789 6955 0.2909 regulation of primary metabolic process biological process 0.646787 0.523726 1.10497 2 179 96 9888 80090 0.2809 regulation of cell differentiation biological process 0.640456 0.527052 1.2987 1 76 97 9991 45595 0.2781 lyase activity molecular function 0.640456 0.527052 1.2987 1 76 97 9991 16829 0.2781 cation transport biological process 0.635528 0.529656 1.0929 2 181 96 9886 6812 0.276 perinuclear region of cytoplasm cellular component 0.631777 0.531646 1.28205 1 77 97 9990 48471 0.2744 Ras protein signal transduction biological process 0.631777 0.531646 1.28205 1 77 97 9990 7265 0.2744 actin cytoskeleton organization biological process 0.631777 0.531646 1.28205 1 77 97 9990 30036 0.2744 ubiquitin-protein ligase activity molecular function 0.631777 0.531646 1.28205 1 77 97 9990 4842 0.2744 nervous system development biological process 0.624485 0.535537 1.08108 2 183 96 9884 7399 0.2712 nucleobase, nucleoside and nucleotide metabolic process biological process 0.614885 0.540703 1.25 1 79 97 9988 55086 0.267 oxidation reduction biological process 0.614885 0.540703 1.25 1 79 97 9988 55114 0.267 I- kappab kinase/nfkappab cascade biological process 0.606665 0.545166 1.23457 1 80 97 9987 43123 0.2635 regulation of catalytic activity biological process 0.60466 0.54626 0.995025 4 398 94 9669 50790 0.2626 ATP binding molecular function 0.597801 0.55002 1.05263 2 188 96 9879 5524 0.2596 regulation of cellular biosynthetic process biological process 0.575197 0.562594 1.17647 1 84 97 9983 31326 0.2498 receptor signaling protein activity molecular function 0.575197 0.562594 1.17647 1 84 97 9983 5057 0.2498 intracellular protein transport biological process 0.567668 0.566846 1.16279 1 85 97 9982 6886 0.2465 transition metal ion molecular function 0.567424 0.566984 1.02041 2 194 96 9873 46914 0.2464 regulation of biological quality biological process 0.565875 0.567863 0.968523 4 409 94 9658 65008 0.2458 transferase activity, transferring hexosyl molecular function 0.560264 0.571058 1.14943 1 86 97 9981 16758 0.2433 adenyl ribonucleotide binding molecular function 0.557676 0.572538 1.0101 2 196 96 9871 32559 0.2422 cell part cellular component 0.556791 0.573045 0.959196 63 6505 35 3562 44464 0.2418 small conjugating protein ligase activity molecular function 0.545831 0.57936 1.1236 1 88 97 9979 19787 0.2371 regulation of I-kappaB kinase/nf-kappab biological process 0.538795 0.583451 1.11111 1 89 97 9978 43122 0.234 spermatogenesis biological process 0.531874 0.587503 1.0989 1 90 97 9977 7283 0.231 male gamete generation biological process 0.531874 0.587503 1.0989 1 90 97 9977 48232 0.231 actin filament-based process biological process 0.531874 0.587503 1.0989 1 90 97 9977 30029 0.231 protein kinase activity biological process 0.531874 0.587503 1.0989 1 90 97 9977 45860 0.231 response to stress biological process 0.524974 0.591571 0.97561 2 203 96 9864 6950 0.228 regulation of binding biological process 0.518371 0.59549 1.07527 1 92 97 9975 51098 0.2251 identical protein binding molecular function 0.516016 0.596894 0.966184 2 205 96 9862 42802 0.2241 cellular process biological process 0.514251 0.597948 0.941864 29 3050 69 7017 9987 0.2233 endoplasmic reticulum membrane cellular component 0.511783 0.599426 1.06383 1 93 97 9974 5789 0.2223 chromosomal part cellular component 0.505301 0.603324 1.05263 1 94 97 9973 44427 0.2194 cellular response to stimulus biological process 0.502909 0.604769 0.931677 3 319 95 9748 51716 0.2184

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO acid-amino acid ligase activity molecular function 0.492647 0.611007 1.03093 1 96 97 9971 16881 0.214 organ morphogenesis biological process 0.486468 0.614794 1.02041 1 97 97 9970 9887 0.2113 cell cycle process biological process 0.485936 0.615121 0.934579 2 212 96 9855 22402 0.211 cell-cell adhesion biological process 0.462706 0.629578 0.980392 1 101 97 9966 16337 0.201 gamete generation biological process 0.462706 0.629578 0.980392 1 101 97 9966 7276 0.201 intracellular signaling cascade biological process 0.452175 0.636243 0.888889 4 446 94 9621 7242 0.1964 small GTPase mediated signal transduction biological process 0.451366 0.636758 0.961538 1 103 97 9964 7264 0.196 cell proliferation biological process 0.449994 0.637632 0.896861 2 221 96 9846 8283 0.1954 cell junction cellular component 0.445825 0.640296 0.952381 1 104 97 9963 30054 0.1936 ATPase activity, coupled molecular function 0.440367 0.6438 0.943396 1 105 97 9962 42623 0.1912 metabolic process biological process 0.430405 0.650246 0.886918 8 894 90 9173 8152 0.1869 transcription factor molecular function 0.429696 0.650707 0.925926 1 107 97 9960 8134 0.1866 ligase activity, forming carbon-nitrogen bonds molecular function 0.419338 0.657482 0.909091 1 109 97 9958 16879 0.1821 endoplasmic reticulum cellular component 0.404366 0.6674 0.884956 1 112 97 9955 44432 0.1756 cellular biosynthetic process biological process 0.399573 0.670606 0.843882 2 235 96 9832 44249 0.1735 transcription activator activity molecular function 0.399573 0.670606 0.843882 2 235 96 9832 16563 0.1735 nucleobase, nucleoside, nucleotide and nucleic acid metabolic process biological process 0.399518 0.670643 0.877193 1 113 97 9954 6139 0.1735 transmembrane transporter activity molecular function 0.390032 0.677035 0.862069 1 115 97 9952 22857 0.1694 DNA binding molecular function 0.377662 0.685462 0.826446 3 360 95 9707 3677 0.164 protein kinase cascade biological process 0.371858 0.689452 0.833333 1 119 97 9948 7243 0.1615 cytoplasm cellular component 0.368113 0.692039 0.867508 11 1257 87 8810 5737 0.1599 transferase activity, transferring glycosyl molecular function 0.36315 0.695482 0.819672 1 121 97 9946 16757 0.1577 GTPase activity molecular function 0.358887 0.698453 0.813008 1 122 97 9945 3924 0.1559 cation homeostasis biological process 0.350535 0.704311 0.8 1 124 97 9943 55080 0.1522 ribonucleotide binding molecular function 0.343293 0.70943 0.784314 2 253 96 9814 32553 0.1491 purine ribonucleotide binding molecular function 0.343293 0.70943 0.784314 2 253 96 9814 32555 0.1491 GTPase regulator activity molecular function 0.33451 0.715689 0.775194 1 128 97 9939 30695 0.1453 ion homeostasis biological process 0.330638 0.718465 0.769231 1 129 97 9938 50801 0.1436 nucleosidetriphosphatase regulator molecular function 0.319332 0.726634 0.75188 1 132 97 9935 60589 0.1387 phosphotransferase activity, alcohol as molecular function 0.310387 0.733163 0.749064 2 265 96 9802 16773 0.1348 synaptic transmission biological process 0.308473 0.734568 0.735294 1 135 97 9932 7268 0.134 regulation of cell cycle biological process 0.308473 0.734568 0.735294 1 135 97 9932 51726 0.134 transferase activity, transferring phosphoruscontaining s molecular function 0.299572 0.741135 0.757576 3 393 95 9674 16772 0.1301 regulation of protein metabolic process biological process 0.294648 0.744794 0.714286 1 139 97 9928 51246 0.128 mitochondrion cellular component 0.287846 0.749877 0.724638 2 274 96 9793 5739 0.125 enzyme binding molecular function 0.285446 0.751679 0.722022 2 275 96 9792 19899 0.124 ATPase activity molecular function 0.27522 0.759405 0.684932 1 145 97 9922 16887 0.1195 mrna metabolic process biological process 0.269071 0.764089 0.675676 1 147 97 9920 16071 0.1169 ligase activity molecular function 0.260137 0.770946 0.662252 1 150 97 9917 16874 0.113 protein binding molecular function 0.256514 0.773744 0.898693 44 4852 54 5215 5515 0.1114 negative regulation of transcription, DNAdependent biological process 0.254367 0.775407 0.653595 1 152 97 9915 45892 0.1105 molecular_function molecular function 0.243675 0.783742 0.932859 76 8071 22 1996 3674 0.1058 hydrolase activity, acting on ester bonds molecular function 0.243527 0.783858 0.675676 2 294 96 9773 16788 0.1058 negative regulation of RNA metabolic process biological process 0.240559 0.786188 0.632911 1 157 97 9910 51253 0.1045 hydrolase activity molecular function 0.220997 0.801719 0.755124 7 920 91 9147 16787 0.096 transcription coactivator activity molecular function 0.215378 0.806237 0.595238 1 167 97 9900 3713 0.0935

% genes in Enrichmen Enrichmen that are t Score t p-value present in list, in list, in in list, list, not in neg log p-value function type GO cytoplasmic part cellular component 0.211169 0.809637 0.804598 14 1726 84 8341 44444 0.0917 oxidoreductase activity molecular function 0.204371 0.81516 0.630915 2 315 96 9752 16491 0.0888 nucleosidetriphosphatase activity molecular function 0.189583 0.827304 0.613497 2 324 96 9743 17111 0.0823 protein serine/threonine kinase activity molecular function 0.186883 0.829541 0.552486 1 180 97 9887 4674 0.0812 cytosol cellular component 0.178524 0.836504 0.690608 5 719 93 9348 5829 0.0775 pyrophosphatase activity molecular function 0.17151 0.842392 0.591716 2 336 96 9731 16462 0.0745 transcription, DNAdependent biological process 0.171405 0.84248 0.529101 1 188 97 9879 45893 0.0744 hydrolase activity, acting on acid anhydrides molecular function 0.168668 0.844789 0.588235 2 338 96 9729 16817 0.0733 hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides molecular function 0.168668 0.844789 0.588235 2 338 96 9729 16818 0.0733 RNA metabolic process biological process 0.167756 0.84556 0.52356 1 190 97 9877 51254 0.0729 establishment of localization biological process 0.158703 0.85325 0.691244 6 862 92 9205 51234 0.0689 transferase activity molecular function 0.158364 0.853539 0.672043 5 739 93 9328 16740 0.0688 peptidase activity, acting on L-amino acid peptides molecular function 0.153974 0.857294 0.502513 1 198 97 9869 70011 0.0669 cytoskeleton cellular component 0.152339 0.858697 0.5 1 199 97 9868 5856 0.0662 cytoskeletal part cellular component 0.147542 0.862826 0.492611 1 202 97 9865 44430 0.0641 peptidase activity molecular function 0.132681 0.875744 0.469484 1 212 97 9855 8233 0.0576 protein amino acid phosphorylation biological process 0.128539 0.879379 0.462963 1 215 97 9852 6468 0.0558 protein kinase activity molecular function 0.124533 0.882909 0.456621 1 218 97 9849 4672 0.0541 anatomical structure morphogenesis biological process 0.115689 0.890752 0.442478 1 225 97 9842 9653 0.0502 binding molecular function 0.0767741 0.926099 0.847607 48 5615 50 4452 5488 0.0333 nucleic acid binding molecular function 0.0673788 0.934841 0.499168 3 598 95 9469 3676 0.0293 intracellular transport biological process 0.0640096 0.937996 0.353357 1 282 97 9785 46907 0.0278 intracellular nonmembrane-bounded cellular component 0.0633542 0.938611 0.352113 1 283 97 9784 43232 0.0275 cellular metabolic biological process 0.0618063 0.940065 0.693756 14 2004 84 8063 44237 0.0268 catalytic activity molecular function 0.0609067 0.940911 0.70922 16 2240 82 7827 3824 0.0265 post-translational protein modification biological process 0.0553795 0.946126 0.423729 2 470 96 9597 43687 0.0241 RNA metabolic process biological process 0.0505452 0.950711 0.326797 1 305 97 9762 16070 0.022 regulation of transcription, DNA-dependent biological process 0.0495201 0.951686 0.324675 1 307 97 9760 6355 0.0215 regulation of metabolic process biological process 0.0484038 0.952749 0.537057 5 926 93 9141 19222 0.021 intracellular membranebounded organelle cellular component 0.0384768 0.962254 0.601604 9 1487 89 8580 43231 0.0167 establishment of localization in cell biological process 0.0379594 0.962752 0.299401 1 333 97 9734 51649 0.0165 nucleoplasm cellular component 0.0349828 0.965622 0.292398 1 341 97 9726 5654 0.0152 nucleus cellular component 0.0320285 0.968479 0.572246 8 1390 90 8677 5634 0.0139 intracellular organelle cellular component 0.0238563 0.976426 0.586166 10 1696 88 8371 43229 0.0104 regulation of macromolecule metabolic biological process 0.0214392 0.978789 0.40107 3 745 95 9322 60255 0.0093 protein modification biological process 0.0195162 0.980673 0.337838 2 590 96 9477 6464 0.0085 regulation of RNA metabolic process biological process 0.0145625 0.985543 0.32 2 623 96 9444 51252 0.0063 cellular protein metabolic process biological process 0.0144215 0.985682 0.376412 3 794 95 9273 44267 0.0063 transcription factor molecular function 0.0116395 0.988428 0.222222 1 449 97 9618 3700 0.0051 transcription regulator activity molecular function 0.007882 0.992149 0.344828 3 867 95 9200 30528 0.0034 intracellular organelle part cellular component 0.0036266 0.99638 0.482057 9 1858 89 8209 44446 0.0016 cellular biopolymer metabolic process biological process 0.0029845 0.99702 0.346921 4 1149 94 8918 34960 0.0013 intracellular part cellular component 0.0018818 0.99812 0.677105 32 4694 66 5373 44424 0.0008

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not in neg log p-value function type GO cellular macromolecule metabolic process biological process 0.0018718 0.99813 0.330852 4 1205 94 8862 44260 0.0008 nuclear part cellular component 0.0010846 0.998916 0.273224 3 1095 95 8972 44428 0.0005

Supplementary Table S6. GO enrichment analysis of down-regulated genes by silencing of RRM2B in IMR90 cells. % genes in in list, Enrichmen Enrichmen that are in list, in list, in list, not GO neg log function type t Score t p-value present in p-value chromosomal part cellular component 47.6372 2.05E-21 32.6316 31 64 350 9720 44427-20.689 nucleoplasm cellular component 34.4269 1.12E-15 14.0351 48 294 333 9490 5654-14.951 cell cycle process biological process 28.1496 5.95E-13 15.8879 34 180 347 9604 22402-12.225 DNA replication biological process 27.9554 7.23E-13 25 22 66 359 9718 6260-12.141 cell cycle phase biological process 25.3 1.03E-11 23.3333 21 69 360 9715 22403-10.988 nuclear part cellular component 23.3575 7.18E-11 7.65027 84 1014 297 8770 44428-10.144 part cellular component 20.7838 9.41E-10 6.3203 118 1749 263 8035 44446-9.0263 cellular response to DNA damage stimulus biological process 18.3848 1.04E-08 14.5455 24 141 357 9643 34984-7.9844 organization biological process 17.9579 1.59E-08 18.5567 18 79 363 9705 51276-7.799 DNA metabolic process biological process 17.6214 2.22E-08 22.0588 15 53 366 9731 6259-7.6529 DNA repair biological process 17.4444 2.65E-08 15.5556 21 114 360 9670 6281-7.576 mitosis biological process 16.5781 6.31E-08 29.7297 11 26 370 9758 7067-7.1998 stress biological process 15.7416 1.46E-07 11.9816 26 191 355 9593 33554-6.8365 regulation of cell cycle biological process 15.7185 1.49E-07 14.7059 20 116 361 9668 51726-6.8265 microtubule motor activity molecular function 14.1959 6.84E-07 31.0345 9 20 372 9764 3777-6.1652 condensation biological process 13.99 8.40E-07 43.75 7 9 374 9775 30261-6.0758 regulation of mitotic cell cycle biological process 13.9227 8.98E-07 26.3158 10 28 371 9756 7346-6.0466 mitotic chromosome condensation biological process 13.7665 1.05E-06 54.5455 6 5 375 9779 7076-5.9787 spindle organization biological process 13.463 1.42E-06 71.4286 5 2 376 9782 7051-5.8469 cellular biopolymer biosynthetic process biological process 13.3459 1.60E-06 11.5 23 177 358 9607 34961-5.7961 biopolymer biosynthetic process biological process 13.3459 1.60E-06 11.5 23 177 358 9607 43284-5.7961 outer kinetochore of condensed chromosome cellular component 13.1508 1.94E-06 100 4 0 377 9784 940-5.7113 DNA binding molecular function 13.0794 2.09E-06 9.09091 33 330 348 9454 3677-5.6803 spindle microtubule cellular component 13.0321 2.19E-06 38.8889 7 11 374 9773 5876-5.6598 microtubule cellular component 12.4427 3.95E-06 25.7143 9 26 372 9758 5874-5.4038 intracellular organelle cellular component 12.3428 4.36E-06 5.74443 98 1608 283 8176 43229-5.3604 nucleus cellular component 12.2655 4.71E-06 6.00858 84 1314 297 8470 5634-5.3269 mitotic cell cycle checkpoint biological process 11.7646 7.77E-06 27.5862 8 21 373 9763 7093-5.1093 cellular response to stimulus biological process 11.4539 1.06E-05 9.00621 29 293 352 9491 51716-4.9744 intracellular membranebounded organelle cellular component 11.3935 1.13E-05 5.81551 87 1409 294 8375 43231-4.9481 chromosome segregation biological process 11.0739 1.55E-05 37.5 6 10 375 9774 7059-4.8094 regulation of cyclindependent protein kinase activity biological process 10.9671 1.73E-05 25 8 24 373 9760 79-4.7629 phosphoinositidemediated signaling biological process 10.8325 1.97E-05 21.4286 9 33 372 9751 48015-4.7045 biopolymer metabolic process biological process 10.6605 2.35E-05 8.3558 31 340 350 9444 43283-4.6298 cytoskeletal part cellular component 10.6518 2.37E-05 10.3448 21 182 360 9602 44430-4.626 double-strand break repair via homologous recombination biological process 10.503 2.75E-05 66.6667 4 2 377 9782 724-4.5614 organelle organization biological process 10.3054 3.35E-05 9.58333 23 217 358 9567 6996-4.4756 motor activity molecular function 10.2452 3.55E-05 20 9 36 372 9748 3774-4.4494 macromolecule metabolic process biological process 9.8984 5.03E-05 8.03109 31 355 350 9429 43170-4.2988 DNA strand elongation during DNA replication biological process 9.85932 5.23E-05 100 3 0 378 9784 6271-4.2818 DNA primase activity molecular function 9.85932 5.23E-05 100 3 0 378 9784 3896-4.2818 establishment of chromosome localization biological process 9.02264 0.0001206 50 4 4 377 9780 51303-3.9185 chromosome, centromeric region cellular component 9.02264 0.0001206 50 4 4 377 9780 775-3.9185

