Εξελικτική Οικολογία - Διάλεξη 9. Επικ. Καθ. Πουλακάκης Νίκος

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Εξελικτική Οικολογία - Διάλεξη 9. Επικ. Καθ. Πουλακάκης Νίκος poulakakis@nhmc.uoc.gr"


1 Εξελικτική Οικολογία - Διάλεξη 9 Φυλογενετικά δέντρα Εισηγητής Επικ. Καθ. Πουλακάκης Νίκος

2 Δημιουργία φυλογενετικού δέντρου Τα βήματα που περιλαμβάνονται στη δημιουργία ενός δέντρου από νουκλεοτιδικές αλληλουχίες είναι: 1) Προσδιορισμός της αλληλουχίας του DNA 2) Προσδιορισμός άλλων αλληλουχιών σχετικών με τις αλληλουχίες που εξετάζουμε και απόκτηση αυτών σε ηλεκτρονική μορφή (από world wide databases). 3) Ευθυγράμμιση των αλληλουχιών 4) Χρήση του αποτελέσματος της ευθυγράμμισης για τη δημιουργία ενός δέντρου 5) Εκτύπωση και πιθανά δημοσίευση των αποτελεσμάτων Μετά το πρώτο βήμα, απαιτείται PC με σύνδεση στο Internet και μια ομάδα κατάλληλων υπολογιστικών προγραμμάτων

3 Βάσεις δεδομένων νουκλεοτιδικών αλληλουχιών Οι βάσεις δεδομένων λειτουργούν ως χώρος αποθήκευσης και άντλησης πληροφορίας, ενώ έχουν και τη δυνατότητα αναζητήσεων και ανταλλαγής δεδομένων με άλλες βάσεις. Ο αριθμός των διαθέσιμων αλληλουχιών αυξάνει ταχύτατα. Έχουν γίνει παράλληλες προσπάθειες σε Ευρώπη, Αμερική και Ιαπωνία για τη δημιουργία βάσεων δεδομένων με όλες τις αλληλουχίες που δημοσιεύονται: a) EMBL (European Molecular Biology Laboratory) database, maintained at EMBL-EBI b) GenBank (Genetic Sequence Data Bank) maintained at NCBI (National Center for Biotechnology Information) International Nucleotide Sequence Database Collaboration c) DDBJ (DNA Data Bank of Japan) maintained at NIG/CIB

4 Βάσεις δεδομένων Τα περισσότερα περιοδικά σήμερα απαιτούν οι αλληλουχίες που πρόκειται να δημοσιευτούν να είναι κατατεθειμένες σε κάποια βάση γενετικών δεδομένων. Απαιτούν την κατάθεση σε μια βάση, χωρίς να επηρεάζει το που θα δημοσιευθεί το σύνολο των αλληλουχιών λ Ανταλλαγή δεδομένων μεταξύ των βάσεων συμβαίνει καθημερινά Οι αλληλουχίες που κατατίθενται μπορεί να διατηρηθούν υπο φύλαξη μετά από σχετική αίτηση του ερευνητή για κάποιο εύλογο χρονικό διάστημα

5 Βάσεις δεδομένων Η ποσότητα της πληροφορίας ρ στις βάσεις αυξάνει με εκπληκτικό ρυθμό. Για παράδειγμα, το 2008 είχαν αποθηκευτεί κοντά στα 100 δις βάσεις νουκλεοτιδίων και 100 εκατομμύρια αλληλουχίες.

6 Κάθε αλληλουχία στις βάσεις χαρακτηρίζεται από Βάσεις δεδομένων 1) entry name, locus name or identifier (ID): Κάθε αλληλουχία έχει ένα και μοναδικό ID 2) accession number (AC): Κάθε AC είναι μοναδικός στη βάση 3) version number: Προέρχεται από το AC και είναι ο αριθμός των φορών που η αλληλουχία έει έχει τροποποιηθεί.

7 Βάσεις δεδομένων ENTREZ Database: Είναι η πιο χρήσιμη βάση δεδομένων ειδικά για φυλογενετικές αναλύσεις. 1) Παρέχει ολοκληρωμένη πρόσβαση σε νουκλεοτιδικές και πρωτεϊνικές αλληλουχίες. 2) Διαθέτει μηχανές αναζήτησης για παρόμοιες αλληλουχίες, παράγοντας μια λίστα από σχετικές αλληλουχίες και τις αντίστοιχες βιβλιογραφικές τους αναφορές. Η βάση Entrez αντλεί δεδομένα από: a) Nucleotide databases (GenBank, EMBL, DDBJ, and PDB), b) Protein databases, c) )Structure t databases, d) Taxonomy databases, e) Genome databases, f) Expression databases, and g) Literature databases (PubMed, OMIM, Books, PubMed Central).

8 Βάσεις δεδομένων Ανάκτηση σχετικών αλληλουχιών μέσω του BLAST Συνήθως έχουμε ήδη μια αλληλουχία (νουκλεοτιδική ή πρωτεϊνική) και χρειάζεται να βρούμε άλλες σχετικές με αυτήν αλληλουχίες. Με τον όρο σχετικές εννοούμε αλληλουχίες λ που είναι όμοιες προς την υπό εξέταση αλληλουχία και θεωρούμε ότι μοιράζονται τον ίδιο κοινό πρόγονο. Ο ευκολότερος τρόπος για την εύρεση σχετικών αλληλουχιών είναι με τη χρήση ενός προγράμματος που ψάχνει μέσα στις βάσεις γενετικών δεδομένων. Η μηχανή αναζήτησης που θα χρησιμοποιήσουμε για το σκοπό αυτό ονομάζεται BLAST (Basic Local lalignment tsearch htool).

9 Βάσεις δεδομένων Η οικογένεια BLAST περιλαμβάνει διάφορα προγράμματα μεταξύ των οποίων είναι τα: 1) BLASTN, που συγκρίνει νουκλεοτιδικές αλληλουχίες 2) BLASTP, που συγκρίνει πρωτεϊνικές αλληλουχίες


11 Αποτέλεσμα έρευνας για μια αλληλουχία BLASTN

12 BLASTN Οι περισσότεροι χρήστες του BLAST είναι γνώστες της αποκαλούμενης «παραδοσιακής» αναφοράς BLAST. Ηαναφορά αυτή αποτελείται από 3 κύριες ενότητες: (1) Ηπρώτη(κορυφή σελίδας), η οποία περιέχει πληροφορίες για την υποβαλλόμενη αλληλουχία, περιλαμβάνει τη βάση δεδομένων που ελέχθηκε χη (Εικ. 1) και μια γραφική απεικόνιση των αποτελεσμάτων (Εικ. 2) 1 2

13 Τύπος προγράμματος και έκδοση Το άρθρο που περιγράφει τον BLAST

14 H κόκκινη γραμμή αντιπροσωπεύει την υποβαλλόμενη αλληλουχία. Οι αλληλουχίες της βάσης δεδομένων εμφανίζονται ευθυγραμμισμένες ως προς αυτήν. Από αυτές, οι πιο όμοιες εμφανίζονται πιο κοντά στην υποβαλλόμενη.

15 Οι 3 πρώτες έχουν υψηλό score ομοιότητας (κόκκινες). ό

16 Οι επόμενες 12 έχουν μικρότερο score (μωβ) και οι οποίες ευθυγραμμίζονται με 2 περιοχές της υποβαλλόμενης, από τη θέση 3 60 και από τη θέση Οι διαγραμμισμένες περιοχές υποδεικνύουν ότι οι δύο περιοχές είναι της ίδιας πρωτεΐνης, αλλά χωρίς ομοιότητα.

17 Οι υπόλοιπες γραμμές (πράσινες, μαύρες), υποδεικνύουν πολύ μικρό score (ομοιότητα). Τοποθετώντας το κέρσορα πάνω σε κάθε γραμμή θα εμφανίζεται η πρόταση καθορισμού για τη συγκεκριμένη αλληλουχία στο παράθυρο πάνω από το γράφημα.

18 BLASTN 2. Η δεύτερη ενότητα περιλαμβάνει σε μία σειρά την περιγραφή για κάθε αλληλουχία που ταιριάζει με την υποβαλλόμενη αλληλουχία.

19 Κάθε γραμμή αποτελείται από 4 πεδία: (α) Οαριθμόςgi, το όνομα της βάσης, ο σχετικός αριθμός εισόδου (Accession number), και το όνομα της αλληλουχίας, τα οποία διαχωρίζονται από κάθετες γραμμές, (β) σύντομη περιγραφή της αλληλουχίας (συνήθως έχει στοιχεία για τον οργανισμό από τον οποίο προέρχεται η αλληλουχία, τον τύπο της αλληλουχίας (π.χ. χ mrna ή DNA), τη λειτουργία της κ.α., (γ) το score της ευθυγράμμισης σε bits. Όσο πιο υψηλό είναι το score τόσο πιο ψηλά στη λίστα είναι η αλληλουχία και (δ) το E-value, που δίνει μια εκτίμηση της στατιστικής σημαντικότητας του αποτελέσματος.

20 Η πρώτη γραμμή του αποτελέσματος μας λέει ότι (α) ο αριθμός gi είναι , η βάση δεδομένων είναι η sp (SWISS-PROT, βάση για πρωτεΐνες με υψηλή ακρίβεια), οαριθμόςεισόδουείναι P26374, το όνομα του τόπου RAE2_HUMAN, ηγραμμήπεριγραφήςείναιrab proteins, το score είναι 1216 και το E-value είναι 0.0. Οι πρώτες αλληλουχίες έχουν πολύ χαμηλό E-values (<1) και είναι είτε πρωτεΐνες RAB είτε αναστολείς GDP. Οι υπόλοιπες με μεγαλύτερο E-values, 0.5 και άνω, υποδεικνύουν ότι μπορεί να έχουν ταιριάξει τυχαία.

21 BLASTN 3. Η τρίτη ενότητα περιλαμβάνει τις ευθυγραμμίσεις για κάθε αλληλουχία της βάσης δεδομένων με την υποβαλλόμενη αλληλουχία.

22 Η ευθυγράμμιση έπεται της γραμμής που περιγράφει την αλληλουχία. Ακολουθεί το bit score (the raw score is in parentheses) και το E-value. Η επόμενη σειρά περιέχει πληροφορίες σχετικά με τον αριθμό των στοιχείων (νουκλεοτίδια ή αμινοξέα) της στοίχισης (Identities) και, εάν υπάρχουν, ο αριθμός των κενών (gaps) στην στοίχιση.

23 Τέλος, εμφανίζεται η στοίχιση (alignment) με την υποβαλλόμενη αλληλουχία στην κορυφή και την αλληλουχία της βάσης που ταιριάζει ως αντικείμενο (Sbjct) από κάτω. Οι αριθμοί δεξιά και αριστερά είναι οι αριθμοί των στοιχείων στην αλληλουχία (νουκλεοτίδια αμινοξέα). Οι παύλες υποδεικνύουν προσθήκες ή ελλείψεις. Oι κάθετες γραμμές μεταξύ των αλληλουχιών υποδεικνύουν ομοιότητα.

24 Ευθυγράμμιση αλληλουχιών

25 Στοίχιση αλληλουχιών, ένας ορισμός Ευθυγράμμιση αλληλουχιών H διευθέτηση των νουκλεοτιδίων ή των αμινοξέων δύο ή περισσότερων αλληλουχιών σε γραμμές (συνήθως) κάθετες, συμπεριλαμβάνοντας ελλείψεις και προσθήκες όπου είναι απαραίτητο έτσι ώστε όλες οι θέσεις να θεωρούνται ομόλογες.

