Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 ΜΕΤΑΛΛΑΞΕΙΣ Γίνονται μόνο στο γενετικό υλικό των κυττάρων, δηλαδή στο DNA και έχουν μόνιμο χαρακτήρα. Δεν θεωρούνται μεταλλάξεις, μεταβολές των προϊόντων της έκφρασης του γενετικού υλικού Σε RNA-ιούς, μπορεί να συμβούν μεταλλάξεις στο γενετικό τους υλικό, δηλαδή γίνονται στο RNA του ιού.

3 Τι είναι μετάλλαξη Μετάλλαξη : κάθε μεταβολή στην αλληλουχία του DNA του κυττάρου. Όταν η αλλαγή αυτή έχει επίδραση στο γονιδιακό προϊόν ( στην πρωτεΐνη ), τότε ενδεχομένως, να εμφανισθεί διαφοροποίηση του φαινοτύπου.

4 είδη μεταλλάξεων Ανάλογα με την έκταση της μετάλλαξης Γονιδιακές μεταλλάξεις αντικατάσταση, προσθήκη, έλλειψη μικρού αριθμού βάσεων Χρωμοσωμικές ανωμαλίες μεταβολή μεγαλύτερου τμήματος χρωμοσώματος

5 Αποτελέσματα μεταλλάξεων Δημιουργία γενετικής ποικιλομορφίας Κληρονομικές ασθένειες Αρκετές περιπτώσεις καρκίνου

6 σε ποια κύτταρα συμβαίνουν μεταλλάξεις Στα σωματικά κύτταρα είναι η πλειονότητα των μεταλλάξεων δεν μεταβιβάζονται στους απογόνους μερικές φορές είναι σημαντικές για την υγεία Στα γενετικά κύτταρα μόνο αυτές μεταβιβάζονται από τα μια γενιά στην επόμενη

7 Δρεπανοκυτταρική αναιμία Η πρώτη γενετική ασθένεια που βρέθηκε ότι οφείλεται σε μετάλλαξη του γενετικού υλικού Στα άτομα που πάσχουν, η αιμοσφαιρίνη HbA είναι διαφορετική από την αιμοσφαιρίνη των φυσιολογικών ατόμων. Πρωτεϊνική μεταβολή αντικατάσταση γλουταμινικού οξέος με βαλίνη αποτέλεσμα μεταβολή της στερεοδιάταξης της αιμοσφαιρίνης HbA με αποτέλεσμα τη μεταβολή του σχήματος των ερυθροκυττάρων.

8 Διαφορά στη δομή της β-αλυσίδας της αιμοσφαιρίνης Αντικατάσταση μιας και μόνο βάσης. Στο έκτο κωδικόνιο της κωδικής αλυσίδας του γονιδίου, που κωδικοποιεί την β αλυσίδα της αιμοσφαιρίνης, αντικαθίσταται μια Α με Τ. GAG GTG η συγκεκριμένη αντικατάσταση έχει ως αποτέλεσμα την αντικατάσταση ενός μόνο από τα αμινοξέα της πολυπεπτιδικής αλυσίδας από κάποιο άλλο.

9 Ο χαρακτήρας της ασθένειας συμβολισμός γονιδίων Πρόκειται για αυτοσωμικική υπολειπόμενη ασθένεια. Το μεταλλαγμένο γονίδιο συμβολίζεται με β s ενώ το φυσιολογικό με B. B β s ο γονότυπος του φορέα β s β s ο γονότυπος του ασθενή B B ο γονότυπος του υγιούς

10 Διαφοροποίηση φορέων - ασθενών Οι ασθενείς δεν παράγουν καθόλου τη φυσιολογική αιμοσφαιρίνη HbA αλλά μόνο τη μεταλλαγμένη HbS. Οι φορείς δεν εμφανίζουν συμπτώματα της ασθένειας παρά μόνο σε συνθήκες μεγάλης έλλειψης οξυγόνου.

11 Φαινοτυπικές μεταβολές 1. Αλλαγή της μορφής των ερυθροκυττάρων σε συνθήκες έλλειψης οξυγόνου. ( δρεπανοειδές σχήμα ) 2. Παρεμπόδιση της κυκλοφορίας του αίματος στα τριχοειδή αιμοφόρα αγγεία με αποτέλεσμα την εμφάνιση προβλημάτων σε όργανα, όπως ο σπλήνας και οι πνεύμονες. 3. Ταχύτερη καταστροφή δρεπανοκυττάρων με αποτέλεσμα την εμφάνιση αναιμίας

12 Τύποι μεταλλάξεων Αντικατάσταση βάσης Χαρακτηριστική περίπτωση, η δρεπανοκυτταρική αναιμία, Πιθανά αποτελέσματα στο πρωτεϊνικό προϊόν που παράγει το γονίδιο Συνώνυμο κωδικόνιο, που δεν τροποποιεί το πρωτεϊνικό προϊόν και τον φαινότυπο. Τροποποιημένη πρωτεΐνη, κατά ένα αμινοξύ, με ενδεχόμενες μεταβολές στην λειτουργικότητα της πρωτεΐνης Μεταβολές στο κωδικόνιο έναρξης ή στο κωδικόνιο λήξης με διαφορετικά κάθε φορά αποτελέσματα Προσθήκη βάσης Προσθήκη τριπλέτας βάσεων : προσθήκη ενός ή περισσότερων αμινοξέων με ενδεχόμενες αλλαγές στη λειτουργικότητα της πρωτεΐνης. Προσθήκη αριθμού βάσεων που δεν είναι πολλαπλάσιο του 3 Έλλειψη βάσης

13 ΑΙΜΟΣΦΑΙΡΙΝΕΣ Αιμοσφαιρίνη Α HbA α2β2 κανονική αιμοσφαιρίνη ενηλίκων Αιμοσφαιρίνη F HbF α2γ2 εμβρυϊκή αιμοσφαιρίνη ( κύρια πρωτεΐνη των εμβρύων) αυξάνεται σε ομόζυγη β-θαλασσαιμία Αιμοσφαιρίνη Α2 HbA2 α2δ2 δευτερεύουσα αιμοσφαιρίνη ενηλίκων αυξάνεται σε φορείς β-θαλασσαιμίας αποτελεί διαγνωστικό δείκτη τα ετερόζυγα εμφανίζουν αυξημένη ποσότητα HbA2. Αιμοσφαιρίνη S HbS α2β2 S προκαλεί δρεπάνωση στα ερυθροκύτταρα

14 Παράγοντες που προκαλούν μεταλλάξεις τα αίτια που προκαλούν τις μεταλλάξεις Λάθη κατά την αντιγραφή του DNA ή το διαχωρισμό των χρωμοσωμάτων ( αυτόματες ) Μεταλλαξογόνοι παράγοντες ακτινοβολίες χημικές ουσίες ακτινοβολία -Χ φορμαλδεΰδη γ-ακτινοβολίες αρωματικοί υδρογονάνθρακες κοσμική ακτινοβολία υπεριώδης ακτινοβολία κ.α.

15 δομή και λειτουργία των πρωτεϊνών Σχέση δομής και λειτουργίας : Η τρισδιάστατη δομή ( στερεοδιάταξη ) της πρωτεΐνης καθορίζει και τη λειτουργία που αυτή εκτελεί. Μια μετάλλαξη που επηρεάζει τη τρισδιάστατη δομή της πρωτεΐνης, επηρεάζει και την λειτουργικότητα της Οι ενζυμικές πρωτεΐνες Τα ένζυμα καταλύουν αντιδράσεις που θα μπορούσαν να γίνουν και χωρίς τη παρουσία τους. Με τη παρουσία του ενζύμου η αντίδραση γίνεται σε πολύ λιγότερο χρόνο. Το ενεργό κέντρο του ενζύμου είναι μια μικρή περιοχή του ενζύμου, στο οποίο γίνεται ο κατάλληλος προσανατολισμός των αντιδρώντων μορίων και τα οποία αντιδρώντα, λέγονται μόρια-υποστρώματα.

16 η σημασία του ενεργού κέντρου του ενζύμου Κάθε μετάλλαξη η οποία γίνεται κοντά στο ενεργό κέντρο του ενζύμου επηρεάζει την ενεργότητα του ενζύμου.

17 Μεταλλάξεις και ασθένειες Οι περισσότερες ασθένειες που οφείλονται σε μεταλλάξεις, δεν είναι αποτέλεσμα ενός μόνο τύπου μετάλλαξης, για το λόγο αυτό εμφανίζουν μεγάλη ετερογένεια. Τα γονίδια που κωδικοποιούν τις αλυσίδες της αιμοσφαιρίνης είναι η χαρακτηριστική περίπτωση για το πλήθος των μεταλλάξεων. Η αιμοσφαιρίνη είναι πρωτεΐνη που παράγεται από τα πρόδρομα ερυθρά αιμοσφαίρια και έχει σφαιρικό σχήμα. Αποτελείται από 4 αλυσίδες, 2 βαριές αλυσίδες α και 2 ελαφρές αλυσίδες β που η καθεμιά έχει από μια θέση σύνδεσης με την αίμη. Επομένως υπάρχουν 2 είδη γονιδίων για τις αλυσίδες α και β. Οι αιμοσφαιρινοπάθειες οφείλονται σε μεταλλάξεις των παραπάνω γονιδίων. Ειδικά στα γονίδια που κωδικοποιούν τις β αλυσίδες, έχει διαπιστωθεί ένα τεράστιο πλήθος διαφορετικών μεταλλάξεων που προκαλούν διαφορετικά αποτελέσματα, όπως η δρεπανοκυτταρική αναιμία και η β-θαλασσαιμία. Πολλές αντικαταστάσεις, ελλείψεις ή προσθήκες βάσεων, προκαλούν β-θαλασσαιμία διαφορετικής βαρύτητας. Για το λόγο αυτό επισημαίνουμε ότι η ασθένεια οφείλεται σε πολλαπλά αλληλόμορφα.

18 ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ α. δρεπανοκυτταρική αναιμία Οφείλεται σε γονιδιακή μετάλλαξη δηλαδή σε αντικατάσταση βάσης που κωδικοποιεί το 6 ο αμινοξύ της β -πολυπεπτιδικής αλυσίδας ( από GAG σε GTG ) με αποτέλεσμα την αντικατάσταση του γλουταμινικού οξέος από τη βαλίνη. H μετάλλαξη τροποποιεί τη στρεοδιάταξη της πρωτεΐνης, με αποτέλεσμα μεταβολή του σχήματος των ερυθροκυττάρων. Κληρονομείται με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. β. β θαλασσαιμία Προκύπτει από πολλές μεταλλάξεις. Ο ανθρώπινος οργανισμός συνθέτει ελαττωμένη ποσότητα β-αλυσίδας ή δεν συνθέτει καθόλου τη β-αλυσίδα. Κληρονομείται με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας Τα ομόζυγα άτομα έχουν αυξημένη ποσότητα HbF, ενώ τα ετερόζυγα εμφανίζουν αυξημένη ποσότητα HbA 2. Η συχνότητα φορέων δρεπανοκυτταρικής αναιμίας και β-θαλασσαιμίας στις χώρες της Μεσογείου οφείλεται σε μετάλλαξη που προστατεύει εμφανίζουν αυξημένη ανθεκτικότητα στη προσβολή από πλασμώδιο, λόγω μετάλλαξης ως προς την ελονοσία. γ. α θαλασσαιμία Οφείλεται, σχεδόν σε όλες τις περιπτώσεις, σε έλλειψη ολόκληρου του γονιδίου που κωδικοποιεί την α- αλυσίδα. Υπάρχουν τέσσερα γονίδια στα χρωμοσώματα. Όσα περισσότερα γονίδια λείπουν τόσο βαρύτερη είναι η ασθένεια. Επηρεάζονται από την έλλειψη της όλα τα είδη αιμοσφαιρίνης.

19 Μεταλλάξεις γονιδίων που κωδικοποιούν ένζυμα του μεταβολισμού Υπάρχει ένας μεγάλος αριθμός μεταλλάξεων των γονιδίων που ελέγχουν τα ένζυμα του μεταβολισμού Η κάθε μετάλλαξη αυτού του είδους, έχει ως αποτέλεσμα και μια διαφορετική διαταραχή του μεταβολισμού, λόγω της διαφοροποίησης της λειτουργικότητας του παραγόμενου ενζύμου. Ασθένειες αυτού του είδους είναι η φαινυλκετονουρία ( PKU ) και ο αλφισμός, ασθένειες που κληρονομούνται με αυτοσωμικό υπολειπόμενο χαρακτήρα.

20 φαινυλκετονουρία - αλφισμός φαινυλκετονουρία (PKU ) Λόγω μετάλλαξης στο γονίδιο δεν συντίθεται το ένζυμο που καταλύει την αντίδραση μετατροπής του αμινοξέος με αποτέλεσμα τη συσσώρευση φαινυλαλανίνης. φαινυλαλανίνη σε τυροσίνη Η ασθένεια μπορεί να προκαλέσει βλάβες στα κύτταρα του εγκεφάλου, με αποτέλεσμα την διανοητική καθυστέρηση και μπορεί να αποφευχθεί με αποφυγή κατανάλωσης τροφών που περιέχουν φαινυλαλανίνη. Η ασθένεια PKU, μπορεί να ανιχνευθεί σε εμβρυική, ή σε νεογνική ηλικία και να υπάρχει η σχετική μέριμνα. αλφισμός Έλλειψη ενζύμου που είναι απαραίτητο για το σχηματισμό της μελανίνης. Στους ασθενείς υπάρχει έλλειψη της χρωστικής : στο δέρμα στα μαλλιά στην ίριδα των ματιών Η ασθένεια εμφανίζει μεγάλη ετερογένεια, λόγω ολικής έλλειψης του ενζύμου ή περιορισμένης ενεργότητας του.

21 ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Πρόκειται για μεταλλάξεις μεγάλης έκτασης, με σοβαρές κατά κανόνα συνέπειες. Α. ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Ο αριθμός των χρωμοσωμάτων είναι διαφορετικός από το φυσιολογικό αριθμό χρωμοσωμάτων. ( ανευπλοειδία ) Β. ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Η δομή των χρωμοσωμάτων είναι διαφορετική από την φυσιολογική.

22 Α. ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ μη διαχωρισμός χρωμοσωμάτων ή χρωματίδων δημιουργία γαμετών με διαφορετικό αριθμό χρωμοσωμάτων από το φυσιολογικό δημιουργία ζυγωτού με λανθασμένη ποσότητα γενετικού υλικού

23 Ο μη διαχωρισμός των χρωμοσωμάτων αν ο μη διαχωρισμός συμβεί στη πρώτη μειωτική διαίρεση οι παραγόμενοι γαμέτες έχουν αν ο μη διαχωρισμός συμβεί στη δεύτερη μειωτική διαίρεση οι παραγόμενοι γαμέτες έχουν ένα επιπλέον ένα λιγότερο ένα επιπλέον ένα λιγότερο φυσιολογικοί χρωμόσωμα χρωμόσωμα χρωμόσωμα χρωμόσωμα γαμέτες εμφανίζεται ζεύγος χρωμοσωμάτων με διαφορετική προέλευση εμφανίζεται ζεύγος πανομοιότυπων χρωμοσωμάτων τρισωμία : ύπαρξη ενός επιπλέον χρωμοσώματος μονοσωμία : ύπαρξη ενός μόνο χρωμοσώματος από τα δύο που αποτελούν το ομόλογο ζεύγος. Η μονοσωμία είναι συνήθως θανατηφόρα, με εξαίρεση το ζεύγος των φυλετικών χρωμοσωμάτων.

24 Οι συχνότερα εμφανιζόμενες περιπτώσεις αριθμητικών χρωμοσωμικών ανωμαλιών σύνδρομο Down (τρισωμία 21 ) : αίτιο : μη διαχωρισμός των χρωμοσωμάτων κατά τη μείωση συμπτώματα : καθυστέρηση στην ανάπτυξη χαρακτηριστικές δυσμορφίες στο πρόσωπο διανοητική καθυστέρηση τρισωμία 13 - τρισωμία 18 συμπτώματα : βαρύτερα από το σύνδρομο Down, πιθανόν λόγω μεγαλύτερου μεγέθους των χρωμοσωμάτων 13 και 18 σύνδρομο Klinefelter ( τρισωμία φυλετικών χρωμοσωμάτων ΧΧΥ ) : εμφάνιση : εξωτερικά χαρακτηριστικά αρσενικού, στειρότητα. Τα χαρακτηριστικά εμφανίζονται μετά την εφηβεία. σύνδρομο Turner ( μονοσωμία, μοναδικό φυλετικό χρωμόσωμα το Χ ) : εμφάνιση : φαινότυπος θηλυκού, απουσία δευτερογενών χαρακτηριστικών του φύλου, στειρότητα.

25 Β. ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Αίτιο : η δράση μεταλλαξογόνων παραγόντων Αποτέλεσμα : αλλαγή της ποσότητας ή της διάταξης της γενετικής πληροφορίας στα χρωμοσώματα Είδη δομικών χρωμοσωμικών ανωμαλιών α. έλλειψη : απώλεια γενετικού υλικού ( παράδειγμα σύνδρομο φωνή της γάτας, έλλειψη τμήματος του χρωμοσώματος 5 ) β. διπλασιασμός : επανάληψη χρωμοσωμικού τμήματος στο χρωμόσωμα γ. αναστροφή : επανένωση ενός τμήματος που προήλθε από δύο θραύσεις, αφού έχει προηγηθεί αναστροφή δ. μετατόπιση : επανένωση ενός θραύσματος σε άλλο μη ομόλογο χρωμόσωμα. Στις αμοιβαίες μετατοπίσεις, δεν χάνεται γενετικό υλικό και ο φαινότυπος είναι φυσιολογικός, υπάρχει όμως ο κίνδυνος απόκτησης απογόνων με χρωμοσωμικές ανωμαλίες.

26 ΔΙΑΓΝΩΣΗ ΓΕΝΕΤΙΚΩΝ ΑΣΘΕΝΕΙΩΝ Ο σκοπός : Α ) έγκαιρος εντοπισμός γενετικών ανωμαλιών Β ) εντοπισμός φορέων Γ ) υπολογισμός πιθανότητας εμφάνισης ασθένειας σε απογόνους παραδείγματα φαινυλκαιτονουρία PKU : έγκαιρη διάγνωση για αποφυγή φαινυλαλανίνης στη διατροφή ΔΡΕΠΑΝΟΚΥΤΤΑΡΙΚΗ ΑΝΑΙΜΙΑ : εντοπισμός φορέων υπολογισμός πιθανότητας

27 Παραδείγματα φαινυλκαιτονουρία PKU : έγκαιρη διάγνωση για αποφυγή φαινυλαλανίνης στη διατροφή ΔΡΕΠΑΝΟΚΥΤΤΑΡΙΚΗ ΑΝΑΙΜΙΑ : εντοπισμός φορέων υπολογισμός πιθανότητας

28 Δρεπανοκυτταρική αναιμία Διάγνωση δρεπανοκυτταρικής αναιμίας Παρατήρηση μορφολογίας ερυθροκυττάρων σε συνθήκες έλλειψης οξυγόνου (δοκιμασία δρεπάνωσης) Προσδιορισμός αιμοσφαιρίνης στα ερυθροκύτταρα Εντοπισμός μεταλλαγμένου γονιδίου β s

29 Μέθοδοι πραγματοποίησης διάγνωσης γενετικών ασθενειών χρωμοσωμικές ανωμαλίες : ανάλυση καρυότυπου γονιδιακές μεταλλάξεις : ανάλυση DNA ( PCR ) φαινυλκετονουρία : βιοχημική ανάλυση

30 Γενετική καθοδήγηση Στις ομάδες ατόμων που πρέπει να ζητήσουν γενετική καθοδήγηση πριν την απόκτηση απογόνων περιλαμβάνονται : Άτομα φορείς γενετικών ασθενειών Άτομα με οικογενειακό ιστορικό γενετικών ασθενειών Γυναίκες άνω των 35 ετών Γυναίκες με πολλαπλές αποβολές

31 Προγεννητικός έλεγχος αμνιοπαρακέντηση - Λήψη χοριακών λαχνών αμνιοπαρακέντηση χρόνος πραγματοποίησης 12 η 16 η εβδομάδα τρόπος πραγματοποίησης Λήψη υγρού από τον αμνιακού υγρού που περιέχει εμβρυικά κύτταρα. Απομόνωση των κυττάρων ( με φυγοκέντρηση ) Βιοχημική ανάλυση πρωτεϊνών ή ενζύμων Καλλιέργεια και δημιουργία του καρυότυπου

32 αμνιοπαρακέντηση λήψη χοριακών λαχνών

33 Λήψη χοριακών λαχνών Χρόνος πραγματοποίησης Πραγματοποιείται την 9 η - 12 η εβδομάδα. Τρόπος πραγματοποίησης Λήψη λαχνών από τα εμβρυικά κύτταρα του χορίου της μήτρας. Χρήση καρυότυπος βιοχημικές αναλύσεις

34 Σύγκριση μεθόδων προγεννητικού ελέγχου αμνιοπαρακέντηση καλύτερη ποιότητα χρωμοσωμάτων λήψη χοριακών λαχνών πιο έγκαιρη διάγνωση

35 καρκίνος Ο καρκίνος : ανεξέλεγκτος πολλαπλασιασμός κυττάρων ενός ιστού. Αίτιο : μεταλλάξεις γονιδίων σωματικών κυττάρων Γονίδια σχετικά με την καρκινογένεση : ογκογονίδια ογκοκατασταλτικά

36 Σε γενετικό επίπεδο ο καρκίνος είναι αποτέλεσμα : μετατροπής πρωτο-ογκογονιδίων σε ογκογονίδια αίτιο : γονιδιακή μετάλλαξη ή χρωμοσωμική ανωμαλία απουσίας λειτουργικότητας ογκοκατασταλτικών γονιδίων αίτιο : μετάλλαξη, συνήθως έλλειψη γονιδίου αδρανοποίηση μηχανισμών επιδιόρθωσης του DNA αποτέλεσμα : αυξημένη συχνότητα εμφάνισης καρκίνου πρωτο-ογκογονίδια γονιδιακή μετάλλαξη χρωμοσωμική ανωμαλία ( συνήθως μετατόπιση ) ογκογονίδια

37 Ο ρόλος των γονιδίων στον καρκίνο ογκοκατασταλτικά γονίδια: ελέγχουν τη κυτταρική διαίρεση και την καταστέλλουν όταν είναι απαραίτητο παράδειγμα καρκίνος αμφιβληστροειδούς βλάβες μηχανισμών επιδιόρθωσης DNA έλλειψη ογκοκατασταλτικού γονιδίου μεταλλάξεις γονιδίων που κωδικοποιούν επιδιορθωτικά ένζυμα παράδειγμα μελαχρωματική ξηροδερμία μετάλλαξη γονιδίου που παράγει επιδιορθωτικό ένζυμο βλαβών UV

38 που οφείλεται η πολυπλοκότητα του καρκίνου o καρκίνος είναι: αποτέλεσμα αλληλεπίδρασης γενετικών και περιβαλλοντικών παραγόντων η πολυπλοκότητα του έχει σχέση : με τη συσσώρευση γενετικών αλλαγών εξαιτίας μεταλλαξογόνων παραγόντων με τα ογκογονίδια και τα ογκοκατασταλτικά γονίδια. Παράδειγμα : καρκίνος παχέος εντέρου

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

Κεφάλαιο 6: Μεταλλάξεις

Κεφάλαιο 6: Μεταλλάξεις Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

βάσεων στις οποίες συµβαίνει: περισσοτέρων βάσεων περισσοτέρων βάσεων περισσοτέρων βάσεων ανωµαλίες χρωµοσωµικές

βάσεων στις οποίες συµβαίνει: περισσοτέρων βάσεων περισσοτέρων βάσεων περισσοτέρων βάσεων ανωµαλίες χρωµοσωµικές ΚΕΦΑΛΑΙΟ 6ο: ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία του DNA ηµιουργούν συνήθως ένα διαφορετικό φαινότυπο χωρίς όµως πάντοτε αυτό να είναι απαραίτητο Αυτό εξαρτάται από τον τρόπο µε τον

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 6 ο...2 I. Μεταλλάξεις...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΚΕΦΑΛΑΙΟ 6 ο ΚΕΦΑΛΑΙΟ 6 ο...2 I. Μεταλλάξεις...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 1 ΚΕΦΑΛΑΙΟ 6 ο I. Μεταλλάξεις Εκπαιδευτικοί στόχοι: Μετά την ολοκλήρωση της µελέτης αυτού του κεφαλαίου ο µαθητής θα πρέπει

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» Εργασία στο μάθημα της Βιολογίας ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Μια εργασία των: Μακρυδάκη Ελευθερία Μπούρλα Ελένη Τμήμα: Γ 3 Ημερομηνία: 27/1/2015 Γενικά με

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α. Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση.

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α. Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση. ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση. 1. Έχοντας στη διάθεσή μας στο εργαστήριο αμιγή στελέχη για ένα συγκεκριμένο χαρακτηριστικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Έκφραση της γενετικής πληροφορίας

Έκφραση της γενετικής πληροφορίας Η ροή της γενετικής πληροφορίας Έκφραση της γενετικής πληροφορίας To DNA ενός οργανισμού είναι ο μοριακός «σκληρός δίσκος» που περιέχει αποθηκευμένες ακριβείς οδηγίες, οι οποίες καθορίζουν τη δομή και

Διαβάστε περισσότερα

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις

ΚΒφόίΙοιο 6 ΜειαΠΠά^εις ΚΒφόίΙοιο 6 ΜειαΠΠά^εις 1. Ενας γενετιστής βρήκε ότι μια μετάλλαξη σε ένα γονίδιο δεν είχε επίδραση στην πολυπεπτιδική αλυσίδα που κωδικοποιείται από αυτό. Σε τι μπορεί να οφείλεται η συγκεκριμένη μετάλλαξη;

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα»

«Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Μεταλλάξεις και ο ρόλος τους στην γενετική ποικιλότητα» «Τι είναι Μετάλλαξη» Γενικά με τον όρο μετάλλαξη ονομάζουμε τις αλλαγές στο γενετικό υλικό, το DNA δηλαδή ενός ζωντανού οργανισμού και πρόκειται

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 29/12/2016 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 29/12/2016 ΘΕΜΑ 1 ο 1. α 2. β 3. γ 4. γ 5. δ ΘΕΜΑ 2ο Β1. Σημειώστε κάθε πρόταση με Σωστό ή Λάθος παραθέτοντας μια σύντομη δικαιολόγηση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Μεταλλάξεις. κεφάλαιο. Ανάλυση χρωμοσωμάτων με τη μέθοδο FISH

Μεταλλάξεις. κεφάλαιο. Ανάλυση χρωμοσωμάτων με τη μέθοδο FISH Μεταλλάξεις κεφάλαιο Ανάλυση χρωμοσωμάτων με τη μέθοδο FISH 6. Μεταλλάξεις Το γενετικό υλικό μπορεί να υποστεί αλλαγές με πολλούς διαφορετικούς τρόπους. Το γεγονός αυτό δεν προκαλεί έκπληξη. Σκεφθείτε

Διαβάστε περισσότερα

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B

Βιολογία ΘΕΜΑ Α ΘΕΜΑ B Βιολογία προσανατολισμού Α. 1. β 2. γ 3. δ 4. γ 5. δ ΘΕΜΑ Α B1. 4,1,2,6,8,3,5,7 ΘΕΜΑ B B2. Σχολικό βιβλίο σελ. 103 Η γενετική καθοδήγηση είναι.υγιών απογόνων. Σχολικό βιβλίο σελ. 103 Παρ ότι γενετική καθοδήγηση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/2015 29 12 2016 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση που συμπληρώνει τις παρακάτω προτάσεις: 1. Η περιοριστική

Διαβάστε περισσότερα

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 4 ΜΑΪΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. α, Α2. β, Α3. δ, Α4. β, Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Ασκησεις για το Κεφάλαιο 6: Μεταλλάξεις

Ασκησεις για το Κεφάλαιο 6: Μεταλλάξεις A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Ένα ανθρώπινο σπερματοζωάριο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. β 2. β 3. α 4. α 5. β


Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου. ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. α, Α2 γ, Α3 γ, Α4 δ, Α5 β ΘΕΜΑ Β Β1. 1Γ, 2Β, 3Α, 4Α, 5Γ, 6Α Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.»

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 9 Μαρτίου 2014 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 9 Μαρτίου 2014 ΘΕΜΑ Α Α1. β, Α2. δ, Α3. γ, Α4. δ, Α5. γ. ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 90-91: «Το παράδειγμα της δρεπανοκυτταρικής

Διαβάστε περισσότερα

ΜΕΤΑΛΛΑΞΕΙΣ. Βαρυπάτη Αθηνά Φυσικός


Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΘΗΜ / ΤΞΗ: ΙΟΛΟΓΙ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝ) ΗΜΕΡΟΜΗΝΙ: 22/01/2017 ΕΠΙΜΕΛΕΙ ΔΙΓΩΝΙΣΜΤΟΣ: ΝΟΤ ΛΖΡΚΗ ΘΕΜ Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. πό τη διασταύρωση ελέγχου

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 6 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


Τρίτη, 30 Μαΐου 2006 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 30 Μαΐου 2006 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ.

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. Απαντήσεις: βιολογια κατευθυνσης 24/02/2013 ΘΕΜΑ 1 ο Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. ΘΕΜΑ 2 ο Α. Σελ 69 σχολικού βιβλίου: «Το μοσχομπίζελο έχει πολλά πλεονεκτήματα... έως και σελ 70 σχολικού..των αποτελεσμάτων».

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α: Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β: Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάση ε. RNA πολυμεράση Β3.

Διαβάστε περισσότερα

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Ο Mendel καλλιέργησε 28.000 φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας Λόγοι επιτυχίας των πειραμάτων του Mendel 1. Μελέτησε μία ή δύο

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία. Δ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Μάρτιος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Δ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Μάρτιος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1.Σε ένα σωματικό κύτταρο ανθρώπου στο στάδιο της μετάφασης υπάρχουν: α. 4 γονίδια για την α-αλυσίδα της αιμοσφαιρίνης β. 8 γονίδια για

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α. 1. δ 2. δ 3. β 4. γ 5. α ΘΕΜΑ Β Β1. Α I Β IV Γ VI Δ VII Ε II ΣΤ III Ζ V Η -


Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA

KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA KΕΦΑΛΑΙΟ 4: Τεχνολογία του Ανασυνδυασµένου DNA Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Πώς ονοµάζονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Λεξικό Βιολογικών όρων

Λεξικό Βιολογικών όρων Λεξικό Βιολογικών όρων ονοματεπώνυμο... Χανιά 2015-2016 1 Κεφ.1 Το Γενετικό Υλικό 2 Αδελφές χρωματίδες:... Απλοειδή:... Αυτοσωμικά χρωμοσώματα:... Βακτηριοφάγος:... Διπλοειδή:... DNA:... Ιστόνες:... 3

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα