D etection of S traw berry m ild yellow edge virus w ith RT2PCR and Ana lysis of the Sequences of 3π Term ina l Reg ion

Σχετικά έγγραφα
(A ntifreeze p roteins, A FP s) (afp ),

svari Real-time RT-PCR RSV

China B iotechnology, 2005, 25 (12) : pcamb IA21201 DH5 1. 2

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Identification of Fish Species using DNA Method

30s 56 60s 72 60s dntp cm s s s 23

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

China Academic Journal Electronic Publishing House. All rights reserved. O ct., 2005

Effects of Plan t Growth Regula tors on the Con ten t of Phenolics in Sweet Cherry D orman t Flower Buds and D ormancy

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

DNA2ITS, Iden tif ica tion of C o lle to trichum sp. from A n thu rium and raeanum and Its Sequenc ing of R ibosoma l D NA2ITS

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΩΡΓΙΚΗΣ ΖΩΟΛΟΓΙΑΣ ΚΑΙ ΕΝΤΟΜΟΛΟΓΙΑΣ

, DYY-8B, ; : Centrifuge 11 R. min

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Supporting Information

Extraction, Amplification and Sequence Analysis of Xiajiadian Ancient Human Bone D NA

Error ana lysis of P2wave non2hyperbolic m oveout veloc ity in layered media

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

16S rrna ARDRA Q938 A (2008) : (2006BAD07B03, 2006BAD08A08, 2006BAD17B08); (NYHYZX07-050)

( CymM v) Erad ica tion of CymM v from T issue Cultures of C ym b id ium sinense w ith Chem otherapy

Shiraia sp. Slf14 III

Rh(III)-Catalyzed C-H Amidation with N-hydroxycarbamates: A. new Entry to N-Carbamate Protected Arylamines

Studies on nuclear phase and genetic attribute of the basidiospores of Flammulina velutipes

Medicago marina 2012

Curran et al.,**. Davies et al ,**, ,***,**/

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

Cytogenetics and RAPD Ana lysis of In terspec if ic Hybr ids from the Cross of F raga ria m andschu rica Staudt and F. ananassa D uch.

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

DNA, , DNA, 1 D NA . DNA

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

Cellular Physiology and Biochemistry

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

6 T-DNA PCR TAIL-PCR T-DNA. 69% 30% T-DNA left border LB right border RB T-DNA A T-DNA

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Molecular evolutionary dynamics of respiratory syncytial virus group A in

Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

BMI/CS 776 Lecture #14: Multiple Alignment - MUSCLE. Colin Dewey

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Research of Han Character Internal Codes Recognition Algorithm in the Multi2lingual Environment

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Κάθε γνήσιο αντίγραφο φέρει υπογραφή του συγγραφέα. / Each genuine copy is signed by the author.

Progress in Modern Biomedicine Vol.11 NO.7 APR ' 10 min PCR 250 copies/ml PCR

Aronia. melanocarpa. Επιβλεπονηερ καθηγηηερ:

Arbitrage Analysis of Futures Market with Frictions

Genetic Rela tion sh ip of Som e Cultivars of Petun ia Hybr ids Using SRAP M arker

C lon ing of 62phosphoglucona te D ehydrogena se Gene ( 6PGD H ) and M olecu2 lar Conf irma tion of A llotetraplo id in C ucum is

Capillary Gel Electrophoresis for Ligase Detection Reaction Products

Introduction to Bioinformatics

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

A Preliminary Analysis of Genetic Relationships for Prunus mume Sieb. et Zucc. by AFLP

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Resistance monitoring and target gene cloning of Bemisia tabaci Q-biotype from Jiangsu Province

ER-Tree (Extended R*-Tree)

Αλγοριθµική και νοηµατική µάθηση της χηµείας: η περίπτωση των πανελλαδικών εξετάσεων γενικής παιδείας 1999

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family

THE GENETIC TRANSFORMATION OF STRAWBERRY WITH WINTER FLOUNDER ANTIFREEZE PROTEIN GENE

Application of a novel immune network learn ing algorithm to fault diagnosis

Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. No ,**1

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

SUPPORTING INFORMATION

Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ

GPS, 0. 5 kg ( In tegrated Fertility Index, IF I) 1. 1 SPSS 10. IF I =

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

* * E mail : matsuto eng.hokudai.ac.jp. Zeiss

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ

OPN antisense oligodeoxynucleotide inhibits p roliferation and apop tosis of human breast carcinoma cell line

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4


(T rip tery g ium w ilf ord ii Hook) ,Beroza [6 ] 4 W ilfo rine W ilfo rdine W ilfo rgine W il2. Euon ine 1. 0% 1980, 1. 1 ; 1. 0%, ; 0.

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

Εφαρμοσμένη Βιοτεχνολογία Εργαστηριακή Άσκηση Εισαγωγή στην Βιοπληροφορική

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ

Table of Contents 1 Supplementary Data MCD

Dietary success of a new key fish in an overfished ecosystem: evidence from fatty acid and stable isotope signatures

Η ΑΝΑΖΗΤΗΣΗ ΤΟΥ ΌΡΟΥ "ΝΟΣΗΛΕΥΤΙΚΗ" ΣΤΑ ΠΡΑΚΤΙΚΑ ΤΩΝ ΣΥΝΕΔΡΙΑΣΕΩΝ ΤΟΥ ΔΙΟΙΚΗΤΙΚΟΥ ΣΥΜΒΟΥΛΙΟΥ ΤΟΥ ΘΕΡΑΠΕΥΤΗΡΙΟΥ ΕΥΑΓΓΕΛΙΣΜΟΣ

CorV CVAC. CorV TU317. 1

TABLE OF CONTENTS Page

Πανεπιστήµιο Πειραιώς Τµήµα Πληροφορικής

CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic

MnZn. MnZn Ferrites with Low Loss and High Flux Density for Power Supply Transformer. Abstract:

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

Transcript:

2005, 32 (3) : Acta Horticulturae Sinica 403 407 RT2PCR 3π 3 (, 110161) : RT2PCR ( SMYEV ), SMYEV SMYEV RT2PCR, 19 2, 12 SMYEV SMYEV SY01 932 bp 3π, 86% 96% SMYEV 3, SY01, 1 RNA SMYEV 3π 3, : ; ; ( SMYEV) ; : S 66814; S 43211 : A : 05132353X (2005) 0320403205 D etection of S traw berry m ild yellow edge virus w ith RT2PCR and Ana lysis of the Sequences of 3π Term ina l Reg ion Yang Hongyi, Zhang Zhihong 3, Gao Xiuyan, Du Guodong, Dai Hongyan, and L i He ( College of Horticulture, Shenyang A gricultural U niversity, Shenyang 110161, China) Abstract: Coat p rotein gene segment of S traw berry m ild yellow edge virus ( SMYEV ) was amp lified with some special p rimers by reverse transcrip tion2polymerase chain reaction ( RT2PCR) from strawberries p lants, and testified by sequencing. A stable system for detection of SM YEV w ith RT2PCR was established, and a2 mong nineteen strawberries cultivars and two w ild strawberries species checked, twelve cultivars and F raga ria pentaphylla were infected. The 932 bp segment in 3π term inal region of SMYEV genome was amp lified from Shenyang isolate SY01. Comparison showed it shared 86% 96% nucleotide acid identity with the published sequences. Phylogenetic analysis show s that all isolates of SM YEV fell into three clades. The Shenyang isolate SY01 lay in the same clade w ith the Europe and America isolates, but formed a small separate branch. Analy2 sis of RNA secondary structure showed that three stem 2loop structures were formed in 3π term inal region, and sequence differences in all isolates impacted little on the stem 2loop structures. Key words: Strawberry; V irus; S traw berry m ild yellow edge virus ( SM YEV ) ; Sequence analysis 1922 Horn, 1,,, 1990 Jelkmann, 2, 3, ( S traw berry m ild yellow edge virus, SMYEV), X ( Potexvirus), ( The International Comm ittee on Taxonomy of V iruses, ICTV) SMYEV, : 2004-10 - 21; : 2005-03 - 14 : (30200187) ; (2002) 3 Author for correspondence ( E2mail: zhangz@ syau1edu1cn) 247

404 32,, 1 Jelkmann 2 Jawee 4, SMYEV,, ( EL ISA) (1 5 ) ( Polymerase chain reaction, PCR),,, PCR 5, 6 Kaden2 Kreuziger 7 PCR (Reverse transcrip tion PCR, RT2PCR ) SMYEV, RNA, PCR ( Immuno2cap ture PCR, IC2 PCR) SMYEV Thomp son 6 RNA, ( Strawberry mottle virus, SMoV ),, RNA, RT2PCR SMYEV, 1 111 UC5 (Fragaria vesca) ( F. ananassa) (Hoko2 wase) (L Zhongzi) 2 ( Shanghai 2) (Antelasi) 2 (Changhong 2) (Nuobinka) (Sweetheart) (Harunoka) (M inglei) (Hogyoku) (Gousimco) (B landenberg) (Allstar) 1 ( Shanghai 1) (El2 santa) (Hinomine) (Anna) (Ai Berry) (Veestar) (F. pentaphylla) (F. nilgerrensis) M 2MLV Invitrogen, Taq DNA Promega, dntp, RNA DNA Marker pmd 182T TaKaRa, 112 GenBank SMYEV 6 9 ( 1), TaKaRa Primer pairs ( 5π 3π) Sequence (5π 3π) 1 SMY EV PCR Table 1 Tested pr im er pa irs for am plify ing segm en ts of SMY EV genom e SM2 /SM1 TGCACTCTGTGTTGACCTTC ( Sense p rimer) 883 GCCAACAGCAAGAATCCTAT( Antisense p rimer) SM3 /SM1 GATACTCGTCTACGAAGGCT( Sense p rimer) 406 GCCAACAGCAAGAATCCTAT( Antisense p rimer) Y1 /Y2 GTGTGCTCAATCCAGCCAG( Sense p rimer) 271 CATGGCACTCATTGGAGCTGGG( Antisense p rimer) CCGCTGCAGTTGTAGGGTA ( Sense p rimer) YT1 /YT2 TTTTTTTTTTTTTTTAAGGAAAAAGAAAAACAAAC ( Antisense p rimer) 932 Target fragment( bp) 113 Frazier 10 114 RNA RT2PCR PCR RNA 11 RT2PCR MJ PTC2150 PCR 20 L, 1 L, (10 mol L - 1 ) 1 L ( YT1 /YT2, ), M 2MLV 60 U, Invitrogen, 37 215 h 1 L PCR, 1 Buffer, 115 mmol L - 1

3 : RT2PCR 3π 405 MgCl 2, 012 mmol L - 1 dntp, 012 mol L - 1, 015 U Taq, 20 L PCR : (1) SM2 /SM1 : 94 2 m in; 94 30 s, 52 40 s, 72 40 s, 35 ; 72 5 m in ( 2) SM3 /SM1 Y1 /Y2 54, 56, SM2 /SM1 (3) YT1 /YT2 : 94 2 m in; 94 30 s, 50 60 s, 72 90 s, 35 ; 72 5 m in EB ( ) 116%, pmd 182T, DH5,,, PCR, BLAST GenBank RNA Structure 411 RNA CLUSTAL 1183, DNAStar 2 211 SMY EV RT2PCR UC5, RT2PCR,, SM2 /SM1 SM3 /SM1,, Y1 /Y2, Y1 /Y2 Y1 /Y2,, 271 bp,, BLAST 271 bp GenBank SMYEV 89% 98%, SMYEV, PCR, RT2PCR SMYEV, 19 2 SMYEV, 2 2 12 SMYEV; 1 SMYEV ( 1) 212 3π 1, SMYEV SY01 YT1 /YT2 932 bp SY01 3π ( GenBank : AY955375), 3 ( Trip le gene block 3, TGB3) SY01 3π GenBank SMYEV 86% 96%, 3CH 1 SMY EV RT2PCR M: 100 bp DNA Ladder; 1: UC5; 2 10:, ; Fig. ( ) ; 11: 12: UC5 1 Detection of SMYEV in the strawberry plants by RT2PCR M: 100 bp DNA Ladder; 1: Strawberry virus indicator UC5 infected with SMYEV; 2-10: Strawberry cultivars, Hokowase, L se Zhongzi, Sweetheart, Harunoka, Minglei, Hogyoku, Gousimco, Blandenberg and Nuobinka, respectively; 11: Control of lack of reverse transcriptase (Hokowase) ; 12: Healthy strawberry virus indicator UC5. ( ) D74 ( ) TGB3 GenBank SMYEV 85% 98%, 6CH, D74 ( ) D /L113 ( ) D /