26 Ευθυγράμμιση αλληλουχιών H διευθέτηση δύο ή περισσότερων αλληλουχιών (νουκλεοτιδικών ή πρωτεϊνικών) σε ένα πλέγμα (μήτρα) Στοιχεία (νουκλεοτίδια, αμινοξέα) ) της ίδιας σειράς προέρχονται ρχ από το ίδιο βιολογικό μακρομόριο (πρωτεΐνη ή νουκλεϊκό οξύ) Τα στοιχεία διευθετούνται με τη σειρά που εμφανίζονται στο μακρομόριο Από το Ν στο C άκρο στις πρωτεΐνες Από το 5 στο 3 στα νουκλεϊκά οξέα

27 Στοίχιση αλληλουχιών ανά ζεύγη Pairwise Alignment: Στοίχιση 2 αλληλουχιών

28 Στοίχιση πολλαπλών αλληλουχιών Multiple Sequence Alignment (MSA): Στοίχιση 3+ αλληλουχιών

29 Στοίχιση πολλαπλών αλληλουχιών MSAs είναι ουσιαστικά ένα σύνολο από pairwise alignments Σε ένα MSA των n αλληλουχιών γίνονται n(n-1)/2 pairwise alignemnts

30 Ευθυγράμμιση αλληλουχιών Κάθε κελί περιλαμβάνει ένα μόνο στοιχείο [είτεί ένα στοιχείο είτε ένα κενό (gap)] Τα στοιχεία της ίδιας στήλης είναι είτε δομικά ισοδύναμα είτε εξελικτικά ισοδύναμα (ομόλογα) Κελί

31 Δομική Ισοδυναμία 4HHB:A - HEMOGLOBIN (DEOXY) 4HHB:B - HEMOGLOBIN (DEOXY) Βακτηριακές τοξίνες και

32 4HHB:A - HEMOGLOBIN (DEOXY) 4HHB:B - HEMOGLOBIN (DEOXY) Βακτηριακές τοξίνες και

33 4HHB:A - HEMOGLOBIN (DEOXY) 4HHB:B - HEMOGLOBIN (DEOXY) Βακτηριακές τοξίνες και

34 Εξελικτική ισοδυναμία = ομολογία Ευθυγράμμιση αλληλουχιών Αναφερόμενοι στην ίδια στήλη, ηιστορία κάθε στοιχείου θα πρέπει να αναζητηθεί στοαντίστοιχοστοιχείοτηςπρογονικήςαλληλουχίας, όπου κάθε αλλαγή οφείλεται σε σημειακές αλλαγές Προγονική αλληλουχία λ AGWYTI Δημίουργία 2 αντίγραφων AGWYTI AGWYTI Υποκατάσταση Υ-W AGWWTI AGWYTI Υποκατάσταση G-Α AGWYTI AAWYTI Προσθήκη PPP AGWYTI AAQQQWYTI Ευθυγράμμιση AGWYTI AGWYTI AGWWTI AGWYTI AGWYTI AAWYTI AG WYTI AAQQQWYTI

35 Παράδειγμα Ευθυγράμμιση αλληλουχιών Ποιο από τα 3 αποτελέσματα ευθυγράμμισης είναι το σωστό;

36 Ευθυγράμμιση αλληλουχιών Ανάλυση με διαφορετικά προγράμματα Τα διαφορετικά προγράμματα δίνουν διαφορετικά αποτελέσματα! Όλα είναι λάθος επειδή τα μοντέλα εξελικτικών διαδικασιών που χρησιμοποιούν είναι πολύ διαφορετικά από αυτό που διαφοροποίησε τις αλληλουχίες στο συγκεκριμένο παράδειγμα

37 Quiz: O αριθμός των προσθηκών Π ί λά θ ό θή ύ Ποιος είναι ο ελάχιστος αριθμός προσθήκων που απαιτούνται για την παραπάνω στοίχιση της αιμοσφαιρίνης;

38 Quiz: O αριθμός των προσθηκών Ποιος είναι ο ελάχιστος αριθμός προσθηκών που απαιτούνται για την παραπάνω στοίχιση της αιμοσφαιρίνης; Εάν όλες οι αλληλουχίες είχαν το ίδιο μήκος, θα μπορούσαμε να εξηγήσουμε την ποικιλομορφία τους χωρίς καμία προσθήκη ή έλλειψη! Εάν η στοίχιση περιέχει αλληλουχίες που έχουν όλες μήκος χ ή ψ τότε Εάν η στοίχιση περιέχει αλληλουχίες που έχουν όλες μήκος χ ή ψ, τότε μπορούμε να εξηγήσουμε την ποικιλομορφία τους με μία προσθήκη ή με μία έλλειψη!

39 Quiz: O αριθμός των προσθηκών Ποιος είναι ο ελάχιστος αριθμός προσθηκών που απαιτούνται για την παραπάνω στοίχιση της αιμοσφαιρίνης; Μπορούμε ΠΑΝΤΑ να εξηγούμε την παρατηρούμενη ποικιλομορφία στο μήκος των αλληλουχιών με: 0 ελλείψεις (η ποικιλομορφία στο μήκος οφείλεται σε προσθήκη) 0 προσθήκες (η ποικιλομορφία στο μήκος οφείλεται σε έλλειψη) συνδυασμός ελλείψεων και προσθηκών

40 Quiz: O αριθμός των προσθηκών Ποιος είναι ο ελάχιστος αριθμός προσθήκων που απαιτούνται για την παραπάνω στοίχιση της αιμοσφαιρίνης;

41 Ευθυγράμμιση αλληλουχιών Διαθέσιμα προγράμματα για pairwise alignment

42 Διαθέσιμα προγράμματα για mutliple alignment

43 Ευθυγράμμιση αλληλουχιών Ένα ζεύγος αλληλουχιών μπορεί να ευθυγραμμιστεί γράφοντας την μία αλληλουχία κάτω από την άλλη με τέτοιο τρόπο ώστε να μεγιστοποιηθεί ο αριθμός των νουκλεοτιδίων που ταιριάζουν, βάζοντας κενά (gaps) στην μια ή στην άλλη αλληλουχία όταν απαιτείται. AF TACGAAAACACCACCCAATCCTAAGAA AF TACGAAAACACGACCCAATCCTAAAAA AF TACGAAAACACCACCCTATCCTAAAAA Η ευθυγράμμιση γίνεται συνήθως με ειδικά υπολογιστικά πακέτα, που χρησιμοποιούν συγκεκριμένους αλγόριθμους. Οι περισσότεροι αλγόριθμοι αρχίζουν συγκρίνοντας την ομοιότητα των αλληλουχιών ανά ζεύγη, και ευθυγραμμίζοντας πρώτα τις δύο αλληλουχίες με τη μεγαλύτερη ομοιότητα. Οι άλλες αλληλουχίες, λ βάσει της σειράς ομοιότητας, προστίθενται σταδιακά.

44 Ευθυγράμμιση αλληλουχιών Όταν σε μια ομάδα αλληλουχιών έχουν προστεθεί κάποια κενά, τότε το τελικό alignment συχνά βελτιώνεται από τον ίδιο τον ερευνητή με manual editing. Η απόκτηση μιας καλής ευθυγράμμισης είναι ίσως το πιο σημαντικό βήμα ώστε να εκτιμήσουμε ένα σωστό φυλογενετικό δέντρο. AF TACGAA--AACACCACC---CAATCCTAAGAA C CC CC C CC G AF TACGAA--AACACGACCGGGCAATCCTAAAAA AF TACGAATTAACACCACCGGGCTATCCTAAAAA Είναι αναγκαίο να ορίσουμε τον αριθμό των gaps ώστε το τελικό αποτέλεσμα να έχει βιολογική υπόσταση. Για το λόγο αυτό χρησιμοποιείται ένα σύστημα σκοραρίσματος όπου τα ταιριάσματα παίρνουν ένα θετικό βαθμό και τα κενά ένα αρνητικό, που είναι γνωστό ως gap penalty.

45 Ευθυγράμμιση αλληλουχιών Η ευθυγράμμιση δύο αλληλουχιών δεν είναι δύσκολη υπόθεση και υπάρχουν πολυάριθμα προγράμματα για το σκοπό αυτό. Όμως η ευθυγράμμιση πολλών αλληλουχιών είναι αρκετά πολύπλοκη υπόθεση και δυστυχώς λίγα προγράμματα μπορούν να το πετύχουν. Πρόγραμμα ClustalX είναι μια ανανεωμένη έκδοση του ClustalW. Για περισσότερες πληροφορίες υπάρχει on-line ClustalX help file στο δίκτυο: p tal/clustalx_help.html

46 Δημιουργία αρχείο εισαγωγής Ευθυγράμμιση αλληλουχιών Το ClustalX, όπως και άλλα προγράμματα, απαιτούν τα δεδομένα (input file) να είναι σε ειδική μορφή ώστε να μπορεί να αναγνωριστεί από το πρόγραμμα (i.e., Fasta format). Το input file περιέχει όλες τις αλληλουχίες που θέλουμε να ευθυγραμμίσουμε. Το ClustalX αναγνωρίζει διάφορα formats για τις αλληλουχίες, αλλά εμείς θα χρησιμοποιήσουμετο μ FASTA.

47 1 ο βήμα: Εισαγωγή των δεδομένων στο ClustalX Ευθυγράμμιση αλληλουχιών

48 Ευθυγράμμιση αλληλουχιών

49 2 ο βήμα: Κθ Καθορισμός των παραμέτρων ευθυγράμμισης Ευθυγράμμιση αλληλουχιών

50 3 ο βήμα: Καθορισμός μορφής αποτελεσμάτων Ευθυγράμμιση αλληλουχιών

51 4 ο Πραγματοποίηση ευθυγράμμισης Ευθυγράμμιση αλληλουχιών Το ClustalX lx παράγει την ευθυγράμμιση σε 3 στάδια: 1) Ευθυγραμμίζει κάθε αλληλουχία με κάθε μία από τις υπόλοιπες σε μια σειρά ευθυγραμμίσεων ανά ζεύγη 2) Χρησιμοποιεί αυτό το σύνολο των ανά ζεύγη ευθυγραμμίσεων και δημιουργεί ένα δέντρο οδηγό 3) Χρησιμοποιεί το δέντρο οδηγό ώστε να παράγει την ευθυγράμμιση όλων των αλληλουχιών (multiple alignments)

52 Φυλογενετική ανάλυση Μετατροπή του αρχείου της ευθυγράμμισης σε format που ανοίγει το πρόγραμμα MEGA

53 Φυλογενετική ανάλυση

54 Φυλογενετική ανάλυση

55 Φυλογενετική ανάλυση (MS Windows Version) Υπάρχουν 4 κύριες κατηγορίες μεθόδων 1) Μέθοδοι Αποστάσεων (Distance methods: Neighbor-Joining), 2) Μέγιστης Φειδωλότητας (Maximum parsimony, MP), 3) Μέγιστης Πιθανότητας (Maximum likelihood, ML) και 4) Μπεϋζιανή Συμπερασματολογία, (Bayesian inference, BI) Καμία μέθοδος δεν είναι η καλύτερη για όλες τις περιπτώσεις. Η μέθοδος που θα χρησιμοποιήσουμε μ εξαρτάται ξρ από το τι θέλουμε να μάθουμε και από το μέγεθος και την πολυπλοκότητα των δεδομένων.

56 Φυλογενετική ανάλυση Τα προγράμματα που θα χρησιμοποιήσουμε είναι: 1) MEGA: Molecular Evolutionary Genetics Analysis 2) PAUP: Phylogenetic Analysis Using Parsimony (*and other methods) (δεδομένα DNA και πρωτεΐνες). 3) Modeltest: εύρεση του κατάλληλου μοντέλου 4) Mr Bayes 5) TreeView

57 Εκτίμηση γενετικών αποστάσεων Το πρώτο βήμα στην ανάλυση των ευθυγραμμισμένων αλληλουχιών είναι η εκτίμηση της γενετικής ή εξελικτικής απόστασης μεταξύ των αλληλουχιών Είναι ένα μέτρο του πόσο διαφορετικές είναι οι αλληλουχίες και εκφράζει τον αριθμό των εξελικτικών αλλαγών που έχουν συμβεί από τη στιγμή της απόκλισης τους Η απλούστερη μέτρηση της εξελικτικής απόστασης είναι η απόσταση p όπου n d ο αριθμός των παρατηρούμενων νουκλεοτιδικών διαφορών και n ο συνολικός αριθμός των νουκλεοτιδίων που συγκρίνονται.

