Εξελικτική Οικολογία - Διάλεξη 9. Επικ. Καθ. Πουλακάκης Νίκος

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Εξελικτική Οικολογία - Διάλεξη 9. Επικ. Καθ. Πουλακάκης Νίκος poulakakis@nhmc.uoc.gr"

Transcript

1 Εξελικτική Οικολογία - Διάλεξη 9 Φυλογενετικά δέντρα Εισηγητής Επικ. Καθ. Πουλακάκης Νίκος

2 Δημιουργία φυλογενετικού δέντρου Τα βήματα που περιλαμβάνονται στη δημιουργία ενός δέντρου από νουκλεοτιδικές αλληλουχίες είναι: 1) Προσδιορισμός της αλληλουχίας του DNA 2) Προσδιορισμός άλλων αλληλουχιών σχετικών με τις αλληλουχίες που εξετάζουμε και απόκτηση αυτών σε ηλεκτρονική μορφή (από world wide databases). 3) Ευθυγράμμιση των αλληλουχιών 4) Χρήση του αποτελέσματος της ευθυγράμμισης για τη δημιουργία ενός δέντρου 5) Εκτύπωση και πιθανά δημοσίευση των αποτελεσμάτων Μετά το πρώτο βήμα, απαιτείται PC με σύνδεση στο Internet και μια ομάδα κατάλληλων υπολογιστικών προγραμμάτων

3 Βάσεις δεδομένων νουκλεοτιδικών αλληλουχιών Οι βάσεις δεδομένων λειτουργούν ως χώρος αποθήκευσης και άντλησης πληροφορίας, ενώ έχουν και τη δυνατότητα αναζητήσεων και ανταλλαγής δεδομένων με άλλες βάσεις. Ο αριθμός των διαθέσιμων αλληλουχιών αυξάνει ταχύτατα. Έχουν γίνει παράλληλες προσπάθειες σε Ευρώπη, Αμερική και Ιαπωνία για τη δημιουργία βάσεων δεδομένων με όλες τις αλληλουχίες που δημοσιεύονται: a) EMBL (European Molecular Biology Laboratory) database, maintained at EMBL-EBI b) GenBank (Genetic Sequence Data Bank) maintained at NCBI (National Center for Biotechnology Information) International Nucleotide Sequence Database Collaboration c) DDBJ (DNA Data Bank of Japan) maintained at NIG/CIB

4 Βάσεις δεδομένων Τα περισσότερα περιοδικά σήμερα απαιτούν οι αλληλουχίες που πρόκειται να δημοσιευτούν να είναι κατατεθειμένες σε κάποια βάση γενετικών δεδομένων. Απαιτούν την κατάθεση σε μια βάση, χωρίς να επηρεάζει το που θα δημοσιευθεί το σύνολο των αλληλουχιών λ Ανταλλαγή δεδομένων μεταξύ των βάσεων συμβαίνει καθημερινά Οι αλληλουχίες που κατατίθενται μπορεί να διατηρηθούν υπο φύλαξη μετά από σχετική αίτηση του ερευνητή για κάποιο εύλογο χρονικό διάστημα

5 Βάσεις δεδομένων Η ποσότητα της πληροφορίας ρ στις βάσεις αυξάνει με εκπληκτικό ρυθμό. Για παράδειγμα, το 2008 είχαν αποθηκευτεί κοντά στα 100 δις βάσεις νουκλεοτιδίων και 100 εκατομμύρια αλληλουχίες.

6 Κάθε αλληλουχία στις βάσεις χαρακτηρίζεται από Βάσεις δεδομένων 1) entry name, locus name or identifier (ID): Κάθε αλληλουχία έχει ένα και μοναδικό ID 2) accession number (AC): Κάθε AC είναι μοναδικός στη βάση 3) version number: Προέρχεται από το AC και είναι ο αριθμός των φορών που η αλληλουχία έει έχει τροποποιηθεί.

7 Βάσεις δεδομένων ENTREZ Database: Είναι η πιο χρήσιμη βάση δεδομένων ειδικά για φυλογενετικές αναλύσεις. 1) Παρέχει ολοκληρωμένη πρόσβαση σε νουκλεοτιδικές και πρωτεϊνικές αλληλουχίες. 2) Διαθέτει μηχανές αναζήτησης για παρόμοιες αλληλουχίες, παράγοντας μια λίστα από σχετικές αλληλουχίες και τις αντίστοιχες βιβλιογραφικές τους αναφορές. Η βάση Entrez αντλεί δεδομένα από: a) Nucleotide databases (GenBank, EMBL, DDBJ, and PDB), b) Protein databases, c) )Structure t databases, d) Taxonomy databases, e) Genome databases, f) Expression databases, and g) Literature databases (PubMed, OMIM, Books, PubMed Central).

8 Βάσεις δεδομένων Ανάκτηση σχετικών αλληλουχιών μέσω του BLAST Συνήθως έχουμε ήδη μια αλληλουχία (νουκλεοτιδική ή πρωτεϊνική) και χρειάζεται να βρούμε άλλες σχετικές με αυτήν αλληλουχίες. Με τον όρο σχετικές εννοούμε αλληλουχίες λ που είναι όμοιες προς την υπό εξέταση αλληλουχία και θεωρούμε ότι μοιράζονται τον ίδιο κοινό πρόγονο. Ο ευκολότερος τρόπος για την εύρεση σχετικών αλληλουχιών είναι με τη χρήση ενός προγράμματος που ψάχνει μέσα στις βάσεις γενετικών δεδομένων. Η μηχανή αναζήτησης που θα χρησιμοποιήσουμε για το σκοπό αυτό ονομάζεται BLAST (Basic Local lalignment tsearch htool).

9 Βάσεις δεδομένων Η οικογένεια BLAST περιλαμβάνει διάφορα προγράμματα μεταξύ των οποίων είναι τα: 1) BLASTN, που συγκρίνει νουκλεοτιδικές αλληλουχίες 2) BLASTP, που συγκρίνει πρωτεϊνικές αλληλουχίες

10 BLASTN

11 Αποτέλεσμα έρευνας για μια αλληλουχία BLASTN

12 BLASTN Οι περισσότεροι χρήστες του BLAST είναι γνώστες της αποκαλούμενης «παραδοσιακής» αναφοράς BLAST. Ηαναφορά αυτή αποτελείται από 3 κύριες ενότητες: (1) Ηπρώτη(κορυφή σελίδας), η οποία περιέχει πληροφορίες για την υποβαλλόμενη αλληλουχία, περιλαμβάνει τη βάση δεδομένων που ελέχθηκε χη (Εικ. 1) και μια γραφική απεικόνιση των αποτελεσμάτων (Εικ. 2) 1 2

13 Τύπος προγράμματος και έκδοση Το άρθρο που περιγράφει τον BLAST

14 H κόκκινη γραμμή αντιπροσωπεύει την υποβαλλόμενη αλληλουχία. Οι αλληλουχίες της βάσης δεδομένων εμφανίζονται ευθυγραμμισμένες ως προς αυτήν. Από αυτές, οι πιο όμοιες εμφανίζονται πιο κοντά στην υποβαλλόμενη.

15 Οι 3 πρώτες έχουν υψηλό score ομοιότητας (κόκκινες). ό

16 Οι επόμενες 12 έχουν μικρότερο score (μωβ) και οι οποίες ευθυγραμμίζονται με 2 περιοχές της υποβαλλόμενης, από τη θέση 3 60 και από τη θέση Οι διαγραμμισμένες περιοχές υποδεικνύουν ότι οι δύο περιοχές είναι της ίδιας πρωτεΐνης, αλλά χωρίς ομοιότητα.

17 Οι υπόλοιπες γραμμές (πράσινες, μαύρες), υποδεικνύουν πολύ μικρό score (ομοιότητα). Τοποθετώντας το κέρσορα πάνω σε κάθε γραμμή θα εμφανίζεται η πρόταση καθορισμού για τη συγκεκριμένη αλληλουχία στο παράθυρο πάνω από το γράφημα.

18 BLASTN 2. Η δεύτερη ενότητα περιλαμβάνει σε μία σειρά την περιγραφή για κάθε αλληλουχία που ταιριάζει με την υποβαλλόμενη αλληλουχία.

19 Κάθε γραμμή αποτελείται από 4 πεδία: (α) Οαριθμόςgi, το όνομα της βάσης, ο σχετικός αριθμός εισόδου (Accession number), και το όνομα της αλληλουχίας, τα οποία διαχωρίζονται από κάθετες γραμμές, (β) σύντομη περιγραφή της αλληλουχίας (συνήθως έχει στοιχεία για τον οργανισμό από τον οποίο προέρχεται η αλληλουχία, τον τύπο της αλληλουχίας (π.χ. χ mrna ή DNA), τη λειτουργία της κ.α., (γ) το score της ευθυγράμμισης σε bits. Όσο πιο υψηλό είναι το score τόσο πιο ψηλά στη λίστα είναι η αλληλουχία και (δ) το E-value, που δίνει μια εκτίμηση της στατιστικής σημαντικότητας του αποτελέσματος.

20 Η πρώτη γραμμή του αποτελέσματος μας λέει ότι (α) ο αριθμός gi είναι , η βάση δεδομένων είναι η sp (SWISS-PROT, βάση για πρωτεΐνες με υψηλή ακρίβεια), οαριθμόςεισόδουείναι P26374, το όνομα του τόπου RAE2_HUMAN, ηγραμμήπεριγραφήςείναιrab proteins, το score είναι 1216 και το E-value είναι 0.0. Οι πρώτες αλληλουχίες έχουν πολύ χαμηλό E-values (<1) και είναι είτε πρωτεΐνες RAB είτε αναστολείς GDP. Οι υπόλοιπες με μεγαλύτερο E-values, 0.5 και άνω, υποδεικνύουν ότι μπορεί να έχουν ταιριάξει τυχαία.

21 BLASTN 3. Η τρίτη ενότητα περιλαμβάνει τις ευθυγραμμίσεις για κάθε αλληλουχία της βάσης δεδομένων με την υποβαλλόμενη αλληλουχία.

22 Η ευθυγράμμιση έπεται της γραμμής που περιγράφει την αλληλουχία. Ακολουθεί το bit score (the raw score is in parentheses) και το E-value. Η επόμενη σειρά περιέχει πληροφορίες σχετικά με τον αριθμό των στοιχείων (νουκλεοτίδια ή αμινοξέα) της στοίχισης (Identities) και, εάν υπάρχουν, ο αριθμός των κενών (gaps) στην στοίχιση.

23 Τέλος, εμφανίζεται η στοίχιση (alignment) με την υποβαλλόμενη αλληλουχία στην κορυφή και την αλληλουχία της βάσης που ταιριάζει ως αντικείμενο (Sbjct) από κάτω. Οι αριθμοί δεξιά και αριστερά είναι οι αριθμοί των στοιχείων στην αλληλουχία (νουκλεοτίδια αμινοξέα). Οι παύλες υποδεικνύουν προσθήκες ή ελλείψεις. Oι κάθετες γραμμές μεταξύ των αλληλουχιών υποδεικνύουν ομοιότητα.

24 Ευθυγράμμιση αλληλουχιών

25 Στοίχιση αλληλουχιών, ένας ορισμός Ευθυγράμμιση αλληλουχιών H διευθέτηση των νουκλεοτιδίων ή των αμινοξέων δύο ή περισσότερων αλληλουχιών σε γραμμές (συνήθως) κάθετες, συμπεριλαμβάνοντας ελλείψεις και προσθήκες όπου είναι απαραίτητο έτσι ώστε όλες οι θέσεις να θεωρούνται ομόλογες.