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value nucleic acid binding molecular function 8.91493 0.0001344 6.82196 41 560 340 9224 3676-3.8717 repair biological process 8.82551 0.0001469 21.875 7 25 374 9759 6302-3.8329 cell cycle biological process 8.61945 0.0001806 21.2121 7 26 374 9758 7049-3.7434 cohesin complex cellular component 8.50131 0.0002032 75 3 1 378 9783 8278-3.6921 metaphase plate congression biological process 8.50131 0.0002032 75 3 1 378 9783 51310-3.6921 kinetochore organization biological process 8.50131 0.0002032 75 3 1 378 9783 51383-3.6921 condensin complex cellular component 8.50131 0.0002032 75 3 1 378 9783 796-3.6921 DNA strand elongation biological process 8.50131 0.0002032 75 3 1 378 9783 22616-3.6921 nucleotide-excision repair, DNA gap filling biological process 8.40594 0.0002235 31.25 5 11 376 9773 6297-3.6507 DNA replication initiation biological process 7.98396 0.0003409 40 4 6 377 9778 6270-3.4674 G2 phase of mitotic cell cycle biological process 7.61327 0.0004939 60 3 2 378 9782 85-3.3064 G2 phase biological process 7.61327 0.0004939 60 3 2 378 9782 51319-3.3064 process biological process 7.61327 0.0004939 60 3 2 378 9782 42447-3.3064 intracellular part cellular component 7.55989 0.0005209 4.42234 209 4517 172 5267 44424-3.2832 microtubule cytoskeleton organization biological process 7.40471 0.0006084 20.6897 6 23 375 9761 226-3.2158 process biological process 7.21695 0.000734 17.0732 7 34 374 9750 7017-3.1343 nucleosome assembly biological process 7.02206 0.000892 23.8095 5 16 376 9768 6334-3.0496 DNA replication factor C complex cellular component 6.94831 0.0009603 50 3 3 378 9781 5663-3.0176 response to DNA damage stimulus biological process 6.92129 0.0009866 16.2791 7 36 374 9748 6974-3.0059 nucleosome cellular component 6.84839 0.0010612 30.7692 4 9 377 9775 786-2.9742 kinesin complex cellular component 6.84839 0.0010612 30.7692 4 9 377 9775 5871-2.9742 division biological process 6.64322 0.0013028 15.5556 7 38 374 9746 51783-2.8851 spindle pole cellular component 6.54172 0.001442 28.5714 4 10 377 9774 922-2.841 regulation of organelle organization biological process 6.51311 0.0014839 11.4943 10 77 371 9707 33043-2.8286 centrosome cellular component 6.47287 0.0015448 12.3288 9 64 372 9720 5813-2.8111 mitotic sister chromatid segregation biological process 6.41683 0.0016338 42.8571 3 4 378 9780 70-2.7868 DNA geometric change biological process 6.41683 0.0016338 42.8571 3 4 378 9780 32392-2.7868 DNA duplex unwinding biological process 6.41683 0.0016338 42.8571 3 4 378 9780 32508-2.7868 establishment of organelle localization biological process 6.37805 0.0016984 20.8333 5 19 376 9765 51656-2.7699 regulation of DNA metabolic process biological process 6.37601 0.0017019 12.1622 9 65 372 9719 51052-2.7691 cell proliferation biological process 6.31734 0.0018047 8.07175 18 205 363 9579 8283-2.7436 spindle cellular component 6.26132 0.0019087 26.6667 4 11 377 9773 5819-2.7193 chromatin binding molecular function 6.21479 0.0019996 16.6667 6 30 375 9754 3682-2.699 chromatin cellular component 6.06936 0.0023127 16.2162 6 31 375 9753 785-2.6359 DNA-directed DNA polymerase activity molecular function 6.00335 0.0024705 25 4 12 377 9772 3887-2.6072 mitotic cell cycle spindle assembly checkpoint biological process 5.97491 0.0025417 37.5 3 5 378 9779 7094-2.5949 negative regulation of mitotic metaphase/anaphase transition biological process 5.97491 0.0025417 37.5 3 5 378 9779 45841-2.5949 sister chromatid segregation biological process 5.97491 0.0025417 37.5 3 5 378 9779 819-2.5949 negative regulation of mitosis biological process 5.59747 0.0037072 33.3333 3 6 378 9778 45839-2.4309 negative regulation of nuclear division biological process 5.59747 0.0037072 33.3333 3 6 378 9778 51784-2.4309 DNA synthesis during DNA repair biological process 5.59747 0.0037072 33.3333 3 6 378 9778 731-2.4309 chromosome movement towards spindle pole biological process 5.4969 0.0040994 66.6667 2 1 379 9783 51305-2.3873

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type regulation of microtubule polymerization or depolymerization biological process 5.4969 0.0040994 66.6667 2 1 379 9783 31110-2.3873 mitotic metaphase biological process 5.4969 0.0040994 66.6667 2 1 379 9783 89-2.3873 mitotic metaphase plate congression biological process 5.4969 0.0040994 66.6667 2 1 379 9783 7080-2.3873 kinetochore binding molecular function 5.4969 0.0040994 66.6667 2 1 379 9783 43515-2.3873 kinetochore assembly biological process 5.4969 0.0040994 66.6667 2 1 379 9783 51382-2.3873 centrosome duplication biological process 5.4969 0.0040994 66.6667 2 1 379 9783 51298-2.3873 DNA replication, synthesis of RNA primer biological process 5.4969 0.0040994 66.6667 2 1 379 9783 6269-2.3873 alpha DNA polymerase:primase complex cellular component 5.4969 0.0040994 66.6667 2 1 379 9783 5658-2.3873 second-messengermediated signaling biological process 5.42927 0.0043863 9.40171 11 106 370 9678 19932-2.3579 nuclear chromosome part cellular component 5.41271 0.0044596 14.2857 6 36 375 9748 44454-2.3507 histone binding molecular function 5.35256 0.004736 16.6667 5 25 376 9759 42393-2.3246 G2/M transition DNA damage checkpoint biological process 5.26877 0.00515 30 3 7 378 9777 31572-2.2882 checkpoint biological process 5.26877 0.00515 30 3 7 378 9777 31576-2.2882 structure-specific DNA binding molecular function 5.26485 0.0051702 12.2807 7 50 374 9734 43566-2.2865 microtubule associated complex cellular component 5.26485 0.0051702 12.2807 7 50 374 9734 5875-2.2865 regulation of ubiquitinprotein ligase activity biological process 5.23443 0.0053299 11.1111 8 64 373 9720 51438-2.2733 DNA polymerase activity molecular function 5.1427 0.0058419 20 4 16 377 9768 34061-2.2334 cellular_component cellular component 5.10055 0.0060934 4.06539 286 6749 95 3035 5575-2.2151 activity biological process 5.06848 0.006292 10.8108 8 66 373 9718 51340-2.2012 single-stranded DNA binding molecular function 5.06795 0.0062953 15.625 5 27 376 9757 3697-2.201 regulation of DNA replication biological process 4.97823 0.0068862 27.2727 3 8 378 9776 6275-2.162 regulation of cellular component organization biological process 4.90414 0.0074159 8.39161 12 131 369 9653 51128-2.1298 transferase activity, transferring phosphoruscontaining s molecular function 4.89698 0.0074691 6.31313 25 371 356 9413 16772-2.1267 metaphase biological process 4.82886 0.0079957 50 2 2 379 9782 51323-2.0971 response to insecticide biological process 4.82886 0.0079957 50 2 2 379 9782 17085-2.0971 response to organophosphorus biological process 4.82886 0.0079957 50 2 2 379 9782 46683-2.0971 DNA unwinding during replication biological process 4.82886 0.0079957 50 2 2 379 9782 6268-2.0971 traversing start control point of mitotic cell cycle biological process 4.82886 0.0079957 50 2 2 379 9782 7089-2.0971 leukocyte tethering or rolling biological process 4.82886 0.0079957 50 2 2 379 9782 50901-2.0971 DNA damage response, signal transduction biological process 4.68197 0.0092607 14.2857 5 30 376 9754 42770-2.0334 binding molecular function 4.66524 0.009417 4.14974 235 5428 146 4356 5488-2.0261 extracellular matrix cellular component 4.6332 0.0097236 10.9375 7 57 374 9727 31012-2.0122 protein binding molecular function 4.52908 0.0107906 4.20752 206 4690 175 5094 5515-1.967 DNA damage checkpoint biological process 4.48386 0.0112898 23.0769 3 10 378 9774 77-1.9473 nuclear ubiquitin ligase complex cellular component 4.48386 0.0112898 23.0769 3 10 378 9774 152-1.9473 extracellular matrix structural constituent molecular function 4.36902 0.0126636 11.5385 6 46 375 9738 5201-1.8974 membrane to membrane docking biological process 4.34304 0.0129969 40 2 3 379 9781 22614-1.8862 lamin binding molecular function 4.34304 0.0129969 40 2 3 379 9781 5521-1.8862 response to lipopolysaccharide biological process 4.27044 0.0139756 21.4286 3 11 378 9773 32496-1.8546

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value PML body cellular component 4.19241 0.0151099 15.3846 4 22 377 9762 16605-1.8207 pyrophosphatase activity molecular function 4.13402 0.0160184 6.21302 21 317 360 9467 16462-1.7954 proteinaceous extracellular matrix cellular component 4.10879 0.0164276 10.9091 6 49 375 9735 5578-1.7844 hydrolase activity, acting on acid anhydrides molecular function 4.07435 0.0170032 6.17647 21 319 360 9465 16817-1.7695 hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides molecular function 4.07435 0.0170032 6.17647 21 319 360 9465 16818-1.7695 DNA-dependent ATPase activity molecular function 4.06133 0.0172261 14.8148 4 23 377 9761 8094-1.7638 protein serine/threonine kinase activity molecular function 3.98536 0.0185858 7.18232 13 168 368 9616 4674-1.7308 cytokinesis during cell cycle biological process 3.96252 0.0190152 33.3333 2 4 379 9780 33205-1.7209 checkpoint biological process 3.96252 0.0190152 33.3333 2 4 379 9780 76-1.7209 negative regulation of DNA replication initiation biological process 3.96252 0.0190152 33.3333 2 4 379 9780 32297-1.7209 gamma-tubulin binding molecular function 3.96252 0.0190152 33.3333 2 4 379 9780 43015-1.7209 BRCA1-A complex cellular component 3.96252 0.0190152 33.3333 2 4 379 9780 70531-1.7209 regulation of DNA recombination biological process 3.96252 0.0190152 33.3333 2 4 379 9780 18-1.7209 nitric oxide metabolic process biological process 3.96252 0.0190152 33.3333 2 4 379 9780 46209-1.7209 regulation of cell proliferation biological process 3.94447 0.0193615 8.88889 8 82 373 9702 42127-1.7131 cell division biological process 3.9364 0.0195183 14.2857 4 24 377 9760 51301-1.7096 response to toxin biological process 3.89499 0.0203435 18.75 3 13 378 9771 9636-1.6916 levels biological process 3.89499 0.0203435 18.75 3 13 378 9771 10817-1.6916 process biological process 3.89499 0.0203435 18.75 3 13 378 9771 42445-1.6916 intracellular nonmembrane-bounded cellular component 3.8805 0.0206406 6.33803 18 266 363 9518 43232-1.6853 nucleosidetriphosphatase activity molecular function 3.86935 0.020872 6.13497 20 306 361 9478 17111-1.6804 phosphoric diester hydrolase activity molecular function 3.8377 0.0215432 11.6279 5 38 376 9746 8081-1.6667 catalytic activity molecular function 3.72159 0.0241954 4.47695 101 2155 280 7629 3824-1.6163 nucleotidyltransferase activity molecular function 3.71722 0.0243014 10 6 54 375 9730 16779-1.6144 double-stranded DNA binding molecular function 3.7032 0.0246446 13.3333 4 26 377 9758 3690-1.6083 negative regulation of transcription factor biological process 3.7032 0.0246446 13.3333 4 26 377 9758 43433-1.6083 cellular component organization biological process 3.69748 0.0247858 5.1186 41 760 340 9024 16043-1.6058 nuclear body cellular component 3.65961 0.0257425 11.1111 5 40 376 9744 16604-1.5893 DNA ligation biological process 3.6509 0.0259677 28.5714 2 5 379 9779 6266-1.5856 negative regulation of smooth muscle cell proliferation biological process 3.6509 0.0259677 28.5714 2 5 379 9779 48662-1.5856 sulfate transport biological process 3.6509 0.0259677 28.5714 2 5 379 9779 8272-1.5856 DNA damage response, signal transduction resulting in induction of biological process 3.6509 0.0259677 28.5714 2 5 379 9779 8630-1.5856 double-strand break repair via nonhomologous end biological process 3.6509 0.0259677 28.5714 2 5 379 9779 6303-1.5856 anaphase-promoting complex-dependent proteasomal ubiquitindependent protein catabolic process biological process 3.64456 0.026133 9.83607 6 55 375 9729 31145-1.5828 microtubule organizing center organization biological process 3.57362 0.028054 16.6667 3 15 378 9769 31023-1.552

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value hydrolase activity molecular function 3.53961 0.0290247 4.96224 46 881 335 8903 16787-1.5372 ubiquitin-protein ligase activity during mitotic cell cycle biological process 3.50435 0.0300662 9.52381 6 57 375 9727 51437-1.5219 nuclear envelope cellular component 3.48966 0.0305113 12.5 4 28 377 9756 5635-1.5155 nucleolus cellular component 3.45466 0.0315982 5.55556 25 425 356 9359 5730-1.5003 chromosome cellular component 3.42924 0.0324115 15.7895 3 16 378 9768 5694-1.4893 response to molecule of bacterial origin biological process 3.42924 0.0324115 15.7895 3 16 378 9768 2237-1.4893 reciprocal meiotic recombination biological process 3.42924 0.0324115 15.7895 3 16 378 9768 7131-1.4893 telomere maintenance biological process 3.42924 0.0324115 15.7895 3 16 378 9768 723-1.4893 cyclin-dependent protein kinase activity molecular function 3.38799 0.0337764 25 2 6 379 9778 4693-1.4714 regulation of microtubule cytoskeleton organization biological process 3.38799 0.0337764 25 2 6 379 9778 70507-1.4714 regulation of exit from mitosis biological process 3.38799 0.0337764 25 2 6 379 9778 7096-1.4714 regulation of cell cycle process biological process 3.38799 0.0337764 25 2 6 379 9778 10564-1.4714 regulation of DNA replication initiation biological process 3.38799 0.0337764 25 2 6 379 9778 30174-1.4714 tumor necrosis factor receptor activity molecular function 3.38799 0.0337764 25 2 6 379 9778 5031-1.4714 ubiquitin-protein ligase activity biological process 3.37061 0.0343686 9.23077 6 59 375 9725 51443-1.4638 protein kinase activity molecular function 3.32252 0.0360618 6.39269 14 205 367 9579 4672-1.443 cell part cellular component 3.3136 0.0363851 4.00426 263 6305 118 3479 44464-1.4391 extracellular region cellular component 3.25241 0.0386807 5.8104 19 308 362 9476 5576-1.4125 response to ionizing radiation biological process 3.16733 0.0421159 14.2857 3 18 378 9766 10212-1.3756 DNA-directed RNA polymerase activity molecular function 3.16733 0.0421159 14.2857 3 18 378 9766 3899-1.3756 RNA polymerase activity molecular function 3.16733 0.0421159 14.2857 3 18 378 9766 34062-1.3756 anchoring collagen cellular component 3.16137 0.0423676 22.2222 2 7 379 9777 30934-1.373 tumor necrosis factor binding molecular function 3.16137 0.0423676 22.2222 2 7 379 9777 43120-1.373 telomere maintenance via telomerase biological process 3.16137 0.0423676 22.2222 2 7 379 9777 7004-1.373 extracellular region part cellular component 3.15081 0.0428174 5.48926 23 396 358 9388 44421-1.3684 nuclear matrix cellular component 3.04802 0.047453 13.6364 3 19 378 9765 16363-1.3237 cellular process biological process 2.9732 0.0511393 6.54762 11 157 370 9627 48522-1.2912 organization biological process 2.96284 0.051672 20 2 8 379 9776 7052-1.2867 nuclear chromosome cellular component 2.96284 0.051672 20 2 8 379 9776 228-1.2867 endodeoxyribonuclease activity molecular function 2.96284 0.051672 20 2 8 379 9776 4520-1.2867 telomere maintenance via telomere lengthening biological process 2.96284 0.051672 20 2 8 379 9776 10833-1.2867 dioxygenase activity molecular function 2.96284 0.051672 20 2 8 379 9776 51213-1.2867 caspase regulator activity molecular function 2.93549 0.0531049 13.0435 3 20 378 9764 43028-1.2749 cytokinesis biological process 2.93549 0.0531049 13.0435 3 20 378 9764 910-1.2749 cellular process biological process 2.88743 0.055719 4.22215 130 2949 251 6835 9987-1.254 transcription cofactor activity molecular function 2.82913 0.0590644 12.5 3 21 378 9763 3712-1.2287 negative regulation of DNA replication biological process 2.7867 0.0616244 18.1818 2 9 379 9775 8156-1.2102 sex differentiation biological process 2.7867 0.0616244 18.1818 2 9 379 9775 7548-1.2102 kinetochore cellular component 2.7867 0.0616244 18.1818 2 9 379 9775 776-1.2102 regulation of innate immune response biological process 2.7867 0.0616244 18.1818 2 9 379 9775 45088-1.2102 fat cell differentiation biological process 2.7867 0.0616244 18.1818 2 9 379 9775 45444-1.2102

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type proteasomal protein catabolic process biological process 2.73366 0.0649807 7.89474 6 70 375 9714 10498-1.1872 proteasomal ubiquitindependent protein catabolic process biological process 2.73366 0.0649807 7.89474 6 70 375 9714 43161-1.1872 small conjugating protein binding molecular function 2.72841 0.0653233 12 3 22 378 9762 32182-1.1849 ubiquitin binding molecular function 2.72841 0.0653233 12 3 22 378 9762 43130-1.1849 binding molecular function 2.68224 0.0684095 7.29167 7 89 374 9695 8022-1.1649 anatomical structure homeostasis biological process 2.64221 0.0712035 9.52381 4 38 377 9746 60249-1.1475 negative regulation of transcription biological process 2.63326 0.0718441 7.69231 6 72 375 9712 16481-1.1436 ubiquitin-protein ligase activity molecular function 2.63326 0.0718441 7.69231 6 72 375 9712 4842-1.1436 midbody cellular component 2.62882 0.0721634 16.6667 2 10 379 9774 30496-1.1417 arylsulfatase activity molecular function 2.62882 0.0721634 16.6667 2 10 379 9774 4065-1.1417 skeletal system development biological process 2.5846 0.0754261 7.59494 6 73 375 9711 1501-1.1225 regulation of cellular process biological process 2.56795 0.0766923 4.24586 105 2368 276 7416 50794-1.1152 phosphotransferase activity, alcohol as molecular function 2.56213 0.0771401 5.61798 15 252 366 9532 16773-1.1127 negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle biological process 2.55415 0.077758 8.19672 5 56 376 9728 51436-1.1093 negative regulation of cellular metabolic biological process 2.53694 0.079108 7.5 6 74 375 9710 31324-1.1018 negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process biological process 2.53694 0.079108 7.5 6 74 375 9710 45934-1.1018 cell proliferation biological process 2.52475 0.0800781 6.42857 9 131 372 9653 8284-1.0965 metabolic process biological process 2.50224 0.0819014 4.65632 42 860 339 8924 8152-1.0867 caspase activator activity molecular function 2.48613 0.0832313 15.3846 2 11 379 9773 8656-1.0797 negative regulation of protein catabolic process biological process 2.48613 0.0832313 15.3846 2 11 379 9773 42177-1.0797 cell cycle checkpoint biological process 2.48613 0.0832313 15.3846 2 11 379 9773 75-1.0797 meiosis biological process 2.48613 0.0832313 15.3846 2 11 379 9773 7126-1.0797 mismatch repair biological process 2.48613 0.0832313 15.3846 2 11 379 9773 6298-1.0797 telomeric DNA binding molecular function 2.48613 0.0832313 15.3846 2 11 379 9773 42162-1.0797 xenobiotic metabolic process biological process 2.48613 0.0832313 15.3846 2 11 379 9773 6805-1.0797 negative regulation of ubiquitin-protein ligase activity biological process 2.4464 0.0866052 7.93651 5 58 376 9726 51444-1.0625 gamete generation biological process 2.42962 0.0880703 6.86275 7 95 374 9689 7276-1.0552 response to radiation biological process 2.3945 0.0912183 7.8125 5 59 376 9725 9314-1.0399 nucleotide binding molecular function 2.39427 0.0912396 5.47445 15 259 366 9525 166-1.0398 G1/S transition of mitotic cell cycle biological process 2.37334 0.0931694 10.3448 3 26 378 9758 82-1.0307 3',5'-cyclic-nucleotide phosphodiesterase molecular function 2.35626 0.094774 14.2857 2 12 379 9772 4114-1.0233 protein amino acid ADPribosylation biological process 2.35626 0.094774 14.2857 2 12 379 9772 6471-1.0233 transferase activity molecular function 2.35126 0.0952491 4.7043 35 709 346 9075 16740-1.0211 ATP binding molecular function 2.29045 0.101221 5.78947 11 179 370 9605 5524-0.9947 protein-dna complex assembly biological process 2.27045 0.103266 6.97674 6 80 375 9704 65004-0.986 response to stimulus biological process 2.23831 0.106639 4.41292 56 1213 325 8571 50896-0.9721 regulation of smooth muscle cell proliferation biological process 2.23736 0.10674 13.3333 2 13 379 9771 48660-0.9717

