ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 5 27 5 473 ~ 479 FGF5 1 2 1 * 1 1 1 1 1 1 1 030801 2 201600 5 fibroblast growth factor 5 FGF5 FGF5 PCR Western FGF5 mrna PCR FGF5 2 5265 P < 0 01 Western FGF5 FGF5 P < 0 01 FGF5 5 PCR Western Q78 S852 FGF5 Expression and Immunolocalization in Back and Ear Skin of Young Alpaca Lama pacos LIU Dan-Dan 1 ZHANG Zhi-Yu 2 HE Xiao-Yan 1 * DONG Yan-Jun 1 ZHU Zhi-Wei 1 BAI Rui 1 ZHANG Jie 1 HAO Huan-Qing 1 XING Hai-Quan 1 1 College of Animal Science and Technology Shanxi Agricultural University Taigu 2 Shanghai Heng Feng Qiang Animal Pharmaceutical Co LTD Shanghai 030801 China 201600 China Abstract Alpaca Lama pacos is a fiber-producing animal of commercial importance The quality and growth of hair at the ear and back skin are different The fibroblast growth factor 5 FGF5 affects hair length in a diverse set of mammalian species Mutations in FGF5 lead to recessive long hair phenotypes in mice dogs and cats and were implicated contributing to the hair length variation in rabbits The aim of this study was to explore the function of FGF5 in the regulation of alpaca hair development and growth by comparing its expression and immunolocalization in the ear and back skin of young alpaca The mrna and protein levels of FGF5 were determined by real-time PCR Western blot and immunohistochemistry The results showed that the FGF5 gene was expressed in alpaca skin reliably The gene expression 2010-12-18 2011-03-08 No 20080311034 2009 No XB2009020 * Tel 0354-6288980 E-mail hexiaoyan630805@ yahoo com cn Received December 18 2010 Accepted March 8 2011 Supported by Shanxi Science and Technology Issue Foundation No 20080311034 and Shanxi Agricultural University Research Startup Project for Introducing Talents in 2009 No XB2009020 * Corresponding author Tel 0354-6288980 E-mail hexiaoyan630805@ yahoo com cn
474 27 quantity of FGF5 in ear skin of alpaca was 2 5265 times than that in back The distribution of FGF5 in alpaca skin were demonstrated and the expression was notable difference between the ear and back skin of young alpaca based on the average optical density Our findings showed that FGF5 might be involved in the regulation of hair development and growth of alpaca and might inhibit the hair growth in alpaca Key words fibroblast growth factor 5 alpaca real-time PCR Western blot immunohistochemistry alpaca Lama pacos FGF5 FGF5 90% FGF5 FGF5 1 ~ 3 let-7b 1 4 1 1 PCR 2 5 3 1 2 3 mirna let-7b 8 mm 3 let-7b 2 RNA 5 fibroblast growth factor 5 FGF5 1 Bouin's FGF5 23 FGFs FGF5 FGF Trizol Reagent Invitrogen 1994 Hebert 5 FGF5 PrimeScript TM RT reagent Kit SYBR Premix Ex Taq TM Ⅵ Ⅱ Perfect Real Time Marker NC Sundberg 6 TaKaRa 2 Taq Angora MasterMix BCA HRP- FGF5 2kb IgG Housley 7 β FGF5 FGF5 DAB Kehler 8 Drogemuller 9 FGF5 1 2 RNA 10 FGF5 RNA 1% RNA ND-100 Roca 11 RNA FGF5 RNA 10 μl 2 FGF5 5 PrimeScript TM 2 μl PrimeScript TM RT Enzyme Mix 0 5 μl Oligo dt 25 pmol Random 6 mers 50 pmol RNA 1 μl 10 μl PCR 37 15 min 85 5 s - 20 1 3 PCR PCR FGF5 NCBI
5 FGF5 475 FGF5 cdna FGF5 mrna 2 - ΔΔCT Primer 3 0 plus FGF5 1 6 Western NCBI Blast FGF5 BCA Table 1 Table 1 genes Gene FGF5 β-actin Primer sequences of target and house-keeping Primer sequences F 5'-GTTCAGGGAGCGATTTCAAG-3' R 5'-AAAGAAAGTTCCGGCTGCTC-3' F 5'-ACCCTCATAGATGGGCACAAG-3' R 5'-AGCCATGTACGTAGCCATCC-3' Product / bp 204 148 4 TBST 3 PCR 5 min HRP- Taq MasterMix 12 5 μl IgG TBST 1 1 000 1 h 10 μmol / L 1 μl cdna1 μl 500 ~ 1 000 ng TBST 3 10 min DAB 25 μl PCR 94 2 3 ~ 5 min min 94 30 s 63 30 s 72 30 s β 1 35 72 5min 1 000 PCR Image-pro plus 6 0 Media 1% Cybernetics FGF5 β DNA western DNA - 20 FGF5 = 1 4 PCR = FGF5 / β cdna FGF5 β Table 1 SPSS 17 0 PCR SYBR Premix Ex Taq TM Ⅱ 2 10 0 μl PCR Forward Primer 10 1 7 μmol / L 0 8 μl PCR Reverse Primer 10 μmol / L Bouin's 0 8 μl ROX Reference DyeⅡ 50 0 4 μl cdna 1 0 μl 20 0 μl 30 s 95 5 s 63 20 s 72 10 s 95 95 1 min 55 30 s 95 30 s FGF5 45 3% H 2 O 2 10 min PBS β 3 20 min 1 100 PCR FGF5 4 C t 1 5 PCR 100 HRP- IgG 37 30 min SPSS17 0 PBS 4 5 min DAB β 3 ~ 5 min PBS 3 3 min 2 - ΔΔCt FGF5 2 5 PBS ΔC t = C t -C t 1 8 ΔΔC t = ΔC t - ΔC t SDS-PAGE 12% 4% Marker 60 μg 30 min NC NC 5% 1 h FGF5 TBST 1 100 5 μm 3 3 min 5% 30 min PBS 3 3 min 1 Image-pro plus 6 0 FGF5
