Expression and regulation of cyclin D3 in rabbit uterus and embryos during early pregnancy 3

49 (5) :606 614, 2003 A cta Zoologica S inica D3 3 33 (, 150030) RT2PCR, D3 (Cyclin D3), Cyclin D3 : (1) 3 8 Cyclin D3, 7, Cyclin D3 ; (2) 2 5 Cyclin D3 ; (3) ; (4), Cyclin D3, Cyclin D3, Cyclin D3 ; (5) RT2PCR Cyclin D3,,, Cyclin D3 [ 49 (5) : 606 614, 2003 ] D3 (Cyclin D3) Expression and regulation of cyclin D3 in rabbit uterus and embryos during early pregnancy 3 SUN Tong TEN G Chun2Bo XU Li2Bin YAN G Zeng2Ming 33 ( College of L if e Science, Northeast A gricult ural U niversity, Harbi n 150030) Abstract Cyclin D3, an important factor in the regulation of the G1/ S transition of the cell cycle in various cell types cul2 tured in vit ro, can maintain the balance of cell growth and development. Although cyclin D3 is expressed in mouse decid2 ualized stromal cells after implantation, cyclin D3 expression in the uterus of other species has not been reported. The aim of this study was to investigate the expression and regulation of cyclin D3 in rabbit uterus and preimplantation embryos during early pregnancy by immunohistochemistry and reverse transcription2pcr ( RT2PCR). Cyclin D3 expression was al2 so examined in pseudopregnant and steroid treated rabbit uterus. There was no detectable cyclin D3 immunostaining in the uteri on day 1 and 2 of pregnancy. In the uteri on day 3 to 6 of pregnancy, a strong immunostaining of cyclin D3 was seen in the glandular epithelium, while no immunostaining was observed in the luminal epithelium. Cyclin D3 immunostaining was detected in the glandular epithelium at implantation site on day 7 of pregnancy, being stronger on the anti2mesometri2 al side than that on the mesometrial side. There was detectable cyclin D3 immunostaining in the glandular epithelium of the inter2implantation area on day 7 of pregnancy. On day 8 of pregnancy, a week immunostaining of cyclin D3 was seen only in the glandular epithelium on the anti2mesometrial side. Cyclin D3 mrna expression was detected in the uterine en2 dometrium from days 1 to 8 of pregnancy by RT2PCR analysis. A high level of cyclin D3 mrna was only seen in the en2 dometrium from days 4 to 8 of pregnancy. In pseudopregnant uteri, no cyclin D3 immunostaining was seen on days 1 and 6, while a strong immunostaining of cyclin D3 was present in the glandular epithelium on days 2-5. In rabbit uteri at es2 trus and diestrus, cyclin D3 immunostaining was undetectable. There was no cyclin D3 immunostaining in the ovariec2 tomized uterus. Cyclin D3 was induced in the glandular epithelium after progesterone treatment, but no immunostaining was detected after estrogen treatment. A combination of estrogen and progesterone also stimulated cyclin D3 immunostain2 ing in the glandular epithelium of ovariectomized rabbit. By RT2PCR analysis, cyclin D3 mrna was detected in oocytes 2002212215, 2003205225 3 (No. 30170110) [ This research was funded by a grant from National Natural Science Foundation of China (No. 30170110) ] 33 (Corresponding author). E2mail : zmyang @mail. neau. edu. cn,, 24, : ν 2003 Acta Zoologica Sinica

5 : D3 607 and all the stages of preimplantation embryos, and was highly expressed in the expanded and hatched blastocysts. These results suggest that the expression of cyclin D3 may play an important role during rabbit blastocyst implantation [ Acta Zoologica Sinica 49 (5) : 606-614, 2003 ]. Key words Rabbit, Uterus, Embryo, Cyclin D3, Early pregnancy, Pseudopregnancy, Ovariectomy (Cyclin),,, 111 Hunt et al., 3 015 kg, 55 kd 42 kd, 14 h (06 00 20 00),, 10 h, A, B ( Evans et 112 al., 1983) 3 11211 G1 S CLN1 CLN2,, CLN3 (Richardson et al., 1989), 3 8 h C D E (Lew 0, 1 8, Bouin s et al., 1991 ; Leopold et al., 1991 ; Koff et al., 1991) Tamura et al. (1993),, - 70, G D1 D2 D3 G1,, G1 S ( Hunter et al., 1994 ; Herzinger et al., 1998) 4 ( 3 ) 17 2 ( Grana et al., 1995) Cyclin D3,, 3 1 : 015 ml / G1 S ; 2 : 5 g 17 2 / ; (Das et al., 1999) 3 : 5 mg / ; 4 : 5 g 1 2, Cyclin D3, 17 2 5 mg / 3 24 h, 3 4,, 5 7, Cyclin D3 mrna 11213,, 8 17 : 00, 0 Cyclin D3 mrna, 1 2 3 4 6, 3 ( Das et al., 11214 150 1999), IU PMSG (, Cyclin D3 mrna, ), 72 h 75 IU hcg ( 217,, ) (Das et al., 1999) 1 1 8, 3, 1, 11212, 015 ml, 1 hcg 16 h,,, Cyclin D3 ; hcg Cyclin D3, 1222, RT2PCR Cyclin 42 82 ; D3,