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type phosphoinositide phospholipase C activity molecular function 2.23736 0.10674 13.3333 2 13 379 9771 4435-0.9717 centrosome organization biological process 2.23736 0.10674 13.3333 2 13 379 9771 51297-0.9717 cyclic-nucleotide phosphodiesterase molecular function 2.23736 0.10674 13.3333 2 13 379 9771 4112-0.9717 RNA catabolic process biological process 2.23736 0.10674 13.3333 2 13 379 9771 6401-0.9717 heterogeneous nuclear ribonucleoprotein cellular component 2.23736 0.10674 13.3333 2 13 379 9771 30530-0.9717 M phase of mitotic cell cycle biological process 2.22291 0.108293 33.3333 1 2 380 9782 87-0.9654 apoptotic chromosome condensation biological process 2.22291 0.108293 33.3333 1 2 380 9782 30263-0.9654 cytokinesis after mitosis biological process 2.22291 0.108293 33.3333 1 2 380 9782 281-0.9654 contractile ring cellular component 2.22291 0.108293 33.3333 1 2 380 9782 5826-0.9654 spindle pole body cellular component 2.22291 0.108293 33.3333 1 2 380 9782 5816-0.9654 spindle pole body organization biological process 2.22291 0.108293 33.3333 1 2 380 9782 51300-0.9654 activation of phospholipase C activity by muscarinic acetylcholine receptor biological process 2.22291 0.108293 33.3333 1 2 380 9782 7207-0.9654 urea transport biological process 2.22291 0.108293 33.3333 1 2 380 9782 15840-0.9654 amide transport biological process 2.22291 0.108293 33.3333 1 2 380 9782 42886-0.9654 chromosome passenger complex cellular component 2.22291 0.108293 33.3333 1 2 380 9782 32133-0.9654 bubble DNA binding molecular function 2.22291 0.108293 33.3333 1 2 380 9782 405-0.9654 binding molecular function 2.22291 0.108293 33.3333 1 2 380 9782 51880-0.9654 regulation of immune system process biological process 2.22291 0.108293 33.3333 1 2 380 9782 2682-0.9654 peptidoglycan biological process 2.22291 0.108293 33.3333 1 2 380 9782 32494-0.9654 negative regulation of interleukin-12 production biological process 2.22291 0.108293 33.3333 1 2 380 9782 32695-0.9654 negative regulation of smooth muscle cell migration biological process 2.22291 0.108293 33.3333 1 2 380 9782 14912-0.9654 insulin-like growth factor binding protein complex cellular component 2.22291 0.108293 33.3333 1 2 380 9782 16942-0.9654 generation of neurons biological process 2.22291 0.108293 33.3333 1 2 380 9782 48699-0.9654 neurogenesis biological process 2.22291 0.108293 33.3333 1 2 380 9782 50769-0.9654 histone exchange biological process 2.22291 0.108293 33.3333 1 2 380 9782 43486-0.9654 glycerol-3-phosphate O- acyltransferase activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 4366-0.9654 activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 4528-0.9654 ribonuclease H activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 4523-0.9654 flap endonuclease activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 48256-0.9654 integral to nuclear inner membrane cellular component 2.22291 0.108293 33.3333 1 2 380 9782 5639-0.9654 negative regulation of mrna processing biological process 2.22291 0.108293 33.3333 1 2 380 9782 50686-0.9654 ferric-chelate reductase activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 293-0.9654 T cell mediated cytotoxicity biological process 2.22291 0.108293 33.3333 1 2 380 9782 1916-0.9654 interferon-gamma production biological process 2.22291 0.108293 33.3333 1 2 380 9782 32729-0.9654 smooth muscle cell apoptosis biological process 2.22291 0.108293 33.3333 1 2 380 9782 34393-0.9654 negative regulation of fatty acid biosynthetic biological process 2.22291 0.108293 33.3333 1 2 380 9782 45717-0.9654 glycerol kinase activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 4370-0.9654 snrnp U2 cellular component 2.22291 0.108293 33.3333 1 2 380 9782 5686-0.9654

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type basic amino acid transmembrane transporter activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 15174-0.9654 male meiosis biological process 2.22291 0.108293 33.3333 1 2 380 9782 7140-0.9654 platelet dense granule membrane cellular component 2.22291 0.108293 33.3333 1 2 380 9782 31088-0.9654 telomere maintenance via telomerase biological process 2.22291 0.108293 33.3333 1 2 380 9782 32212-0.9654 polynucleotide kinase activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 51731-0.9654 ATP-dependent polynucleotide kinase activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 51734-0.9654 single-stranded DNA specific endodeoxyribonuclease activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 14-0.9654 lamin filament cellular component 2.22291 0.108293 33.3333 1 2 380 9782 5638-0.9654 DNA damage response, signal transduction by p53 class mediator resulting in cell cycle biological process 2.22291 0.108293 33.3333 1 2 380 9782 6977-0.9654 polysomal ribosome cellular component 2.22291 0.108293 33.3333 1 2 380 9782 42788-0.9654 6-phosphofructokinase activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 3872-0.9654 calmodulin-dependent cyclic-nucleotide phosphodiesterase molecular function 2.22291 0.108293 33.3333 1 2 380 9782 4117-0.9654 negative regulation of anti-apoptosis biological process 2.22291 0.108293 33.3333 1 2 380 9782 19987-0.9654 clathrin coat assembly biological process 2.22291 0.108293 33.3333 1 2 380 9782 48268-0.9654 triglyceride catabolic process biological process 2.22291 0.108293 33.3333 1 2 380 9782 19433-0.9654 cellular polysaccharide catabolic process biological process 2.22291 0.108293 33.3333 1 2 380 9782 44247-0.9654 process biological process 2.22291 0.108293 33.3333 1 2 380 9782 6071-0.9654 determination of anterior/posterior axis, embryo biological process 2.22291 0.108293 33.3333 1 2 380 9782 8595-0.9654 anterior/posterior axis specification biological process 2.22291 0.108293 33.3333 1 2 380 9782 9948-0.9654 antigen processing and presentation of endogenous peptide biological process 2.22291 0.108293 33.3333 1 2 380 9782 2483-0.9654 antigen processing and presentation of endogenous peptide antigen via MHC class I biological process 2.22291 0.108293 33.3333 1 2 380 9782 19885-0.9654 neuron adhesion biological process 2.22291 0.108293 33.3333 1 2 380 9782 7158-0.9654 ribose phosphate diphosphokinase activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 4749-0.9654 diphosphotransferase activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 16778-0.9654 negative regulation of complement activation biological process 2.22291 0.108293 33.3333 1 2 380 9782 45916-0.9654 single-stranded DNAdependent ATPase molecular function 2.22291 0.108293 33.3333 1 2 380 9782 43142-0.9654 extracellular-glycinegated ion channel activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 16933-0.9654 extracellular-glycinegated chloride channel molecular function 2.22291 0.108293 33.3333 1 2 380 9782 16934-0.9654 camp-dependent protein kinase inhibitor activity molecular function 2.22291 0.108293 33.3333 1 2 380 9782 4862-0.9654 regulation of circadian rhythm biological process 2.22291 0.108293 33.3333 1 2 380 9782 42752-0.9654

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value collagen cellular component 2.21974 0.108637 9.67742 3 28 378 9756 5581-0.964 small conjugating protein ligase activity molecular function 2.1487 0.116636 6.74157 6 83 375 9701 19787-0.9332 proteolysis biological process 2.13095 0.118725 6.10687 8 123 373 9661 6508-0.9255 phospholipase C activity molecular function 2.12793 0.119083 12.5 2 14 379 9770 4629-0.9242 condensed chromosome cellular component 2.12793 0.119083 12.5 2 14 379 9770 793-0.9242 negative regulation of DNA metabolic process biological process 2.12793 0.119083 12.5 2 14 379 9770 51053-0.9242 membrane docking biological process 2.12793 0.119083 12.5 2 14 379 9770 22406-0.9242 sulfuric ester hydrolase activity molecular function 2.12793 0.119083 12.5 2 14 379 9770 8484-0.9242 organization biological process 2.12793 0.119083 12.5 2 14 379 9770 30199-0.9242 adenyl ribonucleotide binding molecular function 2.08089 0.124819 5.55556 11 187 370 9597 32559-0.9037 spermatogenesis biological process 2.0714 0.126009 6.59341 6 85 375 9699 7283-0.8996 male gamete generation biological process 2.0714 0.126009 6.59341 6 85 375 9699 48232-0.8996 regulation of transcription from RNA polymerase II promoter biological process 2.03779 0.130317 5.97015 8 126 373 9658 6357-0.885 secretory granule cellular component 2.0268 0.131756 11.7647 2 15 379 9769 30141-0.8802 regulation of mitosis biological process 2.0268 0.131756 11.7647 2 15 379 9769 7088-0.8802 reproductive developmental process biological process 2.0268 0.131756 11.7647 2 15 379 9769 3006-0.8802 activity molecular function 2.0268 0.131756 11.7647 2 15 379 9769 4536-0.8802 reproductive process biological process 1.99968 0.135378 5.73248 9 148 372 9636 22414-0.8685 biological_process biological process 1.99007 0.136686 3.881 287 7108 94 2676 8150-0.8643 cytokine binding molecular function 1.97973 0.138107 6.84932 5 68 376 9716 19955-0.8598 regulation of retroviral genome replication biological process 1.95387 0.141725 25 1 3 380 9781 45091-0.8486 establishment of spindle localization biological process 1.95387 0.141725 25 1 3 380 9781 51293-0.8486 protein tyrosine/serine/threonine phosphatase activity molecular function 1.95387 0.141725 25 1 3 380 9781 8138-0.8486 oxidoreductase activity, acting on CH or CH2 molecular function 1.95387 0.141725 25 1 3 380 9781 16725-0.8486 anterograde axon cargo transport biological process 1.95387 0.141725 25 1 3 380 9781 8089-0.8486 chromosome, telomeric region cellular component 1.95387 0.141725 25 1 3 380 9781 781-0.8486 deoxynucleoside kinase activity molecular function 1.95387 0.141725 25 1 3 380 9781 19136-0.8486 MyD88-dependent tolllike receptor signaling biological process 1.95387 0.141725 25 1 3 380 9781 2755-0.8486 negative regulation of interleukin-6 production biological process 1.95387 0.141725 25 1 3 380 9781 32715-0.8486 interleukin-1-mediated signaling pathway biological process 1.95387 0.141725 25 1 3 380 9781 70498-0.8486 peptide receptor activity molecular function 1.95387 0.141725 25 1 3 380 9781 1653-0.8486 thrombin receptor activity molecular function 1.95387 0.141725 25 1 3 380 9781 15057-0.8486 DNA ligation during DNA repair biological process 1.95387 0.141725 25 1 3 380 9781 51103-0.8486 spindle midzone cellular component 1.95387 0.141725 25 1 3 380 9781 51233-0.8486 kinetochore microtubule cellular component 1.95387 0.141725 25 1 3 380 9781 5828-0.8486 ATP-dependent chromatin remodeling biological process 1.95387 0.141725 25 1 3 380 9781 43044-0.8486 activity molecular function 1.95387 0.141725 25 1 3 380 9781 4157-0.8486 cyclin-dependent protein kinase holoenzyme complex cellular component 1.95387 0.141725 25 1 3 380 9781 307-0.8486 smooth muscle biological process 1.95387 0.141725 25 1 3 380 9781 45987-0.8486 regulation of smooth muscle cell differentiation biological process 1.95387 0.141725 25 1 3 380 9781 51150-0.8486

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor molecular function 1.95387 0.141725 25 1 3 380 9781 16723-0.8486 protein complex biological process 1.95387 0.141725 25 1 3 380 9781 31334-0.8486 T cell mediated immunity biological process 1.95387 0.141725 25 1 3 380 9781 2711-0.8486 adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains biological process 1.95387 0.141725 25 1 3 380 9781 2824-0.8486 response to UV-B biological process 1.95387 0.141725 25 1 3 380 9781 10224-0.8486 gamma-tubulin large complex cellular component 1.95387 0.141725 25 1 3 380 9781 931-0.8486 DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator biological process 1.95387 0.141725 25 1 3 380 9781 6978-0.8486 gamma-tubulin ring complex cellular component 1.95387 0.141725 25 1 3 380 9781 8274-0.8486 DNA damage response, signal transduction resulting in transcription biological process 1.95387 0.141725 25 1 3 380 9781 42772-0.8486 pyruvate dehydrogenase (acetyl-transferring) kinase activity molecular function 1.95387 0.141725 25 1 3 380 9781 4740-0.8486 telomere organization biological process 1.95387 0.141725 25 1 3 380 9781 32200-0.8486 telomere assembly biological process 1.95387 0.141725 25 1 3 380 9781 32202-0.8486 regulation of telomere maintenance via biological process 1.95387 0.141725 25 1 3 380 9781 32210-0.8486 negative regulation of telomere maintenance via telomerase biological process 1.95387 0.141725 25 1 3 380 9781 32211-0.8486 negative regulation of telomerase activity biological process 1.95387 0.141725 25 1 3 380 9781 51974-0.8486 regulation of immunoglobulin secretion biological process 1.95387 0.141725 25 1 3 380 9781 51023-0.8486 immunoglobulin secretion biological process 1.95387 0.141725 25 1 3 380 9781 51024-0.8486 S phase of mitotic cell cycle biological process 1.95387 0.141725 25 1 3 380 9781 84-0.8486 S phase biological process 1.95387 0.141725 25 1 3 380 9781 51320-0.8486 U6 snrna binding molecular function 1.95387 0.141725 25 1 3 380 9781 17070-0.8486 nitrogen compound biosynthetic process biological process 1.95387 0.141725 25 1 3 380 9781 44271-0.8486 acylglycerol catabolic process biological process 1.95387 0.141725 25 1 3 380 9781 46464-0.8486 cotranslational protein targeting to membrane biological process 1.95387 0.141725 25 1 3 380 9781 6613-0.8486 alditol metabolic process biological process 1.95387 0.141725 25 1 3 380 9781 19400-0.8486 complex cellular component 1.95387 0.141725 25 1 3 380 9781 444-0.8486 interleukin-6 receptor binding molecular function 1.95387 0.141725 25 1 3 380 9781 5138-0.8486 antigen processing and presentation of peptide antigen biological process 1.95387 0.141725 25 1 3 380 9781 48002-0.8486 CCAAT-binding factor complex cellular component 1.95387 0.141725 25 1 3 380 9781 16602-0.8486 artery smooth muscle contraction biological process 1.95387 0.141725 25 1 3 380 9781 14824-0.8486 extracellular ligand-gated ion channel activity molecular function 1.95387 0.141725 25 1 3 380 9781 5230-0.8486

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type excitatory extracellular ligand-gated ion channel activity molecular function 1.95387 0.141725 25 1 3 380 9781 5231-0.8486 regulation of cytoskeleton organization biological process 1.95037 0.142222 8.57143 3 32 378 9752 51493-0.847 metalloendopeptidase activity molecular function 1.95037 0.142222 8.57143 3 32 378 9752 4222-0.847 spliceosome cellular component 1.94295 0.143281 7.40741 4 50 377 9734 5681-0.8438 transport vesicle cellular component 1.93296 0.144719 11.1111 2 16 379 9768 30133-0.8395 hydrolase activity, acting on ester bonds molecular function 1.92756 0.145503 5.06757 15 281 366 9503 16788-0.8371 protein catabolic process biological process 1.91975 0.146644 5.7971 8 130 373 9654 30163-0.8337 biological regulation biological process 1.89787 0.149888 4.03066 142 3381 239 6403 65007-0.8242 acid-amino acid ligase activity molecular function 1.85657 0.156208 6.18557 6 91 375 9693 16881-0.8063 proteolysis involved in cellular protein catabolic process biological process 1.83911 0.158959 5.88235 7 112 374 9672 51603-0.7987 negative regulation of protein metabolic process biological process 1.83159 0.160158 8.10811 3 34 378 9750 51248-0.7955 blood coagulation biological process 1.83159 0.160158 8.10811 3 34 378 9750 7596-0.7955 coagulation biological process 1.83159 0.160158 8.10811 3 34 378 9750 50817-0.7955 ribonucleotide binding molecular function 1.82176 0.161741 5.09804 13 242 368 9542 32553-0.7912 purine ribonucleotide binding molecular function 1.82176 0.161741 5.09804 13 242 368 9542 32555-0.7912 cellular protein catabolic process biological process 1.80927 0.163773 5.83333 7 113 374 9671 44257-0.7858 biopolymer catabolic process biological process 1.80838 0.16392 5.6338 8 134 373 9650 43285-0.7854 tubulin binding molecular function 1.80431 0.164588 7.01754 4 53 377 9731 15631-0.7836 mitosis biological process 1.764 0.171358 10 2 18 379 9766 45840-0.7661 nuclear division biological process 1.764 0.171358 10 2 18 379 9766 51785-0.7661 leukocyte adhesion biological process 1.764 0.171358 10 2 18 379 9766 7159-0.7661 negative regulation of gene-specific biological process 1.764 0.171358 10 2 18 379 9766 32582-0.7661 M phase biological process 1.74923 0.173908 20 1 4 380 9780 279-0.7597 dynein binding molecular function 1.74923 0.173908 20 1 4 380 9780 45502-0.7597 muscarinic acetylcholine receptor activity molecular function 1.74923 0.173908 20 1 4 380 9780 4981-0.7597 prostaglandin E receptor activity molecular function 1.74923 0.173908 20 1 4 380 9780 4957-0.7597 response to X-ray biological process 1.74923 0.173908 20 1 4 380 9780 10165-0.7597 insulin-like growth factor I binding molecular function 1.74923 0.173908 20 1 4 380 9780 31994-0.7597 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides molecular function 1.74923 0.173908 20 1 4 380 9780 16812-0.7597 regulation of lipid kinase activity biological process 1.74923 0.173908 20 1 4 380 9780 43550-0.7597 muscle contraction biological process 1.74923 0.173908 20 1 4 380 9780 45933-0.7597 oxidoreductase activity, oxidizing metal ions molecular function 1.74923 0.173908 20 1 4 380 9780 16722-0.7597 regulation of interferongamma production biological process 1.74923 0.173908 20 1 4 380 9780 32649-0.7597 regulation of smooth muscle cell apoptosis biological process 1.74923 0.173908 20 1 4 380 9780 34391-0.7597 chemosensory behavior biological process 1.74923 0.173908 20 1 4 380 9780 7635-0.7597 UDP-galactose:beta-Nacetylglucosamine beta- 1,3-galactosyltransferase activity molecular function 1.74923 0.173908 20 1 4 380 9780 8499-0.7597

