ΑΠΑΝΤΗΣΕΙΣ ΤΟΝ ΕΡΟΤΗΣΕΟΝ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΠΑΝΤΗΣΕΙΣ ΤΟΝ ΕΡΟΤΗΣΕΟΝ"

Transcript

1 ΑΠΑΝΤΗΣΕΙΣ ΤΟΝ ΕΡΟΤΗΣΕΟΝ 45

2 Κεφάλαιο 1 Το νενειικό υλικό 1. To DNA σε δύο διαφορετικά κύτταρα ανθρώπου βρέθηκε ότι αποτελείται στο ένα από 3x10 9 και στο άλλο από 6x1 θ 9 ζεύγη βάσεων. Πώς πορεί να εξηγηθεί αυτό; Γνωρίζου ε ότι το ανθρώπινο γονιδίω α σε ένα απλοειδές κύτταρο αποτελείται από 3x10 9 περίπου ζευγάρια νουκλεοτιδίων DNA, που είναι οργανω ένα σε 23 χρω οσώ ατα. Επο ένως, το πρώτο κύτταρο θα είναι απλοειδές. Στον άνθρωπο α- πλοειδή κύτταρα είναι οι γα έτες (ωάριο ή σπερ ατοζωάριο). Το δεύτερο κύτταρο περιέχει 2χ(3χ10 9 ) ζευγάρια νουκλεοτιδίων DNA και επο ένως είναι διπλοειδές. Στον άνθρωπο διπλοειδή είναι όλα τα σω ατικά κύτταρα. 2. Με ποιον από τους τρόπους που αναφέρονται πιο κάτω συνδέεται κάθε νουκλεοτίδιο ε το α έσως επό ενο του στην πολυνουκλεοτιδική αλυσίδα του DNA; α. Η φωσφορική ο άδα του ενός ε την αζωτούχο βάση του επο ένου. β. Η φωσφορική ο άδα του ενός ε τη δεοξυριβόζη του επο ένου. γ. Η αζωτούχος βάση του ενός ε τη δεοξυριβόζη του επο ένου. δ. Οι αζωτούχες βάσεις δύο συνεχό ενων νουκλεοτιδίων ε δεσ ούς υδρογόνου. ε. Η δεοξυριβόζη του ενός ε τη φωσφορική ο άδα του επο ένου. στ. Οι φωσφορικές ο άδες δύο συνεχό ενων νουκλεοτιδίων εταξύ τους. Σωστή απάντηση είναι η ε. 3. Σε όριο DNA ευκαρυωτικού κυττάρου η αδενίνη αποτελεί το 20% των α- ζωτούχων βάσεών του. Σε ποιες αναλογίες (%) θα βρίσκεται η κάθε ία από τις υπόλοιπες αζωτούχες βάσεις του; Γνωρίζου ε ότι, λόγω της συ πληρω ατικότητας των βάσεων, σε ένα όριο DNA η ποσότητα της αδενίνης είναι ίση ε την ποσότητα της θυ ίνης, επο ένως και η θυ ίνη θα είναι σε ποσοστό 20%. Οι δύο άλλες αζωτούχες βάσεις θα βρίσκονται επίσης σε ί- σες εταξύ τους ποσότητες. Αν από το 100% των αζωτούχων βάσεων αφαιρέσου ε 20%, που αντιστοιχεί στην αδενίνη, και 20%, που αντιστοιχεί στη θυ ίνη, ένει 60%, από το οποίο το 30% αντιστοιχεί στη γουανίνη και το 30% αντιστοιχεί στην κυτοσίνη. 4. Να αναφέρετε, συνοπτικά, τις λειτουργίες του γενετικού υλικού. Συνοπτικά οι λειτουργίες του γενετικού υλικού είναι: Η αποθήκευση της γενετικής πληροφορίας. Στο DNA (ή το RNA των RNA ιών) περιέχονται οι πληροφορίες που καθορίζουν όλα τα χαρακτηριστικά ενός οργανισ ού και οι οποίες οργανώνονται σε λειτουργικές ονάδες, τα γονίδια. Η διατήρηση και η εταβίβαση της γενετικής πληροφορίας από κύπαρο σε κύτταρο και από οργανισ ό σε οργανισ ό, που εξασφαλίζονται ε τον αυτοδιπλασιασ ό του DNA. Η έκφραση των γενετικών πληροφοριών, που επιτυγχάνεται ε τον έλεγχο της σύνθεσης των πρωτεϊνών. 47

