50 (1) :83-90, 2004 A cta Zoologica S inica 1 ( Ers2MIH 1) 3 D NA 33, 210097 PCR ( IPCR) 3 506 bp ( Eriocheir japonica sinensis) 1 (MIH 1) DNA ( GenBank : A Y310313) 3 2 412 bp 5 917 bp 3 U TR 1, 2 MIH 1 GT2A G MIH 1 412 bp 5, TA TA camp MIH 1 MIH 75 35, 64 % - 65 % [ 50 (1) : 83-90, 2004 ] Molecular cloning and sequence analysis of genomic D NA of the molt2inhibiting hormone 1 gene from Eriocheir japonica sinensis 3 SON G Xia, ZHOU Kai2Ya 33, MA Chang2Yan Institute of Genetic Resources, College of Life Sciences, Nanjing Normal University, Nanjing 210097, China Abstract A full2length sequence of molt2inhibiting hormone 1 (MIH 1) genomic DNA from Eriocheir japonica sinensis ( GenBank Accession No : A Y310313) was cloned by the inverse2pcr method. The sequence is 3 506 bp in size and con2 sists of 3 exons, 2 introns, 412 bp of 5 upstream regulatory region and 917 bp of 3 U TR. The first intron separates the signal peptide and the second intron separates the mature peptide in the coding region. The exon2intron boundary of the Ers2MIH 1 gene follows Chambon s rule for the splice donor and acceptor sites. The 412 bp of the upstream 5 flanking region of the MIH 1 gene contains promoter elements with characteristics similar to other eukaryotic genes. These includ2 ed sequences with high degrees of similarity to the arthropod initiator, TA TA box and camp response element binding protein. The organization of the Ers2MIH 1 gene is identical to that of the molt2inhibiting hormone gene of Charybdis f e2 riatus and Cancer pagurus. The deduced polypeptide consists of a 752amino acid mature peptide and a 352amino acid re2 gion of signal peptide. The mature peptide shares amino acid identity 64 % - 65 % to the MIH from Cancer pagurus, Carcinus m aenas and Cancer m agister [ Acta Zoologica Sinica 50 (1) : 83-90, 2004 ]. Key words Eriocheir japonica sinensis, Molt2inhibiting hormone, Molecular cloning, Sequence analysis ( Molt2inhibiting hormone, M IH) ( Crustacean hy2 M IH, CHH perglycemic hormone, CHH) CHH (Crustacean hyperglycemic hormone, CHH) X2 ( Gonad2inhibiting hormone, GIH), ( Mandibular organ2inhibiting hor2 2003207212, 2003209215 3 (No130130040) [ This research was funded by the grant of Key Project of National Natural Science Foun2 dation of China (No. 30130040) ] 33 (Corresponding author). ν 2004 Acta Zoologica Sinica E2mail : Kyzhounj @jlonline. com
4 8 50 mone, MOIH) ( Keller, 1992) Ers2M IH 1 DNA, 72-78, 6 Cys, 3 (Van Herp, 1998) M IH Y2 111 11111 M IH cdna ( Sun, 1994 ; Ohira et al., 1997 ; Lu et al., 2001) 11112 Ex Taq DNA T4 DNA Ligase ( Ta KaRa ), PCR M IH ( Ohira et al., 1999 ; Gu et al., 2001 ; Lee and Watson, 2002), p GEM g 2T Easy ( Promega ) M IH 112 M IH DNA, 11211 DNA M IH DNA 1 g, Sambrook et al. (1989) ( Chan et DNA al., 1998 ; Lu et al., 2000) ( Eriochei r japonica sinensis ), ( Chan et al., 1998 ; Lu et, al., 2000 ), Ers2M IH 1, cdna ( GenBank : A Y309062),, 2 ErsFP ErsRP (2002) PCR IFP1 IRP1 IRP2 (2003) 1, : cdna 3 RACE ErsFP : 5 2AAACCTGATCGGGAATCGTGAC23 M IH 1 ( Ers2M IH 1) cdna (, 2003), PCR (inverse2pcr, IPCR) 1 ( ), 11212 ( Charybdis f e2 riat us) ( Cancer pagurus) M IH Ers RP : 5 2A GTTA TTGCCCGA GGA TG23 IFP1 : 5 2CCAACA TCTTCCGCA TCGAC23 IRP1 : 5 2TCACA GA TCCA GTCCACCTTC23 1 PCR Ers2MIH 1 ErsFP, ErsRP 2, IFP1 IRP1 IRP2 PCR,, 1 Met, 3 Stop Fig. 1 Strategy for PCR cloning of the Ers2MIH 1 gene Primers ErsFP and ErsRP are used for the amplification of intron 2, primers IFP1, IRP1 and IRP2 are used in inverse PCR. The black boxes indicates the locations and sizes of exons. Methionine in exon 1 indicates the translation initiation site, whereas Stop in exon 3 indicates the translation termination site.