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value spermatid development biological process 1.74923 0.173908 20 1 4 380 9780 7286-0.7597 helicase activity biological process 1.74923 0.173908 20 1 4 380 9780 51096-0.7597 regulation of telomerase activity biological process 1.74923 0.173908 20 1 4 380 9780 51972-0.7597 cytochrome-b5 reductase activity molecular function 1.74923 0.173908 20 1 4 380 9780 4128-0.7597 nitric oxide biosynthetic process biological process 1.74923 0.173908 20 1 4 380 9780 6809-0.7597 cellular carbohydrate catabolic process biological process 1.74923 0.173908 20 1 4 380 9780 44275-0.7597 ubiquinone biosynthetic process biological process 1.74923 0.173908 20 1 4 380 9780 6744-0.7597 quinone cofactor biosynthetic process biological process 1.74923 0.173908 20 1 4 380 9780 45426-0.7597 sister chromatid cohesion biological process 1.74923 0.173908 20 1 4 380 9780 7062-0.7597 complement activation, lectin pathway biological process 1.74923 0.173908 20 1 4 380 9780 1867-0.7597 mitotic recombination biological process 1.74923 0.173908 20 1 4 380 9780 6312-0.7597 vascular smooth muscle contraction biological process 1.74923 0.173908 20 1 4 380 9780 14829-0.7597 blood coagulation, extrinsic pathway biological process 1.74923 0.173908 20 1 4 380 9780 7598-0.7597 molecular_function molecular function 1.74063 0.175409 3.8419 313 7834 68 1950 3674-0.7559 nuclear pore cellular component 1.72185 0.178735 7.69231 3 36 378 9748 5643-0.7478 ubiquitin ligase complex cellular component 1.72185 0.178735 7.69231 3 36 378 9748 151-0.7478 cell cortex part cellular component 1.6876 0.184962 9.52381 2 19 379 9765 44448-0.7329 regulation of epithelial cell proliferation biological process 1.6876 0.184962 9.52381 2 19 379 9765 50678-0.7329 DNA recombination biological process 1.6876 0.184962 9.52381 2 19 379 9765 6310-0.7329 multicellular organismal process biological process 1.67006 0.188236 7.5 3 37 378 9747 51240-0.7253 regulation of biological process biological process 1.66095 0.189959 4.00621 129 3091 252 6693 50789-0.7213 membrane raft cellular component 1.62018 0.197863 7.31707 3 38 378 9746 45121-0.7036 response to estrogen stimulus biological process 1.61589 0.198713 9.09091 2 20 379 9764 43627-0.7018 exonuclease activity molecular function 1.61589 0.198713 9.09091 2 20 379 9764 4527-0.7018 differentiation biological process 1.61589 0.198713 9.09091 2 20 379 9764 30216-0.7018 chemotaxis biological process 1.60922 0.200043 6.0241 5 78 376 9706 6935-0.6989 taxis biological process 1.60922 0.200043 6.0241 5 78 376 9706 42330-0.6989 regulation of viral genome replication biological process 1.5853 0.204886 16.6667 1 5 380 9779 45069-0.6885 mitotic anaphase biological process 1.5853 0.204886 16.6667 1 5 380 9779 90-0.6885 anaphase biological process 1.5853 0.204886 16.6667 1 5 380 9779 51322-0.6885 hyaluronic acid binding molecular function 1.5853 0.204886 16.6667 1 5 380 9779 5540-0.6885 axon cargo transport biological process 1.5853 0.204886 16.6667 1 5 380 9779 8088-0.6885 regulation of cell division biological process 1.5853 0.204886 16.6667 1 5 380 9779 51302-0.6885 pattern recognition receptor signaling biological process 1.5853 0.204886 16.6667 1 5 380 9779 2221-0.6885 toll-like receptor signaling pathway biological process 1.5853 0.204886 16.6667 1 5 380 9779 2224-0.6885 regulation of interleukin- 12 production biological process 1.5853 0.204886 16.6667 1 5 380 9779 32655-0.6885 negative regulation of immune response biological process 1.5853 0.204886 16.6667 1 5 380 9779 50777-0.6885 transmembrane receptor protein tyrosine phosphatase signaling pathway biological process 1.5853 0.204886 16.6667 1 5 380 9779 7185-0.6885 regulation of S phase biological process 1.5853 0.204886 16.6667 1 5 380 9779 33261-0.6885 triglyceride biosynthetic process biological process 1.5853 0.204886 16.6667 1 5 380 9779 19432-0.6885

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value transport biological process 1.5853 0.204886 16.6667 1 5 380 9779 6836-0.6885 heparan sulfate proteoglycan metabolic process biological process 1.5853 0.204886 16.6667 1 5 380 9779 30201-0.6885 exodeoxyribonuclease activity, producing 5'- phosphomonoesters molecular function 1.5853 0.204886 16.6667 1 5 380 9779 16895-0.6885 tissue homeostasis biological process 1.5853 0.204886 16.6667 1 5 380 9779 1894-0.6885 regulation of adaptive immune response biological process 1.5853 0.204886 16.6667 1 5 380 9779 2819-0.6885 regulation of adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains biological process 1.5853 0.204886 16.6667 1 5 380 9779 2822-0.6885 natural killer cell mediated cytotoxicity directed against tumor biological process 1.5853 0.204886 16.6667 1 5 380 9779 2860-0.6885 regulation of muscle cell apoptosis biological process 1.5853 0.204886 16.6667 1 5 380 9779 10660-0.6885 postreplication repair biological process 1.5853 0.204886 16.6667 1 5 380 9779 6301-0.6885 negative regulation of lipid biosynthetic process biological process 1.5853 0.204886 16.6667 1 5 380 9779 51055-0.6885 taste biological process 1.5853 0.204886 16.6667 1 5 380 9779 50909-0.6885 nucleocytoplasmic transporter activity molecular function 1.5853 0.204886 16.6667 1 5 380 9779 5487-0.6885 chromatin assembly complex cellular component 1.5853 0.204886 16.6667 1 5 380 9779 5678-0.6885 3',5'-cyclic-AMP phosphodiesterase molecular function 1.5853 0.204886 16.6667 1 5 380 9779 4115-0.6885 beta-1,3- galactosyltransferase activity molecular function 1.5853 0.204886 16.6667 1 5 380 9779 48531-0.6885 hormone biosynthetic process biological process 1.5853 0.204886 16.6667 1 5 380 9779 42446-0.6885 FACIT collagen cellular component 1.5853 0.204886 16.6667 1 5 380 9779 5593-0.6885 extracellular matrix structural constituent conferring tensile molecular function 1.5853 0.204886 16.6667 1 5 380 9779 30020-0.6885 phagocytosis, engulfment biological process 1.5853 0.204886 16.6667 1 5 380 9779 6911-0.6885 membrane invagination biological process 1.5853 0.204886 16.6667 1 5 380 9779 10324-0.6885 cytoplasmic microtubule cellular component 1.5853 0.204886 16.6667 1 5 380 9779 5881-0.6885 ER overload response biological process 1.5853 0.204886 16.6667 1 5 380 9779 6983-0.6885 oxidoreductase activity, acting on NADH or NADPH, heme protein as molecular function 1.5853 0.204886 16.6667 1 5 380 9779 16653-0.6885 glycerolipid catabolic process biological process 1.5853 0.204886 16.6667 1 5 380 9779 46503-0.6885 quinone cofactor metabolic process biological process 1.5853 0.204886 16.6667 1 5 380 9779 42375-0.6885 oxidoreductase activity, acting on the CH-NH2 of donors, oxygen as acceptor molecular function 1.5853 0.204886 16.6667 1 5 380 9779 16641-0.6885 vasoconstriction biological process 1.5853 0.204886 16.6667 1 5 380 9779 42310-0.6885 glycine binding molecular function 1.5853 0.204886 16.6667 1 5 380 9779 16594-0.6885 neuromuscular process biological process 1.5853 0.204886 16.6667 1 5 380 9779 50905-0.6885 blood coagulation biological process 1.5853 0.204886 16.6667 1 5 380 9779 30194-0.6885 coagulation biological process 1.5853 0.204886 16.6667 1 5 380 9779 50820-0.6885 ATPase activity, coupled molecular function 1.57648 0.206701 5.66038 6 100 375 9684 42623-0.6847 endonuclease activity molecular function 1.54844 0.21258 8.69565 2 21 379 9763 4519-0.6725

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type peptidase activity, acting on L-amino acid peptides molecular function 1.54308 0.213722 5.02513 10 189 371 9595 70011-0.6702 nuclease activity molecular function 1.52257 0.21815 6.25 4 60 377 9724 4518-0.6612 regulation of transcription factor activity biological process 1.4865 0.226163 6.15385 4 61 377 9723 51090-0.6456 small nuclear ribonucleoprotein cellular component 1.48485 0.226536 8.33333 2 22 379 9762 30532-0.6449 pore complex cellular component 1.48106 0.227397 6.81818 3 41 378 9743 46930-0.6432 regulation of immune response biological process 1.48106 0.227397 6.81818 3 41 378 9743 50776-0.6432 enzyme activator activity molecular function 1.48106 0.227397 6.81818 3 41 378 9743 8047-0.6432 cellular macromolecule catabolic process biological process 1.48106 0.227397 6.81818 3 41 378 9743 44265-0.6432 nitrogen compound metabolic process biological process 1.48106 0.227397 6.81818 3 41 378 9743 6807-0.6432 ligase activity, forming carbon-nitrogen bonds molecular function 1.46612 0.230819 5.45455 6 104 375 9680 16879-0.6367 phosphoric ester hydrolase activity molecular function 1.46529 0.23101 5.12821 8 148 373 9636 42578-0.6364 oxidoreductase activity, acting on the CH-NH of donors, NAD or NADP as acceptor molecular function 1.44942 0.234706 14.2857 1 6 380 9778 16646-0.6295 DNA secondary structure binding molecular function 1.44942 0.234706 14.2857 1 6 380 9778 217-0.6295 immune responseactivating signal biological process 1.44942 0.234706 14.2857 1 6 380 9778 2757-0.6295 innate immune responseactivating signal transduction biological process 1.44942 0.234706 14.2857 1 6 380 9778 2758-0.6295 immune responseregulating signal transduction biological process 1.44942 0.234706 14.2857 1 6 380 9778 2764-0.6295 negative regulation of tumor necrosis factor biological process 1.44942 0.234706 14.2857 1 6 380 9778 32720-0.6295 negative regulation of protein complex disassembly biological process 1.44942 0.234706 14.2857 1 6 380 9778 43242-0.6295 regulation of insulin-like growth factor receptor signaling pathway biological process 1.44942 0.234706 14.2857 1 6 380 9778 43567-0.6295 general transcriptional repressor activity molecular function 1.44942 0.234706 14.2857 1 6 380 9778 16565-0.6295 neurogenesis biological process 1.44942 0.234706 14.2857 1 6 380 9778 22008-0.6295 microvillus cellular component 1.44942 0.234706 14.2857 1 6 380 9778 5902-0.6295 apical part of cell cellular component 1.44942 0.234706 14.2857 1 6 380 9778 45177-0.6295 cellular response to extracellular stimulus biological process 1.44942 0.234706 14.2857 1 6 380 9778 31668-0.6295 nucleotide diphosphatase activity molecular function 1.44942 0.234706 14.2857 1 6 380 9778 4551-0.6295 alpha-tubulin binding molecular function 1.44942 0.234706 14.2857 1 6 380 9778 43014-0.6295 fibrinogen complex cellular component 1.44942 0.234706 14.2857 1 6 380 9778 5577-0.6295 regulation of transcription from RNA polymerase III promoter biological process 1.44942 0.234706 14.2857 1 6 380 9778 6359-0.6295 calcium-dependent phospholipid binding molecular function 1.44942 0.234706 14.2857 1 6 380 9778 5544-0.6295 leukocyte migration biological process 1.44942 0.234706 14.2857 1 6 380 9778 50900-0.6295 complex cellular component 1.44942 0.234706 14.2857 1 6 380 9778 5858-0.6295 axoneme part cellular component 1.44942 0.234706 14.2857 1 6 380 9778 44447-0.6295 regulation of telomere maintenance biological process 1.44942 0.234706 14.2857 1 6 380 9778 32204-0.6295 regulation of protein secretion biological process 1.44942 0.234706 14.2857 1 6 380 9778 50708-0.6295 Cajal body cellular component 1.44942 0.234706 14.2857 1 6 380 9778 15030-0.6295

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type phosphofructokinase activity molecular function 1.44942 0.234706 14.2857 1 6 380 9778 8443-0.6295 synaptic transmission, cholinergic biological process 1.44942 0.234706 14.2857 1 6 380 9778 7271-0.6295 clathrin binding molecular function 1.44942 0.234706 14.2857 1 6 380 9778 30276-0.6295 interleukin-1 receptor binding molecular function 1.44942 0.234706 14.2857 1 6 380 9778 5149-0.6295 camp-dependent protein kinase regulator activity molecular function 1.44942 0.234706 14.2857 1 6 380 9778 8603-0.6295 polyubiquitin binding molecular function 1.44942 0.234706 14.2857 1 6 380 9778 31593-0.6295 protein heterodimerization molecular function 1.43976 0.236985 5.40541 6 105 375 9679 46982-0.6253 response to wounding biological process 1.43203 0.238824 4.97238 9 172 372 9612 9611-0.6219 SH3/SH2 adaptor activity molecular function 1.39624 0.247526 6.52174 3 43 378 9741 5070-0.6064 metallopeptidase activity molecular function 1.39624 0.247526 6.52174 3 43 378 9741 8237-0.6064 regulation of I-kappaB kinase/nf-kappab biological process 1.39408 0.24806 5.55556 5 85 376 9699 43122-0.6054 locomotion biological process 1.39408 0.24806 5.55556 5 85 376 9699 40011-0.6054 receptor signaling protein serine/threonine kinase activity molecular function 1.36801 0.254612 7.69231 2 24 379 9760 4702-0.5941 peptide receptor activity, G-protein coupled molecular function 1.36801 0.254612 7.69231 2 24 379 9760 8528-0.5941 inorganic anion transport biological process 1.36801 0.254612 7.69231 2 24 379 9760 15698-0.5941 nuclear import biological process 1.36801 0.254612 7.69231 2 24 379 9760 51170-0.5941 homooligomerization biological process 1.36801 0.254612 7.69231 2 24 379 9760 51260-0.5941 nucleobase, nucleoside, nucleotide and nucleic acid metabolic process biological process 1.36346 0.255773 5.26316 6 108 375 9676 6139-0.5921 macromolecular complex assembly biological process 1.34056 0.2617 4.49438 16 340 365 9444 65003-0.5822 muscarinic acetylcholine receptor signaling biological process 1.33404 0.26341 12.5 1 7 380 9777 7213-0.5794 prostaglandin receptor activity molecular function 1.33404 0.26341 12.5 1 7 380 9777 4955-0.5794 transport biological process 1.33404 0.26341 12.5 1 7 380 9777 10970-0.5794 regulation of tumor necrosis factor production biological process 1.33404 0.26341 12.5 1 7 380 9777 32680-0.5794 response to interleukin-1 biological process 1.33404 0.26341 12.5 1 7 380 9777 70555-0.5794 filopodium cellular component 1.33404 0.26341 12.5 1 7 380 9777 30175-0.5794 mannose binding molecular function 1.33404 0.26341 12.5 1 7 380 9777 5537-0.5794 UV protection biological process 1.33404 0.26341 12.5 1 7 380 9777 9650-0.5794 negative regulation of epithelial cell proliferation biological process 1.33404 0.26341 12.5 1 7 380 9777 50680-0.5794 acylglycerol biosynthetic process biological process 1.33404 0.26341 12.5 1 7 380 9777 46463-0.5794 polypeptide N- acetylgalactosaminyltrans ferase activity molecular function 1.33404 0.26341 12.5 1 7 380 9777 4653-0.5794 natural killer cell mediated cytotoxicity biological process 1.33404 0.26341 12.5 1 7 380 9777 45954-0.5794 negative regulation of cytoskeleton organization biological process 1.33404 0.26341 12.5 1 7 380 9777 51494-0.5794 cysteine-type endopeptidase inhibitor activity molecular function 1.33404 0.26341 12.5 1 7 380 9777 4869-0.5794 myelination biological process 1.33404 0.26341 12.5 1 7 380 9777 42552-0.5794 3'-5' exonuclease activity molecular function 1.33404 0.26341 12.5 1 7 380 9777 8408-0.5794 HAUS complex cellular component 1.33404 0.26341 12.5 1 7 380 9777 70652-0.5794 snrna binding molecular function 1.33404 0.26341 12.5 1 7 380 9777 17069-0.5794 calcium-activated potassium channel molecular function 1.33404 0.26341 12.5 1 7 380 9777 15269-0.5794

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type receptor-mediated endocytosis biological process 1.33404 0.26341 12.5 1 7 380 9777 48260-0.5794 vasodilation biological process 1.33404 0.26341 12.5 1 7 380 9777 45909-0.5794 MAP kinase kinase kinase activity molecular function 1.33404 0.26341 12.5 1 7 380 9777 4709-0.5794 negative regulation of proteolysis biological process 1.33404 0.26341 12.5 1 7 380 9777 45861-0.5794 contraction biological process 1.33404 0.26341 12.5 1 7 380 9777 6939-0.5794 endothelial cell biological process 1.33404 0.26341 12.5 1 7 380 9777 1938-0.5794 protein kinase B signaling biological process 1.33404 0.26341 12.5 1 7 380 9777 51897-0.5794 negative regulation of I- kappab kinase/nfkappab cascade biological process 1.33404 0.26341 12.5 1 7 380 9777 43124-0.5794 extracellular space cellular component 1.31586 0.268243 4.57746 13 271 368 9513 5615-0.5715 ribosome cellular component 1.31422 0.268684 7.40741 2 25 379 9759 5840-0.5708 signal transduction biological process 1.29233 0.274631 4.03785 64 1521 317 8263 7165-0.5613 peptidase activity molecular function 1.28199 0.277485 4.69484 10 203 371 9581 8233-0.5568 regulation of phosphorylation biological process 1.27948 0.278181 6.12245 3 46 378 9738 42325-0.5557 endopeptidase inhibitor activity molecular function 1.27948 0.278181 6.12245 3 46 378 9738 4866-0.5557 peptidase inhibitor activity molecular function 1.27948 0.278181 6.12245 3 46 378 9738 30414-0.5557 chromatin remodeling complex cellular component 1.26319 0.282752 7.14286 2 26 379 9758 16585-0.5486 nucleobase, nucleoside, nucleotide kinase activity molecular function 1.26319 0.282752 7.14286 2 26 379 9758 19205-0.5486 histone acetyltransferase activity molecular function 1.26319 0.282752 7.14286 2 26 379 9758 4402-0.5486 lysine N- acetyltransferase activity molecular function 1.26319 0.282752 7.14286 2 26 379 9758 4468-0.5486 microtubule cytoskeleton cellular component 1.23429 0.29104 11.1111 1 8 380 9776 15630-0.536 activity molecular function 1.23429 0.29104 11.1111 1 8 380 9776 4953-0.536 activity molecular function 1.23429 0.29104 11.1111 1 8 380 9776 4954-0.536 negative regulation of signal transduction biological process 1.23429 0.29104 11.1111 1 8 380 9776 9968-0.536 negative regulation of cell communication biological process 1.23429 0.29104 11.1111 1 8 380 9776 10648-0.536 regulation of interleukin-6 production biological process 1.23429 0.29104 11.1111 1 8 380 9776 32675-0.536 insulin-like growth factor binding molecular function 1.23429 0.29104 11.1111 1 8 380 9776 5520-0.536 anaphase-promoting complex cellular component 1.23429 0.29104 11.1111 1 8 380 9776 5680-0.536 glycerol ether biosynthetic process biological process 1.23429 0.29104 11.1111 1 8 380 9776 46504-0.536 regulation of natural killer cell mediated immunity biological process 1.23429 0.29104 11.1111 1 8 380 9776 2715-0.536 regulation of natural killer cell mediated cytotoxicity biological process 1.23429 0.29104 11.1111 1 8 380 9776 42269-0.536 heterotrimeric G-protein complex cellular component 1.23429 0.29104 11.1111 1 8 380 9776 5834-0.536 GABA-A receptor activity molecular function 1.23429 0.29104 11.1111 1 8 380 9776 4890-0.536 ensheathment of neurons biological process 1.23429 0.29104 11.1111 1 8 380 9776 7272-0.536 axon ensheathment biological process 1.23429 0.29104 11.1111 1 8 380 9776 8366-0.536 nuclear telomere cap complex cellular component 1.23429 0.29104 11.1111 1 8 380 9776 783-0.536 DNA-dependent DNA replication biological process 1.23429 0.29104 11.1111 1 8 380 9776 6261-0.536 ion gated channel activity molecular function 1.23429 0.29104 11.1111 1 8 380 9776 22839-0.536 nucleotide-sugar metabolic process biological process 1.23429 0.29104 11.1111 1 8 380 9776 9225-0.536