476 27 S 4 5 SPSS 17 0 Fig 2A ± Mean ± S D 2 2 1 FGF5 cdna PCR Fig 2B T m 1 PCR 1 204 bp 2 - ΔΔCt FGF5 2 5 PCR Fig 1 FGF5 2 5265 Fig 2C 2 3 FGF5 Western FGF5 Fig 3A FGF5 P < 0 01 Fig 3B Fig 1 PCR analysis of FGF5 in alpaca skin Total RNA was extracted from alpaca skin After cdna was synthesized FGF5 gene was amplified by PCR using specific primers PCR products were analyzed on 1% agarose gels 1 Negative control 2 3 PCR products of FGF5 gene M DL2000 DNA marker 5'-GT- Fig 3 Western blot analysis of FGF5 protein in TCAGGGAGCGTTTCAAGAGAACAGCTATAACACCT alpaca skin A The level of FGF5 protein was ATGCCTCAGTGATACACAGAACTGAGAACACGGG detected by Western blotting Protein extracts were GCGGGAGTGGTACGTGGCCCTGAACAAGAGGGGG separated by 12% SDS-PAGE Western blot were probed AAAGCTAAACGGGGCTGCAGCCCCCGGGTTAAAC with rabbit anti-fgf5 polyclonal antibody and goat antirabbit IgG conjugated with HRP as the second antibody CCCAGCACGTCTCCACTCACTTTCTGCCAAGATTTA AGCAATCGGAGCAGCCGGAACTTTCTTTA-3' then detected colorimetrically using a DAB detection kit DNAMAN FGF5 1 2 and 3 FGF5 protein in ear skin of alpaca 4 5 and NCBI 6 FGF5 protein in back skin of alpaca β-actin was 93% used as the internal control Each lane was from an FGF5 individual alpaca B Quantitative analysis of Western 2 2 FGF5 blots in panel A The level of FGF5 protein was normalized against the level of β-actin Bars in each panel represent the mean ± S D of three replicate PCR FGF5 expriments ** P < 0 01
5 FGF5 477 Fig 2 Real-time PCR analysis of the expression of FGF5 mrna A Real-time PCR amplification plots for FGF5 and β-actin B Real-time PCR dissociation curve for FGF5 and β-actin C Real-time PCR analysis of FGF5 abundance in different areas of skin samples collected from alpacas with back vs ear n = 3 each After real-time PCR amplification plots and dissociation curve analysis and judgement the Ct values could be used for datas analysis through 2 - ΔΔCT Abundance of FGF5 was normalized relative to abundance of β-actin Bars in each panel represent the mean ± S D of three independent expriments ** P < 0 01 Fig 4 Immunohistochemistry analysis of FGF5 protein in different areas of skin samples collected from alpacas with back vs ear The localization of FGF5 protein in ear and back skin of alpaca was detected by immunohistochemistry Immunohistochemistry were probed with rabbit anti-fgf5 polyclonal antibody and goat anti-rabbit IgG conjugated with HRP as the second antibody then detected colorimetricly using a DAB detection kit PBS buffer took the place of rabbit anti-fgf5 polyclonal antibody as negative control A Experiment group in ear skin of alpaca B Negative control in ear skin of alpaca C Experiment group in back skin of alpaca D Negative control in back skin of alpaca indicates root sheath shows hair medulla shows the hair matrix cell
478 27 2 4 FGF5 FGF5 FGF5 FGF5 FGF5 Fig 4 FGF5 Table 2 FGF5 21 FGF5 P < 0 01 22 Table 2 Average optical density of FGF5 positive signal in FGF5 1 Bgl I alpaca hair follicle n = 3 Location Back of alpaca Ear of aplaca FGF5 Root sheath Hair matrix cell Hair medulla 0 1789 ± 0 0 028 A 0 3422 ± 0 0 129 A 0 3582 ± 0 0 169 A 0 3 756 ± 0 0 663 B 0 5548 ± 0 0 349 B 0 9253 ± 0 0599 B All data represent the mean ± S D of three replicate experiments In the same column different capital letters mean extremely significant difference FGF5 Hebert 5 FGF5 mrna FGF5 mrna Ⅵ 1 /3 3 23 FGF5 mrna Suzuki 17 FGF5 FGF-5S FGF5 anagen catagen FGF5 telogen 12 FGF5 FGF5 1 FGF5 13 FGF5 5 14 FGF5 FGF5 50% 15 ~ FGF5 20 FGF5 mrna FGF5 mrna FGF5 FGF5-5S FGF5 FGF5 FGF5 FGF5-5S mrna let-7b 4 FGF5 let-7b FGF5 Western FGF5 mrna References FGF5 FGF5 1 Zhu Z He J Jia X et al MicroRNA-25 functions in regulation