58 Ωστόσο αυτή η μέτρηση η υστερεί σε πολλά σημεία, π.χ. εάν ο ρυθμός υποκατάστασης είναι υψηλός, μπορεί να έχουμε υποεκτίμηση της πραγματικής γενετικής απόστασης (ομοπλασία: back mutation, parallel mutation, multiple mutation). A C T G A---C---T---G A C---G G T---A A A---C---T C G C A C T G A A C G T A A C G C Εκτίμηση γενετικών αποστάσεων A C---A Απλή Υποκατάσταση T G A ιαδοχικές Υποκαταστάσεις A C---A Τυχαίες Υποκαταστάσεις G T---A Παράλληλες Υποκαταστάσεις A A---T Συγκλίνουσες Υποκαταστάσεις C G C---T---C Ανάστροφες Υποκαταστάσεις Αλληλουχία 1 Αλληλουχία 2 A C T G G A G G A A T C G C A A T G A A A G A A T C G C

59 Εκτίμηση γενετικών αποστάσεων First: Second: A T T T G C C G C A T T G C G C C A T es Difference Substitutions

60 Εκτίμηση γενετικών αποστάσεων Εφόσον υπάρχουν 4 τύποι νουκλεοτιδίων (Α, Τ, C και G) σε κάθε αλληλουχία, υπάρχουν 16 διαφορετικοί τύποι νουκλεοτιδικών ζευγών μεταξύ δύο αλληλουχιών Χ και Ψ. Νουκλεοτιδικό ζεύγος Όμοια ΑΑ TT CC GG Total F O 1 O 2 O 3 O 4 O Ts AG GA TC CT Total Μετάπτωση F P 1 P 2 P 3 P 4 P Α C Μεταστροφήτ Tv AC AT GT GC Total Α, G πουρίνες Τ, C, πυριμιδίνες F Q 1 Q 2 Q 3 Q 4 G T CA CG TA TG F Q 5 Q 6 Q 7 Q 8 Q R= P/Q στο ndna εως 15mtDNA

61 Εκτίμηση γενετικών αποστάσεων Δεδομένου ότι ηαπόστασηp μπορεί να υποεκτιμήσει την πραγματική ποσότητα της εξελικτικής αλλαγής, έχει γίνει μια μεγάλη προσπάθεια ανεύρεσης μοντέλων που μετατρέπουν την παρατηρούμενη η απόσταση σε πραγματική εξελικτική απόσταση. Τα μοντέλα αυτά ονομάζονται μοντέλα εξέλιξης ή μέθοδοι διόρθωσης αποστάσεων ή μοντέλα νουκλεοτιδικής υποκατάστασης. Το πρώτο μοντέλο που αναπτύχθηκε είναι των Jukes and Cantor (1969) (JC69), το οποίο θεωρεί ότι όλες οι αλλαγές μεταξύ των νουκλεοτιδίων μπορεί να συμβούν με ίση πιθανότητα d = -3/4 ln (1 4/3p)

62 1. Η απλούστερη περίπτωση: Jukes-Cantor model -- ίση πιθανότητα αλλαγής κάθε νουκλεοτιδίου A α G α α C α T

63 2. Άλλα μοντέλα λαμβάνουν υπόψη τους τις συχνότητες μεταπτώσεων και μεταστροφών A β G Μετάπτωση (Transition): από R σε R Y σε Y Μεταστροφή (Transversion): από R σε Y Y σε R α α ( ) C β T όπου R = A,G Y = C,T

64 Tamura Nei s Model Εκτίμηση γενετικών αποστάσεων Εκτίμηση γενετικών αποστάσεων = R G A R R G A g Q g g P g g g g d e log 2 1 Tamura-Nei s Model R C T Y G A Y C T Y Y C T Q g g g g g g g Q g g P g g g g e 1 l log 2 2 Y R Y R C T R Y G A Y R g g Q g g g g g g g g g g e 2 1 log 2 General Reversible Model + + Τ) ( Τ G C G C μcπ μbπ μαπ c b α μ π π π = Τ Τ Τ ) ( ) ( ) ( Τ C A C A Τ G G A A Τ G C G C μfπ f j μh μjπ μhπ μeπ μdπ e d μg μgπ μcπ μbπ μαπ c b μα Q π π π π π π π π π + + ) ( G C A G C A l k μi μlπ μkπ μiπ π π π

65 Εκτίμηση γενετικών αποστάσεων

66 MEGA 4 Φυλογενετική ανάλυση

67 Φυλογενετική ανάλυση

68 ΜΕΘΟΔΟΙ ΠΙΝΑΚΩΝ ΑΠΟΣΤΑΣΕΩΝ ΜΕΘΟΔΟΣ ΣΥΝΔΕΣΗΣ ΓΕΙΤΟΝΩΝ (NEIGHBOR JOINING) To δένδρο που παράγεται είναι άρριζο και συνήθως απαιτεί μια εξωομάδα για να βρεθεί η ρίζα. Η αρχή της μεθόδου στηρίζεται στην εύρεση των «γειτόνων» διαδοχικά ώστε να μειώνεται το συνολικό μήκος του δέντρου Παράδειγμα: Έστω ο πίνακας αποστάσεων 5 OTUs (A E) OTUs A B C D E A B C D E ---

69 Για κάθε OTU υπολογίζουμε τα μεγέθη r i : το άθροισμα των αποστάσεων της OTU i από όλες τις άλλες και r i /(n-2) όπου n ο αριθμός των OTUs OTUs A B C D E r r/n-2 A B C D E Εν συνεχεία υπολογίζουμε τις τροποποιημένες αποστάσεις (D ij ) ως εξής: D ij = d ij - r i /(n-2) - r j /(n-2), π.χ. D AB = =-1.03, 103 όποτε έχουμε

70 OTUs A B C D E r r/n-2 A B -1, C -0,94-0, D -0,63-0,61-0, E -0,58-0,56-0,68-1, Η μικρότερη (πιο αρνητική) απόσταση υποδεικνύει τις δύο OTUs που ομαδοποιούνται πρώτες (D και Ε στο παράδειγμα), μέσω ενός εσωτερικού «κόμβου 1». Η απόσταση των δύο OTUs από τον κόμβο υπολογίζεται ως εξής: d i -node = d ij /2 + [r i /(n-2) - r j /(n-2)]/2 d j -node = d ij /2 + [r j /(n-2) r i /(n-2)]/2 δηλαδή Απόσταση D κόμβος 1 = 0,12/2 + (0,79-0,69)/2 = 0,11 Απόσταση Ε κόμβος 1 = 0,12/2 + (0,69-0,79)/2 = 0,01

71 Οπότε προκύπτει 0.01 E 0.11 D Καταρτίζεται νέος πίνακας αποστάσεων στον οποίο τα OTUs D και E εμφανίζονται ως ένα σύνθετο OΤU, κόμβος-1 και ακολουθείται η ίδια διαδικασία. Οι νέες αποστάσεις των OTUs από τον κόμβο 1 υπολογίζονται από τη σχέση: D k-node(ij) =(d ik +d jk -d ij )/2 Π.χ. η απόσταση Α - κόμβος 1 D A1 =(0,70+0,65-0,12)/2=0,615 OTUs A B C D E r r/n-2 A B -1, C -0,94-0, D -0,63-0,61-0, E -0,58-0,56-0,68-1,

72 Οπότε έχουμε OTUs A B C Κόμβος 1 r r/n-2 A ,885 0,4425 B -0, , ,4575 C -0,7525-0, ,00 0,50 Κόμβος 1-0, , , , ,96 Η μικρότερη αρνητική απόσταση είναι μεταξύ του C και του κόμβου 1. Απόσταση C κόμβος 2 = 0,64/2 + (0,50-0,96)/2 = 0,09 Απόσταση κόμβου 1 κόμβος 2 = 0,64/2 + (0,96-0,50)/2 = 0,55

73 Οπότε έχουμε 0.09 C 0.01 E Καταρτίζεται νέος πίνακας αποστάσεων στον οποίο τα OTUs C και κόμβος 1 εμφανίζονται ως ένα σύνθετο OΤU, κόμβος-2 και ακολουθείται η ίδια διαδικασία. D OTUs A B Κόμ-2 r r/n-2 A , B -0, ,1775 0,1775 Κόμ-2-0,26-0, ,18

74 Επιλέγουμε το ζεύγος Α - Κόμβος 2. Απόσταση Α κόμβος 3 = 0,0825/2 + (0,1625-0,18)/2 = 0,0325 Απόσταση κόμβου 2 κόμβος 3 = 0,0825/2 + (0,18-0,1625)/2 = 0,05 Οπότε έχουμε A C E 0.11 D

75 Τέλος φτιάχνεται ο νέος πίνακας αποστάσεων μεταξύ του τελευταίου taxon και του κόμβου 3. OTUs B Κόμβος 3 B --- 0,0475 Κόμβος A B C E 0.11 D

76 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

77 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

78 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

79 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

80 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

81 Μήκη Κλάδων Branch lengths

82 Δέντρα χωρίς κλίμακα Τα μήκη των κλάδων δεν παρέχουν καμία πληροφορία Τα μήκη των κλάδων συνήθως επιλέγεται να ευθυγραμμίζονται με τα ονόματα των ΟΤUs

83 Δέντρα με κλίμακα Τα μήκη των κλάδων αντιπροσωπεύουν ένα μέτρο των διαφορών/απόστασης των OTUs που βρίσκονται στις άκρες των κλάδων

84 Δέντρα με κλίμακα Τα μήκη των κλάδων αποτελούν λύ δί δείκτη της απόστασης των OTUs Τα δέντρα θα πρέπει να παρουσιάζονται με κλίμακα (scale bar)

85 Δέντρα με κλίμακα Τα μήκη των κλάδων αποτελούν δείκτη της απόστασης των OTUs Τα δέντρα θα πρέπει να παρουσιάζονται με κλίμακα Στα ορθογώνια δέντρα,, οι γραμμές των κόμβων δεν είναι μήκη κλάδων. Το μήκος τους δεν υποδεικνύει απόσταση ΟΤUs. Π.χ. η απόσταση μεταξύ των C και G είναι το άθροισμα της πράσινης και της γαλάζιας γραμμής, όχι και της κόκκινης.

86 Μετατροπή αρχείου σε nexus format Φυλογενετική ανάλυση

87 Φυλογενετική ανάλυση

88 ΜΕΘΟΔΟΣ ΜΕΓΙΣΤΗΣ ΦΕΙΔΩΛΟΤΗΤΑΣ Η μέθοδος αυτή χρησιμοποιεί το κριτήριο της φειδωλότητας. Αρχή: το καλύτερο δέντρο είναι αυτό που απαιτεί τον μικρότερο αριθμό εξελικτικών βημάτων για την εξήγηση των διαφορών μεταξύ των μελετούμενων taxa Νουκλεοτιδικές Θέσεις Μοναδικά νουκλεοτίδια Αμετάβλητες Μεταβλητές Πληροφοριακές θέσεις Πληροφοριακή θέση: θέση που ευνοεί κάποιο δέντρο έναντι των υπολοίπων. Όταν υπάρχουν 2τουλάχιστον καταστάσεις χαρακτήρων κάθε μια από τις οποίες αντιπροσωπεύεται σε τουλάχιστον 2 από τα taxa.