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value caspase inhibitor activity molecular function 1.23429 0.29104 11.1111 1 8 380 9776 43027-0.536 axis specification biological process 1.23429 0.29104 11.1111 1 8 380 9776 9798-0.536 antigen processing and presentation biological process 1.23429 0.29104 11.1111 1 8 380 9776 19882-0.536 oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two molecular function 1.23429 0.29104 11.1111 1 8 380 9776 16702-0.536 oxidoreductase activity, acting on the CH-NH2 of donors molecular function 1.23429 0.29104 11.1111 1 8 380 9776 16638-0.536 eukaryotic translation initiation factor 4F cellular component 1.23429 0.29104 11.1111 1 8 380 9776 16281-0.536 regulation of tube size biological process 1.23429 0.29104 11.1111 1 8 380 9776 35150-0.536 regulation of blood vessel size biological process 1.23429 0.29104 11.1111 1 8 380 9776 50880-0.536 spectrin cellular component 1.23429 0.29104 11.1111 1 8 380 9776 8091-0.536 regulation of DNA binding biological process 1.22932 0.292492 5.47945 4 69 377 9715 51101-0.5339 enzyme inhibitor activity molecular function 1.22932 0.292492 5.47945 4 69 377 9715 4857-0.5339 response to protein stimulus biological process 1.21471 0.296795 6.89655 2 27 379 9757 51789-0.5275 serine-type endopeptidase activity molecular function 1.20792 0.298818 5.88235 3 48 378 9736 4252-0.5246 cytoplasmic membranebounded vesicle cellular component 1.20069 0.300985 5.40541 4 70 377 9714 16023-0.5215 oxidoreductase activity molecular function 1.19798 0.301804 4.4164 14 303 367 9481 16491-0.5203 G-protein coupled receptor protein signaling biological process 1.19259 0.303433 4.52675 11 232 370 9552 7186-0.5179 response to abiotic stimulus biological process 1.1841 0.306023 5.10204 5 93 376 9691 9628-0.5142 ATPase activity molecular function 1.17978 0.307347 4.79452 7 139 374 9645 16887-0.5124 cytosol cellular component 1.17633 0.30841 4.14365 30 694 351 9090 5829-0.5109 extracellular matrix organization biological process 1.16862 0.310796 6.66667 2 28 379 9756 30198-0.5075 protein kinase C binding molecular function 1.14685 0.317637 10 1 9 380 9775 5080-0.4981 centriole cellular component 1.14685 0.317637 10 1 9 380 9775 5814-0.4981 DNA bending activity molecular function 1.14685 0.317637 10 1 9 380 9775 8301-0.4981 activity molecular function 1.14685 0.317637 10 1 9 380 9775 5044-0.4981 defense response to Gram-positive bacterium biological process 1.14685 0.317637 10 1 9 380 9775 50830-0.4981 gamma-tubulin complex cellular component 1.14685 0.317637 10 1 9 380 9775 930-0.4981 iron ion binding molecular function 1.14685 0.317637 10 1 9 380 9775 5506-0.4981 NAD metabolic process biological process 1.14685 0.317637 10 1 9 380 9775 19674-0.4981 regulation of positive chemotaxis biological process 1.14685 0.317637 10 1 9 380 9775 50926-0.4981 positive chemotaxis biological process 1.14685 0.317637 10 1 9 380 9775 50927-0.4981 kinase activity molecular function 1.14089 0.319535 5.66038 3 50 378 9734 16301-0.4955 cellular macromolecular complex assembly biological process 1.14062 0.319622 4.56853 9 188 372 9596 34622-0.4954 intracellular signaling cascade biological process 1.11317 0.328517 4.22222 19 431 362 9353 7242-0.4834 microtubule organizing center part cellular component 1.08292 0.338606 6.25 2 30 379 9754 44450-0.4703 pattern specification process biological process 1.08292 0.338606 6.25 2 30 379 9754 7389-0.4703 cysteine-type peptidase activity molecular function 1.07802 0.340267 5.45455 3 52 378 9732 8234-0.4682 serine-type peptidase activity molecular function 1.07802 0.340267 5.45455 3 52 378 9732 8236-0.4682 mrna processing biological process 1.07618 0.340895 4.72441 6 121 375 9663 6397-0.4674 sequence-specific DNA binding molecular function 1.06938 0.343222 4.85437 5 98 376 9686 43565-0.4644

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value binding molecular function 1.06933 0.343238 9.09091 1 10 380 9774 42826-0.4644 microtubule organizing center cellular component 1.06933 0.343238 9.09091 1 10 380 9774 5815-0.4644 oxidoreductase activity, acting on the CH-NH of donors molecular function 1.06933 0.343238 9.09091 1 10 380 9774 16645-0.4644 nucleoside kinase activity molecular function 1.06933 0.343238 9.09091 1 10 380 9774 19206-0.4644 negative regulation of NF-kappaB transcription factor activity biological process 1.06933 0.343238 9.09091 1 10 380 9774 32088-0.4644 T cell proliferation biological process 1.06933 0.343238 9.09091 1 10 380 9774 42102-0.4644 condensed nuclear chromosome cellular component 1.06933 0.343238 9.09091 1 10 380 9774 794-0.4644 beta-tubulin binding molecular function 1.06933 0.343238 9.09091 1 10 380 9774 48487-0.4644 protein ubiquitination biological process 1.06933 0.343238 9.09091 1 10 380 9774 31398-0.4644 nucleosome organization biological process 1.06933 0.343238 9.09091 1 10 380 9774 34728-0.4644 GABA receptor activity molecular function 1.06933 0.343238 9.09091 1 10 380 9774 16917-0.4644 fibrillar collagen cellular component 1.06933 0.343238 9.09091 1 10 380 9774 5583-0.4644 glycosaminoglycan biosynthetic process biological process 1.06933 0.343238 9.09091 1 10 380 9774 6024-0.4644 NAD+ ADPribosyltransferase activity molecular function 1.06933 0.343238 9.09091 1 10 380 9774 3950-0.4644 histone H2A acetylation biological process 1.06933 0.343238 9.09091 1 10 380 9774 43968-0.4644 angiogenesis biological process 1.06933 0.343238 9.09091 1 10 380 9774 45766-0.4644 response to external stimulus biological process 1.06126 0.34602 4.45545 9 193 372 9591 9605-0.4609 cellular biopolymer metabolic process biological process 1.05777 0.347231 3.98959 46 1107 335 8677 34960-0.4594 regulation of protein kinase cascade biological process 1.05669 0.347603 4.6875 6 122 375 9662 10627-0.4589 nuclear mrna splicing, via spliceosome biological process 1.0478 0.350708 4.80769 5 99 376 9685 398-0.4551 response to UV biological process 1.04303 0.352386 6.06061 2 31 379 9753 9411-0.453 response to steroid hormone stimulus biological process 1.04303 0.352386 6.06061 2 31 379 9753 48545-0.453 androgen receptor signaling pathway biological process 1.04303 0.352386 6.06061 2 31 379 9753 30521-0.453 cellular macromolecule metabolic process biological process 1.03257 0.35609 3.97022 48 1161 333 8623 44260-0.4484 I- kappab kinase/nfkappab cascade biological process 1.01899 0.360961 4.93827 4 77 377 9707 43123-0.4425 signaling biological process 1.00494 0.366065 5.88235 2 32 379 9752 9755-0.4364 pathway-restricted SMAD protein phosphorylation biological process 0.999996 0.367881 8.33333 1 11 380 9773 10862-0.4343 ATP-dependent DNA helicase activity molecular function 0.999996 0.367881 8.33333 1 11 380 9773 4003-0.4343 deoxyribonucleotide metabolic process biological process 0.999996 0.367881 8.33333 1 11 380 9773 9262-0.4343 phosphoprotein phosphatase inhibitor activity molecular function 0.999996 0.367881 8.33333 1 11 380 9773 4864-0.4343 nucleotide-excision repair biological process 0.999996 0.367881 8.33333 1 11 380 9773 6289-0.4343 acetylgalactosaminyltrans ferase activity molecular function 0.999996 0.367881 8.33333 1 11 380 9773 8376-0.4343 regulation of muscle cell differentiation biological process 0.999996 0.367881 8.33333 1 11 380 9773 51147-0.4343 endoribonuclease activity, producing 5'- phosphomonoesters molecular function 0.999996 0.367881 8.33333 1 11 380 9773 16891-0.4343

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 5'- phosphomonoesters molecular function 0.999996 0.367881 8.33333 1 11 380 9773 16893-0.4343 oxidoreductase activity, acting on the CH-CH of donors, NAD or NADP as acceptor molecular function 0.999996 0.367881 8.33333 1 11 380 9773 16628-0.4343 protein catabolic process biological process 0.999996 0.367881 8.33333 1 11 380 9773 45732-0.4343 ribonuclease activity molecular function 0.999996 0.367881 8.33333 1 11 380 9773 4540-0.4343 carboxylic acid biosynthetic process biological process 0.999996 0.367881 8.33333 1 11 380 9773 46394-0.4343 protein targeting to membrane biological process 0.999996 0.367881 8.33333 1 11 380 9773 6612-0.4343 membrane protein ectodomain proteolysis biological process 0.999996 0.367881 8.33333 1 11 380 9773 6509-0.4343 membrane protein proteolysis biological process 0.999996 0.367881 8.33333 1 11 380 9773 33619-0.4343 NuA4 histone acetyltransferase cellular component 0.999996 0.367881 8.33333 1 11 380 9773 35267-0.4343 H4/H2A histone acetyltransferase cellular component 0.999996 0.367881 8.33333 1 11 380 9773 43189-0.4343 amino acid binding molecular function 0.999996 0.367881 8.33333 1 11 380 9773 16597-0.4343 protein serine/threonine kinase inhibitor activity molecular function 0.999996 0.367881 8.33333 1 11 380 9773 30291-0.4343 regulation of apoptosis biological process 0.990839 0.371265 5.17241 3 55 378 9729 42981-0.4303 extracellular matrix part cellular component 0.990839 0.371265 5.17241 3 55 378 9729 44420-0.4303 molecular adaptor activity molecular function 0.990839 0.371265 5.17241 3 55 378 9729 60090-0.4303 identical protein binding molecular function 0.986896 0.372732 4.34783 9 198 372 9586 42802-0.4286 macromolecular complex subunit organization biological process 0.969404 0.379309 4.13437 16 371 365 9413 43933-0.421 response to drug biological process 0.968556 0.379631 5.71429 2 33 379 9751 42493-0.4206 binding molecular function 0.965723 0.380708 4.62963 5 103 376 9681 8134-0.4194 assembly biological process 0.965555 0.380772 4.43038 7 151 374 9633 6461-0.4193 cell migration biological process 0.963526 0.381545 5.08475 3 56 378 9728 16477-0.4185 p53 binding molecular function 0.937509 0.391602 7.69231 1 12 380 9772 2039-0.4072 phosphatase inhibitor activity molecular function 0.937509 0.391602 7.69231 1 12 380 9772 19212-0.4072 heterophilic cell adhesion biological process 0.937509 0.391602 7.69231 1 12 380 9772 7157-0.4072 epithelial cell proliferation biological process 0.937509 0.391602 7.69231 1 12 380 9772 50679-0.4072 exonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 5'- phosphomonoesters molecular function 0.937509 0.391602 7.69231 1 12 380 9772 16796-0.4072 transcription factor TFTC complex cellular component 0.937509 0.391602 7.69231 1 12 380 9772 33276-0.4072 germ cell development biological process 0.937509 0.391602 7.69231 1 12 380 9772 7281-0.4072 DNA damage response, signal transduction by p53 class mediator biological process 0.937509 0.391602 7.69231 1 12 380 9772 30330-0.4072 NLS-bearing substrate import into nucleus biological process 0.937509 0.391602 7.69231 1 12 380 9772 6607-0.4072 regulation of receptormediated endocytosis biological process 0.937509 0.391602 7.69231 1 12 380 9772 48259-0.4072 pyridine nucleotide metabolic process biological process 0.937509 0.391602 7.69231 1 12 380 9772 19362-0.4072 nicotinamide nucleotide metabolic process biological process 0.937509 0.391602 7.69231 1 12 380 9772 46496-0.4072 binding molecular function 0.937509 0.391602 7.69231 1 12 380 9772 42809-0.4072 regulation of protein kinase B signaling biological process 0.937509 0.391602 7.69231 1 12 380 9772 51896-0.4072

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value amine binding molecular function 0.933757 0.393074 5.55556 2 34 379 9750 43176-0.4055 nucleoplasm part cellular component 0.911995 0.401722 4.20168 10 228 371 9556 44451-0.3961 helicase activity molecular function 0.900459 0.406383 5.40541 2 35 379 9749 4386-0.3911 cytokine activity molecular function 0.900459 0.406383 5.40541 2 35 379 9749 5125-0.3911 response to bacterium biological process 0.900459 0.406383 5.40541 2 35 379 9749 9617-0.3911 regulation of molecular function biological process 0.88877 0.411161 4.01691 19 454 362 9330 65009-0.386 cell cycle arrest biological process 0.886404 0.412135 4.83871 3 59 378 9725 7050-0.385 B cell differentiation biological process 0.880839 0.414435 7.14286 1 13 380 9771 30183-0.3825 O-acyltransferase activity molecular function 0.880839 0.414435 7.14286 1 13 380 9771 8374-0.3825 protein amino acid O- linked glycosylation biological process 0.880839 0.414435 7.14286 1 13 380 9771 6493-0.3825 G2/M transition of mitotic cell cycle biological process 0.880839 0.414435 7.14286 1 13 380 9771 86-0.3825 protein modification biological process 0.880839 0.414435 7.14286 1 13 380 9771 31401-0.3825 DNA repair biological process 0.880839 0.414435 7.14286 1 13 380 9771 45739-0.3825 phospholipase A2 activity molecular function 0.880839 0.414435 7.14286 1 13 380 9771 4623-0.3825 voltage-gated sodium channel activity molecular function 0.880839 0.414435 7.14286 1 13 380 9771 5248-0.3825 enzyme regulator activity molecular function 0.879578 0.414958 4.05405 15 355 366 9429 30234-0.382 protein transport biological process 0.868573 0.41955 5.26316 2 36 379 9748 15031-0.3772 response to light stimulus biological process 0.868573 0.41955 5.26316 2 36 379 9748 9416-0.3772 DNA metabolic process biological process 0.868573 0.41955 5.26316 2 36 379 9748 51054-0.3772 cellular biopolymer catabolic process biological process 0.868573 0.41955 5.26316 2 36 379 9748 34962-0.3772 regulation of protein metabolic process biological process 0.847614 0.428436 4.28571 6 134 375 9650 51246-0.3681 GTP binding molecular function 0.83871 0.432268 4.6875 3 61 378 9723 5525-0.3642 protein ubiquitination biological process 0.83871 0.432268 4.6875 3 61 378 9723 16567-0.3642 activation of caspase activity biological process 0.838018 0.432567 5.12821 2 37 379 9747 6919-0.3639 chemokine activity molecular function 0.838018 0.432567 5.12821 2 37 379 9747 8009-0.3639 regulation of pathwayrestricted SMAD protein phosphorylation biological process 0.829166 0.436413 6.66667 1 14 380 9770 60393-0.3601 mast cell proliferation biological process 0.829166 0.436413 6.66667 1 14 380 9770 70668-0.3601 lymphocyte activation biological process 0.829166 0.436413 6.66667 1 14 380 9770 51251-0.3601 taste receptor activity molecular function 0.829166 0.436413 6.66667 1 14 380 9770 8527-0.3601 histone methyltransferase complex cellular component 0.829166 0.436413 6.66667 1 14 380 9770 35097-0.3601 process biological process 0.829166 0.436413 6.66667 1 14 380 9770 6006-0.3601 SH2 domain binding molecular function 0.829166 0.436413 6.66667 1 14 380 9770 42169-0.3601 RNA polymerase II transcription mediator activity molecular function 0.829166 0.436413 6.66667 1 14 380 9770 16455-0.3601 activation of phospholipase C activity biological process 0.829166 0.436413 6.66667 1 14 380 9770 7202-0.3601 phospholipase C activity biological process 0.829166 0.436413 6.66667 1 14 380 9770 10863-0.3601 spliceosome assembly biological process 0.829166 0.436413 6.66667 1 14 380 9770 245-0.3601 nuclear export biological process 0.829166 0.436413 6.66667 1 14 380 9770 51168-0.3601 cornified envelope cellular component 0.829166 0.436413 6.66667 1 14 380 9770 1533-0.3601 regulation of catalytic activity biological process 0.823244 0.439005 3.9801 16 386 365 9398 50790-0.3575 guanyl ribonucleotide binding molecular function 0.8159 0.442241 4.61538 3 62 378 9722 32561-0.3543 cysteine-type endopeptidase activity molecular function 0.808722 0.445427 5 2 38 379 9746 4197-0.3512 cell development biological process 0.808722 0.445427 5 2 38 379 9746 48468-0.3512

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type apoptosis biological process 0.78927 0.454176 4.08163 8 188 373 9596 43065-0.3428 G-protein signaling, coupled to camp nucleotide second biological process 0.78183 0.457568 6.25 1 15 380 9769 7188-0.3395 negative regulation of translation biological process 0.78183 0.457568 6.25 1 15 380 9769 17148-0.3395 double-stranded RNA binding molecular function 0.78183 0.457568 6.25 1 15 380 9769 3725-0.3395 negative regulation of specific transcription from RNA polymerase II promoter biological process 0.78183 0.457568 6.25 1 15 380 9769 10553-0.3395 exocytosis biological process 0.78183 0.457568 6.25 1 15 380 9769 6887-0.3395 signaling biological process 0.78183 0.457568 6.25 1 15 380 9769 19722-0.3395 galactosyltransferase activity molecular function 0.78183 0.457568 6.25 1 15 380 9769 8378-0.3395 glutathione transferase activity molecular function 0.78183 0.457568 6.25 1 15 380 9769 4364-0.3395 single fertilization biological process 0.78183 0.457568 6.25 1 15 380 9769 7338-0.3395 secretory granule membrane cellular component 0.78183 0.457568 6.25 1 15 380 9769 30667-0.3395 glutamate signaling pathway biological process 0.78183 0.457568 6.25 1 15 380 9769 7215-0.3395 activity molecular function 0.78183 0.457568 6.25 1 15 380 9769 19200-0.3395 response to endoplasmic reticulum stress biological process 0.78183 0.457568 6.25 1 15 380 9769 34976-0.3395 learning or memory biological process 0.78183 0.457568 6.25 1 15 380 9769 7611-0.3395 viral genome replication biological process 0.78183 0.457568 6.25 1 15 380 9769 19079-0.3395 MAPKKK cascade biological process 0.78183 0.457568 6.25 1 15 380 9769 165-0.3395 activation of JUN kinase activity biological process 0.78183 0.457568 6.25 1 15 380 9769 7257-0.3395 aminopeptidase activity molecular function 0.78183 0.457568 6.25 1 15 380 9769 4177-0.3395 regulation of translational initiation biological process 0.78183 0.457568 6.25 1 15 380 9769 6446-0.3395 activation of adenylate cyclase activity biological process 0.78183 0.457568 6.25 1 15 380 9769 7190-0.3395 phospholipase activity biological process 0.78183 0.457568 6.25 1 15 380 9769 10518-0.3395 protein polyubiquitination biological process 0.78183 0.457568 6.25 1 15 380 9769 209-0.3395 single-stranded RNA binding molecular function 0.78183 0.457568 6.25 1 15 380 9769 3727-0.3395 binding molecular function 0.78062 0.458122 4.87805 2 39 379 9745 42379-0.339 regulation of binding biological process 0.770564 0.462752 4.30108 4 89 377 9695 51098-0.3347 activity molecular function 0.763164 0.466189 3.97112 11 266 370 9518 46983-0.3314 system development biological process 0.760198 0.467574 3.93939 13 317 368 9467 48731-0.3301 inflammatory response biological process 0.758381 0.468424 4.10959 6 140 375 9644 6954-0.3294 RNA biosynthetic process biological process 0.758381 0.468424 4.10959 6 140 375 9644 32774-0.3294 establishment of protein localization biological process 0.753645 0.470648 4.7619 2 40 379 9744 45184-0.3273 nucleoside phosphate metabolic process biological process 0.753645 0.470648 4.7619 2 40 379 9744 6753-0.3273 nucleotide metabolic process biological process 0.753645 0.470648 4.7619 2 40 379 9744 9117-0.3273 activity molecular function 0.753645 0.470648 4.7619 2 40 379 9744 8080-0.3273 anion transport biological process 0.753645 0.470648 4.7619 2 40 379 9744 6820-0.3273 channel activity molecular function 0.751344 0.471732 4.41176 3 65 378 9719 15267-0.3263 passive transmembrane transporter activity molecular function 0.751344 0.471732 4.41176 3 65 378 9719 22803-0.3263 regulation of programmed cell death biological process 0.748994 0.472842 3.96825 10 242 371 9542 43067-0.3253 regulation of viral reproduction biological process 0.738289 0.477931 5.88235 1 16 380 9768 50792-0.3206 JAK-STAT cascade biological process 0.738289 0.477931 5.88235 1 16 380 9768 7259-0.3206