5 FGF5 479 of pigmentation by targeting the transcription factor MITF in alpaca Lama pacos skin melanocytes J Domest Anim Endocrinol 2010 38 3 200-209 2 Dong Y Cao J Wang H et al Nitrc oxide enhances the sensitivity of alpaca melanocytes to respond to α-melanocytestimulating hormone by up-regulation melanocortin-1 receptor J Biochem Biophys Res Commun 2010 396 4 849-853 3 B hair cycle J Arch Dermatol Res 1996 288 5-6 264-266 J Geng J J Mu X L Sun L T et al Expression and immunolocalization of enodothelin receptor B in alpaca skin of different colors J Acta Vet Zootech Sin 2010 41 11 1478-1484 4 16 Ota Y Saitoh Y Suzuki S et al Fibroblast growth factor 5 mirna J inhibits hair growth by blocking dermal papilla cell activation He X Y Hao H Q Liu D D et al Differential microrna expression in ear and back skin in young alpaca Vicugna pacos J Chin J Biochem Mol Biol 2010 26 11 1016-1022 5 Hebert J M Rosenquist T Gotz J et al FGF5 as a regulator of the hair growth cycle evidence from targeted and spontaneous mutations J Cell 1994 78 6 1017-1025 6 Sundberg J P Rourk M H Boggess D et al Angora mouse mutation altered hair cycle follicular dystrophy phenotypic maintenance of skin grafts and change in keratin expression J Vet Pathol 1997 34 3 171-179 7 Housley D J Venta P J The long and the short of it evidence that FGF5 is a major determinant of canine hair'-itability J Anim Genet 2006 37 4 309-315 8 Kehler J S David V A Schaffer A A et al Four independent mutations in the feline fibroblast growth factor 5 gene determine the long-haired phenotype in domestic cats J J Hered 2007 98 6 555-566 9 Drogemuller C Rufenacht S Wichert B et al Mutations within the FGF5 gene are associated with hair length in cats J Anim Genet 2007 38 3 218-221 10 5 J Liu H Y Yang G Q Zhang W et al FGF5 SNP J Li C Effects of FGF5gene on fiber traits on inner Mongolian cashmere X Jiang M S Chen S Y et al Correlation analysis between goats J J Hereditas Beijing 2009 31 2 175-179 single nucleotide polymorphism of FGF5 gene and wool yield in rabbits J Hereditas Beijing 2008 30 7 893-899 11 Roca A L Ishida Y Nikolaidis N et al Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth J BMC Evol Biol 2009 9 232 12 Ryan A F The cell cycle and the development and regeneration of hair cells J Curr Top Dev Biol 2003 57 449-446 13 J Liu Z H Ren L M GuoY et al The cyclical variation and regulation of hair follicles and the study on cashmere goat J China Anim Husb Vet Med 2009 36 4 103-106 14 Peth -Schramm A Müller H J Paus R FGF5 and the mufine 15 Rosenquist T A Martin G R Fibroblast growth factor signailing in the hair growth cycle expression of the fibroblast growth factor receptor and ligand genes in the marine hair follicle J Dev Dyn 1996 205 4 379-386 J Biochem Biophys Res Commun 2002 290 1 169-176 17 Suzuki S Kato T Takimoto H et al Localization of rat FGF5 protein in skin macrophage-like cells and FGF-5S protein in hair follicle possible involvement of two Fgf5 gene products in hair growth cycle regulation J J Invest Dermato1 1998 111 6 963-972 18 Suzuki S Ota Y Ozawa K et al Dual-mode regulation of hair growth cycle by two FGF-5 gene products J J Invest Dermatol 2000 114 3 456-463 19 Ito C Saitoh Y Fujita Y et al Decapeptide with fibroblast growth factor FGF 5 partial sequence inhibits hair growth suppressing activity of FGF5 J J Cell Physiol 2003 197 2 272-283 20 Konyukhov B V Martynova Mlu Nesterova A P Gene angora as a modifier of the hairless gene in mouse J Genetika 2007 43 2 254-260 21 FGF5 SNP J Gao A Q Li J Q Li N et al The SNP bioinformatics analysis of FGF5 gene in sheep J Chin J Anim Sci 2008 44 5 5-7 22 FGF5 23 5 FGF5 D Han Sarula Study in the cyclical role growth-contorl of fibroblast growth factor 5 FGF5 goat hair D Rnuinant animal genetic and production Hohhot Inner Mongolia Agricultural University 2009