26 Ευθυγράμμιση αλληλουχιών H διευθέτηση δύο ή περισσότερων αλληλουχιών (νουκλεοτιδικών ή πρωτεϊνικών) σε ένα πλέγμα (μήτρα) Στοιχεία (νουκλεοτίδια, αμινοξέα) ) της ίδιας σειράς προέρχονται ρχ από το ίδιο βιολογικό μακρομόριο (πρωτεΐνη ή νουκλεϊκό οξύ) Τα στοιχεία διευθετούνται με τη σειρά που εμφανίζονται στο μακρομόριο Από το Ν στο C άκρο στις πρωτεΐνες Από το 5 στο 3 στα νουκλεϊκά οξέα

27 Στοίχιση αλληλουχιών ανά ζεύγη Pairwise Alignment: Στοίχιση 2 αλληλουχιών

28 Στοίχιση πολλαπλών αλληλουχιών Multiple Sequence Alignment (MSA): Στοίχιση 3+ αλληλουχιών

29 Στοίχιση πολλαπλών αλληλουχιών MSAs είναι ουσιαστικά ένα σύνολο από pairwise alignments Σε ένα MSA των n αλληλουχιών γίνονται n(n-1)/2 pairwise alignemnts

30 Ευθυγράμμιση αλληλουχιών Κάθε κελί περιλαμβάνει ένα μόνο στοιχείο [είτεί ένα στοιχείο είτε ένα κενό (gap)] Τα στοιχεία της ίδιας στήλης είναι είτε δομικά ισοδύναμα είτε εξελικτικά ισοδύναμα (ομόλογα) Κελί

31 Δομική Ισοδυναμία 4HHB:A - HEMOGLOBIN (DEOXY) 4HHB:B - HEMOGLOBIN (DEOXY) Βακτηριακές τοξίνες και

32 4HHB:A - HEMOGLOBIN (DEOXY) 4HHB:B - HEMOGLOBIN (DEOXY) Βακτηριακές τοξίνες και

33 4HHB:A - HEMOGLOBIN (DEOXY) 4HHB:B - HEMOGLOBIN (DEOXY) Βακτηριακές τοξίνες και

34 Εξελικτική ισοδυναμία = ομολογία Ευθυγράμμιση αλληλουχιών Αναφερόμενοι στην ίδια στήλη, ηιστορία κάθε στοιχείου θα πρέπει να αναζητηθεί στοαντίστοιχοστοιχείοτηςπρογονικήςαλληλουχίας, όπου κάθε αλλαγή οφείλεται σε σημειακές αλλαγές Προγονική αλληλουχία λ AGWYTI Δημίουργία 2 αντίγραφων AGWYTI AGWYTI Υποκατάσταση Υ-W AGWWTI AGWYTI Υποκατάσταση G-Α AGWYTI AAWYTI Προσθήκη PPP AGWYTI AAQQQWYTI Ευθυγράμμιση AGWYTI AGWYTI AGWWTI AGWYTI AGWYTI AAWYTI AG WYTI AAQQQWYTI

35 Παράδειγμα Ευθυγράμμιση αλληλουχιών Ποιο από τα 3 αποτελέσματα ευθυγράμμισης είναι το σωστό;

36 Ευθυγράμμιση αλληλουχιών Ανάλυση με διαφορετικά προγράμματα Τα διαφορετικά προγράμματα δίνουν διαφορετικά αποτελέσματα! Όλα είναι λάθος επειδή τα μοντέλα εξελικτικών διαδικασιών που χρησιμοποιούν είναι πολύ διαφορετικά από αυτό που διαφοροποίησε τις αλληλουχίες στο συγκεκριμένο παράδειγμα

37 Quiz: O αριθμός των προσθηκών Π ί λά θ ό θή ύ Ποιος είναι ο ελάχιστος αριθμός προσθήκων που απαιτούνται για την παραπάνω στοίχιση της αιμοσφαιρίνης;

38 Quiz: O αριθμός των προσθηκών Ποιος είναι ο ελάχιστος αριθμός προσθηκών που απαιτούνται για την παραπάνω στοίχιση της αιμοσφαιρίνης; Εάν όλες οι αλληλουχίες είχαν το ίδιο μήκος, θα μπορούσαμε να εξηγήσουμε την ποικιλομορφία τους χωρίς καμία προσθήκη ή έλλειψη! Εάν η στοίχιση περιέχει αλληλουχίες που έχουν όλες μήκος χ ή ψ τότε Εάν η στοίχιση περιέχει αλληλουχίες που έχουν όλες μήκος χ ή ψ, τότε μπορούμε να εξηγήσουμε την ποικιλομορφία τους με μία προσθήκη ή με μία έλλειψη!

39 Quiz: O αριθμός των προσθηκών Ποιος είναι ο ελάχιστος αριθμός προσθηκών που απαιτούνται για την παραπάνω στοίχιση της αιμοσφαιρίνης; Μπορούμε ΠΑΝΤΑ να εξηγούμε την παρατηρούμενη ποικιλομορφία στο μήκος των αλληλουχιών με: 0 ελλείψεις (η ποικιλομορφία στο μήκος οφείλεται σε προσθήκη) 0 προσθήκες (η ποικιλομορφία στο μήκος οφείλεται σε έλλειψη) συνδυασμός ελλείψεων και προσθηκών

40 Quiz: O αριθμός των προσθηκών Ποιος είναι ο ελάχιστος αριθμός προσθήκων που απαιτούνται για την παραπάνω στοίχιση της αιμοσφαιρίνης;

41 Ευθυγράμμιση αλληλουχιών Διαθέσιμα προγράμματα για pairwise alignment

42 Διαθέσιμα προγράμματα για mutliple alignment

43 Ευθυγράμμιση αλληλουχιών Ένα ζεύγος αλληλουχιών μπορεί να ευθυγραμμιστεί γράφοντας την μία αλληλουχία κάτω από την άλλη με τέτοιο τρόπο ώστε να μεγιστοποιηθεί ο αριθμός των νουκλεοτιδίων που ταιριάζουν, βάζοντας κενά (gaps) στην μια ή στην άλλη αλληλουχία όταν απαιτείται. AF TACGAAAACACCACCCAATCCTAAGAA AF TACGAAAACACGACCCAATCCTAAAAA AF TACGAAAACACCACCCTATCCTAAAAA Η ευθυγράμμιση γίνεται συνήθως με ειδικά υπολογιστικά πακέτα, που χρησιμοποιούν συγκεκριμένους αλγόριθμους. Οι περισσότεροι αλγόριθμοι αρχίζουν συγκρίνοντας την ομοιότητα των αλληλουχιών ανά ζεύγη, και ευθυγραμμίζοντας πρώτα τις δύο αλληλουχίες με τη μεγαλύτερη ομοιότητα. Οι άλλες αλληλουχίες, λ βάσει της σειράς ομοιότητας, προστίθενται σταδιακά.

44 Ευθυγράμμιση αλληλουχιών Όταν σε μια ομάδα αλληλουχιών έχουν προστεθεί κάποια κενά, τότε το τελικό alignment συχνά βελτιώνεται από τον ίδιο τον ερευνητή με manual editing. Η απόκτηση μιας καλής ευθυγράμμισης είναι ίσως το πιο σημαντικό βήμα ώστε να εκτιμήσουμε ένα σωστό φυλογενετικό δέντρο. AF TACGAA--AACACCACC---CAATCCTAAGAA C CC CC C CC G AF TACGAA--AACACGACCGGGCAATCCTAAAAA AF TACGAATTAACACCACCGGGCTATCCTAAAAA Είναι αναγκαίο να ορίσουμε τον αριθμό των gaps ώστε το τελικό αποτέλεσμα να έχει βιολογική υπόσταση. Για το λόγο αυτό χρησιμοποιείται ένα σύστημα σκοραρίσματος όπου τα ταιριάσματα παίρνουν ένα θετικό βαθμό και τα κενά ένα αρνητικό, που είναι γνωστό ως gap penalty.

45 Ευθυγράμμιση αλληλουχιών Η ευθυγράμμιση δύο αλληλουχιών δεν είναι δύσκολη υπόθεση και υπάρχουν πολυάριθμα προγράμματα για το σκοπό αυτό. Όμως η ευθυγράμμιση πολλών αλληλουχιών είναι αρκετά πολύπλοκη υπόθεση και δυστυχώς λίγα προγράμματα μπορούν να το πετύχουν. Πρόγραμμα ClustalX είναι μια ανανεωμένη έκδοση του ClustalW. Για περισσότερες πληροφορίες υπάρχει on-line ClustalX help file στο δίκτυο: p tal/clustalx_help.html

46 Δημιουργία αρχείο εισαγωγής Ευθυγράμμιση αλληλουχιών Το ClustalX, όπως και άλλα προγράμματα, απαιτούν τα δεδομένα (input file) να είναι σε ειδική μορφή ώστε να μπορεί να αναγνωριστεί από το πρόγραμμα (i.e., Fasta format). Το input file περιέχει όλες τις αλληλουχίες που θέλουμε να ευθυγραμμίσουμε. Το ClustalX αναγνωρίζει διάφορα formats για τις αλληλουχίες, αλλά εμείς θα χρησιμοποιήσουμετο μ FASTA.

47 1 ο βήμα: Εισαγωγή των δεδομένων στο ClustalX Ευθυγράμμιση αλληλουχιών

48 Ευθυγράμμιση αλληλουχιών

49 2 ο βήμα: Κθ Καθορισμός των παραμέτρων ευθυγράμμισης Ευθυγράμμιση αλληλουχιών

50 3 ο βήμα: Καθορισμός μορφής αποτελεσμάτων Ευθυγράμμιση αλληλουχιών

51 4 ο Πραγματοποίηση ευθυγράμμισης Ευθυγράμμιση αλληλουχιών Το ClustalX lx παράγει την ευθυγράμμιση σε 3 στάδια: 1) Ευθυγραμμίζει κάθε αλληλουχία με κάθε μία από τις υπόλοιπες σε μια σειρά ευθυγραμμίσεων ανά ζεύγη 2) Χρησιμοποιεί αυτό το σύνολο των ανά ζεύγη ευθυγραμμίσεων και δημιουργεί ένα δέντρο οδηγό 3) Χρησιμοποιεί το δέντρο οδηγό ώστε να παράγει την ευθυγράμμιση όλων των αλληλουχιών (multiple alignments)

52 Φυλογενετική ανάλυση Μετατροπή του αρχείου της ευθυγράμμισης σε format που ανοίγει το πρόγραμμα MEGA

53 Φυλογενετική ανάλυση

54 Φυλογενετική ανάλυση

55 Φυλογενετική ανάλυση (MS Windows Version) Υπάρχουν 4 κύριες κατηγορίες μεθόδων 1) Μέθοδοι Αποστάσεων (Distance methods: Neighbor-Joining), 2) Μέγιστης Φειδωλότητας (Maximum parsimony, MP), 3) Μέγιστης Πιθανότητας (Maximum likelihood, ML) και 4) Μπεϋζιανή Συμπερασματολογία, (Bayesian inference, BI) Καμία μέθοδος δεν είναι η καλύτερη για όλες τις περιπτώσεις. Η μέθοδος που θα χρησιμοποιήσουμε μ εξαρτάται ξρ από το τι θέλουμε να μάθουμε και από το μέγεθος και την πολυπλοκότητα των δεδομένων.

56 Φυλογενετική ανάλυση Τα προγράμματα που θα χρησιμοποιήσουμε είναι: 1) MEGA: Molecular Evolutionary Genetics Analysis 2) PAUP: Phylogenetic Analysis Using Parsimony (*and other methods) (δεδομένα DNA και πρωτεΐνες). 3) Modeltest: εύρεση του κατάλληλου μοντέλου 4) Mr Bayes 5) TreeView

57 Εκτίμηση γενετικών αποστάσεων Το πρώτο βήμα στην ανάλυση των ευθυγραμμισμένων αλληλουχιών είναι η εκτίμηση της γενετικής ή εξελικτικής απόστασης μεταξύ των αλληλουχιών Είναι ένα μέτρο του πόσο διαφορετικές είναι οι αλληλουχίες και εκφράζει τον αριθμό των εξελικτικών αλλαγών που έχουν συμβεί από τη στιγμή της απόκλισης τους Η απλούστερη μέτρηση της εξελικτικής απόστασης είναι η απόσταση p όπου n d ο αριθμός των παρατηρούμενων νουκλεοτιδικών διαφορών και n ο συνολικός αριθμός των νουκλεοτιδίων που συγκρίνονται.