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type tyrosine phosphorylation of STAT protein biological process 0.738289 0.477931 5.88235 1 16 380 9768 42531-0.3206 transcription factor TFI complex cellular component 0.738289 0.477931 5.88235 1 16 380 9768 5669-0.3206 cell growth biological process 0.738289 0.477931 5.88235 1 16 380 9768 30307-0.3206 cytokine receptor activity molecular function 0.738289 0.477931 5.88235 1 16 380 9768 4896-0.3206 negative regulation of biological process biological process 0.738289 0.477931 5.88235 1 16 380 9768 48519-0.3206 mesoderm development biological process 0.738289 0.477931 5.88235 1 16 380 9768 7498-0.3206 ATP-dependent RNA helicase activity molecular function 0.738289 0.477931 5.88235 1 16 380 9768 4004-0.3206 histone H4 acetylation biological process 0.738289 0.477931 5.88235 1 16 380 9768 43967-0.3206 protease binding molecular function 0.738289 0.477931 5.88235 1 16 380 9768 2020-0.3206 protein maturation by peptide bond cleavage biological process 0.738289 0.477931 5.88235 1 16 380 9768 51605-0.3206 phospholipid binding molecular function 0.731044 0.481406 4.34783 3 66 378 9718 5543-0.3175 mrna metabolic process biological process 0.730648 0.481597 4.05405 6 142 375 9642 16071-0.3173 programmed cell death biological process 0.72871 0.482531 3.9801 8 193 373 9591 43068-0.3165 regulation of cell death biological process 0.727927 0.482909 3.93701 10 244 371 9540 10941-0.3161 protein tyrosine phosphatase activity molecular function 0.727741 0.482999 4.65116 2 41 379 9743 4725-0.3161 regulation of cytokine production biological process 0.727741 0.482999 4.65116 2 41 379 9743 1817-0.3161 histone acetyltransferase complex cellular component 0.727741 0.482999 4.65116 2 41 379 9743 123-0.3161 caspase activity biological process 0.727741 0.482999 4.65116 2 41 379 9743 43280-0.3161 regulation of transcription, DNA- biological process 0.718284 0.487588 3.8961 12 296 369 9488 6355-0.3119 protein oligomerization biological process 0.711321 0.490995 4.28571 3 67 378 9717 51259-0.3089 epidermis development biological process 0.711321 0.490995 4.28571 3 67 378 9717 8544-0.3089 oxidoreductase activity, acting on CH-OH of donors molecular function 0.711321 0.490995 4.28571 3 67 378 9717 16614-0.3089 N-acyltransferase activity molecular function 0.702852 0.495171 4.54545 2 42 379 9742 16410-0.3052 protein kinase regulator activity molecular function 0.702852 0.495171 4.54545 2 42 379 9742 19887-0.3052 acetylcholine receptor activity molecular function 0.698095 0.497532 5.55556 1 17 380 9767 15464-0.3032 cytoskeleton-dependent intracellular transport biological process 0.698095 0.497532 5.55556 1 17 380 9767 30705-0.3032 RNA polymerase II transcription factor activity, enhancer binding molecular function 0.698095 0.497532 5.55556 1 17 380 9767 3705-0.3032 B cell activation biological process 0.698095 0.497532 5.55556 1 17 380 9767 42113-0.3032 negative regulation of angiogenesis biological process 0.698095 0.497532 5.55556 1 17 380 9767 16525-0.3032 fertilization biological process 0.698095 0.497532 5.55556 1 17 380 9767 9566-0.3032 signal sequence binding molecular function 0.698095 0.497532 5.55556 1 17 380 9767 5048-0.3032 RNA-dependent ATPase activity molecular function 0.698095 0.497532 5.55556 1 17 380 9767 8186-0.3032 cell motility biological process 0.692152 0.500498 4.22535 3 68 378 9716 48870-0.3006 ligase activity molecular function 0.69082 0.501165 3.97351 6 145 375 9639 16874-0.3 response to stress biological process 0.683302 0.504947 3.90244 8 197 373 9587 6950-0.2968 protein homodimerization activity molecular function 0.683302 0.504947 3.90244 8 197 373 9587 42803-0.2968 calcium ion binding molecular function 0.667624 0.512926 3.96825 5 121 376 9663 5509-0.2899 protein tyrosine kinase activity molecular function 0.660876 0.516399 5.26316 1 18 380 9766 4713-0.287 acetylcholine binding molecular function 0.660876 0.516399 5.26316 1 18 380 9766 42166-0.287 DNA helicase activity molecular function 0.660876 0.516399 5.26316 1 18 380 9766 3678-0.287

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type negative regulation of MAP kinase activity biological process 0.660876 0.516399 5.26316 1 18 380 9766 43407-0.287 regulation of mast cell proliferation biological process 0.660876 0.516399 5.26316 1 18 380 9766 70666-0.287 nucleus biological process 0.660876 0.516399 5.26316 1 18 380 9766 6406-0.287 mrna transport biological process 0.660876 0.516399 5.26316 1 18 380 9766 51028-0.287 cellular macromolecular complex subunit organization biological process 0.660876 0.516399 5.26316 1 18 380 9766 34621-0.287 hydrolase activity biological process 0.660876 0.516399 5.26316 1 18 380 9766 51345-0.287 regulation of JUN kinase activity biological process 0.660876 0.516399 5.26316 1 18 380 9766 43506-0.287 JUN kinase activity biological process 0.660876 0.516399 5.26316 1 18 380 9766 43507-0.287 ligand-dependent nuclear receptor transcription coactivator activity molecular function 0.660876 0.516399 5.26316 1 18 380 9766 30374-0.287 G-protein coupled receptor activity molecular function 0.658213 0.517776 3.83142 10 251 371 9533 4930-0.2859 methyltransferase activity molecular function 0.655927 0.518961 4.34783 2 44 379 9740 8168-0.2849 nucleocytoplasmic transport biological process 0.655927 0.518961 4.34783 2 44 379 9740 6913-0.2849 gated channel activity molecular function 0.655927 0.518961 4.34783 2 44 379 9740 22836-0.2849 phosphoprotein phosphatase activity molecular function 0.637809 0.528449 4.05405 3 71 378 9713 4721-0.277 negative regulation of cellular process biological process 0.634107 0.530409 3.76106 17 435 364 9349 48523-0.2754 transferase activity, transferring one-carbon s molecular function 0.6338 0.530572 4.25532 2 45 379 9739 16741-0.2753 nuclear transport biological process 0.6338 0.530572 4.25532 2 45 379 9739 51169-0.2753 cellular biosynthetic process biological process 0.630238 0.532465 3.79747 9 228 372 9556 44249-0.2737 RNA binding molecular function 0.630165 0.532504 3.78788 10 254 371 9530 3723-0.2737 drug binding molecular function 0.626313 0.534559 5 1 19 380 9765 8144-0.272 negative regulation of cellular component organization biological process 0.626313 0.534559 5 1 19 380 9765 51129-0.272 cell adhesion molecule binding molecular function 0.626313 0.534559 5 1 19 380 9765 50839-0.272 regulation of leukocyte proliferation biological process 0.626313 0.534559 5 1 19 380 9765 70663-0.272 cellular component assembly biological process 0.626313 0.534559 5 1 19 380 9765 22607-0.272 ubiquitin-specific protease activity molecular function 0.626313 0.534559 5 1 19 380 9765 4843-0.272 cell adhesion biological process 0.626313 0.534559 5 1 19 380 9765 45785-0.272 protein modification by small protein conjugation or removal biological process 0.626313 0.534559 5 1 19 380 9765 70647-0.272 cascade biological process 0.626313 0.534559 5 1 19 380 9765 46328-0.272 metalloexopeptidase activity molecular function 0.626313 0.534559 5 1 19 380 9765 8235-0.272 mediator complex cellular component 0.626313 0.534559 5 1 19 380 9765 119-0.272 copper ion binding molecular function 0.626313 0.534559 5 1 19 380 9765 5507-0.272 regulation of behavior biological process 0.626313 0.534559 5 1 19 380 9765 50795-0.272 regulation of chemotaxis biological process 0.626313 0.534559 5 1 19 380 9765 50920-0.272 RNA polymerase II transcription factor molecular function 0.618829 0.538575 3.80435 7 177 374 9607 3702-0.2688 protein metabolic process biological process 0.612504 0.541992 4.16667 2 46 379 9738 51247-0.266 steroid hormone receptor signaling pathway biological process 0.612504 0.541992 4.16667 2 46 379 9738 30518-0.266

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value camp-mediated signaling biological process 0.594137 0.552039 4.7619 1 20 380 9764 19933-0.258 regulation of MAP kinase activity biological process 0.594137 0.552039 4.7619 1 20 380 9764 43405-0.258 embryonic development biological process 0.594137 0.552039 4.7619 1 20 380 9764 9790-0.258 monosaccharide binding molecular function 0.594137 0.552039 4.7619 1 20 380 9764 48029-0.258 small conjugating proteinspecific protease activity molecular function 0.594137 0.552039 4.7619 1 20 380 9764 19783-0.258 SAGA-type complex cellular component 0.594137 0.552039 4.7619 1 20 380 9764 70461-0.258 regulation of lipid biosynthetic process biological process 0.594137 0.552039 4.7619 1 20 380 9764 46890-0.258 JNK cascade biological process 0.594137 0.552039 4.7619 1 20 380 9764 7254-0.258 icosanoid metabolic process biological process 0.594137 0.552039 4.7619 1 20 380 9764 6690-0.258 endoplasmic reticulum lumen cellular component 0.594137 0.552039 4.7619 1 20 380 9764 5788-0.258 thyroid hormone receptor binding molecular function 0.594137 0.552039 4.7619 1 20 380 9764 46966-0.258 calcium-dependent protein binding molecular function 0.594137 0.552039 4.7619 1 20 380 9764 48306-0.258 lipase activity biological process 0.594137 0.552039 4.7619 1 20 380 9764 60193-0.258 cell surface binding molecular function 0.594137 0.552039 4.7619 1 20 380 9764 43498-0.258 response to chemical stimulus biological process 0.59093 0.553812 3.71353 14 363 367 9421 42221-0.2566 RNA splicing biological process 0.587867 0.555511 3.8961 3 74 378 9710 8380-0.2553 cell differentiation biological process 0.577469 0.561317 3.7594 5 128 376 9656 30154-0.2508 response to hormone stimulus biological process 0.57226 0.564249 4 2 48 379 9736 9725-0.2485 perinuclear region of cytoplasm cellular component 0.572127 0.564324 3.84615 3 75 378 9709 48471-0.2485 growth factor activity molecular function 0.572127 0.564324 3.84615 3 75 378 9709 8083-0.2485 phospholipase activity molecular function 0.564114 0.568864 4.54545 1 21 380 9763 4620-0.245 glycerophospholipid biosynthetic process biological process 0.564114 0.568864 4.54545 1 21 380 9763 46474-0.245 adenylate cyclase activity biological process 0.564114 0.568864 4.54545 1 21 380 9763 45762-0.245 developmental process biological process 0.564114 0.568864 4.54545 1 21 380 9763 51094-0.245 acyltransferase activity molecular function 0.556817 0.57303 3.79747 3 76 378 9708 8415-0.2418 transferase activity, transferring acyl s other than amino-acyl s molecular function 0.556817 0.57303 3.79747 3 76 378 9708 16747-0.2418 regulation of response to stimulus biological process 0.553912 0.574697 3.7037 5 130 376 9654 48583-0.2406 complex cellular component 0.553241 0.575083 3.92157 2 49 379 9735 30529-0.2403 kinase regulator activity molecular function 0.553241 0.575083 3.92157 2 49 379 9735 19207-0.2403 cation binding molecular function 0.541242 0.582025 3.64583 14 370 367 9414 43169-0.2351 metal ion binding molecular function 0.541242 0.582025 3.64583 14 370 367 9414 46872-0.2351 negative regulation of protein transport biological process 0.536043 0.585059 4.34783 1 22 380 9762 51224-0.2328 stress-activated protein kinase signaling pathway biological process 0.536043 0.585059 4.34783 1 22 380 9762 31098-0.2328 DNA replication biological process 0.536043 0.585059 4.34783 1 22 380 9762 45740-0.2328 neuropeptide signaling pathway biological process 0.536043 0.585059 4.34783 1 22 380 9762 7218-0.2328 protein kinase inhibitor activity molecular function 0.536043 0.585059 4.34783 1 22 380 9762 4860-0.2328 regulation of protein localization biological process 0.534915 0.585719 3.84615 2 50 379 9734 32880-0.2323 nucleobase, nucleoside, nucleotide and nucleic acid metabolic process biological process 0.51725 0.596158 3.77358 2 51 379 9733 45935-0.2246

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type transcription biological process 0.51725 0.596158 3.77358 2 51 379 9733 45941-0.2246 regulation of developmental process biological process 0.51725 0.596158 3.77358 2 51 379 9733 50793-0.2246 regulation of caspase activity biological process 0.51725 0.596158 3.77358 2 51 379 9733 43281-0.2246 axon guidance biological process 0.50975 0.600646 4.16667 1 23 380 9761 7411-0.2214 cellular component biological process 0.50975 0.600646 4.16667 1 23 380 9761 51130-0.2214 binding molecular function 0.50975 0.600646 4.16667 1 23 380 9761 50681-0.2214 unsaturated fatty acid metabolic process biological process 0.50975 0.600646 4.16667 1 23 380 9761 33559-0.2214 nucleus biological process 0.50975 0.600646 4.16667 1 23 380 9761 6606-0.2214 RNA splicing factor activity, transesterification mechanism molecular function 0.50975 0.600646 4.16667 1 23 380 9761 31202-0.2214 collagen binding molecular function 0.50975 0.600646 4.16667 1 23 380 9761 5518-0.2214 antigen binding molecular function 0.50975 0.600646 4.16667 1 23 380 9761 3823-0.2214 spliceosomal snrnp biogenesis biological process 0.50975 0.600646 4.16667 1 23 380 9761 387-0.2214 binding molecular function 0.500897 0.605987 3.57143 7 189 374 9595 46914-0.2175 ubiquitin-dependent protein catabolic process biological process 0.500219 0.606398 3.7037 2 52 379 9732 6511-0.2172 intracellular receptormediated signaling biological process 0.500219 0.606398 3.7037 2 52 379 9732 30522-0.2172 regulation of macromolecule metabolic biological process 0.491953 0.611431 3.60963 27 721 354 9063 60255-0.2137 negative regulation of cellular protein metabolic process biological process 0.485077 0.61565 4 1 24 380 9760 32269-0.2107 fibroblast growth factor receptor signaling biological process 0.485077 0.61565 4 1 24 380 9760 8543-0.2107 sulfur metabolic process biological process 0.485077 0.61565 4 1 24 380 9760 6790-0.2107 RNA transport biological process 0.485077 0.61565 4 1 24 380 9760 50658-0.2107 establishment of RNA localization biological process 0.485077 0.61565 4 1 24 380 9760 51236-0.2107 amino acid transmembrane molecular function 0.485077 0.61565 4 1 24 380 9760 15171-0.2107 cell recognition biological process 0.485077 0.61565 4 1 24 380 9760 8037-0.2107 lyase activity biological process 0.485077 0.61565 4 1 24 380 9760 51349-0.2107 cytoplasm cellular component 0.479154 0.619307 3.62776 46 1222 335 8562 5737-0.2081 receptor signaling protein activity molecular function 0.473307 0.622939 3.52941 3 82 378 9702 5057-0.2056 regulation of phosphate metabolic process biological process 0.473307 0.622939 3.52941 3 82 378 9702 19220-0.2056 regulation of phosphorus metabolic process biological process 0.473307 0.622939 3.52941 3 82 378 9702 51174-0.2056 transcription from RNA polymerase II promoter biological process 0.472161 0.623653 3.50877 4 110 377 9674 6366-0.2051 ion binding molecular function 0.470285 0.624824 3.5443 14 381 367 9403 43167-0.2042 modification-dependent protein catabolic process biological process 0.467948 0.626286 3.57143 2 54 379 9730 19941-0.2032 unfolded protein binding molecular function 0.467948 0.626286 3.57143 2 54 379 9730 51082-0.2032 extracellular structure organization biological process 0.467948 0.626286 3.57143 2 54 379 9730 43062-0.2032 regulation of endopeptidase activity biological process 0.467948 0.626286 3.57143 2 54 379 9730 52548-0.2032 regulation of heart contraction biological process 0.461889 0.630092 3.84615 1 25 380 9759 8016-0.2006 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds molecular function 0.461889 0.630092 3.84615 1 25 380 9759 16810-0.2006

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type peptidyl-tyrosine phosphorylation biological process 0.461889 0.630092 3.84615 1 25 380 9759 50731-0.2006 response to unfolded protein biological process 0.461889 0.630092 3.84615 1 25 380 9759 6986-0.2006 cytoplasmic vesicle membrane cellular component 0.461889 0.630092 3.84615 1 25 380 9759 30659-0.2006 damaged DNA binding molecular function 0.461889 0.630092 3.84615 1 25 380 9759 3684-0.2006 aminoglycan metabolic process biological process 0.461889 0.630092 3.84615 1 25 380 9759 6022-0.2006 glycosaminoglycan metabolic process biological process 0.461889 0.630092 3.84615 1 25 380 9759 30203-0.2006 protein targeting biological process 0.461889 0.630092 3.84615 1 25 380 9759 6605-0.2006 transferase activity, transferring pentosyl molecular function 0.461889 0.630092 3.84615 1 25 380 9759 16763-0.2006 regulation of transferase activity biological process 0.458663 0.632128 3.47222 5 139 376 9645 51338-0.1992 development biological process 0.452659 0.635935 3.50877 2 55 379 9729 7517-0.1966 response biological process 0.440069 0.643992 3.7037 1 26 380 9758 6959-0.1911 NFkappaB transcription factor activity biological process 0.440069 0.643992 3.7037 1 26 380 9758 51092-0.1911 neurogenesis biological process 0.440069 0.643992 3.7037 1 26 380 9758 50767-0.1911 Rho protein signal transduction biological process 0.440069 0.643992 3.7037 1 26 380 9758 7266-0.1911 BMP signaling pathway biological process 0.440069 0.643992 3.7037 1 26 380 9758 30509-0.1911 regulation of endocytosis biological process 0.440069 0.643992 3.7037 1 26 380 9758 30100-0.1911 pressure biological process 0.440069 0.643992 3.7037 1 26 380 9758 8217-0.1911 chromatin organization biological process 0.437905 0.645387 3.44828 2 56 379 9728 6325-0.1902 G-protein-coupled receptor binding molecular function 0.437905 0.645387 3.44828 2 56 379 9728 1664-0.1902 transcription repressor activity molecular function 0.437385 0.645723 3.42857 6 169 375 9615 16564-0.19 integral to membrane cellular component 0.428278 0.65163 3.49345 16 442 365 9342 16021-0.186 organism biological process 0.42476 0.653927 3.37079 3 86 378 9698 51707-0.1845 nuclear hormone receptor binding molecular function 0.423662 0.654645 3.38983 2 57 379 9727 35257-0.184 regulation of peptidase activity biological process 0.423662 0.654645 3.38983 2 57 379 9727 52547-0.184 negative regulation of cell migration biological process 0.419507 0.657371 3.57143 1 27 380 9757 30336-0.1822 oxidoreductase activity, acting on the CH-CH of donors molecular function 0.419507 0.657371 3.57143 1 27 380 9757 16627-0.1822 phospholipid biosynthetic process biological process 0.419507 0.657371 3.57143 1 27 380 9757 8654-0.1822 cell projection part cellular component 0.419507 0.657371 3.57143 1 27 380 9757 44463-0.1822 mitochondrial nucleoid cellular component 0.419507 0.657371 3.57143 1 27 380 9757 42645-0.1822 regulation of metabolic process biological process 0.414207 0.660864 3.54458 33 898 348 8886 19222-0.1799 intrinsic to membrane cellular component 0.41268 0.661874 3.47072 16 445 365 9339 31224-0.1792 cellular response to hormone stimulus biological process 0.409911 0.663709 3.33333 2 58 379 9726 32870-0.178 electron carrier activity molecular function 0.409911 0.663709 3.33333 2 58 379 9726 9055-0.178 transferase activity, transferring acyl s molecular function 0.402385 0.668723 3.2967 3 88 378 9696 16746-0.1748 defense response to bacterium biological process 0.400106 0.670249 3.44828 1 28 380 9756 42742-0.1738 lipase activity molecular function 0.400106 0.670249 3.44828 1 28 380 9756 16298-0.1738 regulation of vesiclemediated transport biological process 0.400106 0.670249 3.44828 1 28 380 9756 60627-0.1738 induction of apoptosis by extracellular signals biological process 0.400106 0.670249 3.44828 1 28 380 9756 8624-0.1738 lumen cellular component 0.400106 0.670249 3.44828 1 28 380 9756 70013-0.1738