89 Για παράδειγμα έστω 4 υποθετικές αλληλουχίες Νουκλεοτιδικές θέσεις Αλληλουχία A A G A G T G C A 2 A G C C G T G C T 3 A G A T A T C C A 4 A G A G A T C C T 1o Βήμα: Εντοπισμός Πληροφοριακών θέσεων Θέσεις 1, 6, 8 = αμετάβλητες Θέσεις 2, 3, 4, 5, 7 και 9 =μεταβλητές. Ποιες όμως είναι πληροφοριακές;


91 Νουκλεοτιδικές θέσεις Αλληλουχία A A G A G T G C A 2 A G C C G T G C T 3 A G A T A T C C A 4 A G A G A T C C T

92 Νουκλεοτιδικές θέσεις Αλληλουχία A A G A G T G C A 2 A G C C G T G C T 3 A G A T A T C C A 4 A G A G A T C C T


94 2o Βήμα: Υπολογισμός των απαιτούμενων εξελικτικών αλλαγών για κάθε δένδρο Για το δέντρο Ι τα εξελικτικά βήματα είναι Για το δέντρο ΙΙ τα εξελικτικά βήματα είναι Για το δέντρο ΙΙΙ τα εξελικτικά βήματα είναι o Βήμα: Άθροισμα του αριθμού των αλλαγών Για το δέντρο Ι = 4 Για το δέντρο ΙΙ = 5 Για το δέντρο ΙΙΙ = 6 4o Βήμα: Επιλογή του πιο φειδωλού δέντρου Δέντρο Ι

95 Εύρεση των ιδεατών δέντρων Αλγόριθμοι Ακριβείς αλγόριθμοι Ευρετικοί αλγόριθμοι Ακριβείς αλγόριθμοι Exhaustive (<11 taxa) Αποτίμηση όλων των δέντρων και εύρεση του πιο «καλού» Branch and Bound (11<taxa<20) Εγγυάται την εύρεση του καλύτερου δέντρου, χωρίς να απαιτείται η αποτίμηση κάθε δέντρου

96 Exhaustive search A B A B1 B2 B3 4 Κατασκευάζει ένα τυχαίο δέντρο με όλες τις αλληλουχίες. Αρχίζει από ένα δέντρο με 3 taxa. C C11 C C21-D25 C31-D35 To 4 ο taxon προστίθεται με την προσθήκη ενός νέου κλάδου στο μέσο κάθε προϋπάρχοντος κλάδου. C13 C14 C15 D151-D157 Εκτιμά το παραγόμενο δέντρο, βάσει κάποιου κριτηρίου (π.χ. χ μήκος).

97 Πιθανά δέντρα Η διακλαδωτική σειρά του δένδρου (έρριζου ζ ή άρριζου) ) καλείται τοπολογία. για έρριζα δένδρα (n 2): για άρριζα δένδρα (n 3): N R = ( 2n ) 3! 2 n 2 ( n 2 )! N U = ( 2n ) 5! n 2 3 ( n 3 )! Number of Number of rooted trees Number of unrooted trees OTUs (n) (Ν R ) (N U ) , ,135 2,027,025 34,459, ,458,046,676, ,200,794,532,637,891,559, , ,135 2,027,025 7,905,853,580, ,643,095,476,699,771,875

98 Branch and Bound search Ο αλγόριθμος αγόριθμοςξεκινάει φτιάχνοντας ένα δέντρο με όλα τα taxa, το οποίο δεν είναι απαραίτητα και το βέλτιστο και στη συνέχεια συναρμολογεί ένα δέντρο προσθέτοντας ένα taxon κάθε φορά. Α1 Β3 Για 3 taxa (A, B & C) υπάρχει ένα πιθανό δέντρο (A1). Το τέταρτο taxon (D) μπορεί να προστεθεί (branch) ως νέος κλάδος σε κάθε έναν από τους 3 εσωτερικούς κόμβους, δημιουργώντας 3 πιθανά δέντρα (B1, B2, & B3). Ελέγχουμε τα παραγόμενα δέντρα. Το Β2 δημιουργεί ένα νέο όριο (bound) με μήκος 838. Τα Β1, Β3 έχουν μεγαλύτερο μήκος (από το αρχικό τυχαίο δέντρο, 964) και απορρίπτονται και αυτά και τα παράγωγα αυτών δέντρα. Β1 Β2 Το 5 ο taxon (Ε) προστίθεται σε κάθε ένα από τους 5 εσωτερικούς κόμβους του δέντρου Β2. Ελέγχουμε τα νέα δέντρα. Τα Γ1, Γ2, Γ3 έχουν μεγαλύτερο μήκος από το αρχικό και απορρίπτονται. Το Γ4 έχει το ίδιο, ενώ το Γ5 μικρότερο δημιουργώντας ένα νέο όριο (bound), ώστε αν υπήρχε και 6 ο taxon να ξεκινούσαμε από αυτό, δημιουργώντας κάθε φορά ένα νέο όριο.

99 Branch and Bound search Στο πρώτο βήμα αποκλείονται το 1/3 των πιθανών δέντρων, στο δεύτερο το ½ των υπόλοιπων πιθανών δέντρων με αποτέλεσμα να είναι αναγκαίο να εκτιμηθεί το 1/6 των πιθανών δέντρων. Υπό ιδανικές συνθήκες μόνο ένα δέντρο θα παραμείνει σε κάθε βήμα. Η μέθοδος είναι υπολογιστικά εφικτή για αναλύσεις μέχρι 20 taxa που έχουν ~8.2*10 21 Figure modified from Krane & Raymer 2004

100 Heuristic search Ευρετική μέθοδος (>20 taxa) Όταν ο αριθμός των πιθανών δέντρων είναι μεγάλος, τότε η εκτίμηση κάθε δέντρου, χρησιμοποιώντας ακριβείς μεθόδους είναι πρακτικά αδύνατη. Η ευρετική ήμέθοδος ς( (heuristic search) είναι ουσιαστικά ένας αλγόριθμος αναρρίχησης λόφου (hill climbing), όπου επιλέγεται ένα αρχικό δέντρο και στη συνέχεια γίνονται αναδιευθετήσεις επιζητώντας τη βελτίωση του δέντρου, βάσει του δεδομένου κριτηρίου επιλογής.

101 Υπάρχουν πολυάριθμοι ευρετικοί αλγόριθμοι όπως Ευρετικοί αλγόριθμοι 1) Stepwise addition (προσομοιάζει την Branch and Bound) Αρχίζει με ένα δέντρο 3 αλληλουχιών Προσθέτει ένα taxon Εκτιμά όλα τα δέντρα Επιλέγει το δέντρο με το καλύτερο score και προσθέτει νέο taxon

102 Ευρετικοί αλγόριθμοι Μειονέκτημα: εάν το καλύτερο δέντρο σε ένα επίπεδο είναι το Α, αλλά τελικά το καλύτερο δέντρο με όλα τα taxa προέρχεται από το Β του ίδιου επιπέδου, τότε το καλύτερο δέντρο δεν θα βρεθεί. Η τεχνική stepwise θα σκαρφαλώσει στη κορυφή ενός λόφου, αλλά ο λόφος αυτός δεν είναι ο ψηλότερος.

103 Ευρετικοί αλγόριθμοι 2) Star Decomposition O αλγόριθμος ξεκινάει με όλα τα taxa να συνδέονται σε δέντρο με μορφή άστρου (star topology, όλα τα taxa συνδέονται σε ένα εσωτερικό κόμβο). Στη συνέχεια εκτιμώνται όλα τα δέντρα που δημιουργούνται με σύνδεση δύο ακραίων taxa (terminal nodes) σε μία ομάδα. Το δέντρο με τη καλύτερη τιμή (best score) διατηρείται για το επόμενο στάδιο. Σε κάθε βήμα, όταν δημιουργούμε μία νέα ομάδα, ο αριθμός των κλαδιών μειώνεται κατά ένα. Και αυτό συνεχίζεται μέχρι να έχουμε ένα διχοτομούμενο δέντρο.

104 Ευρετικοί αλγόριθμοι Branch swapping (αναδιευθέτηση κλάδων) Στοχεύει στη βελτίωση της αρχικής εκτίμησης πραγματοποιώντας προκαθορισμένες διευθετήσεις στο δέντρο. Στην ουσία είναι τρόποι να «σπρώξεις» το δέντρο να ξεκολλήσει από το τοπικό βέλτιστο και να οδηγηθεί στο συνολικό βέλτιστο. Η μέθοδος αυτή περιλαμβάνει κόψιμο του δέντρου σε ένα ή περισσότερα σημεία (subtrees) και συναρμολόγησή του με τέτοιο τρόπο ώστε να διαφέρει από το αρχικό δέντρο. Υπάρχουν 3 είδη μετακίνησης των υποδέντρων (subtrees) NNI (nearest-neighbor interchange) SPR (subtree pruning and regrafting) TBR (tree bisection and recombination)

105 Branch swapping SPR TBR NNI Εσωτερικός κλάδος Nearest Neighbor Interchange Sub-tree Pruning and Regrafting Tree bisection and reconnection

106 Branch swapping NNI Εσωτερικός κλάδος Εικόνα 1 Εικόνα 2 Εικόνα 3 Αρχικό δέντρο Ανταλλαγή Ανταλλαγή 1 με 3 2 με 3 Nearest Neighbor Interchange Η απλούστερη μέθοδος, γνωστή ως ΝΝΙ, αλλάζει τη συνδεσιμότητα των 4 υποδέντρων του κύριου δέντρου. Κάθε εσωτερικός κλάδος ενός άριζου δέντρου (εικόνα 1) έχει 4 υποδέντρα που συνδέονται σε αυτόν (ένα υποδέντρο μπορεί να αποτελείται από 1 και μόνο κόμβο). Η ΝΝΙ αλλάζει τη θέση αυτών, παράγοντας νέα δέντρα. Υπάρχουν μόνο 2 αλλαγές που οδηγούν σε νέα δέντρα (εικόνες 2 και 3). Η διαδικασία συνεχίζει για κάθε εσωτερικό κλάδο έως ότου να μην γίνονται βελτιώσεις του αρχικού δέντρου βάσει του αρχικού κριτηρίου. Ένα δέντρο με Ν>2 φύλλα (κόμβους) έχει Ν-3 εσωτερικούς κλάδους και έτσι η ΝΝΙ, που ελέγχει 2 δέντρα για κάθε εσωτερικό κλάδο, θα εξετάσει 2(Ν-3) νέα δέντρα.

107 Sub-tree Pruning and Regrafting («κλαδεύω και μπολιάζω») Εικόνα 1 Εικόνα 2 Εικόνα 3 Εικόνα 4 Εικόνα 5 Αρχικό δέντρο Μπόλιασμα του (1,2) στο κλαδί 6 Μπόλιασμα του (1,2) στο κλαδί 5 Μπόλιασμα του 3 στο κλαδί 4 Μπόλιασμα του (1,2) στο κλαδί 4 Η SSR είναι μια στρατηγική ελέγχου της τοπολογίας ενός δέντρου που προσπαθεί να βελτιώσει την αξία (πιθανότητα) ενός δέντρου μέσω της εξής διαδικασίας: 1. Επιλέγει το υποδέντρο του αρχικού δέντρου που θα κλαδέψει (pruning) 2. Αφαιρεί το υποδέντρο και το μπολιάζει σε άλλο σημείο του εναπομείναντος δέντρου, δημιουργώντας ένα νέο δέντρο (π.χ. στην εικόνα 2 κλάδεμα του (1,2) και μπόλιασμα στο κλαδί που οδηγεί στο 6 3. Η διαδικασία δ συνεχίζεται για κάθε πιθανό υποδέντρο και για κάθε κλαδί που μπορεί να το δεχτεί.