58 Ωστόσο αυτή η μέτρηση η υστερεί σε πολλά σημεία, π.χ. εάν ο ρυθμός υποκατάστασης είναι υψηλός, μπορεί να έχουμε υποεκτίμηση της πραγματικής γενετικής απόστασης (ομοπλασία: back mutation, parallel mutation, multiple mutation). A C T G A---C---T---G A C---G G T---A A A---C---T C G C A C T G A A C G T A A C G C Εκτίμηση γενετικών αποστάσεων A C---A Απλή Υποκατάσταση T G A ιαδοχικές Υποκαταστάσεις A C---A Τυχαίες Υποκαταστάσεις G T---A Παράλληλες Υποκαταστάσεις A A---T Συγκλίνουσες Υποκαταστάσεις C G C---T---C Ανάστροφες Υποκαταστάσεις Αλληλουχία 1 Αλληλουχία 2 A C T G G A G G A A T C G C A A T G A A A G A A T C G C

59 Εκτίμηση γενετικών αποστάσεων First: Second: A T T T G C C G C A T T G C G C C A T es Difference Substitutions

60 Εκτίμηση γενετικών αποστάσεων Εφόσον υπάρχουν 4 τύποι νουκλεοτιδίων (Α, Τ, C και G) σε κάθε αλληλουχία, υπάρχουν 16 διαφορετικοί τύποι νουκλεοτιδικών ζευγών μεταξύ δύο αλληλουχιών Χ και Ψ. Νουκλεοτιδικό ζεύγος Όμοια ΑΑ TT CC GG Total F O 1 O 2 O 3 O 4 O Ts AG GA TC CT Total Μετάπτωση F P 1 P 2 P 3 P 4 P Α C Μεταστροφήτ Tv AC AT GT GC Total Α, G πουρίνες Τ, C, πυριμιδίνες F Q 1 Q 2 Q 3 Q 4 G T CA CG TA TG F Q 5 Q 6 Q 7 Q 8 Q R= P/Q στο ndna εως 15mtDNA

61 Εκτίμηση γενετικών αποστάσεων Δεδομένου ότι ηαπόστασηp μπορεί να υποεκτιμήσει την πραγματική ποσότητα της εξελικτικής αλλαγής, έχει γίνει μια μεγάλη προσπάθεια ανεύρεσης μοντέλων που μετατρέπουν την παρατηρούμενη η απόσταση σε πραγματική εξελικτική απόσταση. Τα μοντέλα αυτά ονομάζονται μοντέλα εξέλιξης ή μέθοδοι διόρθωσης αποστάσεων ή μοντέλα νουκλεοτιδικής υποκατάστασης. Το πρώτο μοντέλο που αναπτύχθηκε είναι των Jukes and Cantor (1969) (JC69), το οποίο θεωρεί ότι όλες οι αλλαγές μεταξύ των νουκλεοτιδίων μπορεί να συμβούν με ίση πιθανότητα d = -3/4 ln (1 4/3p)

62 1. Η απλούστερη περίπτωση: Jukes-Cantor model -- ίση πιθανότητα αλλαγής κάθε νουκλεοτιδίου A α G α α C α T

63 2. Άλλα μοντέλα λαμβάνουν υπόψη τους τις συχνότητες μεταπτώσεων και μεταστροφών A β G Μετάπτωση (Transition): από R σε R Y σε Y Μεταστροφή (Transversion): από R σε Y Y σε R α α ( ) C β T όπου R = A,G Y = C,T

64 Tamura Nei s Model Εκτίμηση γενετικών αποστάσεων Εκτίμηση γενετικών αποστάσεων = R G A R R G A g Q g g P g g g g d e log 2 1 Tamura-Nei s Model R C T Y G A Y C T Y Y C T Q g g g g g g g Q g g P g g g g e 1 l log 2 2 Y R Y R C T R Y G A Y R g g Q g g g g g g g g g g e 2 1 log 2 General Reversible Model + + Τ) ( Τ G C G C μcπ μbπ μαπ c b α μ π π π = Τ Τ Τ ) ( ) ( ) ( Τ C A C A Τ G G A A Τ G C G C μfπ f j μh μjπ μhπ μeπ μdπ e d μg μgπ μcπ μbπ μαπ c b μα Q π π π π π π π π π + + ) ( G C A G C A l k μi μlπ μkπ μiπ π π π

65 Εκτίμηση γενετικών αποστάσεων

66 MEGA 4 Φυλογενετική ανάλυση

67 Φυλογενετική ανάλυση

68 ΜΕΘΟΔΟΙ ΠΙΝΑΚΩΝ ΑΠΟΣΤΑΣΕΩΝ ΜΕΘΟΔΟΣ ΣΥΝΔΕΣΗΣ ΓΕΙΤΟΝΩΝ (NEIGHBOR JOINING) To δένδρο που παράγεται είναι άρριζο και συνήθως απαιτεί μια εξωομάδα για να βρεθεί η ρίζα. Η αρχή της μεθόδου στηρίζεται στην εύρεση των «γειτόνων» διαδοχικά ώστε να μειώνεται το συνολικό μήκος του δέντρου Παράδειγμα: Έστω ο πίνακας αποστάσεων 5 OTUs (A E) OTUs A B C D E A B C D E ---

69 Για κάθε OTU υπολογίζουμε τα μεγέθη r i : το άθροισμα των αποστάσεων της OTU i από όλες τις άλλες και r i /(n-2) όπου n ο αριθμός των OTUs OTUs A B C D E r r/n-2 A B C D E Εν συνεχεία υπολογίζουμε τις τροποποιημένες αποστάσεις (D ij ) ως εξής: D ij = d ij - r i /(n-2) - r j /(n-2), π.χ. D AB = =-1.03, 103 όποτε έχουμε

70 OTUs A B C D E r r/n-2 A B -1, C -0,94-0, D -0,63-0,61-0, E -0,58-0,56-0,68-1, Η μικρότερη (πιο αρνητική) απόσταση υποδεικνύει τις δύο OTUs που ομαδοποιούνται πρώτες (D και Ε στο παράδειγμα), μέσω ενός εσωτερικού «κόμβου 1». Η απόσταση των δύο OTUs από τον κόμβο υπολογίζεται ως εξής: d i -node = d ij /2 + [r i /(n-2) - r j /(n-2)]/2 d j -node = d ij /2 + [r j /(n-2) r i /(n-2)]/2 δηλαδή Απόσταση D κόμβος 1 = 0,12/2 + (0,79-0,69)/2 = 0,11 Απόσταση Ε κόμβος 1 = 0,12/2 + (0,69-0,79)/2 = 0,01

71 Οπότε προκύπτει 0.01 E 0.11 D Καταρτίζεται νέος πίνακας αποστάσεων στον οποίο τα OTUs D και E εμφανίζονται ως ένα σύνθετο OΤU, κόμβος-1 και ακολουθείται η ίδια διαδικασία. Οι νέες αποστάσεις των OTUs από τον κόμβο 1 υπολογίζονται από τη σχέση: D k-node(ij) =(d ik +d jk -d ij )/2 Π.χ. η απόσταση Α - κόμβος 1 D A1 =(0,70+0,65-0,12)/2=0,615 OTUs A B C D E r r/n-2 A B -1, C -0,94-0, D -0,63-0,61-0, E -0,58-0,56-0,68-1,

72 Οπότε έχουμε OTUs A B C Κόμβος 1 r r/n-2 A ,885 0,4425 B -0, , ,4575 C -0,7525-0, ,00 0,50 Κόμβος 1-0, , , , ,96 Η μικρότερη αρνητική απόσταση είναι μεταξύ του C και του κόμβου 1. Απόσταση C κόμβος 2 = 0,64/2 + (0,50-0,96)/2 = 0,09 Απόσταση κόμβου 1 κόμβος 2 = 0,64/2 + (0,96-0,50)/2 = 0,55

73 Οπότε έχουμε 0.09 C 0.01 E Καταρτίζεται νέος πίνακας αποστάσεων στον οποίο τα OTUs C και κόμβος 1 εμφανίζονται ως ένα σύνθετο OΤU, κόμβος-2 και ακολουθείται η ίδια διαδικασία. D OTUs A B Κόμ-2 r r/n-2 A , B -0, ,1775 0,1775 Κόμ-2-0,26-0, ,18

74 Επιλέγουμε το ζεύγος Α - Κόμβος 2. Απόσταση Α κόμβος 3 = 0,0825/2 + (0,1625-0,18)/2 = 0,0325 Απόσταση κόμβου 2 κόμβος 3 = 0,0825/2 + (0,18-0,1625)/2 = 0,05 Οπότε έχουμε A C E 0.11 D

75 Τέλος φτιάχνεται ο νέος πίνακας αποστάσεων μεταξύ του τελευταίου taxon και του κόμβου 3. OTUs B Κόμβος 3 B --- 0,0475 Κόμβος A B C E 0.11 D

76 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

77 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

78 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

79 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

80 Ανάλυση Σύνδεσης Γειτόνων στο MEGA

81 Μήκη Κλάδων Branch lengths

82 Δέντρα χωρίς κλίμακα Τα μήκη των κλάδων δεν παρέχουν καμία πληροφορία Τα μήκη των κλάδων συνήθως επιλέγεται να ευθυγραμμίζονται με τα ονόματα των ΟΤUs

83 Δέντρα με κλίμακα Τα μήκη των κλάδων αντιπροσωπεύουν ένα μέτρο των διαφορών/απόστασης των OTUs που βρίσκονται στις άκρες των κλάδων

84 Δέντρα με κλίμακα Τα μήκη των κλάδων αποτελούν λύ δί δείκτη της απόστασης των OTUs Τα δέντρα θα πρέπει να παρουσιάζονται με κλίμακα (scale bar)

85 Δέντρα με κλίμακα Τα μήκη των κλάδων αποτελούν δείκτη της απόστασης των OTUs Τα δέντρα θα πρέπει να παρουσιάζονται με κλίμακα Στα ορθογώνια δέντρα,, οι γραμμές των κόμβων δεν είναι μήκη κλάδων. Το μήκος τους δεν υποδεικνύει απόσταση ΟΤUs. Π.χ. η απόσταση μεταξύ των C και G είναι το άθροισμα της πράσινης και της γαλάζιας γραμμής, όχι και της κόκκινης.

86 Μετατροπή αρχείου σε nexus format Φυλογενετική ανάλυση

87 Φυλογενετική ανάλυση

88 ΜΕΘΟΔΟΣ ΜΕΓΙΣΤΗΣ ΦΕΙΔΩΛΟΤΗΤΑΣ Η μέθοδος αυτή χρησιμοποιεί το κριτήριο της φειδωλότητας. Αρχή: το καλύτερο δέντρο είναι αυτό που απαιτεί τον μικρότερο αριθμό εξελικτικών βημάτων για την εξήγηση των διαφορών μεταξύ των μελετούμενων taxa Νουκλεοτιδικές Θέσεις Μοναδικά νουκλεοτίδια Αμετάβλητες Μεταβλητές Πληροφοριακές θέσεις Πληροφοριακή θέση: θέση που ευνοεί κάποιο δέντρο έναντι των υπολοίπων. Όταν υπάρχουν 2τουλάχιστον καταστάσεις χαρακτήρων κάθε μια από τις οποίες αντιπροσωπεύεται σε τουλάχιστον 2 από τα taxa.

89 Για παράδειγμα έστω 4 υποθετικές αλληλουχίες Νουκλεοτιδικές θέσεις Αλληλουχία A A G A G T G C A 2 A G C C G T G C T 3 A G A T A T C C A 4 A G A G A T C C T 1o Βήμα: Εντοπισμός Πληροφοριακών θέσεων Θέσεις 1, 6, 8 = αμετάβλητες Θέσεις 2, 3, 4, 5, 7 και 9 =μεταβλητές. Ποιες όμως είναι πληροφοριακές;

90

91 Νουκλεοτιδικές θέσεις Αλληλουχία A A G A G T G C A 2 A G C C G T G C T 3 A G A T A T C C A 4 A G A G A T C C T

92 Νουκλεοτιδικές θέσεις Αλληλουχία A A G A G T G C A 2 A G C C G T G C T 3 A G A T A T C C A 4 A G A G A T C C T

93

94 2o Βήμα: Υπολογισμός των απαιτούμενων εξελικτικών αλλαγών για κάθε δένδρο Για το δέντρο Ι τα εξελικτικά βήματα είναι Για το δέντρο ΙΙ τα εξελικτικά βήματα είναι Για το δέντρο ΙΙΙ τα εξελικτικά βήματα είναι o Βήμα: Άθροισμα του αριθμού των αλλαγών Για το δέντρο Ι = 4 Για το δέντρο ΙΙ = 5 Για το δέντρο ΙΙΙ = 6 4o Βήμα: Επιλογή του πιο φειδωλού δέντρου Δέντρο Ι

95 Εύρεση των ιδεατών δέντρων Αλγόριθμοι Ακριβείς αλγόριθμοι Ευρετικοί αλγόριθμοι Ακριβείς αλγόριθμοι Exhaustive (<11 taxa) Αποτίμηση όλων των δέντρων και εύρεση του πιο «καλού» Branch and Bound (11<taxa<20) Εγγυάται την εύρεση του καλύτερου δέντρου, χωρίς να απαιτείται η αποτίμηση κάθε δέντρου

96 Exhaustive search A B A B1 B2 B3 4 Κατασκευάζει ένα τυχαίο δέντρο με όλες τις αλληλουχίες. Αρχίζει από ένα δέντρο με 3 taxa. C C11 C C21-D25 C31-D35 To 4 ο taxon προστίθεται με την προσθήκη ενός νέου κλάδου στο μέσο κάθε προϋπάρχοντος κλάδου. C13 C14 C15 D151-D157 Εκτιμά το παραγόμενο δέντρο, βάσει κάποιου κριτηρίου (π.χ. χ μήκος).