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value protein processing biological process 0.400106 0.670249 3.44828 1 28 380 9756 16485-0.1738 cell motion biological process 0.396792 0.672474 3.33333 6 174 375 9610 6928-0.1723 regulation of primary metabolic process biological process 0.389099 0.677667 3.31492 6 175 375 9609 80090-0.169 peptide binding molecular function 0.383807 0.681263 3.22581 2 60 379 9724 42277-0.1667 regulation of cell growth biological process 0.381782 0.682644 3.33333 1 29 380 9755 1558-0.1658 external side of plasma membrane cellular component 0.381782 0.682644 3.33333 1 29 380 9755 9897-0.1658 negative regulation of developmental process biological process 0.381782 0.682644 3.33333 1 29 380 9755 51093-0.1658 regulation of cell development biological process 0.381782 0.682644 3.33333 1 29 380 9755 60284-0.1658 cell-matrix adhesion biological process 0.381782 0.682644 3.33333 1 29 380 9755 7160-0.1658 regulation of stressactivated protein kinase signaling pathway biological process 0.381782 0.682644 3.33333 1 29 380 9755 70302-0.1658 activity biological process 0.381782 0.682644 3.33333 1 29 380 9755 187-0.1658 sodium ion transport biological process 0.381782 0.682644 3.33333 1 29 380 9755 6814-0.1658 regulation of signal transduction biological process 0.379945 0.683899 3.34572 9 260 372 9524 9966-0.165 regulation of cell communication biological process 0.379945 0.683899 3.34572 9 260 372 9524 10646-0.165 induction of apoptosis biological process 0.370914 0.690103 3.24675 5 149 376 9635 6917-0.1611 negative regulation of cell motion biological process 0.364457 0.694574 3.22581 1 30 380 9754 51271-0.1583 protein phosphatase regulator activity molecular function 0.364457 0.694574 3.22581 1 30 380 9754 19888-0.1583 phosphorus metabolic process biological process 0.364457 0.694574 3.22581 1 30 380 9754 6793-0.1583 phosphate metabolic process biological process 0.364457 0.694574 3.22581 1 30 380 9754 6796-0.1583 nuclear membrane cellular component 0.364457 0.694574 3.22581 1 30 380 9754 31965-0.1583 lumen cellular component 0.364457 0.694574 3.22581 1 30 380 9754 31093-0.1583 phosphoinositide binding molecular function 0.364457 0.694574 3.22581 1 30 380 9754 35091-0.1583 specific RNA polymerase II transcription factor molecular function 0.364457 0.694574 3.22581 1 30 380 9754 3704-0.1583 translation initiation factor activity molecular function 0.364457 0.694574 3.22581 1 30 380 9754 3743-0.1583 activity biological process 0.364457 0.694574 3.22581 1 30 380 9754 60191-0.1583 transcription corepressor activity molecular function 0.36109 0.696916 3.15789 3 92 378 9692 3714-0.1568 regulation of nitrogen compound metabolic process biological process 0.359449 0.698061 3.125 2 62 379 9722 51171-0.1561 nitrogen compound metabolic process biological process 0.359449 0.698061 3.125 2 62 379 9722 51173-0.1561 magnesium ion binding molecular function 0.359449 0.698061 3.125 2 62 379 9722 287-0.1561 hormone receptor binding molecular function 0.359449 0.698061 3.125 2 62 379 9722 51427-0.1561 oxidoreductase activity, acting on the CH-OH of donors, NAD or NADP as acceptor molecular function 0.359449 0.698061 3.125 2 62 379 9722 16616-0.1561 tissue development biological process 0.355718 0.70067 3.1746 4 122 377 9662 9888-0.1545 protein serine/threonine phosphatase activity molecular function 0.348059 0.706057 3.125 1 31 380 9753 4722-0.1512 phosphatase regulator activity molecular function 0.348059 0.706057 3.125 1 31 380 9753 19208-0.1512 cytoskeleton organization biological process 0.348059 0.706057 3.125 1 31 380 9753 7010-0.1512 chromatin remodeling biological process 0.348059 0.706057 3.125 1 31 380 9753 6338-0.1512 regulation of translation biological process 0.348059 0.706057 3.125 1 31 380 9753 6417-0.1512 cytoplasmic vesicle part cellular component 0.347881 0.706183 3.07692 2 63 379 9721 44433-0.1511 transcription regulator activity molecular function 0.337288 0.713703 3.44828 30 840 351 8944 30528-0.1465

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type central nervous system development biological process 0.336703 0.714121 3.0303 2 64 379 9720 7417-0.1462 cell surface receptor linked signal transduction biological process 0.333814 0.716187 3.38409 20 571 361 9213 7166-0.145 growth factor binding molecular function 0.332527 0.717109 3.0303 1 32 380 9752 19838-0.1444 specific transcription from RNA polymerase II promoter biological process 0.332527 0.717109 3.0303 1 32 380 9752 10552-0.1444 regulation of peptidyltyrosine phosphorylation biological process 0.332527 0.717109 3.0303 1 32 380 9752 50730-0.1444 transferase activity, transferring alkyl or aryl (other than methyl) molecular function 0.332527 0.717109 3.0303 1 32 380 9752 16765-0.1444 cytoplasmic membranebounded vesicle lumen cellular component 0.332527 0.717109 3.0303 1 32 380 9752 60205-0.1444 activity molecular function 0.331006 0.718201 3.33333 15 435 366 9349 3700-0.1438 Golgi apparatus cellular component 0.329788 0.719076 3.19635 7 212 374 9572 5794-0.1432 protein amino acid glycosylation biological process 0.325896 0.72188 2.98507 2 65 379 9719 6486-0.1415 zinc ion binding molecular function 0.319083 0.726815 3.10559 5 156 376 9628 8270-0.1386 steroid hormone receptor binding molecular function 0.317802 0.727747 2.94118 1 33 380 9751 35258-0.138 general RNA polymerase II transcription factor molecular function 0.317802 0.727747 2.94118 1 33 380 9751 16251-0.138 regulation of hydrolase activity biological process 0.315788 0.729214 3.05344 4 127 377 9657 51336-0.1371 negative regulation of apoptosis biological process 0.312253 0.731796 3.08642 5 157 376 9627 43066-0.1356 cellular developmental process biological process 0.311878 0.732071 3.15315 7 215 374 9569 48869-0.1354 activity biological process 0.308331 0.734672 3.0303 4 128 377 9656 43549-0.1339 complex cellular component 0.305351 0.736865 2.89855 2 67 379 9717 5667-0.1326 response to cytokine stimulus biological process 0.30383 0.737986 2.85714 1 34 380 9750 34097-0.132 regulation of lymphocyte activation biological process 0.30383 0.737986 2.85714 1 34 380 9750 51249-0.132 cytosolic large ribosomal subunit cellular component 0.30383 0.737986 2.85714 1 34 380 9750 22625-0.132 mrna binding molecular function 0.30383 0.737986 2.85714 1 34 380 9750 3729-0.132 viral reproductive process biological process 0.30383 0.737986 2.85714 1 34 380 9750 22415-0.132 regulation of cellular response to stress biological process 0.30383 0.737986 2.85714 1 34 380 9750 80135-0.132 ligand-gated ion channel activity molecular function 0.30383 0.737986 2.85714 1 34 380 9750 15276-0.132 ligand-gated channel activity molecular function 0.30383 0.737986 2.85714 1 34 380 9750 22834-0.132 protein maturation biological process 0.30383 0.737986 2.85714 1 34 380 9750 51604-0.132 cell-cell adhesion biological process 0.298646 0.741822 2.94118 3 99 378 9685 16337-0.1297 cell adhesion biological process 0.298099 0.742228 3.19489 10 303 371 9481 7155-0.1295 cellular protein complex assembly biological process 0.295585 0.744096 2.85714 2 68 379 9716 43623-0.1284 biological adhesion biological process 0.29335 0.745761 3.18471 10 304 371 9480 22610-0.1274 negative regulation of programmed cell death biological process 0.292569 0.746344 3.0303 5 160 376 9624 43069-0.1271 negative regulation of cell death biological process 0.292569 0.746344 3.0303 5 160 376 9624 60548-0.1271 soluble fraction cellular component 0.292569 0.746344 3.0303 5 160 376 9624 5625-0.1271 regulation of transforming growth factor beta receptor signaling biological process 0.290566 0.74784 2.77778 1 35 380 9749 17015-0.1262 cell migration biological process 0.290566 0.74784 2.77778 1 35 380 9749 30335-0.1262 anatomical structure morphogenesis biological process 0.289357 0.748745 3.09735 7 219 374 9565 9653-0.1257

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type small GTPase mediated signal transduction biological process 0.28284 0.75364 2.88462 3 101 378 9683 7264-0.1228 synaptic transmission biological process 0.280139 0.755679 2.94118 4 132 377 9652 7268-0.1217 negative regulation of cell proliferation biological process 0.280092 0.755714 2.99401 5 162 376 9622 8285-0.1216 anatomical structure formation involved in morphogenesis biological process 0.277963 0.757325 2.7027 1 36 380 9748 48646-0.1207 transcription factor biological process 0.277963 0.757325 2.7027 1 36 380 9748 51091-0.1207 serine-type endopeptidase inhibitor molecular function 0.277963 0.757325 2.7027 1 36 380 9748 4867-0.1207 cell-substrate adhesion biological process 0.277963 0.757325 2.7027 1 36 380 9748 31589-0.1207 amine metabolic process biological process 0.277963 0.757325 2.7027 1 36 380 9748 9308-0.1207 process biological process 0.277963 0.757325 2.7027 1 36 380 9748 51186-0.1207 regulation of response to stress biological process 0.277963 0.757325 2.7027 1 36 380 9748 80134-0.1207 regulation of cellular protein metabolic process biological process 0.277963 0.757325 2.7027 1 36 380 9748 32268-0.1207 blood circulation biological process 0.277963 0.757325 2.7027 1 36 380 9748 8015-0.1207 histone acetylation biological process 0.277963 0.757325 2.7027 1 36 380 9748 16573-0.1207 protein metabolic process biological process 0.277963 0.757325 2.7027 1 36 380 9748 19538-0.1207 cytoskeleton cellular component 0.266477 0.766074 3 6 194 375 9590 5856-0.1157 microtubule binding molecular function 0.265981 0.766454 2.63158 1 37 380 9747 8017-0.1155 cytokine-mediated signaling pathway biological process 0.265981 0.766454 2.63158 1 37 380 9747 19221-0.1155 cellular protein metabolic biological process 0.265981 0.766454 2.63158 1 37 380 9747 32270-0.1155 MAP kinase activity biological process 0.265981 0.766454 2.63158 1 37 380 9747 43406-0.1155 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen molecular function 0.254581 0.775241 2.5641 1 38 380 9746 16705-0.1106 oxidoreductase activity, acting on NADH or NADPH, quinone or similar compound as molecular function 0.254581 0.775241 2.5641 1 38 380 9746 16655-0.1106 glycerolipid metabolic process biological process 0.254581 0.775241 2.5641 1 38 380 9746 46486-0.1106 regulation of multicellular organismal process biological process 0.248643 0.779858 2.99145 7 227 374 9557 51239-0.108 integrin binding molecular function 0.243732 0.783698 2.5 1 39 380 9745 5178-0.1059 regulation of lipid metabolic process biological process 0.243732 0.783698 2.5 1 39 380 9745 19216-0.1059 negative regulation of cell cycle biological process 0.243732 0.783698 2.5 1 39 380 9745 45786-0.1059 process biological process 0.243732 0.783698 2.5 1 39 380 9745 19318-0.1059 female pregnancy biological process 0.243732 0.783698 2.5 1 39 380 9745 7565-0.1059 brain development biological process 0.243732 0.783698 2.5 1 39 380 9745 7420-0.1059 transferase activity, transferring sulfurcontaining s molecular function 0.243732 0.783698 2.5 1 39 380 9745 16782-0.1059 process biological process 0.243732 0.783698 2.5 1 39 380 9745 3013-0.1059 ribonucleoprotein complex biogenesis biological process 0.243732 0.783698 2.5 1 39 380 9745 22613-0.1059 cell motion biological process 0.243732 0.783698 2.5 1 39 380 9745 51272-0.1059 transcription, DNAdependent biological process 0.236575 0.789327 2.7972 4 139 377 9645 6351-0.1027 macromolecular complex cellular component 0.235612 0.790087 2.5974 2 75 379 9709 32991-0.1023 protein complex cellular component 0.235612 0.790087 2.5974 2 75 379 9709 43234-0.1023 regulation of cell differentiation biological process 0.235612 0.790087 2.5974 2 75 379 9709 45595-0.1023

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type transcription activator activity molecular function 0.234756 0.790764 2.95359 7 230 374 9554 16563-0.102 chromatin modification biological process 0.2334 0.791837 2.43902 1 40 380 9744 16568-0.1014 innate immune response biological process 0.2334 0.791837 2.43902 1 40 380 9744 45087-0.1014 carboxylic acid transmembrane transporter activity molecular function 0.223555 0.799671 2.38095 1 41 380 9743 46943-0.0971 ATPase activity, coupled to transmembrane movement of substances molecular function 0.223555 0.799671 2.38095 1 41 380 9743 42626-0.0971 ribonucleoprotein complex assembly biological process 0.223555 0.799671 2.38095 1 41 380 9743 22618-0.0971 phosphatase activity molecular function 0.221243 0.801522 2.65487 3 110 378 9674 16791-0.0961 anatomical structure development biological process 0.218915 0.80339 3.19489 20 606 361 9178 48856-0.0951 lipid binding molecular function 0.215262 0.80633 2.63158 3 111 378 9673 8289-0.0935 isomerase activity molecular function 0.21417 0.807211 2.32558 1 42 380 9742 16853-0.093 regulation of protein amino acid biological process 0.21417 0.807211 2.32558 1 42 380 9742 1932-0.093 sensory perception of chemical stimulus biological process 0.21417 0.807211 2.32558 1 42 380 9742 7606-0.093 organic acid transmembrane transporter activity molecular function 0.21417 0.807211 2.32558 1 42 380 9742 5342-0.093 exopeptidase activity molecular function 0.21417 0.807211 2.32558 1 42 380 9742 8238-0.093 cellular component biogenesis biological process 0.21417 0.807211 2.32558 1 42 380 9742 44085-0.093 nucleobase, nucleoside and nucleotide metabolic process biological process 0.213854 0.807466 2.5 2 78 379 9706 55086-0.0929 intracellular cellular component 0.209463 0.81102 2.7027 4 144 377 9640 5622-0.091 transmembrane transporter activity molecular function 0.203769 0.815651 2.58621 3 113 378 9671 22857-0.0885 regulation of leukocyte activation biological process 0.196682 0.821452 2.22222 1 44 380 9740 2694-0.0854 protein amino acid phosphorylation biological process 0.191758 0.825507 2.77778 6 210 375 9574 6468-0.0833 multi-organism process biological process 0.189908 0.827035 2.63158 4 148 377 9636 51704-0.0825 regulation of protein transport biological process 0.188532 0.828174 2.17391 1 45 380 9739 51223-0.0819 translation factor activity, nucleic acid binding molecular function 0.188532 0.828174 2.17391 1 45 380 9739 8135-0.0819 nervous system development biological process 0.187969 0.82864 2.7027 5 180 376 9604 7399-0.0816 immune response biological process 0.182969 0.832794 2.84698 8 273 373 9511 6955-0.0795 fatty acid metabolic process biological process 0.180751 0.834643 2.12766 1 46 380 9738 6631-0.0785 ATPase activity, coupled to movement of molecular function 0.180751 0.834643 2.12766 1 46 380 9738 43492-0.0785 anti-apoptosis biological process 0.172733 0.841362 2.45902 3 119 378 9665 6916-0.075 transferase activity, transferring glycosyl molecular function 0.172733 0.841362 2.45902 3 119 378 9665 16757-0.075 kinase binding molecular function 0.170636 0.843128 2.29885 2 85 379 9699 19900-0.0741 transferase activity, transferring hexosyl molecular function 0.170636 0.843128 2.29885 2 85 379 9699 16758-0.0741 endosome cellular component 0.170636 0.843128 2.29885 2 85 379 9699 5768-0.0741 GTPase activity molecular function 0.168025 0.845333 2.43902 3 120 378 9664 3924-0.073 sugar binding molecular function 0.166216 0.846863 2.04082 1 48 380 9736 5529-0.0722 regulation of lyase activity biological process 0.166216 0.846863 2.04082 1 48 380 9736 51339-0.0722 negative regulation of RNA metabolic process biological process 0.163768 0.848939 2.53165 4 154 377 9630 51253-0.0711 post-translational protein modification biological process 0.160131 0.852032 2.9661 14 458 367 9326 43687-0.0695 regulation of cell motion biological process 0.159982 0.852159 2.24719 2 87 379 9697 51270-0.0695

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type regulation of establishment of protein biological process 0.15943 0.85263 2 1 49 380 9735 70201-0.0692 carboxylic acid metabolic process biological process 0.15943 0.85263 2 1 49 380 9735 19752-0.0692 cellular ketone metabolic process biological process 0.15943 0.85263 2 1 49 380 9735 42180-0.0692 process biological process 0.15943 0.85263 2 1 49 380 9735 43436-0.0692 binding molecular function 0.15943 0.85263 2 1 49 380 9735 47485-0.0692 developmental process biological process 0.153046 0.85809 3.23404 38 1137 343 8647 32502-0.0665 guanyl-nucleotide exchange factor activity molecular function 0.15294 0.858181 1.96078 1 50 380 9734 5085-0.0664 elevation of cytosolic calcium ion concentration biological process 0.15294 0.858181 1.96078 1 50 380 9734 7204-0.0664 regulation of RNA metabolic process biological process 0.151691 0.859254 3.04 19 606 362 9178 51252-0.0659 protein kinase activity biological process 0.149993 0.860714 2.1978 2 89 379 9695 45860-0.0651 muscle contraction biological process 0.149993 0.860714 2.1978 2 89 379 9695 6936-0.0651 binding molecular function 0.146734 0.863524 1.92308 1 51 380 9733 5539-0.0637 response to virus biological process 0.146734 0.863524 1.92308 1 51 380 9733 9615-0.0637 activation biological process 0.146734 0.863524 1.92308 1 51 380 9733 50865-0.0637 peroxisome cellular component 0.146734 0.863524 1.92308 1 51 380 9733 5777-0.0637 microbody cellular component 0.146734 0.863524 1.92308 1 51 380 9733 42579-0.0637 cellular carbohydrate metabolic process biological process 0.144607 0.865362 2.45399 4 159 377 9625 44262-0.0628 binding molecular function 0.14309 0.866676 2.53807 5 192 376 9592 8092-0.0621 regulation of protein kinase activity biological process 0.138359 0.870786 2.30769 3 127 378 9657 45859-0.0601 RNA processing biological process 0.13755 0.871491 2.42424 4 161 377 9623 6396-0.0597 polysaccharide binding molecular function 0.135117 0.873614 1.85185 1 53 380 9731 30247-0.0587 lytic vacuole cellular component 0.135117 0.873614 1.85185 1 53 380 9731 323-0.0587 lysosome cellular component 0.135117 0.873614 1.85185 1 53 380 9731 5764-0.0587 muscle system process biological process 0.131839 0.876482 2.10526 2 93 379 9691 3012-0.0573 response to organic substance biological process 0.129681 0.878376 1.81818 1 54 380 9730 10033-0.0563 transmembrane receptor protein serine/threonine kinase signaling pathway biological process 0.129681 0.878376 1.81818 1 54 380 9730 7178-0.0563 cytosolic calcium ion homeostasis biological process 0.129681 0.878376 1.81818 1 54 380 9730 51480-0.0563 ion transport biological process 0.128058 0.879802 2.55319 6 229 375 9555 6811-0.0556 transcription coactivator activity molecular function 0.127567 0.880234 2.38095 4 164 377 9620 3713-0.0554 monosaccharide metabolic process biological process 0.124475 0.88296 1.78571 1 55 380 9729 5996-0.0541 oxidoreductase activity, acting on NADH or molecular function 0.124475 0.88296 1.78571 1 55 380 9729 16651-0.0541 process biological process 0.120241 0.886707 2.64026 8 295 373 9489 44238-0.0522 secretion by cell biological process 0.119492 0.887371 1.75439 1 56 380 9728 32940-0.0519 mitochondrial matrix cellular component 0.119492 0.887371 1.75439 1 56 380 9728 5759-0.0519 intrinsic to organelle membrane cellular component 0.11472 0.891616 1.72414 1 57 380 9727 31300-0.0498 integral to organelle membrane cellular component 0.11472 0.891616 1.72414 1 57 380 9727 31301-0.0498 RNA metabolic process biological process 0.113387 0.892805 2.61438 8 298 373 9486 16070-0.0492 stress biological process 0.110148 0.895702 1.69492 1 58 380 9726 6979-0.0478 regulation of cellular localization biological process 0.110148 0.895702 1.69492 1 58 380 9726 60341-0.0478 activity molecular function 0.109016 0.896716 2.5974 8 300 373 9484 5198-0.0473 GTPase activator activity molecular function 0.105767 0.899634 1.66667 1 59 380 9725 5096-0.0459 transcription initiation from RNA polymerase II promoter biological process 0.105767 0.899634 1.66667 1 59 380 9725 6367-0.0459 carbohydrate binding molecular function 0.105164 0.900177 1.96078 2 100 379 9684 30246-0.0457