3 5. Οι επιστή ονες πορούν να κατασκευάσουν ένα σύνθετο ιό που προσβάλλει βακτήρια (βακτηριοφάγος η φάγος) και που έχει το πρωτεϊνικό κάλυ α του φάγου Τ 2 και το DNA του φάγου Τ 4. Όταν ο σύνθετος αυτός φάγος ολύνει ένα βακτήριο, οι απόγονοι φάγοι που θα παραχθούν θα έχουν: α. τις πρωτείνες του φάγου Τ 2 και το DNA του φάγου Τ 4 β. τις πρωτείνες του φάγου Τ 4 και το DNA του φάγου Τ 2 γ. είγ α του DNA και των πρωτεϊνών και των δύο φάγων δ. τις πρωτείνες και το DNA του φάγου Τ 2 ε. τις πρωτείνες και το DNA του φάγου Τ 4 Ποια από τις παραπάνω προτάσεις είναι σωστή; Να τεκ ηριώσετε την απάντησή σας. Σωστή απάντηση είναι η ε. Γνωρίζου ε ότι το DNA αποτελεί το γενετικό υλικό και είναι υπεύθυνο για τη ε- ταβίβαση των γενετικών πληροφοριών στους απογόνους, καθώς και για την έκφραση τους, που επιτυγχάνεται ε τον έλεγχο της σύνθεσης των πρωτεϊνών. Ο σύνθετος ιός έχει DNA του φάγου Τ 4 και επο ένως οι απόγονοι φάγοι που θα παραχθούν θα έχουν τις πρωτεΐνες και το DNA του φάγου Τ Τι είναι τα πλασ ίδια; Να αναφέρετε δύο ση αντικά είδη γονιδίων που ε- ντοπίζονται σε αυτά. Στα βακτήρια εκτός από το κύριο κυκλικό όριο DNA υπάρχουν και τα πλασ ίδια. Τα πλασ ίδια είναι δίκλωνα κυκλικά όρια DNA σε διάφορα εγέθη. Περιέχουν ι- κρό ποσοστό της γενετικής πληροφορίας και αποτελούν το 1-2% του βακτηριακού DNA. Ένα βακτήριο πορεί να περιέχει ένα ή περισσότερα πλασ ίδια τα οποία αντιγράφονται ανεξάρτητα από το κύριο όριο DNA του βακτηρίου. Μεταξύ των γονιδίων που περιέχονται στα πλασ ίδια υπάρχουν γονίδια ανθεκτικότητας σε αντιβιοτικά και γονίδια που σχετίζονται ε τη εταφορά γενετικού υλικού από ένα βακτήριο σε άλλο. Τα πλασ ίδια έχουν τη δυνατότητα να ανταλλάσσουν γενετικό υλικό τόσο εταξύ τους όσο και ε το κύριο όριο DNA του βακτηρίου, καθώς και να εταφέρονται από ένα βακτήριο σε άλλο. Με τον τρόπο αυτό ετασχη ατίζουν το βακτήριο στο οποίο εισέρχονται και του προσδίδουν καινούριες ιδιότητες. 7. Ποια από τις παρακάτω προτάσεις που αφορά τα νουκλεοσώ ατα είναι σωστή; α. Κατασκευάζονται από χρω οσώ ατα β. Αποτελούνται αποκλειστικά από DNA γ. Αποτελούνται από DNA που τυλίγεται γύρω από πρωτείνες (ιστόνες) δ. η ιουργούνται όνο κατά την κυτταρική διαίρεση ε. Ε φανίζονται όνο κατά τη εσόφαση Η σωστή πρόταση είναι η γ. 8. Να τοποθετήσετε κατά έγεθος (ανάλογα ε την ποσότητα του γενετικού υλικού) από το ικρότερο στο εγαλύτερο τα: 48