97 Πιθανά δέντρα Η διακλαδωτική σειρά του δένδρου (έρριζου ζ ή άρριζου) ) καλείται τοπολογία. για έρριζα δένδρα (n 2): για άρριζα δένδρα (n 3): N R = ( 2n ) 3! 2 n 2 ( n 2 )! N U = ( 2n ) 5! n 2 3 ( n 3 )! Number of Number of rooted trees Number of unrooted trees OTUs (n) (Ν R ) (N U ) , ,135 2,027,025 34,459, ,458,046,676, ,200,794,532,637,891,559, , ,135 2,027,025 7,905,853,580, ,643,095,476,699,771,875

98 Branch and Bound search Ο αλγόριθμος αγόριθμοςξεκινάει φτιάχνοντας ένα δέντρο με όλα τα taxa, το οποίο δεν είναι απαραίτητα και το βέλτιστο και στη συνέχεια συναρμολογεί ένα δέντρο προσθέτοντας ένα taxon κάθε φορά. Α1 Β3 Για 3 taxa (A, B & C) υπάρχει ένα πιθανό δέντρο (A1). Το τέταρτο taxon (D) μπορεί να προστεθεί (branch) ως νέος κλάδος σε κάθε έναν από τους 3 εσωτερικούς κόμβους, δημιουργώντας 3 πιθανά δέντρα (B1, B2, & B3). Ελέγχουμε τα παραγόμενα δέντρα. Το Β2 δημιουργεί ένα νέο όριο (bound) με μήκος 838. Τα Β1, Β3 έχουν μεγαλύτερο μήκος (από το αρχικό τυχαίο δέντρο, 964) και απορρίπτονται και αυτά και τα παράγωγα αυτών δέντρα. Β1 Β2 Το 5 ο taxon (Ε) προστίθεται σε κάθε ένα από τους 5 εσωτερικούς κόμβους του δέντρου Β2. Ελέγχουμε τα νέα δέντρα. Τα Γ1, Γ2, Γ3 έχουν μεγαλύτερο μήκος από το αρχικό και απορρίπτονται. Το Γ4 έχει το ίδιο, ενώ το Γ5 μικρότερο δημιουργώντας ένα νέο όριο (bound), ώστε αν υπήρχε και 6 ο taxon να ξεκινούσαμε από αυτό, δημιουργώντας κάθε φορά ένα νέο όριο.

99 Branch and Bound search Στο πρώτο βήμα αποκλείονται το 1/3 των πιθανών δέντρων, στο δεύτερο το ½ των υπόλοιπων πιθανών δέντρων με αποτέλεσμα να είναι αναγκαίο να εκτιμηθεί το 1/6 των πιθανών δέντρων. Υπό ιδανικές συνθήκες μόνο ένα δέντρο θα παραμείνει σε κάθε βήμα. Η μέθοδος είναι υπολογιστικά εφικτή για αναλύσεις μέχρι 20 taxa που έχουν ~8.2*10 21 Figure modified from Krane & Raymer 2004

100 Heuristic search Ευρετική μέθοδος (>20 taxa) Όταν ο αριθμός των πιθανών δέντρων είναι μεγάλος, τότε η εκτίμηση κάθε δέντρου, χρησιμοποιώντας ακριβείς μεθόδους είναι πρακτικά αδύνατη. Η ευρετική ήμέθοδος ς( (heuristic search) είναι ουσιαστικά ένας αλγόριθμος αναρρίχησης λόφου (hill climbing), όπου επιλέγεται ένα αρχικό δέντρο και στη συνέχεια γίνονται αναδιευθετήσεις επιζητώντας τη βελτίωση του δέντρου, βάσει του δεδομένου κριτηρίου επιλογής.

101 Υπάρχουν πολυάριθμοι ευρετικοί αλγόριθμοι όπως Ευρετικοί αλγόριθμοι 1) Stepwise addition (προσομοιάζει την Branch and Bound) Αρχίζει με ένα δέντρο 3 αλληλουχιών Προσθέτει ένα taxon Εκτιμά όλα τα δέντρα Επιλέγει το δέντρο με το καλύτερο score και προσθέτει νέο taxon

102 Ευρετικοί αλγόριθμοι Μειονέκτημα: εάν το καλύτερο δέντρο σε ένα επίπεδο είναι το Α, αλλά τελικά το καλύτερο δέντρο με όλα τα taxa προέρχεται από το Β του ίδιου επιπέδου, τότε το καλύτερο δέντρο δεν θα βρεθεί. Η τεχνική stepwise θα σκαρφαλώσει στη κορυφή ενός λόφου, αλλά ο λόφος αυτός δεν είναι ο ψηλότερος.

103 Ευρετικοί αλγόριθμοι 2) Star Decomposition O αλγόριθμος ξεκινάει με όλα τα taxa να συνδέονται σε δέντρο με μορφή άστρου (star topology, όλα τα taxa συνδέονται σε ένα εσωτερικό κόμβο). Στη συνέχεια εκτιμώνται όλα τα δέντρα που δημιουργούνται με σύνδεση δύο ακραίων taxa (terminal nodes) σε μία ομάδα. Το δέντρο με τη καλύτερη τιμή (best score) διατηρείται για το επόμενο στάδιο. Σε κάθε βήμα, όταν δημιουργούμε μία νέα ομάδα, ο αριθμός των κλαδιών μειώνεται κατά ένα. Και αυτό συνεχίζεται μέχρι να έχουμε ένα διχοτομούμενο δέντρο.

104 Ευρετικοί αλγόριθμοι Branch swapping (αναδιευθέτηση κλάδων) Στοχεύει στη βελτίωση της αρχικής εκτίμησης πραγματοποιώντας προκαθορισμένες διευθετήσεις στο δέντρο. Στην ουσία είναι τρόποι να «σπρώξεις» το δέντρο να ξεκολλήσει από το τοπικό βέλτιστο και να οδηγηθεί στο συνολικό βέλτιστο. Η μέθοδος αυτή περιλαμβάνει κόψιμο του δέντρου σε ένα ή περισσότερα σημεία (subtrees) και συναρμολόγησή του με τέτοιο τρόπο ώστε να διαφέρει από το αρχικό δέντρο. Υπάρχουν 3 είδη μετακίνησης των υποδέντρων (subtrees) NNI (nearest-neighbor interchange) SPR (subtree pruning and regrafting) TBR (tree bisection and recombination)

105 Branch swapping SPR TBR NNI Εσωτερικός κλάδος Nearest Neighbor Interchange Sub-tree Pruning and Regrafting Tree bisection and reconnection

106 Branch swapping NNI Εσωτερικός κλάδος Εικόνα 1 Εικόνα 2 Εικόνα 3 Αρχικό δέντρο Ανταλλαγή Ανταλλαγή 1 με 3 2 με 3 Nearest Neighbor Interchange Η απλούστερη μέθοδος, γνωστή ως ΝΝΙ, αλλάζει τη συνδεσιμότητα των 4 υποδέντρων του κύριου δέντρου. Κάθε εσωτερικός κλάδος ενός άριζου δέντρου (εικόνα 1) έχει 4 υποδέντρα που συνδέονται σε αυτόν (ένα υποδέντρο μπορεί να αποτελείται από 1 και μόνο κόμβο). Η ΝΝΙ αλλάζει τη θέση αυτών, παράγοντας νέα δέντρα. Υπάρχουν μόνο 2 αλλαγές που οδηγούν σε νέα δέντρα (εικόνες 2 και 3). Η διαδικασία συνεχίζει για κάθε εσωτερικό κλάδο έως ότου να μην γίνονται βελτιώσεις του αρχικού δέντρου βάσει του αρχικού κριτηρίου. Ένα δέντρο με Ν>2 φύλλα (κόμβους) έχει Ν-3 εσωτερικούς κλάδους και έτσι η ΝΝΙ, που ελέγχει 2 δέντρα για κάθε εσωτερικό κλάδο, θα εξετάσει 2(Ν-3) νέα δέντρα.

107 Sub-tree Pruning and Regrafting («κλαδεύω και μπολιάζω») Εικόνα 1 Εικόνα 2 Εικόνα 3 Εικόνα 4 Εικόνα 5 Αρχικό δέντρο Μπόλιασμα του (1,2) στο κλαδί 6 Μπόλιασμα του (1,2) στο κλαδί 5 Μπόλιασμα του 3 στο κλαδί 4 Μπόλιασμα του (1,2) στο κλαδί 4 Η SSR είναι μια στρατηγική ελέγχου της τοπολογίας ενός δέντρου που προσπαθεί να βελτιώσει την αξία (πιθανότητα) ενός δέντρου μέσω της εξής διαδικασίας: 1. Επιλέγει το υποδέντρο του αρχικού δέντρου που θα κλαδέψει (pruning) 2. Αφαιρεί το υποδέντρο και το μπολιάζει σε άλλο σημείο του εναπομείναντος δέντρου, δημιουργώντας ένα νέο δέντρο (π.χ. στην εικόνα 2 κλάδεμα του (1,2) και μπόλιασμα στο κλαδί που οδηγεί στο 6 3. Η διαδικασία δ συνεχίζεται για κάθε πιθανό υποδέντρο και για κάθε κλαδί που μπορεί να το δεχτεί.

ΦΥΛΟΓΕΝΕΤΙΚ Α ΔΕΝΤΡΑ

ΦΥΛΟΓΕΝΕΤΙΚ Α ΔΕΝΤΡΑ ΦΥΛΟΓΕΝΕΤΙΚΑ ΔΕΝΤΡΑ Χαρακτηριστική πτυχή της ζωής είναι η απεριόριστη ποικιλότητα της. Δεν υπάρχουν δύο ίδια άτομα σε έναν πληθυσμό, δύο ίδιοι πληθυσμοί σε ένα είδος, δύο ίδια είδη, κ. ο. κ. Παντού, υπάρχει

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 12: Αναζήτηση ομοιοτήτων έναντι βάσεων δεδομένων με τη χρήση ευρετικών αλγορίθμων Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr

Διαβάστε περισσότερα

HMY 795: Αναγνώριση Προτύπων

HMY 795: Αναγνώριση Προτύπων HMY 795: Αναγνώριση Προτύπων Διάλεξη 5 Κατανομές πιθανότητας και εκτίμηση παραμέτρων δυαδικές τυχαίες μεταβλητές Bayesian decision Minimum misclassificaxon rate decision: διαλέγουμε την κατηγορία Ck για

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

Υπερπροσαρμογή (Overfitting) (1)

Υπερπροσαρμογή (Overfitting) (1) Αλγόριθμος C4.5 Αποφυγή υπερπροσαρμογής (overfitting) Reduced error pruning Rule post-pruning Χειρισμός χαρακτηριστικών συνεχών τιμών Επιλογή κατάλληλης μετρικής για την επιλογή των χαρακτηριστικών διάσπασης

Διαβάστε περισσότερα

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 1: Εισαγωγή στη Βιοπληροφορική

Πανεπιστήμιο Δυτικής Μακεδονίας. Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών. Βιοπληροφορική. Ενότητα 1: Εισαγωγή στη Βιοπληροφορική Τμήμα Μηχανικών Πληροφορικής & Τηλεπικοινωνιών Βιοπληροφορική Ενότητα 1: Εισαγωγή στη Βιοπληροφορική Αν. καθηγητής Αγγελίδης Παντελής e-mail: paggelidis@uowm.gr ΕΕΔΙΠ Μπέλλου Σοφία e-mail: sbellou@uowm.gr

Διαβάστε περισσότερα

ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ

ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Αναζήτηση οµοιοτήτων ΑΝΑΖΗΤΗΣΗ ΟΜΟΙΟΤΗΤΩΝ ΣΕ ΒΑΣΕΙΣ Ε ΟΜΕΝΩΝ ΑΚΟΛΟΥΘΙΩΝ Σελίδα 1 εδοµένα Ακολουθία επερώτησης (query sequence) Ακολουθίες στη Βάση εδοµένων (subject sequences) Αναζήτηση Μέθοδοι δυναµικού

Διαβάστε περισσότερα

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΜΗΧΑΝΙΚΩΝ & ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΕΠΕΞΕΡΓΑΣΤΩΝ ΚΑΙ ΥΛΙΚΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΜΗΧΑΝΙΚΩΝ & ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΕΠΕΞΕΡΓΑΣΤΩΝ ΚΑΙ ΥΛΙΚΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΜΗΧΑΝΙΚΩΝ & ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΜΙΚΡΟΕΠΕΞΕΡΓΑΣΤΩΝ ΚΑΙ ΥΛΙΚΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΜΕΛΕΤΗ, ΣΧΕΔΙΑΣΜΟΣ ΚΑΙ ΥΛΟΠΟΙΗΣΗ ΤΗΣ ΣΥΝΑΡΤΗΣΗΣ ΦΥΛΟΓΕΝΕΤΙΚΗΣ ΠΙΘΑΝΟΦΑΝΕΙΑΣ

Διαβάστε περισσότερα

Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC

Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC Μπεϋζιανή Στατιστική και MCMC Μέρος 2 ο : MCMC Περιεχόμενα Μαθήματος Εισαγωγή στο Πρόβλημα. Monte Carlo Εκτιμητές. Προσομοίωση. Αλυσίδες Markov. Αλγόριθμοι MCMC (Metropolis Hastings & Gibbs Sampling).