08 6 49 20, 200 l TRI2 ZOL, - 70 ACTACCTGGA TCGCTAC 3, 5 3, 1 CGGGA TCCA GGCA GTCCACTTCA GTG 3, 113 11311,, 7 m, RT2PCR GAPDH 100 % 95 % 80 % 70 % 50 % 1, 5 min, 2 5 2TCCACCACCCTGTTGCTGTA23, 10 min, 10 % 37 452 bp PCR : 94 4 min ; 1 h, Cy2 : 94 30 s, 60 30 s, 72 30 s clin D3 (1 2 000, 10 %,, GAPDH Cyclin D3 22 ) 4 PBS 3, 5 min, Ig G (1 33 45, 72 5 min, 200, 1 %BSA ) 25 40 min PBS, 3, 3, (1 200, DNA 1 : RNA 1 %BSA ) 25 30 min PBS 3, Vector Laboratory Vector2 Red 24 25 min, Levamisole ( Sigma ), RT2PCR Ig G 3, (UVP,, Inc., Upland, CA, USA) Olympus Cyclin D3 mrna 11312 RT2PCR 1131211 RNA (1) RNA, Cyclin D3 mrna, RNA TR IZOL ( GIBCO) RNA RQ1 DNase, t (Promega Corp., Madison, WI, USA) RNA 24 24 1,,, 1 g/ ml, - 70 (2) 211 RNA 100 g 21111 Cyclin D3 t RNA, TRIZOL RNA RNA DEPC2dH 2 O, RQ1 DNase,, 1 2, Cyclin D3, OD 260, (: A) 3 8 015 RNA,, Cyclin D3 (: - 70 1131212 RT2PCR RT2PCR BcaBEST RNA Cyclin D3, (: PCR Kit ( Takara ), 1 B D) 7, ( l RNA 20 l ) Cyclin D3, : 65 1 min, 30 1 min, (: E) 7 65 (15 30 min ), 65 15 : Cyclin D3 5 CGGAA TTCA 473 bp ( GAPDH) 5 2ACCACGGTGCACGCCA TCAC23, 35, GAPDH Cyclin D3 PCR ; 2 :, RT2PCR ; 3 : DEPC2dH 2 O RT2PCR 115 % Cyclin D3/ GAPDH, GAPDH Cyclin D3/ GAPDH 2 B F) 3 6,, Cyclin D3 ( 30 min, 98 5 min 5 5 min PCR : F) 8,

5 : D3 609 Cyclin D3 ( ( : F) ) 7 Cyclin D3 212 RT2PCR (: E) 21112 Cyclin D3 473 bp Cyclin D3 452 bp GAPDH 1 Cyclin D3 ( 1 : A) Cyclin D3 2 5, GAPDH, (: Cyclin D3/ GAPDH, Cyclin D3 A) 6, Cyclin D3 ( 1 : B), Cy2 (: B) 21113 Cyclin D3, 8 ( 1 : B) Cyclin D3, 473 bp ( ) 1 8, clin D3, 4, 4 7 Cyclin D3 452 bp GAPDH ( 2 : 21114 Cyclin D3 A), Cyclin D3, Cyclin D3 ( : C) ( 2 : B),, 3 ( : D), ( : E) Cyclin D3,,, G1 S 1 1 8 Cyclin D3 Fig. 1 Cyclin D3 expression in rabbit endometrium from day 1 to 8 of pregnancy A. Cyclin D3 GAPDH ( RT2PCR data) B. Cyclin D3 GAPDH (Relative cyclin D3 mrna corrected for loading as determined by GAPDH), (Data are expressed as means S E. Means with different super2 scripts differ significantly)