4 Χρω όσω α, νουκλεοτίδιο, γονίδιο, νουκλεόσω α. (Ένα έσο γονίδιο έχει ήκος 1000 ζεύγη βάσεων). Σωστή σειρά κατά έγεθος από το ικρότερο στο εγαλύτερο είναι: νουκλεοτίδιο, νουκλεόσω α, γονίδιο, χρω όσω α. 9. ΣΤΟ κεί ενο που ακολουθεί διαγράψτε λέξεις ή φράσεις, ώστε η πρόταση που θα παρα είνει να είναι σωστή. Το γενετικό υλικό των ιτοχονδρίων είναι [ ονόκλωνο-δίκλωνο] όριο [DNA- RNA] συνήθως [γρα ικό-κυκλικό] και περιέχει γενετικές πληροφορίες για [όλες- ερικές από] τις λειτουργίες του. Η σωστή πρόταση είναι: Το γενετικό υλικό των ιτοχονδρίων είναι [δίκλωνο] ό- ριο [DNA] συνήθως [κυκλικό] και περιέχει γενετικές πληροφορίες για [ ερικές α- πό] τις λειτουργίες του. 10. Η Acetabularia είναι ένας ονοκύτταρος οργανισ ός ε διαφοροποιη ένα τ ή- ατα: βάση, ίσχο και καπέλο. Σε ένα πείρα α ο J. Hummering «ε φύτευσε» στη βάση του είδους Acetabularia crenulata το ίσχο από το είδος Acetabularia mediteranea και αντίστροφα. Και στις δύο περιπτώσεις το καπέλο που σχη ατίστηκε καθορίστηκε από τη βάση του οργανισ ού και όχι από το ίσχο, που συνδέεται ά εσα ε το καπέλο. Ποια συ περάσ ατα βγαίνουν; Όπως γνωρίζου ε, ο πυρήνας περιέχει το γενετικό υλικό και ελέγχει όλες τις λειτουργίες και τα χαρακτηριστικά των κυττάρων. Είναι προφανές ότι ο πυρήνας της Acetabularia βρίσκεται στη βάση, συνεπώς ε τη ετα όσχευση, ο ίσχος από το είδος Acetabularia mediteranea απέκτησε τον πυρήνα του είδους Acetabularia crenulata και επο ένως και τις γενετικές πληροφορίες για το σχη ατισ ό καπέλου του είδους Acetabularia crenulata. Το αντίστροφο συνέβη ε το ίσχο από το είδος Acetabularia crenulata, που απέκτησε τον πυρήνα του είδους Acetabularia mediteranea. 49

5 Κεφάλαιο 2 Ανιινραφή, έκφραοη και ρύθ ιοη mc νενειικης πληροφορίας Ανιινραιοπ ιου DNA και έκιρραοπ inc νενειικπε nflnpoipopiac 1. Ενα κύτταρο που περιέχει ένα όνο χρω όσω α τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό φώσφορο. Ετσι κάθε νέος κλώνος DNA που συντίθεται κατά την αντιγραφή του DNA θα είναι ραδιενεργός. Το κύτταρο αντιγράφει το DNA του και ετά διαιρείται. Τα θυγατρικά κύτταρα που βρίσκονται ακό η στο ραδιενεργό θρεπτικό έσο αντιγράφουν το DNA τους και διαιρούνται για άλλη ια φορά, οπότε έχου ε συνολικά τέσσερα κύτταρα. Σχεδιάστε το DNA σε κάθε ένα από τα 4 κύτταρα, παριστάνοντας το η ραδιενεργό DNA ε ια συνεχή γρα ή και το ραδιενεργό ε διακεκο ένη γρα ή. Ο ηχανισ ός αντιγραφής του DNA είναι η ισυντηρητικός. Το κύτταρο αρχικά αντιγράφει το DNA του, σχη ατίζοντας δύο νέα όρια DNA και στη συνέχεια διαιρείται. Τα δύο νέα όρια DNA αποτελούνται από ία ητρική αλυσίδα (συνεχής γρα ή) και ία θυγατρική ραδιενεργή αλυσίδα (διακεκο ένη γρα ή). Κατά την διαίρεση κάθε κύτταρο παίρνει από ένα νέο υ- βριδικό όριο. Τα θυγατρικά κύτταρα αντιγράφουν πάλι το DNA τους και κατά τη διαίρεση δίνουν τελικά τέσσερα κύτταρα. Στα δύο από αυτά το DNA αποτελείται από δύο ραδιενεργές αλυσίδες, ενώ στα άλλα δύο από υβριδικά όρια (ραδιενεργό και η ραδιενεργό). 1ος διπλασιασ ό ς 2 ο ς διπλασιασ ό ς Αρχικό κύτταρο Ανάπτυξη σ ε θρεπτικό υλικό που περιέχει ραδιενεργό φώσφορο και αντιγραφή DNA Χρω όσω α που [ αποτελείται από Ι ^ λ ία η ραδιενεργή Ι I διπλή αλυσίδα V J DNA Κυτταρική διαίρεση Ανάπτυξη σ ε θρεπτικό υλικό που περιέχει ραδιενεργό φώσφορο Κυτταρική διαίρεση 50