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value potassium ion transport biological process 0.0975467 0.90706 1.6129 1 61 380 9723 6813-0.0424 transcription from RNA polymerase II promoter biological process 0.0954355 0.908977 1.90476 2 103 379 9681 45944-0.0414 vacuole cellular component 0.09369 0.910565 1.5873 1 62 380 9722 5773-0.0407 cyclic-nucleotidemediated signaling biological process 0.0899925 0.913938 1.5625 1 63 380 9721 19935-0.0391 protein folding biological process 0.0899925 0.913938 1.5625 1 63 380 9721 6457-0.0391 voltage-gated cation channel activity molecular function 0.0899925 0.913938 1.5625 1 63 380 9721 22843-0.0391 visual perception biological process 0.08945 0.914434 1.86916 2 105 379 9679 7601-0.0388 sensory perception of light stimulus biological process 0.08945 0.914434 1.86916 2 105 379 9679 50953-0.0388 cell surface cellular component 0.0865966 0.917047 1.85185 2 106 379 9678 9986-0.0376 regulation of system process biological process 0.0830469 0.920308 1.51515 1 65 380 9719 44057-0.0361 activity molecular function 0.0830469 0.920308 1.51515 1 65 380 9719 45182-0.0361 process biological process 0.0797848 0.923315 1.49254 1 66 380 9718 6066-0.0347 structural constituent of cytoskeleton molecular function 0.0797848 0.923315 1.49254 1 66 380 9718 5200-0.0347 transcription initiation biological process 0.0797848 0.923315 1.49254 1 66 380 9718 6352-0.0347 cell communication biological process 0.0789599 0.924077 2.52101 9 348 372 9436 7154-0.0343 lymphocyte activation biological process 0.0766564 0.926208 1.47059 1 67 380 9717 46649-0.0333 transcription, DNAdependent biological process 0.0745415 0.928169 2.1164 4 185 377 9599 45893-0.0324 cellular protein metabolic process biological process 0.0743508 0.928346 2.88582 23 774 358 9010 44267-0.0323 carbohydrate metabolic process biological process 0.0736541 0.928993 1.44928 1 68 380 9716 5975-0.032 immune system process biological process 0.0736218 0.929023 1.76991 2 111 379 9673 2376-0.032 process biological process 0.0729503 0.929647 3.22101 65 1953 316 7831 44237-0.0317 negative regulation of transcription, DNAdependent biological process 0.0722729 0.930277 1.96078 3 150 378 9634 45892-0.0314 protein kinase binding molecular function 0.0707745 0.931672 1.42857 1 69 380 9715 19901-0.0307 histone modification biological process 0.0707745 0.931672 1.42857 1 69 380 9715 16570-0.0307 RNA metabolic process biological process 0.0707584 0.931687 2.09424 4 187 377 9597 51254-0.0307 cytoplasmic part cellular component 0.0684834 0.933809 3.16092 55 1685 326 8099 44444-0.0297 enzyme linked receptor protein signaling pathway biological process 0.066314 0.935837 1.92308 3 153 378 9631 7167-0.0288 establishment of localization biological process 0.0642548 0.937766 2.88018 25 843 356 8941 51234-0.0279 protein kinase cascade biological process 0.0586095 0.943075 1.66667 2 118 379 9666 7243-0.0255 plasma membrane cellular component 0.0564508 0.945113 2.79898 22 764 359 9020 5886-0.0245 regulation of localization biological process 0.055776 0.945751 1.85185 3 159 378 9625 32879-0.0242 cellular amino acid metabolic process biological process 0.0557664 0.94576 1.31579 1 75 380 9709 6520-0.0242 cellular amine metabolic process biological process 0.0557664 0.94576 1.31579 1 75 380 9709 44106-0.0242 signal transducer activity molecular function 0.0556861 0.945836 2.83019 24 824 357 8960 4871-0.0242 molecular transducer activity molecular function 0.0556861 0.945836 2.83019 24 824 357 8960 60089-0.0242 neurological system process biological process 0.0539083 0.947519 2.10084 5 233 376 9551 50877-0.0234 transport biological process 0.0528703 0.948503 2.52101 12 464 369 9320 6810-0.023 Ras protein signal transduction biological process 0.051526 0.949779 1.28205 1 77 380 9707 7265-0.0224 actin cytoskeleton organization biological process 0.051526 0.949779 1.28205 1 77 380 9707 30036-0.0224 cell fraction cellular component 0.0513154 0.949979 2.54902 13 497 368 9287 267-0.0223 homeostatic process biological process 0.0509776 0.9503 2.17391 6 270 375 9514 42592-0.0221 mitochondrion cellular component 0.0509776 0.9503 2.17391 6 270 375 9514 5739-0.0221

Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value function type regulation of biological quality biological process 0.0503369 0.950909 2.42131 10 403 371 9381 65008-0.0219 enzyme binding molecular function 0.0498028 0.951417 2.16606 6 271 375 9513 19899-0.0216 membrane organization biological process 0.0495306 0.951676 1.26582 1 78 380 9706 16044-0.0215 cell-cell signaling biological process 0.0460659 0.954979 2.28571 8 342 373 9442 7267-0.02 membrane fraction cellular component 0.0460659 0.954979 2.28571 8 342 373 9442 5624-0.02 transmembrane receptor activity molecular function 0.0456304 0.955395 2.47934 12 472 369 9312 4888-0.0198 cell death biological process 0.0451062 0.955896 1.5625 2 126 379 9658 8219-0.0196 death biological process 0.0451062 0.955896 1.5625 2 126 379 9658 16265-0.0196 GTPase regulator activity molecular function 0.0436489 0.95729 1.55039 2 127 379 9657 30695-0.019 cellular calcium ion homeostasis biological process 0.0423075 0.958575 1.20482 1 82 380 9702 6874-0.0184 protein complex binding molecular function 0.0406751 0.960141 1.19048 1 83 380 9701 32403-0.0177 calcium ion homeostasis biological process 0.0406751 0.960141 1.19048 1 83 380 9701 55074-0.0177 organ development biological process 0.0404773 0.960331 1.7341 3 170 378 9614 48513-0.0176 membrane cellular component 0.0399755 0.960813 2.75545 24 847 357 8937 16020-0.0174 regulation of cellular metabolic process biological process 0.0393065 0.961456 1.72414 3 171 378 9613 31323-0.0171 nucleosidetriphosphatase regulator molecular function 0.038268 0.962455 1.50376 2 131 379 9653 60589-0.0166 process biological process 0.0376634 0.963037 2.53378 15 577 366 9207 6464-0.0164 intracellular protein transport biological process 0.0376011 0.963097 1.16279 1 85 380 9699 6886-0.0163 insoluble fraction cellular component 0.0363508 0.964302 2.21607 8 353 373 9431 5626-0.0158 transmembrane receptor protein tyrosine kinase signaling pathway biological process 0.0347633 0.965834 1.13636 1 87 380 9697 7169-0.0151 metal ion transport biological process 0.0346629 0.965931 1.47059 2 134 379 9650 30001-0.0151 leukocyte activation biological process 0.0334265 0.967126 1.1236 1 88 380 9696 45321-0.0145 translational elongation biological process 0.0334265 0.967126 1.1236 1 88 380 9696 6414-0.0145 actin binding molecular function 0.0309078 0.969565 1.0989 1 90 380 9694 3779-0.0134 actin filament-based process biological process 0.0309078 0.969565 1.0989 1 90 380 9694 30029-0.0134 cognition biological process 0.0292774 0.971147 1.78571 4 220 377 9564 50890-0.0127 system process biological process 0.0273136 0.973056 2.13904 8 366 373 9418 3008-0.0119 transport biological process 0.0235082 0.976766 1.02041 1 97 380 9687 16192-0.0102 organ morphogenesis biological process 0.0235082 0.976766 1.02041 1 97 380 9687 9887-0.0102 cytosolic part cellular component 0.0201119 0.980089 0.98039 1 101 380 9683 44445-0.0087 multicellular organismal process biological process 0.0194877 0.980701 2.22672 11 483 370 9301 32501-0.0085 di-, tri-valent inorganic cation homeostasis biological process 0.0193429 0.980843 0.97087 1 102 380 9682 55066-0.0084 apoptosis biological process 0.0178931 0.982266 0.95238 1 104 380 9680 6915-0.0078 endoplasmic reticulum cellular component 0.017772 0.982385 1.65289 4 238 377 9546 5783-0.0077 cell projection cellular component 0.0172092 0.982938 0.9434 1 105 380 9679 42995-0.0075 intrinsic to plasma membrane cellular component 0.0168746 0.983267 2.589 24 903 357 8881 31226-0.0073 sensory perception biological process 0.0160257 0.984102 1.47059 3 201 378 9583 7600-0.007 cation channel activity molecular function 0.0159201 0.984206 0.92593 1 107 380 9677 5261-0.0069 programmed cell death biological process 0.0153126 0.984804 0.91743 1 108 380 9676 12501-0.0067 receptor activity molecular function 0.0134896 0.986601 2.31481 15 633 366 9151 4872-0.0059 integral to plasma membrane cellular component 0.0128127 0.987269 2.52193 23 889 358 8895 5887-0.0056 establishment of localization in cell biological process 0.012352 0.987724 1.79641 6 328 375 9456 51649-0.0054 regulation of transport biological process 0.0121252 0.987948 0.86957 1 114 380 9670 51049-0.0053 multicellular organismal development biological process 0.0090771 0.990964 1.13636 2 174 379 9610 7275-0.0039 metal ion transmembrane transporter activity molecular function 0.0085464 0.99149 0.80645 1 123 380 9661 46873-0.0037 cation homeostasis biological process 0.0082207 0.991813 0.8 1 124 380 9660 55080-0.0036 cation transport biological process 0.0071515 0.992874 1.0929 2 181 379 9603 6812-0.0031

function type Enrichmen t Score Enrichmen t p-value % genes in that are present in list, in list, in in list, list, not GO in neg log p-value ion homeostasis biological process 0.0067699 0.993253 0.76923 1 129 380 9655 50801-0.0029 protein domain specific binding molecular function 0.0062636 0.993756 0.75758 1 131 380 9653 19904-0.0027 mitochondrial part cellular component 0.0062374 0.993782 1.06952 2 185 379 9599 44429-0.0027 intracellular transport biological process 0.0054579 0.994557 1.41343 4 279 377 9505 46907-0.0024 cation transmembrane transporter activity molecular function 0.0053624 0.994652 0.73529 1 135 380 9649 8324-0.0023 cellular lipid metabolic process biological process 0.0045795 0.995431 1.02041 2 194 379 9590 44255-0.002 receptor binding molecular function 0.0024831 0.99752 1.68776 8 466 373 9318 5102-0.0011 ion transmembrane transporter activity molecular function 0.0008974 0.999103 0.54945 1 181 380 9603 15075-0.0004 transporter activity molecular function 0.0008954 0.999105 1.55945 8 505 373 9279 5215-0.0004 substrate-specific transmembrane transporter activity molecular function 0.0004691 0.999531 0.76628 2 259 379 9525 22891-0.0002 substrate-specific transporter activity molecular function 0.0003751 0.999625 0.93458 3 318 378 9466 22892-0.0002 membrane part cellular component 0.0003381 0.999662 2.46846 45 1778 336 8006 44425-0.0001 chemical homeostasis biological process 0.000258 0.999742 0.46729 1 213 380 9571 48878-0.0001 plasma membrane part cellular component 6.10E-05 0.999939 1.9984 25 1226 356 8558 44459-3E-05

a Adr (µg/ml) RRM2B RRM2 RRM1 p53 MDM2 0 0.010.05 0.1 0.2 p21 CIP1 β-actin b shrna Adr p53 shtp53 None NS A B C - + - + - + - + - + c shrna Adr Cyclin E shrb1 None NS A B C - + - + - + - + - + p21 CIP1 CDK4 RRM2B RRM2B CDK4 p21 CIP1 β-actin β-actin Supplementary Figure S1. Acute induction of RRM2B by Adriamycin depends on p53. (a) Western blot analysis of proteins in IMR90 cells treated with various doses of Adriamycin (Adr) as indicated for 24 hours. (b, c) Western blot analysis of IMR90 cells expressing empty vector, scramble non-silencing (NS) shrna or three (b) shtp53s or (c) shrb1s. Transduced cells were treated with 0.2 µg/ml Adr for 24 hours (+) or left untreated (-) one week following retroviral infection.

a % SA-β-gal (+) 100 80 60 40 20 p<0.0001 EP LP b 0 EP LP 80 p<0.0001 % SA-β-gal (+) 60 40 20 Ctrl Adr c 0 100 Ctrl p=0.0049 Adr % SA-β-gal (+) 80 60 40 20 Ctrl RAS- V12 0 Ctrl RASV12 Supplementary Figure S2. Induction of senescence in IMR90 cells. Senescence associated beta-galactosidase (SA-β-gal) activity was analyzed in (a) early passage (EP) or late passage (LP) IMR90 cells, (b) EP IMR90 cells that were treated with 0.1 µg/ml Adriamycin (Adr) for one week or left untreated (ctrl) or (c) EP IMR90 cells that were transduced with retroviruses expressing empty vector (Ctrl) or RASV12. SA-β-gal-positive cells from at least 100 cells were scored, and the values were plotted as the percentage of SA-β-gal-positive cells. The data are presented as the means±sem (n=3). Representative pictures from all samples are shown in the right panels.

MOI Virus p21 CIP1 Ctrl 1x 1/10 p21 CIP1 Ctrl p21 CIP1 RRM2B RRM2 RRM1 β-actin %S 33 5 32 4 Supplementary Figure S3. RRM2B expression is fluenced by p21 CIP1 -induced cell cycle arrest. IMR90 cells were infected with either stock (1x) or diluted (1/10) retroviral supernatant. Four days following infection, cells expressing empty vector (Ctrl) or p21 CIP1 were harvested for immunoblotting and cell cycle analysis. Top: Western blots; bottom: percentage of cells in S phase. MOI: multiplicity of infection.

HMW KARATIN p63 100 µm 100 µm Supplementary Figure S4. Positive staining of cytoplasmic HMW KARATIN and nuclear p63 in the basal cell layer in PIN lesions. Immunocytochemistry for HMW KARATIN (left panel) and p63 (right panel) was performed to detect the intact basal cell layer surrounding the PIN lesion.

shrna - NS RRM2B-C RRM2B-C-mut RRM2B β-actin RRM2B-C RRM2B-C-mut CAGCAGAGATGAAGGACTT CAGCAGAGCGCAAGGACTT Supplementary Figure S5. Point mutations in prevent the silencing of RRM2B. IMR90 cells were infected with psuper.retro.puro retroviruses expressing empty vector (-), non-silencing (NS) shrna, -C or -C-mut. Top: Western blots, β-actin was used as a loading control; bottom: alignment of -C and -C-mut sense strand sequences. Mutated nucleotides in -C-mut are underlined.

a shrna +Dox (Days) - NS A B C D 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 RRM2B β-actin b shrna Dox RRM2B RAS - NS RRM2B-D - + - + - + c % SA-β-gal (+) 100 80 60 40 20 β-actin 0 DOX shrna - + - + - + - - NS NS RRM2B-D Supplementary Figure S6. Silencing of RRM2B does fluence RASV12-induced senescence. (a) Western blot analysis of RRM2B and β-actin in IMR90 cells transduced with ptripz lentiviruses expressing tetracycline-inducible non-silencing (NS) shrna, four different RRM2B shrnas or vector alone (-). Puromycin-resistant transduced cells were incubated with 1 µg/ml doxycyclin (Dox) and harvested from day 0-3. (b) Western blot analysis of RRM2B, RAS and β-actin in IMR90 cells transduced with ptripz lentiviruses expressing empty vector (-), shns or -D. Each cell strain was re-infected with retrovirus expressing RASV12. Two days following infection, cells were treated with 1 µg/ml Dox for 12 days. Immunoblotting confirmed the expression of RASV12 in all samples. Silencing of RRM2B was only detected in ptripz--d-infected cells that were treated with 1 µg/ml Dox. (c) SA-β-gal activity was measured in cultures as described in (b) (means±sem, n=3). There was no statistically significant difference between the RRM2B-silenced cells and any of the five non-silencing controls.

a Time (hr) RRM2B β-actin 0 0.5 1 2 4 6 10 20 24 48 96 b 30 p=0.0001 % SA-β-gal (+) 20 10 0 Control H O 2 2 Supplementary Figure S7. Induction of RRM2B and senescence by transient treatment of IMR90 cells with H 2 O 2. (a) IMR90 cells were treated with 200 µm H 2 O 2 for two hours. Following treatment, cells were washed and fed with fresh media. Samples were harvested at time points up to 96 hours. Expression of RRM2B and β-actin was detected by immunoblotting. (b) SA-β-gal activity was measured five days following the transient treatment with H 2 O 2 (means±sem, n=3).

a shrna Dox RRM2B β-actin - NS RRM2B - + - + - + b 1.2 p=0.2230 p=0.0820 p=0.0005 Relative mtdna content 1.0 0.8 0.6 0.4 0.2 0.0 Dox - + - + - + shrna - NS RRM2B Supplementary Figure S8. Reduction of mtdna content by silencing of RRM2B. IMR90 cells were transduced with ptripz lentiviruses expressing vector alone, shns or (-C as described in Figure S6). Transduced cells were either cultured in doxycyclin (Dox) for 2 weeks (+) or left untreated (-). (a) Western blot analysis of RRM2B and the loading control β-actin. (b) Relative mtdna DNA content was quantified by comparing the level of the mitochondrial COX-1 gene relative to that of the nuclear β-globin gene using quantitative real-time PCR. The COX-1/β-GLOBIN DNA ratio in the Dox-treated samples (+) from each transduced cell strain was normalized to the ratio in the untreated controls (-) of the corresponding cell strain. The data are plotted as the means±sem (n=3).

a Medium DCF intensity (% of control) 150 100 50 0 p=0.0029 p=0.1088 p=0.0052 Vector RRM2B Vector RRM2B b H 2 O 2 p-p38mapk p38mapk p-mapkapk-2 MAPKAPK-2 RRM2B GAPDH Vector RRM2B Vector RRM2B - - + + -H 2 O 2 + H O 2 2 Supplementary Figure S9. RRM2B overexpression suppresses ROS levels and attenuates the activation of p38mapk in response to hydrogen peroxide. (a) IMR90 cells were infected with MSCVhygro retroviruses expressing vector alone or RRM2B. One week following infection, transduced cells were treated with 400 µm H 2 O 2 for 90 minutes prior to CM-H2DCFDA staining. The DCF fluorescent intensity was analyzed by flow cytometry (means±sem, n=3). (b) Western blot analysis of proteins from the transduced IMR90 cells treated with 400 µm H 2 O 2 for 30 minutes (+) or left untreated (-).

150 Median DCF intensity (% of control) 100 50 0 Adr-HU Adr+HU RASV12-HU RASV12+HU Supplementary Figure S10. Scavenging of the tyrosyl radical of RRM2B by hydroxyurea (HU) has no detectable effect on ROS levels. IMR90 cells were induced to enter senescence by chronic treatment with low dose Adriamycin (Adr, 0.1 µg/ml) or by transduction with pbabepuro retrovirus to express RASV12. One week after Adriamycin treatment or two weeks following RASV12 expression, senescent cells were incubated with HU for 18 hours before measurement of the ROS level by CM-H2DCFDA staining. The DCF fluorescent intensity was analyzed by flow cytometry (means±sem, n=3).

Rrm2b +/+ Rrm2b +/- Rrm2b -/- p6 p7 Supplementary Figure S11. Induction of premature senescence in Rrm2b +/- and Rrm2b -/- MEFs. A SA-β-gal activity assay was performed in MEFs with different Rrm2b genotypes at p6 and p7. The cell morphology and SA-β-gal staining of each strain were visualized by light microscopy, and representative pictures are shown.

a Rrm2b +/+ +/- -/- b Vector RAS C R C R C R 50 p=0.009 Rrm2b RRM1 RRM2 p19 Arf p53 * % SA-β-gal (+) 40 30 20 p21 Cip1 Mdm2 10 p16 Ink4a p15 Ink4b β-actin 0 Vector C R C R C R Rrm2b +/+ +/- -/- Supplementary Figure S12. Acceleration of RASV12-induced premature senescence in Rrm2b +/- and Rrm2b -/- MEFs compared to their wild type counter parts. MEFs (p3) derived from three different Rrm2b genotypes as indicated were infected with retroviruses expressing either vector alone (C) or RASV12 (R). One week following retroviral infection, the cells were analyzed. (a) Western blot analysis of known senescence regulators in the transduced MEFs. *: non-specific bands; : Rrm2b-specific band. (b) SA-β-gal activity assays were performed to quantify the percentage of senescent cells (means±sem, n=3).