Μέθοδοι Φυλογένεσης. Μέθοδοι που βασίζονται σε αποστάσεις UPGMA Κοντινότερης γειτονίας (Neighbor joining) Fitch-Margoliash Ελάχιστης εξέλιξης

Μέθοδοι Φυλογένεσης. Μέθοδοι που βασίζονται σε αποστάσεις UPGMA Κοντινότερης γειτονίας (Neighbor joining) Fitch-Margoliash Ελάχιστης εξέλιξης Μέθοδοι Φυλογένεσης Μέθοδοι που βασίζονται σε αποστάσεις UPGMA Κοντινότερης γειτονίας (Neighbor joining) Fitch-Margoliash Ελάχιστης εξέλιξης Μέθοδοι που βασίζονται σε χαρακτήρες Μέγιστη φειδωλότητα (Maximum

Διαβάστε περισσότερα


ΦΥΛΟΓΕΝΕΤΙΚ Α ΔΕΝΤΡΑ ΦΥΛΟΓΕΝΕΤΙΚΑ ΔΕΝΤΡΑ Χαρακτηριστική πτυχή της ζωής είναι η απεριόριστη ποικιλότητα της. Δεν υπάρχουν δύο ίδια άτομα σε έναν πληθυσμό, δύο ίδιοι πληθυσμοί σε ένα είδος, δύο ίδια είδη, κ. ο. κ. Παντού, υπάρχει

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015

Βιοπληροφορική Ι. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 Βιοπληροφορική Ι Παντελής Μπάγκος Αναπληρωτής Καθηγητής Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 1 Φυλογενετικές σχέσεις Χρησιμοποιούνται οι ομοιότητες και οι διαφορές των μελετούμενων οργανισμών Τα χαρακτηριστικά

Διαβάστε περισσότερα

Βιοπληροφορική. Ενότητα 16: Μεθοδολογίες (Ανα-) Κατασκευής, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Βιοπληροφορική. Ενότητα 16: Μεθοδολογίες (Ανα-) Κατασκευής, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Βιοπληροφορική Ενότητα 16: Μεθοδολογίες (Ανα-) Κατασκευής, 2 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι Επεξήγηση των μεθόδων (ανα-)κατασκευής φυλογενετικών δέντρων. Παρουσίαση

Διαβάστε περισσότερα

Κεφάλαιο 5 ο : Αλγόριθµοι Σύγκρισης Ακολουθιών Βιολογικών εδοµένων

Κεφάλαιο 5 ο : Αλγόριθµοι Σύγκρισης Ακολουθιών Βιολογικών εδοµένων Κεφάλαιο 5 ο : Αλγόριθµοι Σύγκρισης Ακολουθιών Βιολογικών εδοµένων Σε αυτό το κεφάλαιο παρουσιάζουµε 2 βασικούς αλγορίθµους σύγκρισης ακολουθιών Βιολογικών εδοµένων τους BLAST & FASTA. Οι δυο αλγόριθµοι

Διαβάστε περισσότερα

Βιοπληροφορική. Ενότητα 6: Στοίχιση ακολουθιών ανά ζεύγη Σύστημα βαθμολόγησης, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ.

Βιοπληροφορική. Ενότητα 6: Στοίχιση ακολουθιών ανά ζεύγη Σύστημα βαθμολόγησης, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Βιοπληροφορική Ενότητα 6: Στοίχιση ακολουθιών ανά ζεύγη Σύστημα βαθμολόγησης, 2 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι Κατανόηση της σημασίας του συστήματος βαθμολόγησης

Διαβάστε περισσότερα

Μέθοδοι μελέτης εξέλιξης

Μέθοδοι μελέτης εξέλιξης H διερεύνηση της μοριακής βάσης της εξέλιξης βασίζεται σε μεγάλο βαθμό στη διευκρίνιση της διαδικασίας με την οποία μετασχηματίσθηκαν στη διάρκεια της εξέλιξης πρωτεϊνες, άλλα μόρια και βιοχημικές πορείες

Διαβάστε περισσότερα

Εφαρμοσμένη Βιοτεχνολογία Εργαστηριακή Άσκηση Εισαγωγή στην Βιοπληροφορική

Εφαρμοσμένη Βιοτεχνολογία Εργαστηριακή Άσκηση Εισαγωγή στην Βιοπληροφορική Εφαρμοσμένη Βιοτεχνολογία Εργαστηριακή Άσκηση Εισαγωγή στην Βιοπληροφορική Δραστηριότητες 1. Εύρεση γονιδίων/πρωτεϊνών από βάσεις δεδομένων 2. Ευθυγράμμιση και σύγκριση γονιδίων/πρωτεϊνών 3. Δημιουργία

Διαβάστε περισσότερα

Βιοπληροφορική. Ενότητα 6: Στοίχιση ακολουθιών ανά ζεύγη Σύστημα βαθμολόγησης, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ.

Βιοπληροφορική. Ενότητα 6: Στοίχιση ακολουθιών ανά ζεύγη Σύστημα βαθμολόγησης, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Βιοπληροφορική Ενότητα 6: Στοίχιση ακολουθιών ανά ζεύγη Σύστημα βαθμολόγησης, 2 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι Κατανόηση της σημασίας του συστήματος βαθμολόγησης

Διαβάστε περισσότερα

Βιοπληροφορική. Blast/PSI-Blast 3o εργαστήριο

Βιοπληροφορική. Blast/PSI-Blast 3o εργαστήριο Βιοπληροφορική Blast/PSI-Blast 3o εργαστήριο Αναζήτηση οµόλογων ακολουθιών σε βάσεις δεδοµένων (i) Οµόλογες ακολουθίες πιθανόν να έχουν παρόµοιες λειτουργίες. Ακολουθία επερώτησης (query sequence) Υποκείµενες

Διαβάστε περισσότερα

ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ. Βιοπληροφορική. Ενότητα 5 η : Φυλογενετική ανάλυση 2. Ηλίας Καππάς Τμήμα Βιολογίας

ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ. Βιοπληροφορική. Ενότητα 5 η : Φυλογενετική ανάλυση 2. Ηλίας Καππάς Τμήμα Βιολογίας ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Ενότητα 5 η : Φυλογενετική ανάλυση 2 Ηλίας Καππάς Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative Commons.

Διαβάστε περισσότερα

Τεχνητή Νοημοσύνη (ΥΠ23) 6 ο εξάμηνο Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Ουρανία Χατζή

Τεχνητή Νοημοσύνη (ΥΠ23) 6 ο εξάμηνο Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Ουρανία Χατζή Τεχνητή Νοημοσύνη (ΥΠ23) 6 ο εξάμηνο Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Ουρανία Χατζή raniah@hua.gr 1 Αναζήτηση Δοθέντος ενός προβλήματος με περιγραφή είτε στον χώρο καταστάσεων

Διαβάστε περισσότερα


ΠΟΛΛΑΠΛΗ ΣΤΟΙΧΙΣΗ ΑΚΟΛΟΥΘΙΩΝ I ΠΟΛΛΑΠΛΗ ΣΤΟΙΧΙΣΗ ΑΚΟΛΟΥΘΙΩΝ I Σελίδα 1 Πολλαπλή στοίχιση αποκαλύπτει συντηρημένες περιοχές αντιστοίχιση καταλοίπων με κριτήρια ομοιότητας σε επίπεδο δομής εξέλιξης λειτουργίας ακολουθίας Σελίδα 2 Πολλαπλή

Διαβάστε περισσότερα

Πολλαπλή στοίχιση Φυλογένεση

Πολλαπλή στοίχιση Φυλογένεση Πολλαπλή στοίχιση Φυλογένεση MSA: Τι είναι Στοίχιση για 3 ή περισσότερες ακολουθίες. Αποκαλύπτονται οι συντηρηµένες περιοχές µεταξύ των ακολουθιών µιας οικογένειας. Χρειάζεται για: Δηµιουργία profiles/motifs

Διαβάστε περισσότερα

Φυλογένεση. 5o εργαστήριο

Φυλογένεση. 5o εργαστήριο Φυλογένεση 5o εργαστήριο Φυλογένεση οργανισµών Δείχνει την εξελικτική πορεία µιας οµάδας οργανισµών. Οι κόµβοι (nodes) στο δένδρο απεικονίζουν γεγονότα ειδογένεσης. H φυλογένεση µπορεί να γίνει από µια

Διαβάστε περισσότερα

Λίγη εξέλιξη: οµολογία

Λίγη εξέλιξη: οµολογία Φυλογένεση Η εκτίµηση της εξελικτικής ιστορίας γονιδίων/πρωτεϊνών ή οργανισµών. Η απεικόνιση αυτής της ιστορίας γίνεται µε φυλογράµµατα/ κλαδογράµµατα Λίγη εξέλιξη: οµολογία Οµόλογα γονίδια: κοινός εξελικτικός

Διαβάστε περισσότερα

Στοίχιση κατά ζεύγη. Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment)

Στοίχιση κατά ζεύγη. Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) Στοίχιση κατά ζεύγη: Τι είναι Αντιστοίχιση των νουκλεοτιδίων/αµινοξέων δυο ακολουθιών, ώστε να εντοπιστούν οι οµοιότητες και οι διαφορές τους. Χρησιµοποιείται

Διαβάστε περισσότερα

Πίνακες αντικατάστασης PAM και BLOSUM και εναλλακτικές προσεγγίσεις

Πίνακες αντικατάστασης PAM και BLOSUM και εναλλακτικές προσεγγίσεις Πίνακες αντικατάστασης PAM και BLOSUM και εναλλακτικές προσεγγίσεις Βασίλης Προμπονάς, PhD Ερευνητικό Εργαστήριο Βιοπληροφορικής Τμήμα Βιολογικών Επιστημών Νέα Παν/πολη, Γραφείο B161 Πανεπιστήμιο Κύπρου

Διαβάστε περισσότερα

(Μερος 2 ο ) Εισηγητής: Ν. Πουλακάκης

(Μερος 2 ο ) Εισηγητής: Ν. Πουλακάκης Ταξινομικοί χαρακτήρες και Φυλογενετική ανασύσταση. Σχολές ταξινόμησης. Θεωρίες για την Ταξινομική. Φυλογενετική ανάλυση: Μοριακή συστηματική. Οι κύριες διαιρέσεις της Ζωής. (Μερος 2 ο ) Εισηγητής: Ν.

Διαβάστε περισσότερα

Ασκήσεις 1 & 2. Βάσεις Δεδομένων. Εργαλεία Αναζήτησης ClustalW & Blast

Ασκήσεις 1 & 2. Βάσεις Δεδομένων. Εργαλεία Αναζήτησης ClustalW & Blast Ασκήσεις 1 & 2 Βάσεις Δεδομένων Εργαλεία Αναζήτησης ClustalW & Blast Μοριακή Προσομοίωση Εισαγωγή: Δομική Βάση Βιολογικών Φαινομένων Η αξιοποίηση του πλήθους των δομικών στοιχείων για την εξαγωγή βιολογικά

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 12: Αναζήτηση ομοιοτήτων έναντι βάσεων δεδομένων με τη χρήση ευρετικών αλγορίθμων Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr

Διαβάστε περισσότερα

Βιοπληροφορική. Ενότητα 5: Στοίχιση ακολουθιών ανά ζεύγη, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Βιοπληροφορική. Ενότητα 5: Στοίχιση ακολουθιών ανά ζεύγη, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Βιοπληροφορική Ενότητα 5: Στοίχιση ακολουθιών ανά ζεύγη, 2 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι Κατανόηση της συσχέτισης ομολογίας ομοιότητας. Παρουσίαση των πληροφοριών

Διαβάστε περισσότερα

HMY 795: Αναγνώριση Προτύπων

HMY 795: Αναγνώριση Προτύπων HMY 795: Αναγνώριση Προτύπων Διάλεξη 5 Κατανομές πιθανότητας και εκτίμηση παραμέτρων δυαδικές τυχαίες μεταβλητές Bayesian decision Minimum misclassificaxon rate decision: διαλέγουμε την κατηγορία Ck για

Διαβάστε περισσότερα

Βιοπληροφορική. Ενότητα 15: Φυλογενετική Ανάλυση, 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Βιοπληροφορική. Ενότητα 15: Φυλογενετική Ανάλυση, 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Βιοπληροφορική Ενότητα 15: Φυλογενετική Ανάλυση, 1 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι παρουσίαση και ανάδειξη της σημασίας της φυλογενετικής ανάλυσης. παρουσίαση των

Διαβάστε περισσότερα

Αλγόριθμοι Εύρεσης Ομοιοτήτων Ακολουθιών Μέρος ΙΙ: Ευριστικές μέθοδοι αναζήτησης σε βάσεις δεδομένων

Αλγόριθμοι Εύρεσης Ομοιοτήτων Ακολουθιών Μέρος ΙΙ: Ευριστικές μέθοδοι αναζήτησης σε βάσεις δεδομένων Αλγόριθμοι Εύρεσης Ομοιοτήτων Ακολουθιών Μέρος ΙΙ: Ευριστικές μέθοδοι αναζήτησης σε βάσεις δεδομένων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of

Διαβάστε περισσότερα

ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ. Βιοπληροφορική. Ενότητα 3 η : Πολλαπλή ευθυγράμμιση. Σ. Γκέλης Τμήμα Βιολογίας

ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ. Βιοπληροφορική. Ενότητα 3 η : Πολλαπλή ευθυγράμμιση. Σ. Γκέλης Τμήμα Βιολογίας ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Ενότητα 3 η : Πολλαπλή ευθυγράμμιση Σ. Γκέλης Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative Commons. Για

Διαβάστε περισσότερα

Τεχνητή Νοημοσύνη. 4η διάλεξη ( ) Ίων Ανδρουτσόπουλος.