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ Βιολογία ΘΕΜΑ Α κατεύθυνσης 1. δ 2. α 3. γ 4. δ 5. γ 6. α 7. δ 8. α 9. α 10. α ΘΕΜΑ Β Β1. Η ραδιενέργεια 32 Ρ θα βρίσκεται στο κλάσμα Β, δηλαδή στο κλάσμα εκείνο που περιλαμβάνει τα βακτήρια που έχουν

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 1 ο -Το γενετικό υλικό Το γενετικό υλικό Ιστορική αναδρομή 1869: Το DNA εντοπίζεται στον πυρήνα των κυττάρων 1944: Μέχρι τότε δεν ήταν γνωστό ότι αποτελεί το γενετικό

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Το γενετικό υλικό. κεφάλαιο. Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης

Το γενετικό υλικό. κεφάλαιο. Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης Το γενετικό υλικό κεφάλαιο Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης To DNA είναι το γενετικό υλικό Η απάντηση δόθηκε το 1944, όταν οι Avery, Mac-Leod και

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΛΥΚΕΙΟ ΠΑΝ/ΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΠΕΙΡΑΜΑΤΑ 1. Σε ένα πείραμα παρόμοιο με αυτό που διεξήγαγε ο Griffith, αφού θανατώσατε με

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Οργά νωση Γενετικού Υλικού

Οργά νωση Γενετικού Υλικού Βιολογία Γ Γυμνασίου: Διατήρηση και Συνέχεια της Ζωής Οργά νωση Γενετικού Υλικού Γονίδιο: Η μονάδα της κληρονομικότητας. Ουσιαστικά είναι ένα κομμάτι από το DNA που αποθηκεύει πληροφορίες για κάποιο συγκεκριμένο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ)

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα

Κεφάλαιο 4: Ανασυνδυασμένο DNA

Κεφάλαιο 4: Ανασυνδυασμένο DNA Κεφάλαιο 4: Ανασυνδυασμένο DNA 1. Η ανάπτυξη της γενετικής μηχανικής επέτρεψε: α. την κατανόηση των μηχανισμών αντιγραφής του γενετικού υλικού β. την απομόνωση των πλασμιδίων από τα βακτήρια γ. την πραγματοποίηση

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DNA είναι το γενετικό υλικό. Ποιο πίστευαν αρχικά οι επιστήμονες πως είναι το μόριο που μεταφέρει τη γενετική πληροφορία; Παρ όλο που το DNA εντοπίστηκε στον πυρήνα των

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες;

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Οι πρωτεΐνες αποτελούν δομικά ή λειτουργικά συστατικά των κυττάρων και δομούνται από απλούστερες ενώσεις, τα αμινοξέα.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΗΜΥ 001 -Υγεία και Τεχνολογία. Σενάρια Ιατρικής Φαντασίας (Γενετική)

ΗΜΥ 001 -Υγεία και Τεχνολογία. Σενάρια Ιατρικής Φαντασίας (Γενετική) ΗΜΥ 001 -Υγεία και Τεχνολογία Σενάρια Ιατρικής Φαντασίας (Γενετική) Γενετική ηµιουργήµατα της φύσης συνέπεια στα µορφολογικά χαρακτηριστικά τους αναπαραγωγική διαδικασία οι απόγονοι µοιάζουν σε µικρό ή

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΠΑΘΟΓΟΝΟ (σκότωνε τα ποντίκια που µόλυνε)

ΠΑΘΟΓΟΝΟ (σκότωνε τα ποντίκια που µόλυνε) ΚΕΦΑΛΑΙΟ 1ο: ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1 ΠΟΙΟ ΜΟΡΙΟ ΜΕΤΑΦΕΡΕΙ ΤΗ ΓΕΝΕΤΙΚΗ ΠΛΗΡΟΦΟΡΙΑ; Το 1969 εντοπίστηκε στον πυρήνα των κυττάρων το DNA Μέχρι το 1944 δεν ήταν γνωστό ότι αποτελεί το γενετικό υλικό των οργανισµών

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Β1. Β2. ΘΕΜΑ 2ο 1. 2.

Β1. Β2. ΘΕΜΑ 2ο 1. 2. 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 20 ΣΕΠΤΕΜΒΡΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: BΙΟΛΟΓΙΑ (ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο Α1.

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

«Δομή του Γενετικού Υλικού σε Προκαρυωτικούς και Ευκαρυωτικούς Οργανισμούς»

«Δομή του Γενετικού Υλικού σε Προκαρυωτικούς και Ευκαρυωτικούς Οργανισμούς» Εργασία στο μάθημα της βιολογίας «Δομή του Γενετικού Υλικού σε Προκαρυωτικούς και Ευκαρυωτικούς Οργανισμούς» Μπαμπάλας Γεώργιος 31/01/2014 1ο Γυμνάσιο Κερατέας Υπεύθ.Καθηγητής:Κεραμάρης,Κ ΕΥΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ

Διαβάστε περισσότερα

ΛΥΚΕΙΟ.. ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2015/2016

ΛΥΚΕΙΟ.. ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2015/2016 ΛΥΚΕΙΟ.. ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2015/2016 ΒΑΘ.:... / 35 ΟΛΟΓΡ.:... ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2016 ΥΠΟΓΡ.:... ΤΑΞΗ: Α ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: dd/mm/yyyy ΜΑΘΗΜΑ: XHMEIA - ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΙΚΟΣ ΧΡΟΝΟΣ: 2 ΩΡΕΣ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA

ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA ΚΕΦ.4 ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ-ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 4.1. Τι ονομάζεται ανασυνδυασμένο DNA, που χρησιμοποιείται; 4.2. Τι είναι η γενετική μηχανική, ποιοι είναι οι στόχοι της και

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

Επιβίωση ποντικών 1 ζωντανά βακτήρια S ΟΧΙ 2 ζωντανά βακτήρια R ΝΑΙ ένεση σε ποντικούς 3 βακτήρια S που προηγουμένως θανατώθηκαν με θέρμανση ΝΑΙ

Επιβίωση ποντικών 1 ζωντανά βακτήρια S ΟΧΙ 2 ζωντανά βακτήρια R ΝΑΙ ένεση σε ποντικούς 3 βακτήρια S που προηγουμένως θανατώθηκαν με θέρμανση ΝΑΙ 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DA είναι το γενετικό υλικό Να περιγράψετε το πείραμα του Griffith Ο Griffith ασχολήθηκε με δύο στελέχη 1 του πνευμονόκοκκου (του βακτηρίου 2 Diplococcus pneumoniae) που είχαν τις

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα

1.1. Το γενετικό υλικό είναι το DNA 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ

1.1. Το γενετικό υλικό είναι το DNA 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1.1. Το γενετικό υλικό είναι το DNA ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1.1.1 Γιατί οι επιστήμονες πίστευαν ότι τα μόρια που μεταφέρουν τη γενετική πληροφορία είναι οι πρωτεΐ νες; Οι επιστήμονες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο ΘΕΜΑ 1 Ο Α) 1. Β 2. Δ 3. Δ Β) 1. 1.Δ 2. 1. ΣΤ 2. Γ 2. Ε 3. Ε 3. Β 4. Α 4. Γ 5. Β 5. Α 6. Ζ 6. Δ 7. ΣΤ 7. Ζ ΘΕΜΑ

Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΛΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Υπεύθυνη καθηγήτρια: Δασκαλάκη Κατερίνα Μοίρες 2012-2013 Περιεχόμενα

Διαβάστε περισσότερα