1 : 1 ( Ers2MIH 1) DNA 85 IRP2 : 5 2CTTGTA GA TGTCACGA TTCCC23 11213 PCR Ers2M IH 1 2 search/ db/ TFSEARCH1html ) PatSearch ver2 DNA ErsFP ErsRP PCR 2 : 30 l (50 mmol/ L KCl, 3 mmol/ L MgCl 2, 10 mmol/ L Tris2HCl p H 813, 015 U Taq DNA, 200 nmol/ L dn TP, 10 pmol) 100 ng DNA : 95 3 min ; 98 5 s, 60 30 s, 72 3 min, 30 ; 72 20 min 11214 IPCR Ers2M IH 1 1 5 p2distance NJ 1121411 DNA 3 g 1 000 DNA 30 l Pst, PCR 211 Ers2MIH 1 2 PCR 1121412 50 l ErsFP ErsRP PCR (66 mmol/ L Tris2HCl p H 716, 616 mmol/ L Mg2 Cl 2, 10 mmol/ L D TT, 011 mmol/ L A TP, T4DNA Ligase 350 U ), 500 ng/ ml 1121413 PCR ( IPCR) 1 PCR : 5 l 30 l (50 mmol/ L KCl, 3 mmol/ L MgCl 2, 10 mmol/ L Tris2HCl p H 813, 015 U Taq DNA, 200 nmol/ L ; 72 20 min www server ( http :/ / pdap11t rc1rwcp1or1jp/ re2 sion11 1 TRANSFAC ( http :/ / transfac1gbfbraunschweig1de/ TRANSFAC) ; Clustal X (118) ( Thomp2 son et al., 1999) Ers2M IH 1 CHH ; MEGA (211) Ers2M IH 1 4 4 M IH 1 GIH 1 CHH 1 MOIH (Neighbor2Joining), 2 1 1 ( 2), 212 Ers2MIH 1 1 5 200 ng/ ml 100 ng/ ml, 14 IPCR 18 h Pst 100 ng/ ml PCR 2 kb ( 3) Blast x, Pst Ers2M IH 1 5 dn TP, IFP1 IRP1 10 pmol), 95 1 1 2 3 min ; 98 5 s, 58 30 s, 72 6 min, 28 213 Ers2MIH 1 ; 72 7 min 2 PCR : PCR 1 PCR 1 PCR 2 3 RACE M IH 1, IFP1 IRP2 10 pmol 95 cdna ( GenBank : A Y309062) 3 min ; 96 5 s, 60 30 s, 72 3 min, 30, 3 506 bp Ers2M IH1 DNA ( 4) GenBank, 11215 PCR 2 A Y310313 PCR p GEM g 2T Easy Ers2M IH 1 DNA 3 J M109, 2 Ers2M IH 1 110, 35 75 11216 1 2, 2 Ers2M IH 1 1 1 194 bp, cdna PCR, 2 3, 2 650 bp, Ers2M IH 1 DNA ( 2 3 1 Gln 1) Arg, 2 Arg Blastp Ers2M IH 1 1 2 Swissprot ; GenomeNet M IH (Chan et al.,1998 ; Lu et
6 8 50 2 Ers2MIH 1 2 PCR M : DNA 1 : ErsFP ErsRP M : DNA 1 : PCR Fig. 2 Results of PCR amplif ication of intron 2 of Ers2 MIH 1 gene M : DNA marker DL 2 000. 1 : Amplification products of primer ErsFP and ErsRP. 3 PCR Fig. 3 Amplif ication products of inverse PCR M : DNA marker DL 2 000. 1 : Amplification products of inverse PCR. 4 Ers2MIH 1 DNA 3,, TATA, camp,, polya Fig. 4 Genomic DNA sequence of the Ers2MIH 1 3 indicates a stop codon. Putative transcription initiation site is indicated by arrow, TATA sequences are boxed. camp response element binding (CREB) elements are underlined and arthropod initiator elements are double underlined. The polyadenylation signals are indicated by dotted, underlined letters. al., 2000) Ers2M IH 1 ( Cancer m agister ) M IH Chambon 64 % - 65 %, ( Metapenaeus en2 ( GT2A G ) (Mount, 1982), Ers2M IH 1 49 % 42 % CHH 6 Cys ( 5) Blastp, Ers2M IH 1 M IH sis) ( M arsu penaeus japonicus ) M IH 144, 120, 83 % NJ ( Cancer, 5 M IH 1 GIH pagurus) ( Carcinus m aenas) 1, 3 M IH 1