Τεχνητή Νοημοσύνη. 4η διάλεξη ( ) Ίων Ανδρουτσόπουλος. Τεχνητή Νοημοσύνη 4η διάλεξη (2016-17) Ίων Ανδρουτσόπουλος http://www.aueb.gr/users/ion/ 1 Οι διαφάνειες αυτής της διάλεξης βασίζονται κυρίως στα βιβλία Τεχνητή Νοημοσύνη των Βλαχάβα κ.ά., 3η έκδοση, Β.

Διαβάστε περισσότερα


ΣΤΟΙΧΙΣΗ ΑΚΟΛΟΥΘΙΩΝ ΑΝΑ ΖΕΥΓΗ ΣΤΟΙΧΙΣΗ ΑΚΟΛΟΥΘΙΩΝ ΑΝΑ ΖΕΥΓΗ Σελίδα 1 Ομολογία Σελίδα 2 Ομολογία Ομολογία κοινή εξελικτική καταγωγή Ορθόλογα γονίδια ειδογένεση συνήθως, ίδια βιολογική λειτουργία Παράλογα γονίδια γονιδιακός διπλασιασμός

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

Υπερπροσαρμογή (Overfitting) (1)

Υπερπροσαρμογή (Overfitting) (1) Αλγόριθμος C4.5 Αποφυγή υπερπροσαρμογής (overfitting) Reduced error pruning Rule post-pruning Χειρισμός χαρακτηριστικών συνεχών τιμών Επιλογή κατάλληλης μετρικής για την επιλογή των χαρακτηριστικών διάσπασης

Διαβάστε περισσότερα

PSI-Blast: τι είναι. Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης)

PSI-Blast: τι είναι. Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης) PSI-Blast PSI-Blast PSI-Blast: τι είναι PSI-Blast: Position-specific iterated Blast Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης) Altschul et al., 1997 http://www.ncbi.nlm.nih.gov/pmc/articles/pmc146917/pdf/253389.pdf

Διαβάστε περισσότερα

Λυσεις προβλημάτων τελικής φάσης Παγκύπριου Μαθητικού Διαγωνισμού Πληροφορικής 2007

Λυσεις προβλημάτων τελικής φάσης Παγκύπριου Μαθητικού Διαγωνισμού Πληροφορικής 2007 Λυσεις προβλημάτων τελικής φάσης Παγκύπριου Μαθητικού Διαγωνισμού Πληροφορικής 2007 Πρόβλημα 1 Το πρώτο πρόβλημα λύνεται με τη μέθοδο του Δυναμικού Προγραμματισμού. Για να το λύσουμε με Δυναμικό Προγραμματισμό

Διαβάστε περισσότερα


ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Αναζήτηση οµοιοτήτων ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Σελίδα 1 εδοµένα Ακολουθία επερώτησης (query sequence) Ακολουθίες στη Βάση εδοµένων (subject sequences) Αναζήτηση Μέθοδοι δυναµικού

Διαβάστε περισσότερα

Ειδικά Θέματα Βιοπληροφορικής

Ειδικά Θέματα Βιοπληροφορικής Ειδικά Θέματα Βιοπληροφορικής Παντελής Μπάγκος Αναπληρωτής Καθηγητής Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 1 Διάλεξη 5 Profile Hidden Markov Models και Transformational Grammars 2 Profile HMM Ένα ΗΜΜ με left-to-right

Διαβάστε περισσότερα

Ασκήσεις μελέτης της 6 ης διάλεξης

Ασκήσεις μελέτης της 6 ης διάλεξης Οικονομικό Πανεπιστήμιο Αθηνών, Τμήμα Πληροφορικής Μάθημα: Τεχνητή Νοημοσύνη, 2016 17 Διδάσκων: Ι. Ανδρουτσόπουλος Ασκήσεις μελέτης της 6 ης διάλεξης 6.1. (α) Το mini-score-3 παίζεται όπως το score-4,

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 1: Εισαγωγή στη Βιοπληροφορική

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 1: Εισαγωγή στη Βιοπληροφορική Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 1: Εισαγωγή στη Βιοπληροφορική Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ Μπέλλου Σοφία e-mail: sbellou@uowm.gr

Διαβάστε περισσότερα

ΣΤΑΤΙΣΤΙΚΗ ΕΠΙΧΕΙΡΗΣΕΩΝ ΕΙΔΙΚΑ ΘΕΜΑΤΑ. Κεφάλαιο 10. Εισαγωγή στην εκτιμητική


Διαβάστε περισσότερα


ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Σελίδα 1 Αναζήτηση ομοιοτήτων Δεδομένα Ακολουθία επερώτησης (query sequence) Ακολουθίες στη Βάση Δεδομένων (subject sequences) Αναζήτηση Μέθοδοι δυναμικού

Διαβάστε περισσότερα

Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC

Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC Δημήτρης Φουσκάκης, Επίκουρος Καθηγητής, Σχολή Εφαρμοσμένων Μαθηματικών και Φυσικών Επιστημών, Τομέας Μαθηματικών, Τηλέφωνο: (210) 772-1702, Φαξ: (210) 772-1775.

Διαβάστε περισσότερα

Θεωρήστε ένα puzzle (παιχνίδι σπαζοκεφαλιάς) με την ακόλουθη αρχική διαμόρφωση : b b b w w w e

Θεωρήστε ένα puzzle (παιχνίδι σπαζοκεφαλιάς) με την ακόλουθη αρχική διαμόρφωση : b b b w w w e Άσκηση 1 Θεωρήστε ένα puzzle (παιχνίδι σπαζοκεφαλιάς) με την ακόλουθη αρχική διαμόρφωση : b b b w w w e Υπάρχουν τρία μαύρα τετραγωνάκια (b), τρία άσπρα (w) και ένα κενό (e). Η σπαζοκεφαλιά έχει τις ακόλουθες

Διαβάστε περισσότερα

HMY 795: Αναγνώριση Προτύπων. Διάλεξη 2

HMY 795: Αναγνώριση Προτύπων. Διάλεξη 2 HMY 795: Αναγνώριση Προτύπων Διάλεξη 2 Επισκόπηση θεωρίας πιθανοτήτων Θεωρία πιθανοτήτων Τυχαία μεταβλητή: Μεταβλητή της οποίας δε γνωρίζουμε με βεβαιότητα την τιμή (αντίθετα με τις ντετερμινιστικές μεταβλητές)

Διαβάστε περισσότερα

HMY 795: Αναγνώριση Προτύπων

HMY 795: Αναγνώριση Προτύπων HMY 795: Αναγνώριση Προτύπων Διάλεξη 3 Επιλογή μοντέλου Επιλογή μοντέλου Θεωρία αποφάσεων Επιλογή μοντέλου δεδομένα επικύρωσης Η επιλογή του είδους του μοντέλου που θα χρησιμοποιηθεί σε ένα πρόβλημα (π.χ.

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC

Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC Περιεχόμενα Μαθήματος Εισαγωγή στο Πρόβλημα. Monte Carlo Εκτιμητές. Προσομοίωση. Αλυσίδες Markov. Αλγόριθμοι MCMC (Metropolis Hastings & Gibbs Sampling).

Διαβάστε περισσότερα

Αλγόριθμοι και Δομές Δεδομένων (IΙ) (γράφοι και δένδρα)

Αλγόριθμοι και Δομές Δεδομένων (IΙ) (γράφοι και δένδρα) Ιόνιο Πανεπιστήμιο Τμήμα Πληροφορικής Εισαγωγή στην Επιστήμη των Υπολογιστών 2016-17 Αλγόριθμοι και Δομές Δεδομένων (IΙ) (γράφοι και δένδρα) http://mixstef.github.io/courses/csintro/ Μ.Στεφανιδάκης Αφηρημένες

Διαβάστε περισσότερα

(Μέρος 1 ο ) Εισηγητής: Ν. Πουλακάκης

(Μέρος 1 ο ) Εισηγητής: Ν. Πουλακάκης Ταξινομικοί χαρακτήρες και Φυλογενετική ανασύσταση. Σχολές ταξινόμησης. Θεωρίες για την Ταξινομική. Φυλογενετική ανάλυση: Μοριακή συστηματική. Οι κύριες διαιρέσεις της Ζωής. (Μέρος 1 ο ) Εισηγητής: Ν.

Διαβάστε περισσότερα

Β Γραφικές παραστάσεις - Πρώτο γράφημα Σχεδιάζοντας το μήκος της σανίδας συναρτήσει των φάσεων της σελήνης μπορείτε να δείτε αν υπάρχει κάποιος συσχετισμός μεταξύ των μεγεθών. Ο συνήθης τρόπος γραφικής

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

Ποσοτικές Μέθοδοι στη Διοίκηση Επιχειρήσεων ΙΙ Σύνολο- Περιεχόμενο Μαθήματος

Ποσοτικές Μέθοδοι στη Διοίκηση Επιχειρήσεων ΙΙ Σύνολο- Περιεχόμενο Μαθήματος Ποσοτικές Μέθοδοι στη Διοίκηση Επιχειρήσεων ΙΙ Σύνολο- Περιεχόμενο Μαθήματος Χιωτίδης Γεώργιος Τμήμα Λογιστικής και Χρηματοοικονομικής Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Σ ΤΑΤ Ι Σ Τ Ι Κ Η. Statisticum collegium iv

Σ ΤΑΤ Ι Σ Τ Ι Κ Η. Statisticum collegium iv Σ ΤΑΤ Ι Σ Τ Ι Κ Η i Statisticum collegium iv Στατιστική Συμπερασματολογία Ι Σημειακές Εκτιμήσεις Διαστήματα Εμπιστοσύνης Στατιστική Συμπερασματολογία (Statistical Inference) Το πεδίο της Στατιστικής Συμπερασματολογία,

Διαβάστε περισσότερα

Επίλυση Προβλημάτων 1

Επίλυση Προβλημάτων 1 Επίλυση Προβλημάτων 1 Επίλυση Προβλημάτων Περιγραφή Προβλημάτων Αλγόριθμοι αναζήτησης Αλγόριθμοι τυφλής αναζήτησης Αναζήτηση πρώτα σε βάθος Αναζήτηση πρώτα σε πλάτος (ΒFS) Αλγόριθμοι ευρετικής αναζήτησης