10 6 49 2 Cyclin D3 Fig. 2 Cyclin D3 expression at early stage of rabbit embryos A. Cyclin D3 GAPDH ( Representative RT2PCR of Cyclin D3 and GAPDH in rabbit oocyte and early stage embryos) B. Cyclin D3 GAPDH (Relative mrna for of cyclin D3 and GAPDH in rabbit oocyte and embryos) (Data are expressed as means S E) 1 9 22 42 82 ( The number from 1 to 9 is oocyte, zygote, 22 cell, 42cell, 82cell, morula, unexpanded blastocyst, expanded blastocyst and hatched blastocyst, respectively) (Das et al., 1999) Cyclin D3 ( Kwun et al., 1974) (Bartkova et al., 1998 ; Beumer et al., 2000), 3 15, Cyclin D3 (Challis et al., 1973) ( Geum et al., 1997) 1 2, 3, 4 6, 3,, 4, Cyclin D3 4 (Car2 RT2PCR, Cyclin D3 3 son et al., 2000) 1 2, Cy2 (Dey et al., 1986),, Cyclin D3 3, 8 clin D3, 3 4, (Das et al.,, Cyclin D3, 1999), Cyclin D3,, 0 15,, 1 2 Cyclin D3

5 : D3 611,, ( Yang et al., 1998), Cyclin D3 Cyclin D3, Cyclin D3 4 (Depoortere et al.,, 1998), Cyclin D3, 7 T, Cyclin D3, Cyclin D3 mrna ( ) RT2 ( Garcia2Gras et al., 2000) PCR, Cyclin D3 8 Cyclin D3, Cyclin D3 Cyclin D3, Cyclin D3,,, Cyclin (Das et al., 1999) D3, Cyclin D3 Hoxa210, (Benson et al., 1996) ( References), Cyclin D3 mrna (Das et al., 1999), Cyclin D3 4 ( Cyclin2depen2 dent kinase 4),, Cyclin D3 p21 4 ( Tan et al., 2002), Cyclin D1 Cyclin D2 Cyclin D3 2,,, (Ciemerych et al., 2002),, Cyclin D3 Cyclin D1 Cyclin D2, 2 5 Cyclin D3, 6, 3 Cyclin D3, 3 8 Cyclin D3,, Cyclin D3 Cyclin D3, Cyclin D3, 1998 A requirement for cyclin D32cyclin2dependent kinase (cdk)2 Cyclin D3 Cyclin D3, Cyclin D3 T2 Cyclin D3 Bartkova, J., J. Lukas, M. Strauss and J. Bartek 1998 Cyclin D3 : requirement for G1/ S transition and high abundance in quies2 cent tissues suggest a dual role in proliferation and differentiation. Oncogene 17 : 1 027 1 037. Benson, G. V., H. Lim, B. C. Paria, I. Satokata, S. K. Dey and R. L. Maas 1996 Mechanism of reduced fertility in Hoxa210 mutant mice : uterine homeosis and loss of maternal Hoxa210 ex2 pression. Development 122 : 2 687 2 696. Beumer, T. L., H. L. Roepers2Gajadien, I. S. Gademan, H. B. Kal and D. G. de Rooij 2000 Involvement of the D2type cyclins in germ cell proliferation and differentiation in the mouse. Biol. prod. 63 : 1 893 1 898. Re2 Carson, D. D., I. Bagchi, S. K. Dey, A. C. Enders, A. T. Fa2 zleabas, B. Lessey and K. Yoshinaga 2000 Embryo implanta2 tion. Deve. Biol. 223 : 217 237. Challis, J. R. G., I. J. Davies and K. J. Ryan 1973 The concen2 trations of progesterone, estrone and estradiol217 in the pregnant rabbits. Endocri nology 93 : 961 976. Ciemerych, M. A., A. M. Kenney, E. Sicinska, I. Kalaszczynska, R. T. Bronson, D. H. Rowitch, H. Gardner and P. Sicinski 2002 Development of mice expressing a single D2type cyclin. Genes Dev. 16 : 3 277 3 289. Das, S. K., H. Lim, B. C. Paria and S. K. Dey 1999 Cyclin D3 in the mouse uterus is associated with the decidualization process during early pregnancy. J. Mol. Endocri nology 22 : 91 101. Depoortere, F., A. van Keymeulen, J. Lukas, S. Costagliola, J. Bartkova, J. E. Dumont, J. Bartek, P. P. Roger and S. Dremier 4 assembly in the cyclic adenosine monophosphate2dependent prolif2 eration of thyrocytes. J. Cell Biol. 140 : 1 427 1 439. Dey, S. K. and D. C. Johnson 1986 Embryonic signals in pregnan2 cy. A nn. N. Y. Acad. Sci. 476 : 49 62.

12 6 49 Evans, T., E. T. Rosenthal, J. Youngblom, D. Distel and T. Hunt 1983 Cyclin : a protein specified by maternal mrna in sea urchin eggs that is destroyed at each cleavage division. 396. Cell 33 : 389 Garcia2Gras, E. A., P. Chi and T. A. Thompson 2000 Glucocor2 ticoid2mediated destabilization of cyclin D3 mrna involves RNA2 protein interactions in the 3 2untranslated region of the mrna. J. Biol. Chem. 275 : 22 001 22 008. Geum, D., W. Sun, S. K. Paik, C. C. Lee and K. Kim 1997 E2 strogen2induced cyclin D1 and D3 gene expressions during mouse u2 terine cell proliferation in vivo : differential induction mechanism of cyclin D1 and D3. Mol. Reprod. Dev. 46 : 450 458. Grana, X. and E. P. Reddy 1995 Cell cycle control in mammalian cells : role of cyclins, cyclin2dependent kinases, growth suppressor genes and cyclin2dependent kinase inhibitors. Oncogene 11 : 211 219. Herzinger, T. and S. I. Reed 1998 Cyclin D3 is rate2limiting for the G1 \ S phase transition in fibroblasts. J. Biol. Chem. 273 : 14 958 14 961. Hunter, T. and J. Pines 1994 Cyclins and cancer : cyclin D and CD K inhibitors come of age. Cell 79 : 551 555. Koff, A., F. Cross, A. Fisher, J. Schumacher, K. Leguellec, M. Philippe and J. M. Roberts 1991 Human cyclin E, a new cy2 clin that interacts with two members of the CDC2 gene family. Cell 66 : 1 217 1 228. Kwun, J. K. and C. W. Emmens 1974 Hormone requirements for implantation and pregnancy in the ovariectomized rabbits. A ust. J. Biol. Sci. 27 : 275 283. Leopold, P. and P. H. O Farrell 1991 An evolutionarily conserved cyclin homolog from Drosophila rescues yeast deficient in G1 cy2 clins. Cell 66 : 1 207 1 216. Lew, D. J., V. Dulic and S. I. Reed 1991 Isolation of three novel human cyclins by rescue of G1 cyclin (Cln) function in yeast. Cell 66 : 1 197 1 206. Richardson, H. E., C. Wittenberg, F. Cross and S. I. Reed 1989 Cyclin2like proteins in yeast. Cell 59 : 1 127 1 133. Tamura, K., Y. Kanaoka, S. Jinno, A. Nagata, Y. Ogiso, K. Shimizu, T. Hayakawa, H. Nojima and H. Okayama 1993 Cyclin G: a new mammalian cyclin with homology to fission yeast Cig1. Oncogene 8 : 2 113 2 118. Tan, J., S. Raja, M. K. Davis, O. Tawfik, S. K. Dey and S. K. Das 2002 Evidence for coordinated interaction of cyclin D3 with p21 and cdk6 in directing the development of uterine stromal cell decidualization and polyploidy during implantation. Mech. Dev. 111 : 99 113. Yang, M., H. Nomura, Y. Hu, S. Kaneko, H. Kaneko, M. Tanaka and K. Nakashima 1998 Prolactin2induced expression of TATA2less cyclin D3 gene is mediated by Sp1 and AP2. Biochem. Mol. Biol. Int. 44 : 51 58. ( Explanation of Plates) ( Plate ) D3 (Cyclin D3 immunostaining in rabbit uterus during early pregnancy) A B C D. 1 4 5 6 [ Pregnant uteri on day 1, 4, 5 and 6 are shown ] 45 E. 7 [ The contralateral uterus (mesometrial side) at the implantation site on day 7 ] 45 F. 7 (Day 7 uterus at inter2implantation site) 7 (Day 7 embryo is indicated by the arrow) L : (Uterine lumen) S : (Uterine stroma) M : (Myometrium) 45 ( Plate ) D3 (Cyclin D3 immunostaining in rabbit uterus during early pregnancy) A B. 4 6 (A and B are pseudopregnant uteri on days 4 and 6, respectively) 45 D E F C., (D) ( E) ( F), (C) [ Ovariec2 tomized rabbits were treated with sesame oil for control ( C), or with progesterone (D), estradiol ( E) and a combination of progesterone and estradiol ( F) ] 45 L : (Uterine lumen) S : (Uterine stroma) M : (Myometrium)

: D3 SUN Tong et al. : Expression and regulation of cyclin D3 in rabbit uterus and embryos during early pregnancy Plate ( Explanation at the end of the text)

: D3 SUN Tong et al. : Expression and regulation of cyclin D3 in rabbit uterus and embryos during early pregnancy Plate ( Explanation at the end of the text)