1 : 1 ( Ers2MIH 1) DNA 87 5 Ers2MIH 1 MIH Fig. 5 Alignments of Ers2MIH 1 with other MIHs Cancer magister ( ) MIH (Umphrey et al., 1998), Carci nus maenas ( ) MIH ( Klein et al., 1993), Charybdis f e2 riat us ( ) MIH (Chan et al., 1998), Calli nectes sapi dus ( ) MIH (Lee et al., 1995), Marsupenaeus japonicus ( ) MIH (Ohira et al., 1997), Metapenaeus ensis ( ) MIH ( Gu and Chan, 1998), ( Carcinus m aenas) production inhibiting hormone) ( Cancer m agister ) M IH, (de Kleijn and van Herp, 1995 ; Yang et al., 1995 ; ( Charybdis f eriat us ) ( Calli nectes sapidus) M IH, 99 ( CHH precursor2related peptide, M IH 1 4 CPRP), 3 M IH, 98 C 7 2C 43 C 23 2C 39 C 26 2C 52 ; V IH ( Nephrops norvegicus) GIH, CPRP, 3 M IH, M IH CHH C 7 2C 44 C 24 2C 40 C 27 2C 53 ( Marco et MOIH M IH GIH ( al., 2000) Ers2M IH 1 DNA 6) 214 Ers2MIH 1, CPRP, Ers2M IH 1 5 3 C 7 2C 44 C 24 2C 40 C 27 2,, C 53, Ers2M IH 1 CHH V IH Blastp, Ers2M IH 1 TCA GC TA TA ( Cancer pagurus) ( Carcinus box camp ( cam P2responsive m aenas) ( Cancer m agister) element binding protein, CREB protein) M IH TGACGTAA 3 CHH 6 ( Nephrops norvegicus) GIH Cys, 3 M IH ( 6), CHH, CHH CHH V IH 2, Gen2 CHH V IH ( Vitellogenin inhibiting hor2 mone) 2, V IH RIH ( Re2 M IH 2 Lacombe et al., 1999) CHH 3 506 bp, 3 2, Ers2M IH 1 M IH, V IH M IH, Bank M IH 17, 13 cdna, 4 DNA
8 8 50 6 CHH NJ Fig. 6 NJ phylogenetic tree analysis of CHH family members amino acid sequences Carci nus maenas ( ) MIH ( Klein et al., 1993), Cancer magister ( ) MIH (Umphrey et al., 1998), Charybdis f e2 riat us ( ) MIH (Chan et al., 1998), Calli nectes sapi dus ( ) MIH (Lee et al., 1995), Nephrops norvegicus ( ) GIH ( Edomi et al., 2002), Penaeus monodon ( ) MIH ( Krungkasem et al., 2001), Metapenaeus ensis ( ) MIH ( Gu and Chan, 1998), Fenneropenaeus chi nensis ( ) MIH ( Wang et al., 2003), Marsupenaeus japonicus ( ) MIH (O2 hira et al., 1997), Carci nus maenas CHH ( Weidemann et al., 1989), L ibi nia emargi nata ( ) MOIH (Liu et al., 1997) ( Charybdis f eriat us ) ( Cancer pagurus) M IH DNA ( 4 313 bp 3 227 bp),, 5 M IH DNA PCR TCA GT (Cherbas and Cherbas, 1993), + 4 - + 8, Ers2M IH 1 + 4 DNA, DNA, TCA GC, CAP (Bucher, 1990) M IH, 24 bp 42 bp, TA TA box (Bucher, 1990) CREB, Pst (Benbrook and Jones, 1994) Ers2M IH 1 PCR, 2 ( 4) PCR CREB camp, camp M IH M IH,, M IH,,, CHH DNA cdna ( References) DNA,, DNA, PCR ( anchored PCR) ( Shyamal and Ames, 1989) PCR (Ochman et al., 1988) PCR 2, Benbrook DM, Jones NC, 1994. Different binding specificites and transactivation of variant CRES by CREB complexes. Acids Res. 22 : 1 463-1 469. Bucher P, 1990. Nucleic Weight matrix description of four eukaryotic RNA polymerase promotor elements derived from 502 unrelated pro2 motor sequences. J. Mol. Biol. 212 : 563-578. Chan SM, Chen XG, Gu PL, 1998. PCR cloning and expression of the molt2inhibiting hormone gene for the crab ( Charybdis f eriat us).