Διαβάστε περισσότερα


ΙΑ ΟΧΙΚΕΣ ΒΕΛΤΙΩΣΕΙΣ Tel.: +30 2310998051, Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Σχολή Θετικών Επιστημών Τμήμα Φυσικής 541 24 Θεσσαλονίκη Καθηγητής Γεώργιος Θεοδώρου Ιστοσελίδα: http://users.auth.gr/theodoru ΙΑ ΟΧΙΚΕΣ ΒΕΛΤΙΩΣΕΙΣ

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015

Βιοπληροφορική Ι. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 Βιοπληροφορική Ι Παντελής Μπάγκος Αναπληρωτής Καθηγητής Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 1 Διάλεξη 4 Hidden Markov Models (HMMs) 2 Μαρκοβιανά μοντέλα εξάρτησης Η πιθανότητα εμφάνισης ενός νουκλεοτιδίου

Διαβάστε περισσότερα

Oικονομικές και Mαθηματικές Eφαρμογές

Oικονομικές και Mαθηματικές Eφαρμογές Το πακέτο ΕXCEL: Oικονομικές και Mαθηματικές Eφαρμογές Eπιμέλεια των σημειώσεων και διδασκαλία: Ευαγγελία Χαλιώτη* Θέματα ανάλυσης: - Συναρτήσεις / Γραφικές απεικονίσεις - Πράξεις πινάκων - Συστήματα εξισώσεων

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Δομές Δεδομένων Εργαστηριακή Άσκηση 2012-2013. Γκόγκος Νίκος Α.Μ.: 4973 Έτος: 3 ο Email: gkogkos@ceid.upatras.gr. Εισαγωγικά:

Δομές Δεδομένων Εργαστηριακή Άσκηση 2012-2013. Γκόγκος Νίκος Α.Μ.: 4973 Έτος: 3 ο Email: gkogkos@ceid.upatras.gr. Εισαγωγικά: Δομές Δεδομένων Εργαστηριακή Άσκηση 2012-2013 Γκόγκος Νίκος Α.Μ.: 4973 Έτος: 3 ο Email: gkogkos@ceid.upatras.gr Εισαγωγικά: Η υλοποίηση του project έχει γίνει σε python [2.7]. Τα python modules είναι αυτόνομα

Διαβάστε περισσότερα


ΠΑΡΟΥΣΙΑΣΗ ΣΤΑΤΙΣΤΙΚΩΝ ΔΕΔΟΜΕΝΩΝ ο Κεφάλαιο: Στατιστική ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΚΑΙ ΟΡΙΣΜΟΙ ΣΤΗ ΣΤΑΤΙΣΤΙΚΗ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ Πληθυσμός: Λέγεται ένα σύνολο στοιχείων που θέλουμε να εξετάσουμε με ένα ή περισσότερα χαρακτηριστικά. Μεταβλητές X: Ονομάζονται

Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα

On line αλγόριθμοι δρομολόγησης για στοχαστικά δίκτυα σε πραγματικό χρόνο

On line αλγόριθμοι δρομολόγησης για στοχαστικά δίκτυα σε πραγματικό χρόνο On line αλγόριθμοι δρομολόγησης για στοχαστικά δίκτυα σε πραγματικό χρόνο Υπ. Διδάκτωρ : Ευαγγελία Χρυσοχόου Επιβλέπων Καθηγητής: Αθανάσιος Ζηλιασκόπουλος Τμήμα Μηχανολόγων Μηχανικών Περιεχόμενα Εισαγωγή

Διαβάστε περισσότερα

Αριθμητική εύρεση ριζών μη γραμμικών εξισώσεων

Αριθμητική εύρεση ριζών μη γραμμικών εξισώσεων Αριθμητική εύρεση ριζών μη γραμμικών εξισώσεων Με τον όρο μη γραμμικές εξισώσεις εννοούμε εξισώσεις της μορφής: f( ) 0 που προέρχονται από συναρτήσεις f () που είναι μη γραμμικές ως προς. Περιέχουν δηλαδή

Διαβάστε περισσότερα


ΕΛΕΓΧΟΣ ΠΑΡΑΓΩΓΙΚΩΝ ΔΙΕΡΓΑΣΙΩΝ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ Ανώτατο Εκπαιδευτικό Ίδρυμα Πειραιά Τεχνολογικού Τομέα ΕΛΕΓΧΟΣ ΠΑΡΑΓΩΓΙΚΩΝ ΔΙΕΡΓΑΣΙΩΝ Ενότητα: Αναγνώριση Διεργασίας - Προσαρμοστικός Έλεγχος (Process Identification) Αλαφοδήμος Κωνσταντίνος

Διαβάστε περισσότερα

Συνδυασμός Μαθηματικών με γραφικές παραστάσεις

Συνδυασμός Μαθηματικών με γραφικές παραστάσεις Το πρόγραμμα Origin Συνδυασμός Μαθηματικών με γραφικές παραστάσεις Δημιουργία γραφικής παράστασης συνάρτησης Για να δημιουργήσετε τη γραφική παράσταση από μια συνάρτηση επιλέξτε File-New-Graph To Origin

Διαβάστε περισσότερα

HMY 795: Αναγνώριση Προτύπων

HMY 795: Αναγνώριση Προτύπων HMY 795: Αναγνώριση Προτύπων Διαλέξεις 7 8 Μπεϋζιανή εκτίμηση συνέχεια Μη παραμετρικές μέθοδοι εκτίμησης πυκνότητας Εκτίμηση ML για την κανονική κατανομή Μπεϋζιανή εκτίμηση για την κανονική κατανομή Γνωστή

Διαβάστε περισσότερα


ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Ενότητα 1 η : Εισαγωγή. Ηλίας Καππάς Τμήμα Βιολογίας ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ Ενότητα 1 η : Εισαγωγή Ηλίας Καππάς Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative Commons.

Διαβάστε περισσότερα

Εξερευνώντας την Εξέλιξη Κεφάλαιο 7

Εξερευνώντας την Εξέλιξη Κεφάλαιο 7 Εξερευνώντας την Εξέλιξη Κεφάλαιο 7 Εξερευνώντας την Εξέλιξη Σχέση μεταξύ αλληλουχίας αμινοξέων, δομής και λειτουργίας πρωτεϊνών Καταγωγή από έναν κοινό πρόγονο Εξελικτική Συγγένεια/Προέλευση Δύο ομάδες

Διαβάστε περισσότερα

SilverPlatter WebSPIRS 4.1.

SilverPlatter WebSPIRS 4.1. WebSPIRS 4.1. Η υπηρεσία WebSPIRS από τη SilverPlatter αποτελεί ένα φιλικό εργαλείο πρόσβασης και αναζήτησης σε περιεχόμενα βάσεων δεδομένων. Η Βιβλιοθήκη και Κέντρο Πληροφόρησης του Πανεπιστημίου Θεσσαλίας

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 10: Κατασκευή φυλογενετικών δέντρων

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 10: Κατασκευή φυλογενετικών δέντρων Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 10: Κατασκευή φυλογενετικών δέντρων Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ Μπέλλου Σοφία e-mail: sbellou@uowm.gr

Διαβάστε περισσότερα

Βάσεις δεδομένων αλληλουχιών

Βάσεις δεδομένων αλληλουχιών Βάσεις δεδομένων αλληλουχιών Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus ΣΥΝΟΨΗ Βάσεις δεδομένων νουκλεοτιδικών αλληλουχιών Λίγη ιστορία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ταξινόµιση οργανισµών

Ταξινόµιση οργανισµών Ταξινόµιση οργανισµών Ιεραρχική κατηγοριοποίηση/ οµαδοποίηση οργανισµών. Linnaeus (1707-1778) οµαδοποίησε οργανισµούς µε βάση κοινούς χαρακτήρες. Αργότερα, η ταξινόµιση προσαρµόστηκε στην εξελικτική θεωρία

Διαβάστε περισσότερα

21. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 4 - ΔΗΜΙΟΥΡΓΩΝΤΑΣ ΜΕ ΤΟ BYOB BYOB. Αλγόριθμος Διαδικασία Παράμετροι

21. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 4 - ΔΗΜΙΟΥΡΓΩΝΤΑΣ ΜΕ ΤΟ BYOB BYOB. Αλγόριθμος Διαδικασία Παράμετροι 21. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 4 - ΔΗΜΙΟΥΡΓΩΝΤΑΣ ΜΕ ΤΟ BYOB BYOB Αλγόριθμος Διαδικασία Παράμετροι Τι είναι Αλγόριθμος; Οι οδηγίες που δίνουμε με λογική σειρά, ώστε να εκτελέσουμε μια διαδικασία ή να επιλύσουμε ένα

Διαβάστε περισσότερα

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers

Διαβάστε περισσότερα


2. ΧΡΗΣΗ ΣΤΑΤΙΣΤΙΚΩΝ ΠΑΚΕΤΩΝ ΣΤΗ ΓΡΑΜΜΙΚΗ ΠΑΛΙΝΔΡΟΜΗΣΗ 2. ΧΡΗΣΗ ΣΤΑΤΙΣΤΙΚΩΝ ΠΑΚΕΤΩΝ ΣΤΗ ΓΡΑΜΜΙΚΗ ΠΑΛΙΝΔΡΟΜΗΣΗ Η χρησιμοποίηση των τεχνικών της παλινδρόμησης για την επίλυση πρακτικών προβλημάτων έχει διευκολύνει εξαιρετικά από την χρήση διαφόρων στατιστικών

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 9: Φυλογενετική ανάλυση

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 9: Φυλογενετική ανάλυση Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 9: Φυλογενετική ανάλυση Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ Μπέλλου Σοφία e-mail: sbellou@uowm.gr Τμήμα

Διαβάστε περισσότερα

Κατανεμημένα Συστήματα Ι

Κατανεμημένα Συστήματα Ι Κατανεμημένα Συστήματα Ι Παναγιώτα Παναγοπούλου 11η Διάλεξη 12 Ιανουαρίου 2017 1 Ανεξάρτητο σύνολο Δοθέντος ενός μη κατευθυνόμενου γραφήματος G = (V, E), ένα ανεξάρτητο σύνολο (independent set) είναι ένα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Οι Εξελικτικοί Αλγόριθμοι (ΕΑ) είναι καθολικοί στοχαστικοί αλγόριθμοι βελτιστοποίησης, εμπνευσμένοι από τις βασικές αρχές της φυσικής εξέλιξης.

Οι Εξελικτικοί Αλγόριθμοι (ΕΑ) είναι καθολικοί στοχαστικοί αλγόριθμοι βελτιστοποίησης, εμπνευσμένοι από τις βασικές αρχές της φυσικής εξέλιξης. Οι Εξελικτικοί Αλγόριθμοι (ΕΑ) είναι καθολικοί στοχαστικοί αλγόριθμοι βελτιστοποίησης, εμπνευσμένοι από τις βασικές αρχές της φυσικής εξέλιξης. Ένα από τα γνωστότερα παραδείγματα των ΕΑ είναι ο Γενετικός

Διαβάστε περισσότερα

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά;

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; ΒΙΟΛΟΓΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ 12 26/10/2016 Κεφάλαιο 3 Α μέρος Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; Ποια είναι η δομή

Διαβάστε περισσότερα

Βοηθητικό Εγχειρίδιο

Βοηθητικό Εγχειρίδιο AGFN EXPERT LITE Χρηµατιστήριο Αθηνών Χρηµατιστήριο Αξιών Κύπρου Βοηθητικό Εγχειρίδιο Version ΠΕΡΙΕΧΟΜΕΝΑ 1. ΕΙΣΑΓΩΓΗ... 2 1.1. ΕΚΚΙΝΗΣΗ ΕΦΑΡΜΟΓΗΣ AGFN EXPERTLITE... 2 2. ΣΥΝ ΕΣΗ (LOGIN)... 3

Διαβάστε περισσότερα


ΤΥΦΛΗ ΑΝΑΖΗΤΗΣΗ (1) ΣΤΡΑΤΗΓΙΚΗ Ή ΑΛΓΟΡΙΘΜΟΣ ΑΝΑΖΗΤΗΣΗΣ ΤΥΦΛΗ ΑΝΑΖΗΤΗΣΗ (1) ΣΤΡΑΤΗΓΙΚΗ Ή ΑΛΓΟΡΙΘΜΟΣ ΑΝΑΖΗΤΗΣΗΣ Μια αυστηρά καθορισµένη ακολουθία ενεργειών µε σκοπό τη λύση ενός προβλήµατος. Χαρακτηριστικά οθέν πρόβληµα: P= Επιλυθέν πρόβληµα: P s

Διαβάστε περισσότερα


ΑΡΧΕΣ ΒΙΟΛΟΓΙΚΗΣ ΜΗΧΑΝΙΚΗΣ ΑΡΧΕΣ ΒΙΟΛΟΓΙΚΗΣ ΜΗΧΑΝΙΚΗΣ Εργαστήριο Βιοπληροφορικής 7 ο εξάμηνο Σχολή Μηχανολόγων Μηχανικών ΕΜΠ Διδάσκων: Λεωνίδας Αλεξόπουλος Fritz Kahn (1888 1968) 1 Περιεχόμενα Ομοιότητα πρωτεϊνών Σύγκριση αλληλουχιών

Διαβάστε περισσότερα

Graph Algorithms. Παρουσίαση στα πλαίσια του μαθήματος «Παράλληλοι Αλγόριθμοι» Καούρη Γεωργία Μήτσου Βάλια

Graph Algorithms. Παρουσίαση στα πλαίσια του μαθήματος «Παράλληλοι Αλγόριθμοι» Καούρη Γεωργία Μήτσου Βάλια Graph Algorithms Παρουσίαση στα πλαίσια του μαθήματος «Παράλληλοι Αλγόριθμοι» Καούρη Γεωργία Μήτσου Βάλια Περιεχόμενα Μεταβατικό Κλείσιμο Συνεκτικές συνιστώσες Συντομότερα μονοπάτια Breadth First Spanning

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κεφάλαιο 9. Έλεγχοι υποθέσεων

Κεφάλαιο 9. Έλεγχοι υποθέσεων Κεφάλαιο 9 Έλεγχοι υποθέσεων 9.1 Εισαγωγή Όταν παίρνουμε ένα ή περισσότερα τυχαία δείγμα από κανονικούς πληθυσμούς έχουμε τη δυνατότητα να υπολογίζουμε στατιστικά, όπως μέσους όρους, δειγματικές διασπορές

Διαβάστε περισσότερα

Βιοπληροφορική. Ενότητα 13: Μοντέλα Πολλαπλής Στοίχισης (1/2), 1.5ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Βιοπληροφορική. Ενότητα 13: Μοντέλα Πολλαπλής Στοίχισης (1/2), 1.5ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Βιοπληροφορική Ενότητα 13: Μοντέλα Πολλαπλής Στοίχισης (1/2), 1.5ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι παρουσίαση των μοντέλων πολλαπλής στοίχισης. κατανόηση των εφαρμογών

Διαβάστε περισσότερα

Βιοπληροφορική. Βάσεις Δεδοµένων 1ο εργαστήριο. Γρηγόρης Αµούτζιας

Βιοπληροφορική. Βάσεις Δεδοµένων 1ο εργαστήριο. Γρηγόρης Αµούτζιας Βιοπληροφορική Βάσεις Δεδοµένων 1ο εργαστήριο Γρηγόρης Αµούτζιας Χρησιµοποιούνται για: Oργάνωση Αποθήκευση Επεξεργασία Αναζήτηση/επαναπόκτηση της βιολογικής πληροφορίας Βάσεις Δεδοµένων: Εισαγωγή Βάσεις

Διαβάστε περισσότερα

Χρήστος Ι. Σχοινάς Αν. Καθηγητής ΔΠΘ. Συμπληρωματικές σημειώσεις για το μάθημα: «Επιχειρησιακή Έρευνα ΙΙ»

Χρήστος Ι. Σχοινάς Αν. Καθηγητής ΔΠΘ. Συμπληρωματικές σημειώσεις για το μάθημα: «Επιχειρησιακή Έρευνα ΙΙ» Χρήστος Ι. Σχοινάς Αν. Καθηγητής ΔΠΘ Συμπληρωματικές σημειώσεις για το μάθημα: «Επιχειρησιακή Έρευνα ΙΙ» 2 ΔΥΝΑΜΙΚΟΣ ΠΡΟΓΡΑΜΜΑΤΙΣΜΟΣ Προβλήματα ελάχιστης συνεκτικότητας δικτύου Το πρόβλημα της ελάχιστης

Διαβάστε περισσότερα

Υ: Νόσος. Χ: Παράγοντας Κινδύνου 1 (Ασθενής) 2 (Υγιής) Σύνολο. 1 (Παρόν) n 11 n 12 n 1. 2 (Απών) n 21 n 22 n 2. Σύνολο n.1 n.2 n..

Υ: Νόσος. Χ: Παράγοντας Κινδύνου 1 (Ασθενής) 2 (Υγιής) Σύνολο. 1 (Παρόν) n 11 n 12 n 1. 2 (Απών) n 21 n 22 n 2. Σύνολο n.1 n.2 n.. Μέτρα Κινδύνου για Δίτιμα Κατηγορικά Δεδομένα Σε αυτή την ενότητα θα ορίσουμε δείκτες μέτρησης του κινδύνου εμφάνισης μίας νόσου όταν έχουμε δίτιμες κατηγορικές μεταβλητές. Στην πιο απλή περίπτωση μας

Διαβάστε περισσότερα

Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R

Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R, Επίκουρος Καθηγητής, Τομέας Μαθηματικών, Σχολή Εφαρμοσμένων Μαθηματικών και Φυσικών Επιστημών, Εθνικό Μετσόβιο Πολυτεχνείο. Περιεχόμενα Εισαγωγή στο

Διαβάστε περισσότερα

Διπλωματική Εργασία: «Συγκριτική Μελέτη Μηχανισμών Εκτίμησης Ελλιπούς Πληροφορίας σε Ασύρματα Δίκτυα Αισθητήρων»

Διπλωματική Εργασία: «Συγκριτική Μελέτη Μηχανισμών Εκτίμησης Ελλιπούς Πληροφορίας σε Ασύρματα Δίκτυα Αισθητήρων» Τμήμα Πληροφορικής και Τηλεπικοινωνιών Πρόγραμμα Μεταπτυχιακών Σπουδών Διπλωματική Εργασία: «Συγκριτική Μελέτη Μηχανισμών Εκτίμησης Ελλιπούς Πληροφορίας σε Ασύρματα Δίκτυα Αισθητήρων» Αργυροπούλου Αιμιλία

Διαβάστε περισσότερα

Τεχνητή Νοημοσύνη (ΥΠ23) 6 ο εξάμηνο Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Ουρανία Χατζή

Τεχνητή Νοημοσύνη (ΥΠ23) 6 ο εξάμηνο Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Ουρανία Χατζή Τεχνητή Νοημοσύνη (ΥΠ23) 6 ο εξάμηνο Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Ουρανία Χατζή raniah@hua.gr 1 Αλγόριθμοι Ευριστικής Αναζήτησης Πολλές φορές η τυφλή αναζήτηση δεν επαρκεί

Διαβάστε περισσότερα

Συγκριτική Γονιδιωματική

Συγκριτική Γονιδιωματική ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ ΙΙ Συγκριτική Γονιδιωματική Παντελής Μπάγκος 1 2 Μέθοδοι Ανάλυσης Μέθοδοι βασισμένες στην ομοιότητα ακολουθιών Τοπική ομοιότητα Ολική ομοιότητα Προγνωστικές μέθοδοι Δευτεροταγής δομή Διαμεμβρανικά

Διαβάστε περισσότερα

Υ: Νόσος. Χ: Παράγοντας Κινδύνου 1 (Ασθενής) 2 (Υγιής) Σύνολο. 1 (Παρόν) n 11 n 12 n 1. 2 (Απών) n 21 n 22 n 2. Σύνολο n.1 n.2 n..

Υ: Νόσος. Χ: Παράγοντας Κινδύνου 1 (Ασθενής) 2 (Υγιής) Σύνολο. 1 (Παρόν) n 11 n 12 n 1. 2 (Απών) n 21 n 22 n 2. Σύνολο n.1 n.2 n.. Μέτρα Κινδύνου για Δίτιμα Κατηγορικά Δεδομένα Σε αυτή την ενότητα θα ορίσουμε δείκτες μέτρησης του κινδύνου εμφάνισης μίας νόσου όταν έχουμε δίτιμες κατηγορικές μεταβλητές. Στην πιο απλή περίπτωση μας

Διαβάστε περισσότερα

Μέτρα θέσης και διασποράς

Μέτρα θέσης και διασποράς Μέτρα θέσης και διασποράς Η επικρατούσα τιμή ως μέτρο κεντρικής τάσης Εύκολο στον υπολογισμό Επικρατούσα τιμή Η πιο συχνή ή η πιο συχνά εμφανιζόμενη τιμή σε ένα σύνολο τιμών 11, 3, 8, 2, 1, 5, 3, 7 Επικρατούσα

Διαβάστε περισσότερα

HMY 795: Αναγνώριση Προτύπων

HMY 795: Αναγνώριση Προτύπων HMY 795: Αναγνώριση Προτύπων Διάλεξη 2 Επισκόπηση θεωρίας πιθανοτήτων Τυχαίες μεταβλητές: Βασικές έννοιες Τυχαία μεταβλητή: Μεταβλητή της οποίας δε γνωρίζουμε με βεβαιότητα την τιμή (σε αντίθεση με τις

Διαβάστε περισσότερα

Κεφάλαιο 8 Μέθοδοι ανάλυσης κυκλωμάτων

Κεφάλαιο 8 Μέθοδοι ανάλυσης κυκλωμάτων Κεφάλαιο 8 Μέθοδοι ανάλυσης κυκλωμάτων 8 Μέθοδοι ανάλυσης κυκλωμάτων ΠΕΡΙΕΧΟΜΕΝΑ ΚΕΦΑΛΑΙΟΥ Συστήματα εξισώσεων στην ανάλυση κυκλωμάτων Η μέθοδος των ρευμάτων βρόχων Η μεθοδος των ρευμάτων των κλάδων 2

Διαβάστε περισσότερα

Επίλυση προβληµάτων. Αλγόριθµοι Αναζήτησης

Επίλυση προβληµάτων. Αλγόριθµοι Αναζήτησης Επίλυση προβληµάτων! Περιγραφή προβληµάτων Αλγόριθµοι αναζήτησης Αλγόριθµοι τυφλής αναζήτησης Αλγόριθµοι ευρετικής αναζήτησης Παιχνίδια δύο αντιπάλων Προβλήµατα ικανοποίησης περιορισµών Γενικά " Τεχνητή

Διαβάστε περισσότερα

Εφαρμόζονται σε προβλήματα στα οποία δεν υπάρχει πληροφορία που να επιτρέπει την αξιολόγηση των καταστάσεων του χώρου αναζήτησης.

Εφαρμόζονται σε προβλήματα στα οποία δεν υπάρχει πληροφορία που να επιτρέπει την αξιολόγηση των καταστάσεων του χώρου αναζήτησης. Ανάλογα με το αν ένας αλγόριθμος αναζήτησης χρησιμοποιεί πληροφορία σχετική με το πρόβλημα για να επιλέξει την επόμενη κατάσταση στην οποία θα μεταβεί, οι αλγόριθμοι αναζήτησης χωρίζονται σε μεγάλες κατηγορίες,

Διαβάστε περισσότερα