1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό"

Transcript

1 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων S που μετατρέπει τα R βακτήρια σε S είναι Β. Σε ποιο από τα παρακάτω πειράματα η μετατροπή των S βακτηρίων σε R πραγματοποιείται μέσα σε ζωντανό οργανισμό(in vivo) ; α. Πείραμα Griffith β. Πείραμα Avery,MacCleod, Mc Carty Γ. Σε ποιο από τα παρακάτω πειράματα η μετατροπή των S βακτηρίων σε R πραγματοποιείται μέσα σε δοκιμαστικό σωλήνα (in vitro) ; α. Πείραμα Griffith β. Πείραμα Avery,MacCleod, Mc Carty Με βάση την παρακάτω εικόνα(πείραμα Hersey-Chase) να απαντήσετε τις ερωτήσεις που ακολουθούν. Α. Να σημειώσετε με (+) ποια ένεση ήταν θανατηφόρος για τους ποντικούς και με (-) ποια δεν ήταν θανατηφόρος. α. Στέλεχος S ( ) β. Στέλεχος R ( ) γ. Στέλεχος S θανατωμένο ( ) Β. Το μίγμα των νεκρών S με τα ζωντανά R. : α. Είναι θανατηφόρο β. Δεν είναι θανατηφόρο Γ. Όταν στον ποντικό χορηγήθηκε ένεση με μίγμα ζωντανών R και νεκρών S, μέσα στο σώμα του ποντικού πραγματοποιήθηκε η μετατροπή.. : α. Τα ζωντανά R βακτήρια μετατράπηκαν σε ζωντανά S β. Τα ζωντανά S μετατράπηκαν σε ζωντανά R Με βάση την παρακάτω εικόνα(πείραμα Avery, MacCleod,McCarty) να απαντήσετε τις ερωτήσεις που ακολουθούν. A.Ο ιός που προσβάλλει το βακτήριο E.coli αποτελείται.. : α. Μόνο από DNA β. Μόνο από πρωτεΐνες γ. DNA και πρωτεΐνες Β. Με ραδιενεργό Ρ(φώσφορο) σημαίνεται. : α. Το DNA του ιού β. Οι πρωτεΐνες του ιού Γ. Με ραδιενεργό S(θείο) σημαίνεται. : α. Το DNA του ιού β. Οι πρωτεΐνες του ιού Δ. Το γενετικό υλικό του ιού κληρονομείται στην επόμενη γενιά ιών ; α. Ναι β. Όχι Ε. Τι ανιχνεύτηκε στην επόμενη γενιά ιών ; α. ραδιενεργός Ρ β. ραδιενεργό S γ. ραδιενεργός Ρ και ραδιενεργό S ΣΤ. Με βάση τα πειραματικά δεδομένα στην αμέσως επόμενη γενιά ιών: α. πέρασε το DNA της πατρικής γενιάς β. πέρασαν οι πρωτεΐνες της πατρικής γενιάς γ. πέρασε και το DNA και οι πρωτεΐνες της πατρικής γενιάς. 1

2 Α. Ερώτηση συμπλήρωσης κενών Να συμπληρώσετε τα κενά των παρακάτω φράσεων με τις λέξεις-κλειδιά που σας δίνονται στην παρένθεση. Το είναι η ουσία που είναι υπεύθυνη για τη δομή και τη σωστή λειτουργία του κυττάρου.οι ουσίες που οι επιστήμονες είχαν την υποψία ότι αποτελούν το γενετικό υλικό ήταν οι και το. To DNA είναι ένα πολυμερές που αποτελείται από την συνένωση 4 ειδών. Οι πρωτεΐνες αντίθετα είναι πολυμερή που αποτελούνται από. Υπάρχουν 20 διαφορετικά είδη αμινοξέων. Τα πειράματα του Griffith, των Avery,Mac Leod,McCarthy και τέλος το πείραμα των Hersey-Chase επιβεβαίωσαν ότι το γενετικό υλικό είναι το DNA. ( λέξεις-κλειδιά : αμινοξέα, πρωτεΐνες,νουκλεοτιδίων, γενετικό, υλικό, DNA ) Β. Ερωτήσεις πολλαπλής επιλογής Να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση. Πείραμα του Griffith Ποιος από τους παρακάτω συνδυασμούς βακτηρίων είναι θανατηφόρος για τα ποντίκια : α. Ζωντανά αδρά βακτήρια (χωρίς κάλυμμα) β. Ζωντανά λεία βακτήρια ( με κάλλυμα) γ. Νεκρά αδρά βακτήρια (χωρίς κάλυμμα) δ. Νεκρά λεία βακτήρια ( με κάλλυμα) Ποιος από τους παρακάτω συνδυασμούς βακτηρίων είναι θανατηφόρος για τα ποντίκια : α. Μείγμα ζωντανών αδρών και νεκρών λείων βακτηρίων. β. Μείγμα νεκρών αδρών και νεκρών λείων βακτηρίων γ. Ζωντανά αδρά βακτήρια (χωρίς κάλυμμα) δ. Νεκρά λεία βακτήρια ( με κάλλυμα) Ο πνευμονιόκοκκος, τα δύο στελέχη του οποίου χρησιμοποίησε ο Griffith στο γνωστό πείραμα, είναι: α. μύκητας. β. βακτήριο. γ. ιός. δ. πρωτόζωο Στο πείραμα του Griffith: α. τα αδρά μη παθογόνα βακτήρια μετασχηματίστηκαν σε αδρά παθογόνα β. τα αδρά μη παθογόνα βακτήρια μετασχηματίστηκαν σε λεία παθογόνα γ. τα λεία παθογόνα βακτήρια μετασχηματίστηκαν σε αδρά δ. τα αδρά βακτήρια μετασχηματίστηκαν σε λεία παθογόνα Πείραμα