1 : 1 ( Ers2MIH 1) DNA 89 Gene 224 : 23-33. Cherbas L, Cherbas P, 1993. The arthropod initiator : the capsite con2 sensus plays an important role in transcription. Mol. Biol. 23 : 81-90. Insect Biochem. Edomi P, Azzoni E, Mettulio R, Pandolfelli N, Ferrero EA, Giulianini PG, 2002. Gonad2inhibiting hormone of the Norway lobster ( Nephrops norvegicus) : cdna cloning, expression, recombinant protein production and immunolocalization. Gene 284 (1-2) : 93-102. Gu PL, Chu KH, Chan SM, 2001. Bacterial expression of the shrimp molt2inhibiting hormone (MIH) : antibody production, immunocy2 tochemical study and biological assay. Cell Tissue Res. 303 (1) : 129-136. Gu PL, Chan SM, 1998. Cloning of a cdna encoding a putative molt2 inhibiting hormone from the eyestalk of the sand shrimp Metape2 naeus ensis. Mol. Marine Biol. Biotechnol. 7 (3) : 214-220. Keller R, 1992. Crustacean neuropeptides : structures, functions and comparative aspects. Experientia 48 : 439-448. de Kleijn DPV, van Herp F, 1995. Molecular biology of neurohormone precursors in the eyestalk of Crustacea. Compar. Biochem. Physi2 ol. 112B : 573-579. Klein J M, Mangerich S, De Kleijn DPV, Keller R, Weidemann WM, 1993. Molecular cloning of crustacean molting2inhibiting hormone (MIH) precursor. FEBS Lett. 334 : 139-142. Krungkasem C, Ohira T, Yang WJ, Abdulah R, Nagasawa H, Aida K, 2001. Identification of two distinct molt2inhibiting hormone re2 lated peptides from the giant tiger prawn, Penaeus monodon. J. Mar. Biotechnol. 20 (3) : 232-236. Lacombe C, Greve P, Martin G, 1999. Overview on the sub2grouping of the crustacean hyperglycemic hormone family. Neuropeptides 33 (1) : 71-80. Lee KJ, Elton TS, Bej A K, Watts A K, Watson RD, 1995. Molecular cloning of a cdna encoding putative molting2inhibiting hormone from the blue crab, Callinectes sapidus. Biochem. Biophys. Res. Commun. 209 : 1 126-1 131. Lee KJ, Watson RD, 2002. Expression of crustacean ( Calli nectes sapi dus) molt2inhibiting hormone in insect cells using recombinant baculovirus. J. Exp. Zool. 292 (1) : 41-51. Liu L, Laufer H, Gogarten PJ, Wang M, 1997. cdna cloning of a mandibular organ inhibiting hormone from the spider crab L ibinia emargi nata. Invert. Neurosci. 3 (2-3) : 199-204. Lu W, Wainwright G, Olohan LA, Webster SG, Rees HH, Turner PC, 2001. Characterization of cdna encoding molt2inhibiting hor2 mone of the crab, Cancer pagurus ; expression of MIH in non2x2 organ tissues. Gene 278 (1-2) : 149-159. Lu W, Wainwright G, Webster SG, Rees HH, Turner PC, 2000. Clustering of mandibular organ2inhibiting hormone and moult2in2 hibiting hormone genes in the crab, Cancer pagurus, and implica2 tions for regulation of expression. Gene 253 (2) : 197-207. Marco HG, Stoeva S, Voelter W, Gade G, 2000. Characterization and sequence elucidation of a novel peptide with molt2inhibiting activity from the South African