Διαβάστε περισσότερα

ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Ενότητα 1 η : Εισαγωγή. Ηλίας Καππάς Τμήμα Βιολογίας

ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Ενότητα 1 η : Εισαγωγή. Ηλίας Καππάς Τμήμα Βιολογίας ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ Ενότητα 1 η : Εισαγωγή Ηλίας Καππάς Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες χρήσης Creative Commons.

Διαβάστε περισσότερα

HMY 795: Αναγνώριση Προτύπων

HMY 795: Αναγνώριση Προτύπων HMY 795: Αναγνώριση Προτύπων Διάλεξη 3 Επιλογή μοντέλου Επιλογή μοντέλου Θεωρία αποφάσεων Επιλογή μοντέλου δεδομένα επικύρωσης Η επιλογή του είδους του μοντέλου που θα χρησιμοποιηθεί σε ένα πρόβλημα (π.χ.

Διαβάστε περισσότερα

HMY 795: Αναγνώριση Προτύπων

HMY 795: Αναγνώριση Προτύπων HMY 795: Αναγνώριση Προτύπων Διαλέξεις 7 8 Μπεϋζιανή εκτίμηση συνέχεια Μη παραμετρικές μέθοδοι εκτίμησης πυκνότητας Εκτίμηση ML για την κανονική κατανομή Μπεϋζιανή εκτίμηση για την κανονική κατανομή Γνωστή

Διαβάστε περισσότερα

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3

Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 1 Τμήμα Βιολογίας, Πανεπιστήμιο Κρήτης, Ηράκλειο Κρήτης. 2 Department of Biological Sciences, Texas Tech University, MS 43131, Lubbock,Texas 79409-3131. 3 Department of Biology, Faculty of Science, Dokuz

Διαβάστε περισσότερα

Oικονομικές και Mαθηματικές Eφαρμογές

Oικονομικές και Mαθηματικές Eφαρμογές Το πακέτο ΕXCEL: Oικονομικές και Mαθηματικές Eφαρμογές Eπιμέλεια των σημειώσεων και διδασκαλία: Ευαγγελία Χαλιώτη* Θέματα ανάλυσης: - Συναρτήσεις / Γραφικές απεικονίσεις - Πράξεις πινάκων - Συστήματα εξισώσεων

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

(Μέρος 1 ο ) Εισηγητής: Ν. Πουλακάκης

(Μέρος 1 ο ) Εισηγητής: Ν. Πουλακάκης Ταξινομικοί χαρακτήρες και Φυλογενετική ανασύσταση. Σχολές ταξινόμησης. Θεωρίες για την Ταξινομική. Φυλογενετική ανάλυση: Μοριακή συστηματική. Οι κύριες διαιρέσεις της Ζωής. (Μέρος 1 ο ) Εισηγητής: Ν.

Διαβάστε περισσότερα

2. ΧΡΗΣΗ ΣΤΑΤΙΣΤΙΚΩΝ ΠΑΚΕΤΩΝ ΣΤΗ ΓΡΑΜΜΙΚΗ ΠΑΛΙΝΔΡΟΜΗΣΗ

2. ΧΡΗΣΗ ΣΤΑΤΙΣΤΙΚΩΝ ΠΑΚΕΤΩΝ ΣΤΗ ΓΡΑΜΜΙΚΗ ΠΑΛΙΝΔΡΟΜΗΣΗ 2. ΧΡΗΣΗ ΣΤΑΤΙΣΤΙΚΩΝ ΠΑΚΕΤΩΝ ΣΤΗ ΓΡΑΜΜΙΚΗ ΠΑΛΙΝΔΡΟΜΗΣΗ Η χρησιμοποίηση των τεχνικών της παλινδρόμησης για την επίλυση πρακτικών προβλημάτων έχει διευκολύνει εξαιρετικά από την χρήση διαφόρων στατιστικών

Διαβάστε περισσότερα

PSI-Blast: τι είναι. Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης)

PSI-Blast: τι είναι. Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης) PSI-Blast PSI-Blast PSI-Blast: τι είναι PSI-Blast: Position-specific iterated Blast Position specific scoring matrices (PSSMs) (Πίνακες αντικατάστασης θέσης) Altschul et al., 1997 http://www.ncbi.nlm.nih.gov/pmc/articles/pmc146917/pdf/253389.pdf

Διαβάστε περισσότερα

Λυσεις προβλημάτων τελικής φάσης Παγκύπριου Μαθητικού Διαγωνισμού Πληροφορικής 2007

Λυσεις προβλημάτων τελικής φάσης Παγκύπριου Μαθητικού Διαγωνισμού Πληροφορικής 2007 Λυσεις προβλημάτων τελικής φάσης Παγκύπριου Μαθητικού Διαγωνισμού Πληροφορικής 2007 Πρόβλημα 1 Το πρώτο πρόβλημα λύνεται με τη μέθοδο του Δυναμικού Προγραμματισμού. Για να το λύσουμε με Δυναμικό Προγραμματισμό

Διαβάστε περισσότερα

Βοηθητικό Εγχειρίδιο

Βοηθητικό Εγχειρίδιο AGFN EXPERT LITE Χρηµατιστήριο Αθηνών Χρηµατιστήριο Αξιών Κύπρου Βοηθητικό Εγχειρίδιο Version 7.5.0.322 ΠΕΡΙΕΧΟΜΕΝΑ 1. ΕΙΣΑΓΩΓΗ... 2 1.1. ΕΚΚΙΝΗΣΗ ΕΦΑΡΜΟΓΗΣ AGFN EXPERTLITE... 2 2. ΣΥΝ ΕΣΗ (LOGIN)... 3

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΛΗΡΟΦΟΡΙΑΣ ΠΑΡΟΥΣΙΑΣΗ ΤΕΛΙΚΗΣ ΕΡΓΑΣΙΑΣ ΛΙΝΑ ΜΑΣΣΟΥ

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΛΗΡΟΦΟΡΙΑΣ ΠΑΡΟΥΣΙΑΣΗ ΤΕΛΙΚΗΣ ΕΡΓΑΣΙΑΣ ΛΙΝΑ ΜΑΣΣΟΥ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΕΦΑΡΜΟΣΜΕΝΩΝ ΜΑΘΗΜΑΤΙΚΩΝ ΚΑΙ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΑΛΓΟΡΙΘΜΟΙ ΕΞΟΡΥΞΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΠΑΡΟΥΣΙΑΣΗ ΤΕΛΙΚΗΣ ΕΡΓΑΣΙΑΣ ΛΙΝΑ ΜΑΣΣΟΥ Δ.Π.Μ.Σ: «Εφαρμοσμένες Μαθηματικές Επιστήμες» 2008

Διαβάστε περισσότερα

Δομές Δεδομένων Εργαστηριακή Άσκηση 2012-2013. Γκόγκος Νίκος Α.Μ.: 4973 Έτος: 3 ο Email: gkogkos@ceid.upatras.gr. Εισαγωγικά:

Δομές Δεδομένων Εργαστηριακή Άσκηση 2012-2013. Γκόγκος Νίκος Α.Μ.: 4973 Έτος: 3 ο Email: gkogkos@ceid.upatras.gr. Εισαγωγικά: Δομές Δεδομένων Εργαστηριακή Άσκηση 2012-2013 Γκόγκος Νίκος Α.Μ.: 4973 Έτος: 3 ο Email: gkogkos@ceid.upatras.gr Εισαγωγικά: Η υλοποίηση του project έχει γίνει σε python [2.7]. Τα python modules είναι αυτόνομα

Διαβάστε περισσότερα

SilverPlatter WebSPIRS 4.1.

SilverPlatter WebSPIRS 4.1. WebSPIRS 4.1. Η υπηρεσία WebSPIRS από τη SilverPlatter αποτελεί ένα φιλικό εργαλείο πρόσβασης και αναζήτησης σε περιεχόμενα βάσεων δεδομένων. Η Βιβλιοθήκη και Κέντρο Πληροφόρησης του Πανεπιστημίου Θεσσαλίας

Διαβάστε περισσότερα

Ανάλυση εικόνων DSLR με το πρόγραμμα IRIS

Ανάλυση εικόνων DSLR με το πρόγραμμα IRIS Δεκέμβριος 2014: Θεματικός Μήνας Μεταβλητών Άστρων Μαραβέλιας Γρηγόρης Ανάλυση εικόνων DSLR με το πρόγραμμα IRIS v1.0 Πηγές Το υλικό προέρχεται από τις ακόλουθες πηγές (τις οποίες μπορείτε να συμβουλευτείτε

Διαβάστε περισσότερα

Συνδυασμός Μαθηματικών με γραφικές παραστάσεις

Συνδυασμός Μαθηματικών με γραφικές παραστάσεις Το πρόγραμμα Origin Συνδυασμός Μαθηματικών με γραφικές παραστάσεις Δημιουργία γραφικής παράστασης συνάρτησης Για να δημιουργήσετε τη γραφική παράσταση από μια συνάρτηση επιλέξτε File-New-Graph To Origin

Διαβάστε περισσότερα

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων

Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Βάσεις δομικών δεδομένων βιολογικών μακρομορίων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus Εισαγωγή Βασικές αρχές δομής πρωτεϊνών και νουκλεϊκών

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ

ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ ΚΕΦΑΛΑΙΟ 3ο ΤΥΧΑΙΟΙ ΑΡΙΘΜΟΙ ΕΛΕΓΧΟΣ ΤΥΧΑΙΟΤΗΤΑΣ 3.1 Τυχαίοι αριθμοί Στην προσομοίωση διακριτών γεγονότων γίνεται χρήση ακολουθίας τυχαίων αριθμών στις περιπτώσεις που απαιτείται η δημιουργία στοχαστικών

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Εργασία. στα. Γενικευμένα Γραμμικά Μοντέλα

Εργασία. στα. Γενικευμένα Γραμμικά Μοντέλα Εργασία στα Γενικευμένα Γραμμικά Μοντέλα Μ. Παρζακώνης ΜΕΣ/ 06015 Ο παρακάτω πίνακας δίνει τα αποτελέσματα 800 αιτήσεων για δάνειο σε μία τράπεζα. Ο πίνακας παρουσιάζει τον αριθμό των δανείων που εγκρίθηκαν,

Διαβάστε περισσότερα

Δομές Δεδομένων (Data Structures)

Δομές Δεδομένων (Data Structures) Δομές Δεδομένων (Data Structures) Ανάλυση - Απόδοση Αλγορίθμων Έλεγχος Αλγορίθμων. Απόδοση Προγραμμάτων. Χωρική/Χρονική Πολυπλοκότητα. Ασυμπτωτικός Συμβολισμός. Παραδείγματα. Αλγόριθμοι: Βασικές Έννοιες

Διαβάστε περισσότερα

PROJECT ΣΤΟ ΜΑΘΗΜΑ "ΕΙΣΑΓΩΓΗ ΣΤΙΣ ΕΥΡΕΤΙΚΕΣ ΜΕΘΟΔΟΥΣ"