406 32 L114 ( ) D /L119 ( ) D /M1110 ( ) D /K1159 ( ) D /V1180 ( ) 7CH ( ) 69N ( ) 314CP2cav ( ) SY01 ( T2C, D74 5203 ) ( P2S) 93% 100%, 5CH ( ) D74 SMYEV 96 X ( Potato virus X, PVX) 54%, 213 SMYEV 3π SMYEV ( 2), MY18 3 (2CH 3CH 5CH ) 1, 9Redland 4 ( 6CH 4CH 10CH 7CH ) 1, SY01 15,, 1, 214 RNA 2 SMY EV 3π F ig. 2 Phylogenetic tree of the 3πnucleotide sequence of SMY EV isola tes RNA Structure 411 RNA X 3π,, 3πU RNA RNA Structure 411 SY01 3π 3 ( 3), ACUAGU, F ig. 3 SMY EV SY01 3π RNA 3 The RNA secondary structure of SMY EV isola te SY01 3π term ina l reg ion

3 : RT2PCR 3π 407, PVX 12 ACUUAA, X, 3 Hadidi 13 PCR (, ), ( ),, Kaden2Kreuziger 7 SMYEV, PCR SMYEV, IC2PCR SMYEV SMYEV,, SMYEV, SMYEV RNA SMYEV 14 15,, PCR,,,, : 1 Converse R H, Martin R R, Sp iegel S. Strawberry m ild yellow edge. In: Converse R H ed. V irus diseases of small fruits. W ashington: US Department of Agriculture, Agriculture Research Service, 1987. 25 29 2 Jelkmann W, Martin R R, Lesemann D E, Vetten H J, Skelton F. A new potexvirus associated with strawberry m ild yellow edge disease. Journal of General V irology, 1990, 71: 1251 1258 3 Lamp recht S, Jelkmann W. Infectious cdna clone used to identify strawberry m ild yellow edge associated potexvirus as causal agent of the disease. Journal of General V irology, 1997, 78: 2347 2353 4 Jawee A, Adam s A N. Serological detection of strawberry m ild yellow edge associated virus. Acta Horticulturae, 1995, 385: 98 104 5 Thomp son J R, Jelkmann W. The detection and variation of Strawberry mottle virus. Plant D isease, 2003, 87: 385 390 6 Thomp son J R, W etzel S, KlerksM M, Vagkov D, Schoen C D, Λpak J. Multip lex RT2PCR detection of four aphid2borne strawberry viruses in Fragaria spp. in combination with a p lant mrna specific internal control. Journal of V irologicalmethods, 2003, 111: 85 93 7 Kaden2Kreuziger D, Lamp recht S, Martin R R, Jelkmann W. Immunocap ture polymerase chain reaction assay and EL ISA for the detection of strawberry m ild yellow edge associated potexvirus. Acta Horticulturae, 1995, 385: 33 40 8 Jelkmann W, Maiss E, Martin R R. The nucleotide sequence and genome organization of strawberry m ild yellow edge2associated potexvirus. Journal of General V irology, 1992, 73: 475 479 9 Thomp son J R, Jelkmann W. Strain diversity and conserved genome elements in S trawberry m ild yellow edge virus. A rchives of V irology, 2004, 149: 1897 1909 10 Frazier N W. Detection of graft2transm issible diseases in strawberry by a modified leaf grafting technique. Plant D isease Reporter, 1974, 58: 203 207 11,,,,. RT2PCR., 2005, 35 ( 2) : 116 122 Yang H Y, Zhang Z H, Du G D, Dai H Y, Gao X Y. RT2PCR detection Strawberrymottle virus based internal control. ACTA Phytopatholog2 ica Sinica, 2005, 35 (2) : 116 122 ( in Chinese) 12 Pillai2Nair N, Kim K H, Hemenway C. Cis2acting regulatory elements in the Potato virus X 3πnon2translated region differentially affectm inus2 strand and p lus2strand RNA accumulation. Journal of Molecular B iology, 2003, 326: 701 720 13 Hadidi A, MontasserM S, Levy L, Goth R W, Converse R H, Madkour M A, Skrzeckows L J. Detection of potato leafroll and strawberry m ild yellow2edge luteoviruses by reverse transcrip tion2polymerase chain reaction amp lification. Plant D isease, 1993, 77: 595 600 14,,,,,.., 1990, 23 (4) : 43 49 W ang G P, L iu F C, Xue G R, Zhu Q Y, Yang Z Y, W ang H Y. Research on identification of strawberry viruses in China and techniques of obtaining virus2free strawberries. Scientia Agricultura Sinica, 1990, 23 (4) : 43 49 ( in Chinese) 15,.., 1992, 23 (3) : 163 167 W ei S Q, W u Y H. Studies on the aphid transm ission, purification and morphology of strawberry m ild yellow edge virus. Journal of Shenyang Agricultural University, 1992, 23 (3) : 163 167 ( in Chinese)