spiny lobster, Jasus lalandii. Peptides 21 : 1 313-1 321. Mount SM, 1982. A catalogue of splice junction sequnce. Nucleic Acids Res. 10 : 459-472. Ochman H, Gerber AS, Hartl DL, 1988. Genetic applications of an in2 verse polymerase chain reaction. Genetics 120 : 621-623. Ohira T, Nishimura T, Sonobe H, Okuno A, Watanabe T, Nagasawa H, Kawazoe I, Aida K, 1999. Expression of a recombinant molt2 inhibiting hormone of the kuruma prawn Penaeus japonicus in Es2 cherichia coli. Biosci. Biotechnol. Biochem. 63 ( 9) : 1 576-1 581. Ohira T, Watanabe T, Nagasawa H, Aida K, 1997. Molecular cloning of a molt2inhibiting hormone cdna from the kuruma prawn Pe2 naeus japonicus. Zool. Sci. 14 : 785-789. Sambrook J, Fritsch E, Maniatis T, 1989. Molecular Cloning : A Lab2 oratory Manual. Cold Spring Harbor Laboratory Press. N Y: Cold Spring Harbor Laboratory. Shyamal V, Ames GFL, 1989. Genome walking by single2specific primer polymerase chain reaction : SSP2PCR. Gene 84 : 1-8. Song X, Zhou KY, Ma CY, 2003. Molecular cloning and Northern blot analysis of a cdna fragment of the molt2inhibiting hormone 1 gene from Eriochei r japonica si nensis. J. Fish Sci. Chn. 10 ( 5 ) : 353-358 ( In Chinese). Sun PS, 1994. Molecular cloning and sequence analysis of a cdna en2 coding a molt2inhibiting hormone2like neuropeptide from the white shrimp Penaeus vannamei. Mol. Mar. Biol Biotechnol. 3 : 1-6. Thompson JD, Higgins DG, Gibson TJ, 1999. CLUSTAL X multiple sequence alignment program, version 118. Umphrey HR, Lee KJ, Watson RD, E Spaziani, 1998. Molecular cloning of a cdna encoding molting2inhibiting hormone of the crab Cancer magister. Mol. Cell Endocrinol. 136 : 145-149. Van Herp F, 1998. Molecular, cytological and physiological aspects of the crustacean hyperglycaemic hormone family. In : Coast GM, Webster SG, ed. Recent Advances in Arthropod Endocrinology. Cambridge, MA : Cambridge University Press, Society for Experi2 mental Biology Seminar Series 65, 53-70. Wang ZZ, Jiao CZ, Zhang XJ, Xiang J H, 2003. Molecular cloning and sequence analysis of full length cdna encoding molt2inhibiting hor2 mone from Fennropenaeus chinensis. Acta Genet. Sin. 30 ( 2) : 128-134 ( In Chinese). Wang ZZ, Xiang J H, Cui ZX, 2002. Molecular cloning and sequence analysis of cdna encoding partial putative molt2inhibiting hormone from the crab Eriocheir sinensis. Oceanol. Limnol. Sin. 33 (4) : 432-438 ( In Chinese). Weidemann W, Gromoll J, Keller R, 1989. Cloning and sequence anal2 ysis of cdna for precursor of a crustacean hyperglycemic hormone. FEBS Lett. 257 (1) : 31-34. Yang WJ, Aida K, Nagasawa H, 1995. Amino acid sequences of a hy2 perglycemic hormone and its related peptides from the kuruma prawn, Penaeus japonicus. Aquaculture 135 : 205-212.,,, 2003. 1 (MIH 1) cdna Northern. 10 (5) : 353-358.
0 9 50,,,, 2003.,,, 2002. cdna. 30 (2) : 128-134. cdna. 33 (4) : 432-438.