PROJECT ΣΤΟ ΜΑΘΗΜΑ ΕΙΣΑΓΩΓΗ ΣΤΙΣ ΕΥΡΕΤΙΚΕΣ ΜΕΘΟΔΟΥΣ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ ΚΑΙ ΠΛΗΡΟΦΟΡΙΚΗΣ PROJECT ΣΤΟ ΜΑΘΗΜΑ "ΕΙΣΑΓΩΓΗ ΣΤΙΣ ΕΥΡΕΤΙΚΕΣ ΜΕΘΟΔΟΥΣ" ΜΕΡΟΣ ΔΕΥΤΕΡΟ Υπεύθυνος Καθηγητής Λυκοθανάσης Σπυρίδων Ακαδημαικό Έτος:

Διαβάστε περισσότερα

Αριθμητική εύρεση ριζών μη γραμμικών εξισώσεων

Αριθμητική εύρεση ριζών μη γραμμικών εξισώσεων Αριθμητική εύρεση ριζών μη γραμμικών εξισώσεων Με τον όρο μη γραμμικές εξισώσεις εννοούμε εξισώσεις της μορφής: f( ) 0 που προέρχονται από συναρτήσεις f () που είναι μη γραμμικές ως προς. Περιέχουν δηλαδή

Διαβάστε περισσότερα

Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) Blast

Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) Blast Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) & Blast Στοίχιση κατά ζεύγη Αντιστοίχιση των νουκλεοτιδίων/αµινοξέων δυο ακολουθιών, ώστε να εντοπιστούν οι οµοιότητες και οι διαφορές τους. Χρησιµοποιείται

Διαβάστε περισσότερα

Μέθοδος μέγιστης πιθανοφάνειας

Μέθοδος μέγιστης πιθανοφάνειας Μέθοδος μέγιστης πιθανοφάνειας Αν x =,,, παρατηρήσεις των Χ =,,,, τότε έχουμε διαθέσιμο ένα δείγμα Χ={Χ, =,,,} της κατανομής F μεγέθους με από κοινού σ.κ. της Χ f x f x Ορισμός : Θεωρούμε ένα τυχαίο δείγμα

Διαβάστε περισσότερα

Επίλυση προβληµάτων. Αλγόριθµοι Αναζήτησης

Επίλυση προβληµάτων. Αλγόριθµοι Αναζήτησης Επίλυση προβληµάτων! Περιγραφή προβληµάτων Αλγόριθµοι αναζήτησης Αλγόριθµοι τυφλής αναζήτησης Αλγόριθµοι ευρετικής αναζήτησης Παιχνίδια δύο αντιπάλων Προβλήµατα ικανοποίησης περιορισµών Γενικά " Τεχνητή

Διαβάστε περισσότερα

ΤΥΦΛΗ ΑΝΑΖΗΤΗΣΗ (1) ΣΤΡΑΤΗΓΙΚΗ Ή ΑΛΓΟΡΙΘΜΟΣ ΑΝΑΖΗΤΗΣΗΣ

ΤΥΦΛΗ ΑΝΑΖΗΤΗΣΗ (1) ΣΤΡΑΤΗΓΙΚΗ Ή ΑΛΓΟΡΙΘΜΟΣ ΑΝΑΖΗΤΗΣΗΣ ΤΥΦΛΗ ΑΝΑΖΗΤΗΣΗ (1) ΣΤΡΑΤΗΓΙΚΗ Ή ΑΛΓΟΡΙΘΜΟΣ ΑΝΑΖΗΤΗΣΗΣ Μια αυστηρά καθορισµένη ακολουθία ενεργειών µε σκοπό τη λύση ενός προβλήµατος. Χαρακτηριστικά οθέν πρόβληµα: P= Επιλυθέν πρόβληµα: P s

Διαβάστε περισσότερα

Δέντρα Απόφασης (Decision(

Δέντρα Απόφασης (Decision( Δέντρα Απόφασης (Decision( Trees) Το μοντέλο που δημιουργείται είναι ένα δέντρο Χρήση της τεχνικής «διαίρει και βασίλευε» για διαίρεση του χώρου αναζήτησης σε υποσύνολα (ορθογώνιες περιοχές) Ένα παράδειγμα

Διαβάστε περισσότερα

Μάθημα: Ακουστική και Ψυχοακουστική

Μάθημα: Ακουστική και Ψυχοακουστική Τμήμα Τεχνών Ήχου και Εικόνας Ιόνιο Πανεπιστήμιο Μάθημα: Ακουστική και Ψυχοακουστική Εργαστηριακή Άσκηση 1 «Ποσοτική εκτίμηση ελαχίστου κατωφλίου ακουστότητας» Διδάσκων: Φλώρος Ανδρέας Δρ. Ηλ/γος Μηχ/κός

Διαβάστε περισσότερα

Δομές Δεδομένων και Αλγόριθμοι

Δομές Δεδομένων και Αλγόριθμοι Δομές Δεδομένων και Αλγόριθμοι Χρήστος Γκόγκος ΤΕΙ Ηπείρου Χειμερινό Εξάμηνο 2014-2015 Παρουσίαση 20 Huffman codes 1 / 12 Κωδικοποίηση σταθερού μήκους Αν χρησιμοποιηθεί κωδικοποίηση σταθερού μήκους δηλαδή

Διαβάστε περισσότερα

Δομές Δεδομένων. Δημήτρης Μιχαήλ. Δέντρα Αναζήτησης. Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο

Δομές Δεδομένων. Δημήτρης Μιχαήλ. Δέντρα Αναζήτησης. Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Δομές Δεδομένων Δέντρα Αναζήτησης Δημήτρης Μιχαήλ Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Το πρόβλημα Αναζήτηση Θέλουμε να διατηρήσουμε αντικείμενα με κλειδιά και να μπορούμε εκτός από

Διαβάστε περισσότερα

Ε ανάληψη. Α ληροφόρητη αναζήτηση

Ε ανάληψη. Α ληροφόρητη αναζήτηση ΠΛΗ 405 Τεχνητή Νοηµοσύνη Το ική Αναζήτηση Local Search Τµήµα Ηλεκτρονικών Μηχανικών και Μηχανικών Υ ολογιστών Πολυτεχνείο Κρήτης Ε ανάληψη Α ληροφόρητη αναζήτηση σε πλάτος, οµοιόµορφου κόστους, σε βάθος,

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R

Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R Ανάλυση Δεδομένων με χρήση του Στατιστικού Πακέτου R, Επίκουρος Καθηγητής, Τομέας Μαθηματικών, Σχολή Εφαρμοσμένων Μαθηματικών και Φυσικών Επιστημών, Εθνικό Μετσόβιο Πολυτεχνείο. Περιεχόμενα Εισαγωγή στο

Διαβάστε περισσότερα

Βιομηχανικοί Ελεγκτές

Βιομηχανικοί Ελεγκτές Βιομηχανικοί Ελεγκτές Σημειώσεις Εργαστηρίου Έλεγχος Στάθμης Δοχείου με P.I.D. Ελεγκτή Περιεχόμενα 1. Τρόπος Εισαγωγής στο πρόγραμμα εξομοίωσης. 2. Τρόπος λειτουργίας εξομοιωτή. 3. Αναγνώριση ιδιοτήτων

Διαβάστε περισσότερα

Διάλεξη 1 Βασικές έννοιες

Διάλεξη 1 Βασικές έννοιες Εργαστήριο SPSS Ψ-4201 (ΕΡΓ) Λεωνίδας Α. Ζαμπετάκης Β.Sc., M.Env.Eng., M.Ind.Eng., D.Eng. Εmail: statisticsuoc@gmail.com Διαλέξεις αναρτημένες στο: Διαλέξεις: ftp://ftp.soc.uoc.gr/psycho/zampetakis/ Διάλεξη

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

Διαδικασία Ελέγχου Μηδενικών Υποθέσεων

Διαδικασία Ελέγχου Μηδενικών Υποθέσεων Διαδικασία Ελέγχου Μηδενικών Υποθέσεων Πέτρος Ρούσσος, Τμήμα Ψυχολογίας, ΕΚΠΑ Η λογική της διαδικασίας Ο σάκος περιέχει έναν μεγάλο αλλά άγνωστο αριθμό (αρκετές χιλιάδες) λευκών και μαύρων βόλων: 1 Το

Διαβάστε περισσότερα

Άσκηση 10, σελ. 119. Για τη μεταβλητή x (άτυπος όγκος) έχουμε: x censored_x 1 F 3 F 3 F 4 F 10 F 13 F 13 F 16 F 16 F 24 F 26 F 27 F 28 F

Άσκηση 10, σελ. 119. Για τη μεταβλητή x (άτυπος όγκος) έχουμε: x censored_x 1 F 3 F 3 F 4 F 10 F 13 F 13 F 16 F 16 F 24 F 26 F 27 F 28 F Άσκηση 0, σελ. 9 από το βιβλίο «Μοντέλα Αξιοπιστίας και Επιβίωσης» της Χ. Καρώνη (i) Αρχικά, εισάγουμε τα δεδομένα στο minitab δημιουργώντας δύο μεταβλητές: τη x για τον άτυπο όγκο και την y για τον τυπικό

Διαβάστε περισσότερα

Case 08: Επιλογή Διαφημιστικών Μέσων Ι ΣΕΝΑΡΙΟ (1)

Case 08: Επιλογή Διαφημιστικών Μέσων Ι ΣΕΝΑΡΙΟ (1) Case 08: Επιλογή Διαφημιστικών Μέσων Ι ΣΕΝΑΡΙΟ (1) Το πρόβλημα της επιλογής των μέσων διαφήμισης (??) το αντιμετωπίζουν τόσο οι επιχειρήσεις όσο και οι διαφημιστικές εταιρείες στην προσπάθειά τους ν' αναπτύξουν

Διαβάστε περισσότερα

ΕΚΠ 413 / ΕΚΠ 606 Αυτόνοµοι (Ροµ οτικοί) Πράκτορες

ΕΚΠ 413 / ΕΚΠ 606 Αυτόνοµοι (Ροµ οτικοί) Πράκτορες ΕΚΠ 413 / ΕΚΠ 606 Αυτόνοµοι (Ροµ οτικοί) Πράκτορες Πιθανοτική Συλλογιστική II Τµήµα Ηλεκτρονικών Μηχανικών και Μηχανικών Υ ολογιστών Πολυτεχνείο Κρήτης ίκτυα Bayes σηµασιολογία Πλεονεκτήµατα συµπαγής αναπαράσταση

Διαβάστε περισσότερα

Γιατί είναι σημαντική η Βιοποικιλότητα;

Γιατί είναι σημαντική η Βιοποικιλότητα; Γενετική Διαχείριση Ο όρος βιοποικιλότητα αναφέρεται σε όλους τους διαφορετικούς οργανισμούς του πλανήτη μας και περιλαμβάνει τόσο την ποικιλότητα σε επίπεδο ειδών, όσο και τη γενετική ποικιλότητα. Γιατί

Διαβάστε περισσότερα

Άριστες κατά Pareto Κατανομές

Άριστες κατά Pareto Κατανομές Άριστες κατά Pareto Κατανομές - Ορισμός. Μια κατανομή x = (x, x ) = (( 1, )( 1, )) ονομάζεται άριστη κατά Pareto αν δεν υπάρχει άλλη κατανομή x = ( x, x ) τέτοια ώστε: U j( x j) U j( xj) για κάθε καταναλωτή

Διαβάστε περισσότερα

SPSS Statistical Package for the Social Sciences

SPSS Statistical Package for the Social Sciences SPSS Statistical Package for the Social Sciences Ξεκινώντας την εφαρμογή Εισαγωγή εδομένων Ορισμός Μεταβλητών Εισαγωγή περίπτωσης και μεταβλητής ιαγραφή περιπτώσεων ή και μεταβλητών ΣΤΑΤΙΣΤΙΚΗ Αθανάσιος

Διαβάστε περισσότερα

Σενάριο 17: Παιχνίδι μνήμης με εικόνες

Σενάριο 17: Παιχνίδι μνήμης με εικόνες Σενάριο 17: Παιχνίδι μνήμης με εικόνες Φύλλο Εργασίας Τίτλος: Παιχνίδι μνήμης με εικόνες Γνωστικό Αντικείμενο: Εφαρμογές Πληροφορικής-Υπολογιστών Διδακτική Ενότητα: Διερευνώ - Δημιουργώ Ανακαλύπτω, Συνθετικές

Διαβάστε περισσότερα

1.1 ΔΕΙΓΜΑΤΙΚΟΙ ΧΩΡΟΙ ΕΝΔΕΧΟΜΕΝΑ

1.1 ΔΕΙΓΜΑΤΙΚΟΙ ΧΩΡΟΙ ΕΝΔΕΧΟΜΕΝΑ ΚΕΦΑΛΑΙΟ : ΠΙΘΑΝΟΤΗΤΕΣ. ΔΕΙΓΜΑΤΙΚΟΙ ΧΩΡΟΙ ΕΝΔΕΧΟΜΕΝΑ Αιτιοκρατικό πείραμα ονομάζουμε κάθε πείραμα για το οποίο, όταν ξέρουμε τις συνθήκες κάτω από τις οποίες πραγματοποιείται, μπορούμε να προβλέψουμε με

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ

ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ ΟΙΚΟΝΟΜΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΠΛΗΡΟΦΟΡΙΚΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΑΛΓΟΡΙΘΜΩΝ ΒΟΗΘΟΣ: ΒΑΓΓΕΛΗΣ ΔΟΥΡΟΣ Φροντιστήριο #: Εύρεση Ελαχίστων Μονοπατιών σε Γραφήματα που Περιλαμβάνουν και Αρνητικά Βάρη: Αλγόριθμος

Διαβάστε περισσότερα

Αλγόριθμοι και Πολυπλοκότητα

Αλγόριθμοι και Πολυπλοκότητα Αλγόριθμοι και Πολυπλοκότητα Ροή Δικτύου Δημήτρης Μιχαήλ Τμήμα Πληροφορικής και Τηλεματικής Χαροκόπειο Πανεπιστήμιο Μοντελοποίηση Δικτύων Μεταφοράς Τα γραφήματα χρησιμοποιούνται συχνά για την μοντελοποίηση

Διαβάστε περισσότερα

Εξεταστέα Ύλη (Syllabus) Έκδοση 5.0

Εξεταστέα Ύλη (Syllabus) Έκδοση 5.0 Εξεταστέα Ύλη (Syllabus) Έκδοση 5.0 Πνευματικά Δικαιώματα 2007 Ίδρυμα ECDL (ECDL Foundation www.ecdl.org) Όλα τα δικαιώματα είναι κατοχυρωμένα. Κανένα μέρος αυτού του εγγράφου δεν μπορεί να αναπαραχθεί

Διαβάστε περισσότερα

Θεωρία παιγνίων Δημήτρης Χριστοφίδης Εκδοση 1η: Παρασκευή 3 Απριλίου 2015. Παραδείγματα Παράδειγμα 1. Δυο άτομα παίζουν μια παραλλαγή του σκακιού όπου σε κάθε βήμα ο κάθε παίκτης κάνει δύο κανονικές κινήσεις.

Διαβάστε περισσότερα

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα Γ... 3 1.1 Σαψάκη Δ. - Σαψάκη Π.... 3 1.2 Βλάχου - Γεωργοπούλου... 3 1.3 Μπέρτσου - Τσάμη... 4 1.4 Καραγιάννη

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΑΠΟΜΑΚΡΥΣΜΕΝΗΣ ΕΙΣΑΓΩΓΗΣ ΒΑΘΜΟΛΟΓΙΩΝ ΑΠΟ ΔΙΔΑΣΚΟΝΤΕΣ

ΠΡΟΓΡΑΜΜΑ ΑΠΟΜΑΚΡΥΣΜΕΝΗΣ ΕΙΣΑΓΩΓΗΣ ΒΑΘΜΟΛΟΓΙΩΝ ΑΠΟ ΔΙΔΑΣΚΟΝΤΕΣ ΠΡΟΓΡΑΜΜΑ ΑΠΟΜΑΚΡΥΣΜΕΝΗΣ ΕΙΣΑΓΩΓΗΣ ΒΑΘΜΟΛΟΓΙΩΝ ΑΠΟ ΔΙΔΑΣΚΟΝΤΕΣ 1. ΓΕΝΙΚΑ Εκδοση 1.0, 26/08/2009 Η εγκατάσταση του προγράμματος απομακρυσμένης εισαγωγής βαθμολογιών απαιτεί περιβάλλον windows (Windows 2000,

Διαβάστε περισσότερα

Ανάλυση Διασποράς Ανάλυση Διασποράς διακύμανση κατά παράγοντες διακύμανση σφάλματος Παράδειγμα 1: Ισομεγέθη δείγματα

Ανάλυση Διασποράς Ανάλυση Διασποράς διακύμανση κατά παράγοντες διακύμανση σφάλματος Παράδειγμα 1: Ισομεγέθη δείγματα Ανάλυση Διασποράς Έστω ότι μας δίνονται δείγματα που προέρχονται από άγνωστους πληθυσμούς. Πόσο διαφέρουν οι μέσες τιμές τους; Με άλλα λόγια: πόσο πιθανό είναι να προέρχονται από πληθυσμούς με την ίδια

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 18. 18 Μηχανική Μάθηση

ΚΕΦΑΛΑΙΟ 18. 18 Μηχανική Μάθηση ΚΕΦΑΛΑΙΟ 18 18 Μηχανική Μάθηση Ένα φυσικό ή τεχνητό σύστηµα επεξεργασίας πληροφορίας συµπεριλαµβανοµένων εκείνων µε δυνατότητες αντίληψης, µάθησης, συλλογισµού, λήψης απόφασης, επικοινωνίας και δράσης

Διαβάστε περισσότερα

Λογισμική Εφαρμογή Διαχείρισης Ερωτηματολογίων ΟΔΗΓΟΣ ΧΡΗΣΗΣ System Συμβουλευτική Α.Ε

Λογισμική Εφαρμογή Διαχείρισης Ερωτηματολογίων ΟΔΗΓΟΣ ΧΡΗΣΗΣ System Συμβουλευτική Α.Ε σχετικά με τον έλεγχο της καπνιστικής συνήθειας 1 22 Λογισμικές εφαρμογές καταγραφής και αξιοποίησης πληροφοριών σχετικά με τον έλεγχο της καπνιστικής συνήθειας Λογισμική Εφαρμογή Διαχείρισης Ερωτηματολογίων

Διαβάστε περισσότερα

Εισόδημα Κατανάλωση 1500 500 1600 600 1300 450 1100 400 600 250 700 275 900 300 800 352 850 400 1100 500

Εισόδημα Κατανάλωση 1500 500 1600 600 1300 450 1100 400 600 250 700 275 900 300 800 352 850 400 1100 500 Εισόδημα Κατανάλωση 1500 500 1600 600 1300 450 1100 400 600 250 700 275 900 300 800 352 850 400 1100 500 Πληθυσμός Δείγμα Δείγμα Δείγμα Ο ρόλος της Οικονομετρίας Οικονομική Θεωρία Διατύπωση της

Διαβάστε περισσότερα

έρευνας και στατιστική» παραμετρικές συγκρίσεις»

έρευνας και στατιστική» παραμετρικές συγκρίσεις» ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΣΙΚΗΣ ΑΓΩΓΗΣ & ΑΘΛΗΤΙΣΜΟΥ «Μεθοδολογία έρευνας και στατιστική» Μάθημα μεταπτυχιακού κύκλου σπουδών Διάλεξη: «Μη παραμετρικές συγκρίσεις» ΔΙΔΑΣΚΩΝ: Δρ. Αθανάσιος

Διαβάστε περισσότερα

Τοποθετήστε τη δισκέτα στο drive B και σε περιβάλλον MS-DOS πληκτρολογήστε: B:

Τοποθετήστε τη δισκέτα στο drive B και σε περιβάλλον MS-DOS πληκτρολογήστε: B: Συστήματα floppy disk Τοποθετήστε τη δισκέτα στο drive B και σε περιβάλλον MS-DOS πληκτρολογήστε: B: Συστήματα σκληρού δίσκου Οι χρήστες σκληρού δίσκου θα πρέπει να δημιουργήσουν ένα directory με το όνομα

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΣΗΜΕΙΩΣΕΙΣ ΓΡΑΜΜΙΚΗΣ ΑΛΓΕΒΡΑΣ. ρ Χρήστου Νικολαϊδη

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΣΗΜΕΙΩΣΕΙΣ ΓΡΑΜΜΙΚΗΣ ΑΛΓΕΒΡΑΣ. ρ Χρήστου Νικολαϊδη ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΣΗΜΕΙΩΣΕΙΣ ΓΡΑΜΜΙΚΗΣ ΑΛΓΕΒΡΑΣ ρ Χρήστου Νικολαϊδη Δεκέμβριος Περιεχόμενα Κεφάλαιο : σελ. Τι είναι ένας πίνακας. Απλές πράξεις πινάκων. Πολλαπλασιασμός πινάκων.

Διαβάστε περισσότερα

Συμπεριφορά συναρτήσεως σε κλειστές φραγμένες περιοχές. (x 0, y 0, f(x 0, y 0 ) z = L(x, y)

Συμπεριφορά συναρτήσεως σε κλειστές φραγμένες περιοχές. (x 0, y 0, f(x 0, y 0 ) z = L(x, y) 11.7. Aκρότατα και σαγματικά σημεία 903 39. Εκτίμηση μέγιστου σφάλματος Έστω ότι u e sin και ότι τα,, και μπορούν να μετρηθούν με μέγιστα δυνατά σφάλματα 0,, 0,6, και / 180, αντίστοιχα. Εκτιμήστε το μέγιστο

Διαβάστε περισσότερα

27-Ιαν-2009 ΗΜΥ 429. 2. (ι) Βασική στατιστική (ιι) Μετατροπές: αναλογικό-σεψηφιακό και ψηφιακό-σε-αναλογικό

27-Ιαν-2009 ΗΜΥ 429. 2. (ι) Βασική στατιστική (ιι) Μετατροπές: αναλογικό-σεψηφιακό και ψηφιακό-σε-αναλογικό ΗΜΥ 429 2. (ι) Βασική στατιστική (ιι) Μετατροπές: αναλογικό-σεψηφιακό και ψηφιακό-σε-αναλογικό 1 (i) Βασική στατιστική 2 Στατιστική Vs Πιθανότητες Στατιστική: επιτρέπει μέτρηση και αναγνώριση θορύβου και

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Κεφάλαιο 5: Στρατηγική χωροταξικής διάταξης

Κεφάλαιο 5: Στρατηγική χωροταξικής διάταξης K.5.1 Γραμμή Παραγωγής Μια γραμμή παραγωγής θεωρείται μια διάταξη με επίκεντρο το προϊόν, όπου μια σειρά από σταθμούς εργασίας μπαίνουν σε σειρά με στόχο ο κάθε ένας από αυτούς να κάνει μια ή περισσότερες

Διαβάστε περισσότερα

Δυναμικές Ιστοσελίδες Εισαγωγή στην Javascript για προγραμματισμό στην πλευρά του client

Δυναμικές Ιστοσελίδες Εισαγωγή στην Javascript για προγραμματισμό στην πλευρά του client ΕΣΔ 516 Τεχνολογίες Διαδικτύου Δυναμικές Ιστοσελίδες Εισαγωγή στην Javascript για προγραμματισμό στην πλευρά του client Περιεχόμενα Περιεχόμενα Javascript και HTML Βασική σύνταξη Μεταβλητές Τελεστές Συναρτήσεις

Διαβάστε περισσότερα

Οδηγίες για την εγκατάσταση του πακέτου Cygwin

Οδηγίες για την εγκατάσταση του πακέτου Cygwin Οδηγίες για την εγκατάσταση του πακέτου Cygwin Ακολουθήστε τις οδηγίες που περιγράφονται σε αυτό το file μόνο αν έχετε κάποιο laptop ή desktop PC που τρέχουν κάποιο version των Microsoft Windows. 1) Copy

Διαβάστε περισσότερα

Επίλυση προβληµάτων. Περιγραφή προβληµάτων Αλγόριθµοι αναζήτησης

Επίλυση προβληµάτων. Περιγραφή προβληµάτων Αλγόριθµοι αναζήτησης Επίλυση προβληµάτων Περιγραφή προβληµάτων Αλγόριθµοι αναζήτησης! Αλγόριθµοι τυφλής αναζήτησης Αλγόριθµοι ευρετικής αναζήτησης Παιχνίδια δύο αντιπάλων Προβλήµατα ικανοποίησης περιορισµών Αλγόριθµοι τυφλής

Διαβάστε περισσότερα

ΦΥΣΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ Στοιχεία της ανθρώπινης Βιολογίας

ΦΥΣΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ Στοιχεία της ανθρώπινης Βιολογίας ΦΥΣΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ Διαλέξη:7η 14/10/2015 Ε. Δ. Βαλάκος Στοιχεία της ανθρώπινης Βιολογίας Ταξινόµηση των ειδών Η θέση των ανθρώπων στη φύση Μέθοδοι ταξινόµησης Ταξινοµικές προσεγγίσεις Βιβλιογραφία Ταξινομηση

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΟ ΣΤΑΤΙΣΤΙΚΗΣ

ΕΡΓΑΣΤΗΡΙΟ ΣΤΑΤΙΣΤΙΚΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΜΑΘΗΜΑΤΙΚΩΝ ΤΟΜΕΑΣ ΣΤΑΤΙΣΤΙΚΗΣ ΚΑΙ ΕΠΙΧΕΙΡΗΣΙΑΚΗΣ ΕΡΕΥΝΑΣ ΕΡΓΑΣΤΗΡΙΟ ΣΤΑΤΙΣΤΙΚΗΣ Εισαγωγή στο P.A.S.W. Υποχρεωτικό μάθημα 4 ου εξαμήνου

Διαβάστε περισσότερα

ΣΥΣΤΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΣΥΝΕΡΓΑΤΩΝ Secure With Cromar Web Version 1.0

ΣΥΣΤΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΣΥΝΕΡΓΑΤΩΝ Secure With Cromar Web Version 1.0 ΣΥΣΤΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΣΥΝΕΡΓΑΤΩΝ Secure With Cromar Web Version 1.0 Πρόσβαση http://www.cromar.gr/securewithcromar/main.html Εκπαιδευτικά Video: http://www.cromar.gr/pages.php?p_id=145 Εισαγωγή... 3 Διαθεσιμότητα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ 2. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ

ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ 2. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΕΝΟΤΗΤΕΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ (One-Way Analyss of Varance) Η ανάλυση

Διαβάστε περισσότερα

δημιουργία: http://macedonia.uom.gr/~acg επεξεργασία: Ν.Τσάντας

δημιουργία: http://macedonia.uom.gr/~acg επεξεργασία: Ν.Τσάντας Θεωρία Παιγνίων Μελέτη στοιχείων που χαρακτηρίζουν καταστάσεις ανταγωνιστικής άλληλεξάρτησης με έμφαση στη διαδικασία λήψης αποφάσεων περισσοτέρων από ένα ληπτών απόφασης (αντιπάλων). Παίγνια δύο παικτών

Διαβάστε περισσότερα

Περιεχόµενα 1. Εγκατάσταση 2. Εισαγωγή 3. Σύνδεση 4. Ρυθµίσεις 2.1 Περιοχή εργασιών και πλοήγησης 2.2 Περιοχή απεικόνισης "Λεπτοµέρειες" 2.3 Περιοχή απεικόνισης "Στατιστικά" 4.1 Προφίλ 4.2 ίκτυο 4.2.1

Διαβάστε περισσότερα

Matrix Algorithms. Παρουσίαση στα πλαίσια του μαθήματος «Παράλληλοι. Αλγόριθμοι» Γ. Καούρη Β. Μήτσου

Matrix Algorithms. Παρουσίαση στα πλαίσια του μαθήματος «Παράλληλοι. Αλγόριθμοι» Γ. Καούρη Β. Μήτσου Matrix Algorithms Παρουσίαση στα πλαίσια του μαθήματος «Παράλληλοι Αλγόριθμοι» Γ. Καούρη Β. Μήτσου Περιεχόμενα παρουσίασης Πολλαπλασιασμός πίνακα με διάνυσμα Πολλαπλασιασμός πινάκων Επίλυση τριγωνικού

Διαβάστε περισσότερα

«Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio»

«Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio» «Η συμβολή της βιοπληροφορικής στη μελέτη της ποικιλότητας των πληθυσμών της πεταλούδας Carassius gibelio» Γεώργιος Τσιπάς 1, Μαρία Τάτση 2 1 Καθηγητής Βιολόγος Ph.D., Γυμνάσιο Καινουργίου Αιτωλοακαρνανίας

Διαβάστε περισσότερα

Κατάτµηση Εικόνων: Ανίχνευση Ακµών και Κατάτµηση µε Κατωφλίωση

Κατάτµηση Εικόνων: Ανίχνευση Ακµών και Κατάτµηση µε Κατωφλίωση ΤΨΣ 50 Ψηφιακή Επεξεργασία Εικόνας Κατάτµηση Εικόνων: Ανίχνευση Ακµών και Κατάτµηση µε Κατωφλίωση Τµήµα ιδακτικής της Τεχνολογίας και Ψηφιακών Συστηµάτων Πανεπιστήµιο Πειραιώς Περιεχόµενα Βιβλιογραφία

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΜΕΤΑΦΟΡΑΣ

ΠΡΟΒΛΗΜΑΤΑ ΜΕΤΑΦΟΡΑΣ (Transportation Problems) Βασίλης Κώστογλου E-mail: vkostogl@it.teithe.gr URL: www.it.teithe.gr/~vkostogl Περιγραφή Ένα πρόβλημα μεταφοράς ασχολείται με το πρόβλημα του προσδιορισμού του καλύτερου δυνατού

Διαβάστε περισσότερα

Απαλλακτική Εργασία Γραφικά & Εικονική Πραγματικότητα. Παπαπαύλου Χρήστος ΑΜ: 6609

Απαλλακτική Εργασία Γραφικά & Εικονική Πραγματικότητα. Παπαπαύλου Χρήστος ΑΜ: 6609 Απαλλακτική Εργασία Γραφικά & Εικονική Πραγματικότητα Παπαπαύλου Χρήστος ΑΜ: 6609 Αναπαράσταση μοντέλου Το 3D μοντέλο το αποθηκεύουμε στην μνήμη με τις εξής δομές δεδομένων: Λίστα κορυφών Λίστα τριγώνων

Διαβάστε περισσότερα

Διακριτά Μαθηματικά. Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα

Διακριτά Μαθηματικά. Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα Διακριτά Μαθηματικά Απαρίθμηση: Εισαγωγικά στοιχεία Αρχή του Περιστεριώνα Συνδυαστική ανάλυση μελέτη της διάταξης αντικειμένων 17 ος αιώνας: συνδυαστικά ερωτήματα για τη μελέτη τυχερών παιχνιδιών Απαρίθμηση:

Διαβάστε περισσότερα

ΙΚΤΥΑ ΕΠΙΚΟΙΝΩΝΙΩΝ Εργαστηριακή Άσκηση 1

ΙΚΤΥΑ ΕΠΙΚΟΙΝΩΝΙΩΝ Εργαστηριακή Άσκηση 1 ΙΚΤΥΑ ΕΠΙΚΟΙΝΩΝΙΩΝ Εργαστηριακή Άσκηση 1 1. Εισαγωγή στο Network Simulator v2 (NS2) Το NS2 (Network Simulator version 2) είναι ένα πρόγραμμα για προσομοιώσεις δικτύων που διατίθεται δωρεάν. Ο δικτυακός

Διαβάστε περισσότερα

EBSCOhost Research Databases

EBSCOhost Research Databases Η EBSCOhost είναι ένα online σύστημα αναζήτησης σε έναν αριθμό βάσεων δεδομένων, στις οποίες είναι συμβεβλημένο κάθε φορά το ίδρυμα. Διαθέτει πολύγλωσσο περιβάλλον αλληλεπίδρασης (interface) με προεπιλεγμένη

Διαβάστε περισσότερα

Η ΙΣΧΥΣ ΕΝΟΣ ΕΛΕΓΧΟΥ. (Power of a Test) ΚΕΦΑΛΑΙΟ 21

Η ΙΣΧΥΣ ΕΝΟΣ ΕΛΕΓΧΟΥ. (Power of a Test) ΚΕΦΑΛΑΙΟ 21 ΚΕΦΑΛΑΙΟ 21 Η ΙΣΧΥΣ ΕΝΟΣ ΕΛΕΓΧΟΥ (Power of a Test) Όπως είδαμε προηγουμένως, στον Στατιστικό Έλεγχο Υποθέσεων, ορίζουμε δύο είδη πιθανών λαθών (κινδύνων) που μπορεί να συμβούν όταν παίρνουμε αποφάσεις

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Προτεινόμενες εργασίες Προγραμματισμού Διαδικτύου

Προτεινόμενες εργασίες Προγραμματισμού Διαδικτύου Προτεινόμενες εργασίες Προγραμματισμού Διαδικτύου Ιωάννης Γ. Τσούλος Εργασία Πρώτη - Αριθμομηχανή Με την χρήση του περιβάλλοντος AWT ή του SWING θα πρέπει να δημιουργηθεί αριθμομηχανή για την εκτέλεση

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΜΕ ΥΠΟΛΟΓΙΣΤΙΚΑ ΕΡΓΑΛΕΙΑ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΠΡΩΤΕΪΝΗΣ GEMININB

ΜΕΛΕΤΗ ΜΕ ΥΠΟΛΟΓΙΣΤΙΚΑ ΕΡΓΑΛΕΙΑ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΠΡΩΤΕΪΝΗΣ GEMININB ΣΧΟΛΗ ΙΑΤΡΙΚΗΣ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΠΛΗΡΟΦΟΡΙΚΗ ΕΠΙΣΤΗΜΩΝ ΖΩΗΣ ΜΕΛΕΤΗ ΜΕ ΥΠΟΛΟΓΙΣΤΙΚΑ ΕΡΓΑΛΕΙΑ ΤΗΣ ΑΝΘΡΩΠΙΝΗΣ ΠΡΩΤΕΪΝΗΣ GEMININB ΔΡΙΤΣΟΠΟΥΛΟΥ ΕΛΕΝΗ Α.Μ. 1003 ΠΕΡΙΕΧΟΜΕΝΑ ΠΕΡΙΕΧΟΜΕΝΑ 2

Διαβάστε περισσότερα

Ερμηνεία αποτελεσμάτων Ανάλυση διακύμανσης κατά ένα παράγοντα

Ερμηνεία αποτελεσμάτων Ανάλυση διακύμανσης κατά ένα παράγοντα Ερμηνεία αποτελεσμάτων Ανάλυση διακύμανσης κατά ένα παράγοντα Αρχείο δεδομένων school.sav Στον πίνακα Descriptives, μας δίνονται για την Επίδοση ως προς τις πέντε διαφορετικές μεθόδους διδασκαλίας, το

Διαβάστε περισσότερα

ΕΡΩΤΗΜΑΤΟΛΟΓΙΟ ΞΕΝΟΔΟΧΕΙΑΚΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ (Hotel Questionnaire) Εγχειρίδιο χρήσης (Demo Manual)

ΕΡΩΤΗΜΑΤΟΛΟΓΙΟ ΞΕΝΟΔΟΧΕΙΑΚΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ (Hotel Questionnaire) Εγχειρίδιο χρήσης (Demo Manual) ΕΡΩΤΗΜΑΤΟΛΟΓΙΟ ΞΕΝΟΔΟΧΕΙΑΚΩΝ ΕΠΙΧΕΙΡΗΣΕΩΝ (Hotel Questionnaire) Εγχειρίδιο χρήσης (Demo Manual) «WeKnow» ΔΗΜΗΤΡΙΟΣ ΨΥΧΙΑΣ & ΣΙΑ Ε.Ε. Υποστήριξη Πληροφοριακών Συστημάτων και Επικοινωνιών Σελίδα 1 από 19

Διαβάστε περισσότερα

ΒΕΛΤΙΣΤΕΣ ΙΑ ΡΟΜΕΣ ΣΕ ΙΚΤΥΑ ΜΕΤΑΒΛΗΤΟΥ ΚΟΣΤΟΥΣ

ΒΕΛΤΙΣΤΕΣ ΙΑ ΡΟΜΕΣ ΣΕ ΙΚΤΥΑ ΜΕΤΑΒΛΗΤΟΥ ΚΟΣΤΟΥΣ ΒΕΛΤΙΣΤΕΣ ΙΑ ΡΟΜΕΣ ΣΕ ΙΚΤΥΑ ΜΕΤΑΒΛΗΤΟΥ ΚΟΣΤΟΥΣ Μωυσιάδης Πολυχρόνης, Ανδρεάδης Ιωάννης Τμήμα Μαθηματικών Α.Π.Θ. ΠΕΡΙΛΗΨΗ Στην εργασία αυτή παρουσιάζεται μία μελέτη για την ελάχιστη διαδρομή σε δίκτυα μεταβλητού

Διαβάστε περισσότερα