των Avery, Mac Leod,McCarthy Ποιο από τα παρακάτω συστατικά είναι υπεύθυνο για το μετασχηματισμό των αδρών βακτηρίων σε λεία. α. Πρωτεΐνες β. Υδατάνθρακες γ. DNA δ. RNA Ποιο από τα παραπάνω ένζυμα μπορεί να σταματήσει το μετασχηματισμό των αδρών βακτηρίων σε λεία : α. Η θρυψίνη που διασπά τις πρωτεΐνες β. Η ριβονουκλεάση που διασπά το RNA γ. Η δεοξυριβονουκλεάση που διασπά το DNA δ. Κανένα από τα παραπάνω ένζυμα Πείραμα Hersey-Chase Με ραδιενεργό 32 Ρ οι ερευνητές ιχνηθέτησαν α. To DNA των βακτηρίων που μόλυναν οι φάγοι β. Τις πρωτεΐνες των βακτηρίων που μόλυναν οι φάγοι γ. Τις πρωτεΐνες των φάγων Τ 2. δ. Το DNA των φάγων Τ Στις πρωτεΐνες του φάγου Τ 2 ενσωματώνεται : α. ραδιενεργός 32 Ρ β. ραδιενεργό 35 S γ. ραδιενεργός 32 Ρ και ραδιενεργό 35 S δ. ούτε ραδιενεργός 32 Ρ ούτε ραδιενεργό 35 S Τι αναμένουμε ότι ανίχνευσαν οι πειραματιστές Hersey-Chase στην αμέσως επόμενη γενία φάγων: Α. 35 S και 32 Ρ Β. 35 S Γ. 32 Ρ Δ. Ούτε 32 Ρ ούτε 35 S Τα πειράματα των Hershey και Chase απέδειξαν: α. ότι ολόκληρος ο φάγος εισέρχεται τα βακτήρια β. ότι το πρωτεϊνικό περίβλημα εισέρχεται στο βακτήριο γ. ότι το DNA είναι το γενετικό υλικό δ. όλα τα παραπάνω Βιοχημικά δεδομένα Οι πρωτεΐνες αποτελούνται από : α. Αμινοξέα β. Αιθέρες γ. Καρβοξυλικά οξέα δ. Νουκλεοτίδια Η ποσότητα του DNA είναι : α. ίδια σε όλα τα είδη των σωματικών κυττάρων ενός οργανισμού. β. διπλάσια στα ηπατικά κύτταρα των οργανισμών. γ. μικρότερη στους περισσότερο εξελιγμένους οργανισμούς. 2

3 δ. η μισή στα διπλοειδή κύτταρα σε σχέση με τα απλοειδή Η ποσότητα του DNA : α. είναι ίδια σε όλους τους απλοειδείς οργανισμούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισμούς γ. μεταβάλλεται στα κύτταρα των διαφόρων ιστών ενός οργανισμού δ. διαφέρει στα κύτταρα οργανισμών που ανήκουν σε διαφορετικά είδη Η ποσότητα του DNA είναι : α. σταθερή σε κάθε σωματικό κύτταρο,ενός οργανισμού και δεν μεταβάλλεται με τις αλλαγές του περιβάλλοντος β. είναι, κατά κανόνα, ανάλογη με την πολυπλοκότητα του οργανισμού. γ. η μισή στα γαμετικά κύτταρα σε σχέση με τα σωματικά δ. όλα τα παραπάνω Συνήθως οι εξελικτικά κατώτεροι οργανισμοί: α. Έχουν λιγότερη ποσότητα DNA. β. Έχουν λιγότερη ποσότητα λιπιδίων. γ. Έχουν μεγαλύτερη ποσότητα DNA. δ. Έχουν πάντα ίδια ποσότητα DNA. Γ. Ερωτήσεις τύπου σωστό-λάθος Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) ή λανθασμένες (Λ) Πείραμα του Griffith Το στέλεχος του βακτηρίου Diplococcus pneumoniae που διαθέτει προστατευτικό κάλλυμα σχηματίζει αδρές αποικίες,ενώ το αντίστοιχο στέλεχος που δεν διαθέτει προστατευτικό κάλλυμα σχηματίζει λείες αποικίες Τα λεία βακτήρια είναι μη παθογόνα, ενώ τα αντίστοιχα αδρά είναι παθογόνα Ο Griffith χρησιμοποίησε υψηλή θερμοκρασία για να σκοτώσει τα λεία βακτήρια Μετά την μόλυνση των ποντικών με μείγμα ζωντανών αδρών και νεκρών λείων βακτηρίων, στο αίμα των νεκρών Το πείραμα του Griffith πραγματοποιήθηκε in vitro Στο πείραμα του Griffith τα αδρά βακτήρια μετασχηματίστηκαν σε λεία παθογόνα. Πείραμα Avery, Mac Leod,McCarthy Το 1944 οι Avery, Mac Leod,McCarthy, επανέλαβαν το πείραμα του Griffith in vitro. Πείραμα των Hersey-Chase Οι πρωτεΐνες του καλλύματος των φάγων που είχε ιχνηθετηθεί με 35 S βρέθηκε και στην επόμενη γενιά φάγων Το πείραμα των Hersey-Chase έδειξε ότι μόνο το DNA των ραδιενεργών φάγων εισήλθε στα βακτηριακά κύτταρα και Βιοχημικά δεδομένα Σε έναν πολυκύτταρο οργανισμό όπως ο άνθρωπος, όλα τα είδη των σωματικών του κυττάρων ( όπως ηπατικά κύτταρα, κύτταρα καρδιάς, κύτταρα σπλήνα) περιέχουν την ίδια ποσότητα DNA Οι γαμέτες των ανώτερων οργανισμών που είναι απλοειδή κύτταρα περιέχουν διπλάσια ποσότητα DNA, από τα σωματικά κύτταρα που είναι διπλοειδή Ένας απλός μονοκύτταρος οργανισμός περιέχει μικρότερη ποσότητα DNA στο κύτταρο του, από ότι περιέχει ένα κύτταρο ενός εξελικτικά ανώτερου οργανισμού Η ποσότητα του DNA σε κάθε οργανισμό είναι σταθερή και δεν μεταβάλλεται από τις αλλαγές στο περιβάλλον. Δ. Ερωτήσεις ανάπτυξης Να περιγράψετε το πείραμα με το οποίο επιβεβαιώθηκε οριστικά ότι το DNA είναι το γενετικό υλικό Με βάση ποιο πειραματικό δεδομένο οι Hersey-Chase διαπίστωσαν ποιο συστατικό της πατρικής γενιάς φάγων κληρονομήθηκε στην αμέσως επόμενη γενιά ; Να χαρακτηρίσετε τις παρακάτω προτάσεις που αφορούν το πείραμα του Griffith ως σωστές ή λάθος,αιτιολογώντας την επιλογή σας. α. Το πρωτεϊνικό κάλυμμα από τα παθογόνα βακτήρια μπορούσαν να τροποποιήσουν τα μη παθογόνα. β. Τα βακτήρια S τα οποία θανατώνονταν με θέρμανση προκαλούσαν πνευμονία. γ. Ένα συστατικό των νεκρών παθογόνων βακτηρίων είχε την ικανότητα μετασχηματισμού των μη παθογόνων σε παθογόνα. δ. Στο πείραμα του Griffith αποδείχθηκε ότι οι βακτηριοφάγοι εισάγουν το DNA τους μέσα σε βακτήρια. 3

4 1.2. Το DNA αποτελείται από νουκλεοτίδια που ενώνονται με φωσφοδιεστερικό δεσμό, -Η διπλή έλικα του DNA Με βάση την εικόνα που σας δίνεται απαντήστε τις ερωτήσεις που ακολουθούν. Α.Το νουκλεοτίδιο αποτελείται : α. μόνο από ένα σάκχαρο β. από ένα σάκχαρο και μία φωσφορική ομάδα γ. από ένα σάκχαρο, μία φωσφορική ομάδα και μία αζωτούχο βάση Β. Πόσα διαφορετικά νουκλεοτίδια υπάρχουν σε ένα μόριο DNA: α. Ένα β. Δύο γ. Τρία δ. Τέσσερα Γ. Σε μία πολυνουκλεοτιδική αλυσίδα που αναπτύσσεται, ένα νέο νουκλεοτίδιο μπορεί να προστεθεί. : α. Στο 5 άκρο της β. Στο 3 άκρο της Δ. Το πρώτο νουκλεοτίδιο της αλυσίδας βρίσκεται πάντα.: α. Στο 5 άκρο της β. Στο 3 άκρο της Ε. Το τελευταίο νουκλεοτίδιο της αλυσίδας βρίσκεται πάντα.: α. Στο 5 άκρο της β. Στο 3 άκρο της ΣΤ. Υπάρχει περιορισμός για το είδος της βάσης (Α,Τ,G,C)που θα έχει το νουκλεοτίδιο που προστίθεται στην αλυσίδα ; α. Ναι β. Όχι Με βάση την εικόνα που σας δίνεται απαντήστε τις ερωτήσεις που ακολουθούν. Α. Τα νουκλεοτίδια στην ίδια αλυσίδα συνδέονται με. : α. Φωσφοδιεστερικούς δεσμούς β. Δεσμούς υδρογόνου Β. Δύο νουκλεοτίδια που ανήκουν σε διαφορετικές αλυσίδες συνδέονται με.. : α. Φωσφοδιεστερικούς δεσμούς β. Δεσμούς υδρογόνου Γ. Οι δύο αλυσίδες του DNA στο χώρο : α. Βρίσκονται σε επίπεδη διάταξη β. Σχηματίζουν διπλή έλικα Δ.Ο σκελετός (εξωτερικό) ενός μορίου DNA αποτελείται από : α. σάκχαρα και φωσφορικές ομάδες β. αζωτούχες βάσεις Ε. Το εσωτερικό ενός μορίου DNA αποτελείτε από. : α. σάκχαρα και φωσφορικές ομάδες β. αζωτούχες βάσεις ΣΤ. Ποιο τμήμα του μορίουdna είναι σταθερό σε οποιοδήποτε μόριο DNA : α. Το εσωτερικό β. Το εξωτερικό Ζ. Ποιο τμήμα του μορίουdna μπορεί να μεταβάλλεται σε διάφορα είδη DNA : α. Το εσωτερικό β. Το εξωτερικό Η.Η σειρά των βάσεων στη μία αλυσίδα μπορούμε να ισχυριστούμε ότι καθορίζει τη σειρά των βάσεων στην άλλη αλυσίδα. : α. Ναι β. Όχι. Θ. Απέναντι από το 5 άκρο της μίας αλυσίδας βρίσκεται το 3 άκρο της άλλης άρα οι αλυσίδες είναι. : α. αντιπαράλληλες β. συμπληρωματικές Ι. Οι δύο αλυσίδες ενός μορίου DNA είναι συμπληρωματικές δηλαδή. : α. Η σειρά των βάσεων της μίας καθορίζει τη σειρά των βάσεων της άλλης β. Απέναντι από το 5 άκρο της μίας βρίσκεται το 3 άκρο της άλλης. 4

5 1.2.3.Να συμπληρωθεί σωστά ο παρακάτω πίνακας με τα βιοχημικά δεδομένα του Chargaff. Σύσταση βάσεων (%) Οργανισμοί Α(%) Τ(%) C(%) G(%) E.coli 26 M.tuberculosis 15 Ζυμομύκητας 33 Ρέγγα 22,5 Ποντικός 21,5 Άνθρωπος 20 Α. Ερωτήσεις πολλαπλής επιλογής : Να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση Ένα νουκλεοτίδιο του DNA αποτελείται από : α. Μία πεντόζη τη δεοξυριβόζη και μία αζωτούχο βάση β. Μία πεντόζη τη ριβόζη, μία αζωτούχο βάση και μία φωσφορική ομάδα γ. Μία πεντόζη τη δεοξυριβόζη, μία αζωτούχο βάση και μία φωσφορική ομάδα Μία πεντόζη τη δεοξυριβόζη και μία φωσφορική ομάδα. 2.Ένα νουκλεοτίδιο DNA μπορεί να αποτελείται από α. δεοξυριβόζη, φωσφορική ομάδα, ουρακίλη. β. ριβόζη, φωσφορική ομάδα, θυμίνη. γ. DNA δεσμάση, φωσφορική ομάδα, αδενίνη. δ. δεοξυριβόζη, φωσφορική ομάδα, αδενίνη Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση των νουκλεοτιδίων με α. δεσμούς υδρογόνου. β. φωσφοδιεστερικούς δεσμούς. γ. πεπτιδικούς δεσμούς. δ. ετεροπολικούς δεσμούς Τα νουκλεοτίδια σε μία πολυνουκλεοτιδική αλυσίδα συνδέονται μεταξύ τους με : α. Φωσφοδιεστερικό δεσμό 5-3 β. Φωσφοδιεστερικό δεσμό 3-5 γ. Ημιπολικό δεσμό δ. Δισουλφιδικό δεσμό Το RNA αποτελείται από α. πεπτίδια, που συνδέονται μεταξύ τους με πεπτιδικό δεσμό β. αμινοξέα, που συνδέονται μεταξύ τους με πεπτιδικό δεσμό γ. νουκλεοτίδια, που συνδέονται με φωσφοδιεστερικό δεσμό δ. διαφορετικά μόρια πεντοζών, που συνδέονται με αζωτούχες βάσεις Ποια από τις παρακάτω αζωτούχες βάσεις δεν συναντάμε σε ένα μόριο DNA α. Αδενίνη (Α) β. Γουανίνη ( G) γ. Θυμίνη (Τ) δ. Ουρακίλη ( U) Μια αλυσίδα DNA έχει την παρακάτω αλληλουχία νουκλεοτιδίων 5 ΑΑΤGGCGATGCA 3 Ποια είναι η αλληλουχία νουκλεοτιδίων της συμπληρωματικής αλυσίδας της; α. 5 TTACCGCTACGT 3 β. 5 TGCATCGCCATT 3 γ. 3 ΤΤΑCCGCTACGT 5 δ. β και γ Β. Ερωτήσεις τύπου σωστό-λάθος Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) ή λανθασμένες (Λ) Ο φωσφοδιεστερικός δεσμός 3-5 σχηματίζεται μεταξύ της φωσφορικής ομάδας του 3 άνθρακα του ενός νουκλεοτιδίου και του υδροξυλίου που βρίσκεται στον 5 άνθρακα του επόμενου νουκλεοτιδίου Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων που υπάρχουν σε μία πολυνουκλεοτιδική αλυσίδα, το 1 ο νουκλεοτίδιο έχει ελεύθερο το 3 άκρο ενώ το τελευταίο νουκλεοτίδιο έχει ελεύθερο το 5 άκρο Ο προσανατολισμός μίας πολυνουκλεοτιδικής αλυσίδας είναι πάντα Ο σκελετός της πολυνουκλεοτιδικής αλυσίδας αποτελείτε από επανάληψη μορίων φωσφορική ομάδα-πεντόζη-φωσφορική ομάδα- πεντόζη Πολλά νουκλεοτίδια ενώνονται μεταξύ τους με ετεροπολικούς δεσμούς και δημιουργούν μία πολυνουκλεοτιδική αλυσίδα Η σύνδεση με δεσμούς υδρογόνου της Α (αδενίνης) με την C (κυτοσίνη) είναι τόσο ισχυρή όσο και η σύνδεση της Τ (θυμίνης) με τη G (γουανίνη) Στο δίκλωνο μόριο DNA ισχύει πάντα : A+T=C+G Να συμπληρώσετε τα κενά των παρακάτω φράσεων Το DNA αποτελείται από δύο αλυσίδες που σχηματίζουν στο χώρο μία διπλή έλικα. Η διπλή έλικα έχει ένα σκελετό, που αποτελείτε από επαναλαμβανόμενα μόρια - ενωμένα με φωσφοδιεστερικό δεσμό. Ο σκελετός είναι και βρίσκεται στο εξωτερικό του μορίου. Προς το εσωτερικό 5

6 του σκελετού βρίσκονται οι βάσεις που είναι Οι αζωτούχες βάσεις της μίας αλυσίδας συνδέονται με την άλλη αλυσίδα με βάση τον κανόνα της. Απέναντι από την αδενίνη συνδέεται μόνο η και αντίστροφα. Η κυτοσίνη συνδέεται μόνο με τη και αντίστροφα. Ανάμεσα στην και τη σχηματίζονται δύο δεσμοί υδρογόνου, ενώ ανάμεσα στη γουανίνη και την κυτοσίνη. Οι δύο αλυσίδες είναι, η αλληλουχία των βάσεων της μίας καθορίζει την αλληλουχία της άλλης. Οι δύο αλυσίδες είναι απέναντι από το άκρο της μίας βρίσκεται το άκρο της άλλης. Δ. Ερωτήσεις ανάπτυξης Ποια είδη δεσμών συνδέουν δύο διαφορετικά νουκλεοτίδια στο ίδιο μόριο DNA και ποιος ο ρόλος των δεσμών αυτών στο μόριο του DNA ; Ποια είναι η δομή του DNA στο χώρο σύμφωνα με το μοντέλο της διπλής έλικας των Watson και Crick; Να περιγράψετε το σχηματισμό μιας πολυνουκλεοτιδικής αλυσίδας, με προσανατολισμό 5 3. Ε.Προβλήματα Αν το 30% του DNA ενός οργανισμού είναι Τ(θυμίνη),τότε..: α. Το 70% είναι οι πουρίνες(α+g) β. Το 20% είναι η γουανίνη (G) γ. Το 30% είναι η αδενίνη (Α) δ. Το 70% είναι οι πυριμιδίνες (T+C) ε. Και η β και η γ είναι σωστές Στη διπλή έλικα του DNA στο εσωτερικό της υπάρχουν. : α. Ζευγάρια πουρινών-πυριμιδινών β. Ζευγάρια G-C που συνδέονται με Τ. γ. Μόρια σακχάρου που συνδέονται με φωσφορικές ομάδες δ. Το 5 και 3 άκρο ε. Και η α και η β είναι σωστές Να εξετάσετε ποια στοιχεία συνδέονται μεταξύ τους με ομοιοπολικούς δεσμούς : α. αζωτούχος βάση με σάκχαρο β. σάκχαρο με φωσφορική ομάδα γ. Οι βάσεις δύο διαφορετικών αλυσίδων δ. Τα νουκλεοτίδια της ίδιας αλυσίδας Η αλληλουχία βάσεων μίας αλυσίδας είναι : 5 -ΤΑGCCT-3, η αλληλουχία βάσεων της συμπληρωματική της είναι.. : α. 3 -TCCGAT-5 β. 3 -ATCGGA-5 γ. 3 -TAGCCT-5 δ.3 -ΑΑCGGUA Οι πυριμιδίνες.: α. συνδέονται μόνο με πουρίνες β. είναι η Τ και η C γ. είναι η Α και η G δ. και το α και το β είναι σωστά Το νουκλεοτίδιο..: α. είναι μικρότερο από μία βάση β. είναι μονομερές των νουκλεϊκών οξέων. γ. διαφέρουν μεταξύ τους σε πολλά σημεία. δ. διαθέτουν τουλάχιστον 4 φωσφορικές ομάδες Να εξετάσετε την ορθότητα των παρακάτω σχέσεων : α. Α=G β.α+g=c+t γ. Α+Τ=G+C δ.α=c ε.g=t Η αλυσίδα ενός δίκλωνου μορίου DNA είναι. Να βρεθεί η αλληλουχία βάσεων της συμπληρωματικής αλυσίδας Στο DNA ορισμένων βακτηρίων το ποσοστό της αδενίνης είναι 13%. Να βρεθούν τα ποσοστά των υπολοίπων βάσεων Πόσες είναι οι δυνατές αλληλουχίες νουκλεοτιδίων σε μία αλυσίδα που αποτελείται από Ν νουκλεοτίδια ; Να βρείτε τις δυνατές αλληλουχίες νουκλεοτιδίων στο δίκλωνο DNA που αποτελείται από δύο αλυσίδες με Ν νουκλεοτίδια Οι δύο αλυσίδες της διπλής έλικας του DNA μπορούν να διαχωριστούν με θέρμανση. Αν θερμαίναμε ένα διάλυμα που περιέχει τα παρακάτω μόρια DNA: Σε ποιο μόριο οι δύο αλυσίδες θα άνοιγαν σε μικρότερη θερμοκρασία και σε ποιο σε μεγαλύτερη ; Αιτιολογήστε την απάντησή σας. 6

7 1.3. Λειτουργίες γενετικού υλικού. Γενετικό υλικό προκαρυωτικών κυττάρων. Α. Ερωτήσεις πολλαπλής επιλογής. Να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση. Λειτουργίες γενετικού υλικού Ο αυτοδιπλασιασμός του DNA εξασφαλίζει : α. Την αποθήκευση της γενετικής πληροφορίας. β. Τη διατήρηση και τη μεταβίβαση της γενετικής πληροφορίας. γ. Την έκφραση των γενετικών πληροφοριών δ. Την οργάνωση της γενετικής πληροφορίας σε λειτουργικές μονάδες Η έκφραση των γενετικών πληροφοριών επιτυγχάνεται με : α. Τον έλεγχο της σύνθεσης των πρωτεϊνών. β. Τον αυτοδιπλασιασμό του DNA. γ. Την οργάνωση της γενετικής πληροφορίας σε γονίδια. δ. Την αποθήκευση της γενετικής πληροφορίας Ποιο από τα παρακάτω κύτταρα είναι διπλοειδές : α. Ο γαμέτης ενός διπλοειδούς οργανισμού β. Ένα προκαρυωτικό κύτταρο. γ. Ένα σωματικό κύτταρο ενός διπλοειδούς οργανισμού. δ. Ένα οποιοδήποτε ευκαρυωτικό κύτταρο Ο όρος αριθμός βάσεων χρησιμοποιείται για να περιγράψει : α. Το είδος του νουκλεϊκού οξέος. β. Το μήκος ενός νουκλεϊκού οξέος. γ. Την σειρά των βάσεων του νουκλεϊκού οξέος. δ. Το είδος του κυττάρου που ανήκει το νουκλεϊκό οξύ Στα ευκαρυωτικά κύτταρα, το γενετικό υλικό κατανέμεται α. στον πυρήνα. β. στα μιτοχόνδρια και στο πλασμίδιο. γ. στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. δ. στον πυρήνα και στα ριβοσώματα Η συμπληρωματικότητα των βάσεων έχει μεγάλη σημασία: α. για τον αυτοδιπλασιασμό του DNA β. για τη μεταβίβαση της γενετικής πληροφορίας από κύτταρο σε κύτταρο γ. για τη σύνθεση των πρωτεϊνών δ. για όλα τα παραπάνω Στους διπλοειδείς οργανισμούς α. το γονιδίωμα των σωματικών κυττάρων υπάρχει σε ένα αντίγραφο β. το γονιδίωμα των γαμετών υπάρχει σε δύο αντίγραφα γ. τα σωματικά κύτταρα περιέχουν διπλάσια ποσότητα DNA από τους γαμέτες δ. τα κύτταρα τους είναι προκαρυωτικά Ο όρος αλληλουχία βάσεων α. εκφράζει την ακολουθία των νουκλεοτιδίων σε ένα νουκλεϊκό οξύ β. εκφράζει την ακολουθία των πεντοζών μιας πολυνουκλεοτιδικής αλυσίδας γ. αναφέρεται στον αριθμό φωσφοδιεστερικών δεσμών δ. αναφέρεται στην ακολουθία των φωσφορικών ομάδων Οι γαμέτες είναι απλοειδή κύτταρα γιατί α. το γενετικό τους υλικό υπάρχει σε ένα μόνο αντίγραφο β. το γονιδίωμα τους είναι μονόκλωνο γ. η δομή τους είναι όμοια με των προκαρυωτικών κυττάρων δ. το γονιδίωμά τους υπάρχει σε δύο μόνο αντίγραφα Ένας οργανισμός που το γονιδίωμα του αποτελείται από ένα μόριο DNA: α.μπορεί να έχει και απλοειδή και διπλοειδή κύτταρα β. Μπορεί να έχει μόνο απλοειδή κύτταρα γ. Μπορεί να έχει μόνο διπλοειδή κύτταρα δ. Δεν μπορεί να έχει ούτε διπλοειδή,ούτε απλοειδή κύτταρα Οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού, είναι αποθηκευμένες: α. στο μόριο DNA β. στα χρωμοσώματα όλων των κυττάρων γ. στα γονίδια δ. στις πολυπεπτιδικές αλυσίδες Γενετικό υλικό προκαρυωτικών κυττάρων Το κυρίως γενετικό υλικό των προκαρυωτικών κυττάρων είναι : α. Ένα κυκλικό μονόκλωνο μόριο DNA. β. Ένα ευθύγραμμο δίκλωνο μόριο DNA. γ. Ένα δίκλωνο κυκλικό μόριο RNA. δ. Ένα δίκλωνο κυκλικό μόριο DNA Το πλασμίδιο είναι α. δίκλωνο γραμμικό μόριο DNA. β. δίκλωνο κυκλικό μόριο DNA. γ. δίκλωνο κυκλικό μόριο RNA. δ. δίκλωνο γραμμικό μόριο RNA. 7

8 Ένα πλασμίδιο στα βακτήρια μπορεί να είναι : α. Ένα δίκλωνο κυκλικό μόριο DNA που περιέχει το 1-2% της γενετικής πληροφορίας του βακτηρίου. β. Γονίδιο ανθεκτικότητας στα αντιβιοτικά. γ. Ένα δίκλωνο κυκλικό μόριο DNA που περιέχει το σύνολο της γενετικής πληροφορίας του βακτηρίου. δ. Τμήμα του δίκλωνου κυκλικού DNA του βακτηρίου υπεύθυνο για το αυτοδιπλασιασμό του Δίκλωνο κυκλικό μόριο DNA περιέχεται σε: α. γαμέτη β. ευκαρυωτικό πυρήνα γ. βακτήριο δ. νουκλεόσωμα. Β. Ερωτήσεις τύπου σωστό-λάθος Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) ή λανθασμένες (Λ). Λειτουργίες γενετικού υλικού Υπάρχουν ιοί που το γενετικό τους υλικό είναι το RNA Στα ευκαρυωτικά κύτταρα το γενετικό υλικό κατανέμεται μόνο στον πυρήνα Στα ευκαρυωτικά κύτταρα το γενετικό υλικό κατανέμεται στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες Ο όρος γονιδίωμα στα ευκαρυωτικά κύτταρα αναφέρεται συνήθως στο γενετικό υλικό του πυρήνα Το μόνο τμήμα των νουκλεοτιδίων στο μόριο DNA (ή RNA) που αλλάζει είναι η αζωτούχος βάση Αναφέρεται ότι ένα μόριο DNA έχει μήκος σε αριθμό βάσεων, επειδή είναι δίκλωνο ενώ ένα μόριο RNA έχει μήκος σε ζεύγη βάσεων επειδή είναι μονόκλωνο Το γονιδίωμα περιέχει το σύνολο των γονιδίων ενός κυττάρου Το καρδιακό κύτταρο περιέχει διπλάσια ποσότητα DNA από το γαμετικό κύτταρο Σε μερικές περιπτώσεις το RNA είναι φορέας γενετικών πληροφοριών. Γενετικό υλικό προκαρυωτικών κυττάρων Σε πολλά βακτήρια, εκτός από το κύριο κυκλικό μόριο DNA, υπάρχουν και τα πλασμίδια Ένα βακτήριο δεν μπορεί να περιέχει παραπάνω από ένα πλασμίδια Τα πλασμίδια μπορούν να αντιγράφονται ανεξάρτητα από το κύριo μόριο DNA Τα πλασμίδια δεν περιέχουν γονίδια Τα πλασμιδια φέρουν μόνο την πληροφορία ανθεκτικότητας σε διάφορα αντιβιοτικά Τα πλασμίδια περιέχουν γονίδια ανθεκτικότητας στα αντιβιοτικά, καθώς και γονίδια μεταφοράς γενετικού υλικού από το ένα βακτήριο στο άλλο Τα πλασμίδια μπορούν να μεταφέρονται από το ένα βακτήριο στο άλλο Δεν μπορούμε να έχουμε ανταλλαγή γενετικού υλικού μεταξύ πλασμιδίου και κύριου μορίου DNA Τα πλασμίδια μπορούν να προσδώσουν σε ένα βακτήριο καινούργιες ιδιότητες Το γενετικό υλικό των προκαρυωτικών κυττάρων έχει μήκος 1μm, με τη βοήθεια πρωτεϊνών ξεδιπλώνεται ώστε το τελικό του μήκος να φτάνει το 1mm. Γ. Ερωτήσεις συμπλήρωσης κενών. Να συμπληρώσετε τα κενά στις παρακάτω προτάσεις με τους κατάλληλους όρους Το DNA, δηλαδή κατασκευάζει αντίγραφο του εαυτού του Η γενετική πληροφορία οργανώνεται σε λειτουργικές μονάδες τα Η και η μεταβίβαση της γενετικής πληροφορίας εξασφαλίζεται με τον αυτοδιπλασιασμό του DNA Η των γενετικών πληροφοριών επιτυγχάνεται με τον έλεγχο της σύνθεσης των πρωτεϊνών Η χημική σύσταση του γενετικού υλικού των ιών είναι ή Το γενετικό υλικό ενός κυττάρου αποτελεί το του Τα κύτταρα στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο ονομάζονται Τα κύτταρα στα οποία το γονιδίωμα υπάρχει σε δύο αντίγραφα ονομάζονται Για την περιγραφή του μήκους ή της αλληλουχίας ενός νουκλεϊκού οξέος χρησιμοποιείται ο όρος ή βάσεων αντίστοιχα. Στα φυτικά κύτταρα το γενετικό υλικό εντοπίζεται εκτός από τον πυρήνα, στα και στους To γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα DNA Σε πολλά βακτήρια εκτός από το κύριο μόριο DNA υπάρχουν και. Δ. Ερωτήσεις ανάπτυξης Το DNA αποτελεί το γενετικό υλικό όλων των κυττάρων και των περισσότερων ιών. Να 8

9 περιγράψετε συνοπτικά τις λειτουργίες του γενετικού υλικού Τι εννοούμε με τον όρο γονιδίωμα; Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή; Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα; Σε τι διαφέρει το γενετικό υλικό των σωματικών κυττάρων από εκείνο των γεννητικών κυττάρων; Σε τι διαφέρει το γονίδιο από το γονιδίωμα; Ε. Ερωτήσεις-Ασκήσεις Προβλήματα Με βάση τον παρακάτω πίνακα να απαντήσετε στις ερωτήσεις που ακολουθούν. Πίνακας-Μέγεθος γονιδιώματος διαφόρων οργανισμών Χρωμοσώματα Οργανισμός Συνολικό DNA (απλοειδές (ζεύγη βάσεων) κύτταρο) Zea mays (καλαμπόκι) Homo sapiens(άνθρωπος) Drosophila melanogaster(έντομο) , Sacharomyces cerevisae(ευκαρυωτικός οργανισμός) Escherichia coli(βακτήριο) 1, Α. Απομονώθηκαν 3 διπλοειδή κύτταρα που το καθένα από αυτά ανήκει σε έναν από τους οργανισμούς του πίνακα. Με βάση τα δεδομένα που σας δίνονται να συμπληρώσετε τα κενά με τους οργανισμούς που ανήκουν τα κύτταρα. Κύτταρο-1 : ζεύγη βάσεων και 46 χρωμοσώματα. Κύτταρο-2 : ζεύγη βάσεων και 20 χρωμοσώματα. Κύτταρο-3: 3, ζεύγη βάσεων και 8 χρωμοσώματα. Β. Ένας από τους παραπάνω ευκαρυωτικούς οργανισμούς δεν διαθέτει διπλοειδή κύτταρα, ποιος είναι αυτός : α. Zea mays β. Homo sapiens γ. Drosophila melanogaster δ. Sacharomyces cerevisae Γ. Ποιοι από τους παρακάτω οργανισμούς δεν αναπαράγονται φυλετικά. α. Zea mays και Drosophila melanogaster β. Drosophila melanogaster και Sacharomyces cerevisae. γ. Sacharomyces cerevisae και Escherichia coli. δ. Drosophila melanogaster και Escherichia coli. 9

10 1.4. Γενετικό υλικό ευκαρυωτικών οργανισμών Μορφή που βρίσκεται το γενετικό υλικό μέσα στον πυρήνα των ευκαρυωτικών κυττάρων Ένα μόριο DNA μέσα στον πυρήνα των ευκαρυωτικών κυττάρων είναι α. Μονόκλωνο β. Δίκλωνο Ένα μόριο DNA μέσα στον πυρήνα των ευκαρυωτικών κυττάρων είναι α. Γραμμικό β. Κυκλικό Ένα γραμμικό και δίκλωνο μόριο DNA μπορούμε να το συναντήσουμε α. Μέσα σε προκαρυωτικό κύτταρο β. Μέσα σε ευκαρυωτικό κύτταρο Να χαρακτηρίσετε την παρακάτω πρόταση ως σωστή ή λανθασμένη : Μέσα στον πυρήνα ενός ευκαρυωτικού κυττάρου δεν μπορεί να υπάρχουν περισσότερα από ένα γραμμικά και δίκλωνα κυκλικά μόρια DNA Να χαρακτηριστεί η παρακάτω πρόταση ως σωστή ή λανθασμένη: Μέσα στον πυρήνα ενός ευκαρυωτικού κυττάρου υπάρχουν πολλά δίκλωνα και γραμμικά μόρια DNA, ανεξάρτητα από το είδος του οργανισμού που προέρχονται ( άνθρωπος,γάτα,σκύλος..) ο αριθμός και η μορφή τους είναι ίδια Να ελέγξετε την ορθότητα της παρακάτω πρότασης. Ένα σωματικό κύτταρο του ανθρώπου μπορεί να έχει 46 μόρια DNA,ενώ ένα σωματικό κύτταρο μίας γάτας 38 και ενός σκύλου Να χαρακτηρίσετε την παρακάτω πρόταση ως ΣΩΣΤΗ ή ΛΑΘΟΣ Ο αριθμός μορίων DNA στον πυρήνα ενός ευκαρυωτικού κυττάρου εξαρτάται από το είδος του οργανισμού από τον οποίο προέρχεται Είναι σωστός ο ισχυρισμός ότι ένα νευρικό ανθρώπινο σωματικό κύτταρο μπορεί να έχει 100 μόρια DNA,ενώ ένα κύτταρο από τα οστά ενός ανθρώπου να έχει 46 ; O πυρήνας ενός ανθρωπίνου σωματικού κυττάρου έχει διάμετρο..: α. 10mm β. 10μm Μπορούν τα 46 μόρια DNA όπως είναι να χωρέσουν μέσα στον πυρήνα του σωματικού κυττάρου ; α. Ναι β. Όχι Να κατατάξετε κατά σειρά ( από το μικρότερο προς το μεγαλύτερο) τα στάδια συσπείρωσης του DNA μέσα στον πυρήνα ενός ευκαρυωτικού κυττάρου Νουκλεοσώματα :( ) Χρωμοσώματα: ( ) Ινίδια χρωματίνης: ( ) Να επιλέξετε το σχήμα που κατά την άποψη σας αποτυπώνει σωστά τον όρο νουκλεόσωμα Να ελέγξετε την ορθότητα της παρακάτω φράσης : Ένα μόριο DNA ευκαρυωτικού κυττάρου περιέχει ένα μεγάλο αριθμό νουκλεοσωμάτων. Χημική σύσταση του γενετικού υλικού μέσα στον πυρήνα των ευκαρυωτικών κυττάρων Τα 46 μόρια DNA που βρίσκονται μέσα στον πυρήνα ενός ανθρωπίνου σωματικού κυττάρου αν τα τοποθετούσαμε σε σειρά θα είχαν μήκος σχεδόν : α. 2m β. 2mm 10

11 Ποια κατά τη γνώμη σας είναι η «διάταξη» των νουκλεοσωμάτων σε ένα μόριο DNA Να συμπληρώσετε τα κενά των παρακάτω προτάσεων με τους σωστούς όρους. 146 ζεύγη βάσεων τυλίγονται γύρω από ένα οκταμερές πρωτεΐνων που ονομάζονται, σχηματίζοντας ένα. Τα αναδιπλώνονται περαιτέρω και με τη βοήθεια άλλων πρωτεΐνων σχηματίζοντας. Το χημικό υλικό που αποτελείται από το σύμπλεγμα DNA+ιστόνες+άλλες πρωτεΐνες ονομάζεται. Ο μέγιστος βαθμός συσπείρωσης της είναι το Οι φάσεις G1-S-G2 αποτελούν το στάδιο της ενώ η φάση Μ το στάδιο της ή αλλιώς της κυτταρικής Σε ποιο στάδιο γίνεται ο διπλασιασμός του γενετικού υλικού ; Α. Στη φάση G1 Β. Στη φάση S Γ. Στη φάση G2 Δ. Στη φάση Μ Σε ποιο στάδιο έχουμε τη χρωματίνη στην αποσυσπειρωμένη μορφή της ( ινίδια χρωματίνης) ; Α. Μεσόφαση Β. Μίτωση Σε ποιο στάδιο έχουμε τη χρωματίνη στο μέγιστο βαθμό συσπεί-ρωσης (μεταφασικά χρωμοσώματα) ; Α. Μεσόφαση Β. Μίτωση Αλλάζει η σύσταση της χρωματίνης κατά το πέρασμα από το στάδιο της μεσόφασης στο στάδιο της μίτωσης ; Αλλάζει ο βαθμός συμπύκνωσης της χρωματίνης κατά το πέρασμα από το στάδιο της μεσόφασης στο στάδιο της μίτωσης ; Να συμπληρωθούν τα κενά με τους κατάλληλους όρους. Στο στάδιο της μεσόφασης η χρωματίνη εμφανίζει μικρό βαθμό συσπείρωσης σχηματίζοντας που δεν είναι ορατά ως μεμονωμένες δομές με το οπτικό μικροσκόπιο. Στο στάδιο της μίτωσης το ίδιο χημικό υλικό η χρωματίνη συσπειρώνεται σχηματίζοντας τα μιτωτικά ή μεταφασικά που είναι ορατά με το μκροσκόπιο. Κυτταρικός κύκλος-ο κύκλος ζωής ενός σωματικού κυττάρου. 11

12 Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική Η έννοια του χρωμοσώματος. Σας δίνεται η παρακάτω εικόνα με βάση την οποία θα απαντήσετε τις ερωτήσεις της ενότητας «η έννοια του χρωμοσώματος» Στο στάδιο της μεσόφασης πριν το διπλασιασμό(g1) ποιον όρο χρησιμοποιούμε για να περιγράψουμε ένα μόριο DNA : Α. Χρωμόσωμα Β. Αδελφή χρωματίδα Στο στάδιο της μεσόφασης πριν το διπλασιασμό(g1) ποιον όρο χρησιμοποιούμε για να περιγράψουμε ένα μόριο DNA : Α. Ινίδιο χρωματίνης Β. Αδελφή χρωματίδα Στο στάδιο της μεσόφασης μετά το διπλασιασμό ο όρος χρωμόσωμα περιγράφει : Α. Ένα μεμονομένο μόριο DNA ως ινίδιο χρωματίνης Β. Δυο πανομοιότυπα μόρια DNA ως αδελφές χρωματίδες ενωμένα στο κεντρομερίδιο Σε ποιο στάδιο της μεσόφασης μπορούμε να βρούμε ένα μεμονομένο μόριο DNA (ως ινίδιο χρωματίνης) : Α. G1 Β. G Σε ποιο στάδιο της μεσόφασης μπορούμε να βρούμε τις αδελφές χρωματίδες: Α. G1 Β. G Στο στάδιο της μίτωσης μέχρι τη μετάφαση Α. Τα δύο όμοια μόρια DNA ως αδελφές χρωματίδες παραμένουν ενωμένα στο κεντρομερίδιο. Β. Οι δυο «πρώην» αδελφές χρωματίδες αποχωρίζονται Στο στάδιο της μίτωσης μετά τη μετάφαση Α. