ANALYSIS ON DNA METHYLATION DIVERSITY OF DIPLOID AND TETRAPLOID OF WATERMELON( Citrullus Lanatus)

Transcript

1 ,23 (1) :80 84 Journal of Nuclear Agricultural Sciences : (2009) DNA (,, ) :, 3 ( Citrullus lanatus) (MSAP),10 546,, 3,,,DNA,DNA,DNA, 0102 % :; ; (MSAP) ; ANALYSIS ON DNA METHYLATION DIVERSITY OF DIPLOID AND TETRAPLOID OF WATERMELON( Citrullus Lanatus) NIE Li2juan WANG Zi2cheng WANG Yi2fan LI Guo2shen HE Yan2xia ( The institute of agriculture biotechnology, henan university, Kaifeng, Henan ) Abstract :The pure diploid and autotetraploid of Kexi, Zhongjin and Meixuan of watermelon ( Citrullus lanatus) were analyzed by MSAP technique to investigate the epigenetic variety of plant different multiple, 546 bands were amplified by 10 primer combinations, 3 bands were found special or diploid or tetraploid, and these bands had no variety difference as a result of multiple difference. The result indicated that compared to the pure diploid, autotetraploid had DNA hypo2methylation and single band hyper2methylation. However, the diversity of DNA methylation sensitivity polymorphism between the diploid and tetraploid of the same breed was only only about 0102 %. Key words :diploid ; autotetraploid ; MSAP ; methylation diversity, [1 ],,,,DNA DNA DNA DNA, Liu [2 ],,, DNA Wang [3 ], DNA, Song [4 ] PCR mrna, Guo [5 ],,, : : : ( ), (06ZDZR011) :(19822),,,, :(19742),,,,,Tel : ; E2mail edu. cn

2 1 DNA 81, [6 ],,DNA, (MSAP) (AFLP),DNA DNA [7 ] DNA AFLP,, MSAP DNA, ( Citrullus lanatus) 2005, , ,, 10, 1 2 3, :,,,,, 112 CTAB DNA [8 ],AFLP DNA,, (MSAP) 3 DNA [9 ] DNA = = Π AFLP : DNA, EcoR ΠMse 37 3h,65 215h : T 4,25 2h, 10, : PCR 20 : 94 30s,56 1min,72 1minPTC2100 (),50, : PCR : 1 :94 30s, 65 1min, 72 1min ; 2 13,DNA 017, ; 14 36, 56,(AFLP 1) : (1),,(2) 95 %,,1 2, (3) 1ml 015 %,, (1ml 015 % :5 l,1ml 95 %,5 l ) 5min, 95 % (4), (70ml 6 %PAGE 400 l APS 40 l TEMED ) (5) 3 h, : (1), 1 TBE(Tris + + EDTA),75W 30min (2) 2Π3 (98 %, % FF %),,94 3min, (3),,, 8 l (4) 2Π3, : (1) 10min,, : 200ml + 10ml ml ; (2) 10min :4g + 200ml + 10ml ml ; (3) 5-10s ; (4) 15-20min :60g + 6ml ml ; (5)

3 AFLP Table 1 Sequence of adapters and primers used in AFLP primer EcoR (adaptor) E2A 3 sequence (5-3 ) CTCGTAGACTGCGTACC AATTGGTACGCAGTC GACTGCGTACCAATTCA EcoR + ACG(E01) GACTGCGTACCAATTCACG EcoR + ACC(E02) EcoR + AAC(E03) GACTGCGTACCAATTCAAC EcoR + ACT(E04) Mse (adaptor) M2C 3 Mse + CCA(M01) Mse + CTA(M02) Mse + CAC(M03) Mse + CTC(M04) GACTGCGTACCAATTCACT GACGATGAGTCCTGAG TACTCAGGACTCAT GACGATGAGTCCTGAGTAAC GACGATGAGTCCTGAGTAACCA GACGATGAGTCCTGAGTAACTA GACGATGAGTCCTGAGTAACAC GACGATGAGTCCTGAGTAACTC : 3 Note : 3 was primes for pre2amplification. The same as following table. 2 MSAP Table 2 The primer sequence of MSAP technique primer EcoR adaptor E2A 3 EcoR + ACG( E01) EcoR + ACC( E02) EcoR + AAC( E03) EcoR + ACT( E04) EcoR + AGG( E05) EcoR + AGG( E07) EcoR + AGG( E08) Hpa 2Msp H2M2A 3 Hpa 2Msp + TCCA Hpa 2Msp + TCAA sequence (5-3 ) CTCGTAGACTGCGTACC AATTGGTACGCAGTC GACTGCGTACCAATTCA GACTGCGTACCAATTCACG GACTGCGTACCAATTCAAC GACTGCGTACCAATTCACT GACTGCGTACCAATTCAGG GACTGCGTACCAATTCAGC GACTGCGTACCAATTCACA CGAGCAGGACTCATGA GATCATGAGTCCTGCT ATCATGAGTCCTGCTCGG ATCATGAGTCCTGCTCGGTCCA ATCATGAGTCCTGCTCGGTCAA MSAP Msp Hap Mse,EcoR EcoR ΠHpa : EcoR ΠHpa,20 l 250ng DNA, EcoR 3U,10 ( 500mmolΠL Tris2HCl, ph 715 ; 100mmolΠL MgCl 2 ; 10mmolΠL Dithiothreitol ; 100mmolΠL NaCl), h, h,6 l, 3U Hpa,2 l 10 ( 100mmolΠL Tris2HCl ; ph 715 ; 100mmolΠL MgCl 2 ;10mmolΠL Dithiothreitol), 20 l,37 3h ; EcoR ΠMsp, EcoR Msp, 37 3h, AFLP (AFLP 2, 3) 3 Hpa Msp Table 3 The methylation2sensitive, restriction bands of Hpa and Msp and the classify of the bands pattern methylation state CCGG C5mCGG 5hmCCGG C5hm CGG 5mC5mCGG 5mCCGG restriction enzyme activityand restriction bands Hpa Msp H M non non non non count of the bands :CCGG, 5mC5mCGG, C5mCGG,5hmC CGGCCGGDNA - DNA Note: CCGG, unmethylation site. 5mC5mCGG, fully methylation site. C5mCGG,methylaiton of the inner cytosine. 5hmC CGGmeans methylation of the outer cytosine (one strand) AFLP, 7 336,,, 1 E02ΠM03 E01Π M02, DNA 1 AFLP Fig. 1 AFLP map of different multiple materials ; and 3 denotes Kexi, Zhongjin and Meixuan respectively ; 4, 5 and 6 denotes the corresponding autoteraploid materials respectively 212 DNA, PCR 3 : Hpa Msp Msp Hpa

4 1 DNA 83 ; Hpa Msp ( 3) ,3 ( 4),, DNA (,, ) 4,E08ΠTCAA,, 5 2CmCGG23 ( 2) ; E08Π TCCA,,5 2mCmCGG23,5 2ChmCGG235 2hmCCGG23 ; E02ΠTCAA,, 5 2CCGG23 5 2ChmCGG235 2hmCCGG2 3,,E07ΠTCCA, : , 2 5,, DNA, primer combinatons 4 Table 4 The diversity of the bandsof different primer combinations diploid autotetraploid E07ΠTCCA E08ΠTCAA E08ΠTCCA E02ΠTCAA : ; Note :1,2 and 3 denotes Kexi, Zhongjin and Meixuan respectively ; 4,5 and 6 denotes the corresponding autotetraploid materials. 213 DNA,, ( 5) 2,,5, 2 E08ΠTCAA Fig. 2 Parts of amplified bands of E08ΠTCAA primer combination : ; 4 5 6, M Msp,H Hpa Note : 1,2 and 3 denotes Kexi, Zhongjin and Meixuan respectively ; 4,5 and 6 denotes the corresponding autotetraploid materials. The band which the arrow point at was the changed pattern, pattern of pure diploid turneded into pattern of autotetraploid. M means the emplied productions in Msp digest, H the emplied productions in Hpa digest.,, DNA DNA,,5 DNA, ,, 3, DNA,, DNA DNA,,,,DNA,, MSAP,

5 84 Journal of Nuclear Agricultural Sciences 2009,23 (1) : DNA Table 5 The statistical analysis on the DNA methylation bands pattern of the diploid and the autotetraploid patterns diploid A utotetraploid total amplification bands total methylation bands average of diploid average of autotetraploid methylation polymorphism( %) ,, 0102 % DNA,,, DNA,, [10-13 ] [14 ] RAPD,DNA ; [10 ] RAPD,, [5 ],,,,DNA,,, DNA,DNA,,, DNA,,, : [J ].,2003,17 (3) : [ 2 ] Liu B, Wendel J F. Epigenetic phenomena and the evolution of plant allopolyploids[j ]. Mol Phylogenetics Evol, 2003, 29 (3) : [ 3 ] Wang J, Tian L, Madlung A, et al. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids [ J ]. Genetics, 2004, 167 : [ 4 ] Song K M, Osbom T C. A method for examining expression of homologous genes in plant polyploid [ J ]. Biology, 1994, 26 : Plant Molecular Biolecular [ 5 ] Guo M, Davis D, Birchler J A. Dosage effects on gene expression in a maize ploidy series[j ]. Genetics, 1996, 142 (4) : [ 6 ],,. AFLP [J ]., 2004, 21, (1) :46 49 [ 7 ] Xiong L Z, Xu C G, Saghai2Maroof M A. Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation2sensitive amplification polymorphisn technique[j ]. Mol Gen Genet, 1999, 261 : [ 8 ],,,,. CTAB DNA [J ]., 2004, 26 (4) : [ 9 ],,,. DNA [J ].,2007, 43 (1) :85 87 [10 ],,. [M]. :,2001 [11 ],,,. DNA [J ].,1998, 24 (1) :79 81 [12 ],,. AFLP [J ]., 2002, 19, (2) : [13 ]. [J ]. :, 1997 [14 ],,,. DNA RAPD [J ].,2001, 27 (3) : [ 1 ],,.