2005, 32 (3) : Acta Horticulturae Sinica 403 407 RT2PCR 3π 3 (, 110161) : RT2PCR ( SMYEV ), SMYEV SMYEV RT2PCR, 19 2, 12 SMYEV SMYEV SY01 932 bp 3π, 86% 96% SMYEV 3, SY01, 1 RNA SMYEV 3π 3, : ; ; ( SMYEV) ; : S 66814; S 43211 : A : 05132353X (2005) 0320403205 D etection of S traw berry m ild yellow edge virus w ith RT2PCR and Ana lysis of the Sequences of 3π Term ina l Reg ion Yang Hongyi, Zhang Zhihong 3, Gao Xiuyan, Du Guodong, Dai Hongyan, and L i He ( College of Horticulture, Shenyang A gricultural U niversity, Shenyang 110161, China) Abstract: Coat p rotein gene segment of S traw berry m ild yellow edge virus ( SMYEV ) was amp lified with some special p rimers by reverse transcrip tion2polymerase chain reaction ( RT2PCR) from strawberries p lants, and testified by sequencing. A stable system for detection of SM YEV w ith RT2PCR was established, and a2 mong nineteen strawberries cultivars and two w ild strawberries species checked, twelve cultivars and F raga ria pentaphylla were infected. The 932 bp segment in 3π term inal region of SMYEV genome was amp lified from Shenyang isolate SY01. Comparison showed it shared 86% 96% nucleotide acid identity with the published sequences. Phylogenetic analysis show s that all isolates of SM YEV fell into three clades. The Shenyang isolate SY01 lay in the same clade w ith the Europe and America isolates, but formed a small separate branch. Analy2 sis of RNA secondary structure showed that three stem 2loop structures were formed in 3π term inal region, and sequence differences in all isolates impacted little on the stem 2loop structures. Key words: Strawberry; V irus; S traw berry m ild yellow edge virus ( SM YEV ) ; Sequence analysis 1922 Horn, 1,,, 1990 Jelkmann, 2, 3, ( S traw berry m ild yellow edge virus, SMYEV), X ( Potexvirus), ( The International Comm ittee on Taxonomy of V iruses, ICTV) SMYEV, : 2004-10 - 21; : 2005-03 - 14 : (30200187) ; (2002) 3 Author for correspondence ( E2mail: zhangz@ syau1edu1cn) 247
404 32,, 1 Jelkmann 2 Jawee 4, SMYEV,, ( EL ISA) (1 5 ) ( Polymerase chain reaction, PCR),,, PCR 5, 6 Kaden2 Kreuziger 7 PCR (Reverse transcrip tion PCR, RT2PCR ) SMYEV, RNA, PCR ( Immuno2cap ture PCR, IC2 PCR) SMYEV Thomp son 6 RNA, ( Strawberry mottle virus, SMoV ),, RNA, RT2PCR SMYEV, 1 111 UC5 (Fragaria vesca) ( F. ananassa) (Hoko2 wase) (L Zhongzi) 2 ( Shanghai 2) (Antelasi) 2 (Changhong 2) (Nuobinka) (Sweetheart) (Harunoka) (M inglei) (Hogyoku) (Gousimco) (B landenberg) (Allstar) 1 ( Shanghai 1) (El2 santa) (Hinomine) (Anna) (Ai Berry) (Veestar) (F. pentaphylla) (F. nilgerrensis) M 2MLV Invitrogen, Taq DNA Promega, dntp, RNA DNA Marker pmd 182T TaKaRa, 112 GenBank SMYEV 6 9 ( 1), TaKaRa Primer pairs ( 5π 3π) Sequence (5π 3π) 1 SMY EV PCR Table 1 Tested pr im er pa irs for am plify ing segm en ts of SMY EV genom e SM2 /SM1 TGCACTCTGTGTTGACCTTC ( Sense p rimer) 883 GCCAACAGCAAGAATCCTAT( Antisense p rimer) SM3 /SM1 GATACTCGTCTACGAAGGCT( Sense p rimer) 406 GCCAACAGCAAGAATCCTAT( Antisense p rimer) Y1 /Y2 GTGTGCTCAATCCAGCCAG( Sense p rimer) 271 CATGGCACTCATTGGAGCTGGG( Antisense p rimer) CCGCTGCAGTTGTAGGGTA ( Sense p rimer) YT1 /YT2 TTTTTTTTTTTTTTTAAGGAAAAAGAAAAACAAAC ( Antisense p rimer) 932 Target fragment( bp) 113 Frazier 10 114 RNA RT2PCR PCR RNA 11 RT2PCR MJ PTC2150 PCR 20 L, 1 L, (10 mol L - 1 ) 1 L ( YT1 /YT2, ), M 2MLV 60 U, Invitrogen, 37 215 h 1 L PCR, 1 Buffer, 115 mmol L - 1
3 : RT2PCR 3π 405 MgCl 2, 012 mmol L - 1 dntp, 012 mol L - 1, 015 U Taq, 20 L PCR : (1) SM2 /SM1 : 94 2 m in; 94 30 s, 52 40 s, 72 40 s, 35 ; 72 5 m in ( 2) SM3 /SM1 Y1 /Y2 54, 56, SM2 /SM1 (3) YT1 /YT2 : 94 2 m in; 94 30 s, 50 60 s, 72 90 s, 35 ; 72 5 m in EB ( ) 116%, pmd 182T, DH5,,, PCR, BLAST GenBank RNA Structure 411 RNA CLUSTAL 1183, DNAStar 2 211 SMY EV RT2PCR UC5, RT2PCR,, SM2 /SM1 SM3 /SM1,, Y1 /Y2, Y1 /Y2 Y1 /Y2,, 271 bp,, BLAST 271 bp GenBank SMYEV 89% 98%, SMYEV, PCR, RT2PCR SMYEV, 19 2 SMYEV, 2 2 12 SMYEV; 1 SMYEV ( 1) 212 3π 1, SMYEV SY01 YT1 /YT2 932 bp SY01 3π ( GenBank : AY955375), 3 ( Trip le gene block 3, TGB3) SY01 3π GenBank SMYEV 86% 96%, 3CH 1 SMY EV RT2PCR M: 100 bp DNA Ladder; 1: UC5; 2 10:, ; Fig. ( ) ; 11: 12: UC5 1 Detection of SMYEV in the strawberry plants by RT2PCR M: 100 bp DNA Ladder; 1: Strawberry virus indicator UC5 infected with SMYEV; 2-10: Strawberry cultivars, Hokowase, L se Zhongzi, Sweetheart, Harunoka, Minglei, Hogyoku, Gousimco, Blandenberg and Nuobinka, respectively; 11: Control of lack of reverse transcriptase (Hokowase) ; 12: Healthy strawberry virus indicator UC5. ( ) D74 ( ) TGB3 GenBank SMYEV 85% 98%, 6CH, D74 ( ) D /L113 ( ) D /
406 32 L114 ( ) D /L119 ( ) D /M1110 ( ) D /K1159 ( ) D /V1180 ( ) 7CH ( ) 69N ( ) 314CP2cav ( ) SY01 ( T2C, D74 5203 ) ( P2S) 93% 100%, 5CH ( ) D74 SMYEV 96 X ( Potato virus X, PVX) 54%, 213 SMYEV 3π SMYEV ( 2), MY18 3 (2CH 3CH 5CH ) 1, 9Redland 4 ( 6CH 4CH 10CH 7CH ) 1, SY01 15,, 1, 214 RNA 2 SMY EV 3π F ig. 2 Phylogenetic tree of the 3πnucleotide sequence of SMY EV isola tes RNA Structure 411 RNA X 3π,, 3πU RNA RNA Structure 411 SY01 3π 3 ( 3), ACUAGU, F ig. 3 SMY EV SY01 3π RNA 3 The RNA secondary structure of SMY EV isola te SY01 3π term ina l reg ion
3 : RT2PCR 3π 407, PVX 12 ACUUAA, X, 3 Hadidi 13 PCR (, ), ( ),, Kaden2Kreuziger 7 SMYEV, PCR SMYEV, IC2PCR SMYEV SMYEV,, SMYEV, SMYEV RNA SMYEV 14 15,, PCR,,,, : 1 Converse R H, Martin R R, Sp iegel S. Strawberry m ild yellow edge. In: Converse R H ed. V irus diseases of small fruits. W ashington: US Department of Agriculture, Agriculture Research Service, 1987. 25 29 2 Jelkmann W, Martin R R, Lesemann D E, Vetten H J, Skelton F. A new potexvirus associated with strawberry m ild yellow edge disease. Journal of General V irology, 1990, 71: 1251 1258 3 Lamp recht S, Jelkmann W. Infectious cdna clone used to identify strawberry m ild yellow edge associated potexvirus as causal agent of the disease. Journal of General V irology, 1997, 78: 2347 2353 4 Jawee A, Adam s A N. Serological detection of strawberry m ild yellow edge associated virus. Acta Horticulturae, 1995, 385: 98 104 5 Thomp son J R, Jelkmann W. The detection and variation of Strawberry mottle virus. Plant D isease, 2003, 87: 385 390 6 Thomp son J R, W etzel S, KlerksM M, Vagkov D, Schoen C D, Λpak J. Multip lex RT2PCR detection of four aphid2borne strawberry viruses in Fragaria spp. in combination with a p lant mrna specific internal control. Journal of V irologicalmethods, 2003, 111: 85 93 7 Kaden2Kreuziger D, Lamp recht S, Martin R R, Jelkmann W. Immunocap ture polymerase chain reaction assay and EL ISA for the detection of strawberry m ild yellow edge associated potexvirus. Acta Horticulturae, 1995, 385: 33 40 8 Jelkmann W, Maiss E, Martin R R. The nucleotide sequence and genome organization of strawberry m ild yellow edge2associated potexvirus. Journal of General V irology, 1992, 73: 475 479 9 Thomp son J R, Jelkmann W. Strain diversity and conserved genome elements in S trawberry m ild yellow edge virus. A rchives of V irology, 2004, 149: 1897 1909 10 Frazier N W. Detection of graft2transm issible diseases in strawberry by a modified leaf grafting technique. Plant D isease Reporter, 1974, 58: 203 207 11,,,,. RT2PCR., 2005, 35 ( 2) : 116 122 Yang H Y, Zhang Z H, Du G D, Dai H Y, Gao X Y. RT2PCR detection Strawberrymottle virus based internal control. ACTA Phytopatholog2 ica Sinica, 2005, 35 (2) : 116 122 ( in Chinese) 12 Pillai2Nair N, Kim K H, Hemenway C. Cis2acting regulatory elements in the Potato virus X 3πnon2translated region differentially affectm inus2 strand and p lus2strand RNA accumulation. Journal of Molecular B iology, 2003, 326: 701 720 13 Hadidi A, MontasserM S, Levy L, Goth R W, Converse R H, Madkour M A, Skrzeckows L J. Detection of potato leafroll and strawberry m ild yellow2edge luteoviruses by reverse transcrip tion2polymerase chain reaction amp lification. Plant D isease, 1993, 77: 595 600 14,,,,,.., 1990, 23 (4) : 43 49 W ang G P, L iu F C, Xue G R, Zhu Q Y, Yang Z Y, W ang H Y. Research on identification of strawberry viruses in China and techniques of obtaining virus2free strawberries. Scientia Agricultura Sinica, 1990, 23 (4) : 43 49 ( in Chinese) 15,.., 1992, 23 (3) : 163 167 W ei S Q, W u Y H. Studies on the aphid transm ission, purification and morphology of strawberry m ild yellow edge virus. Journal of Shenyang Agricultural University, 1992, 23 (3) : 163 167 ( in Chinese)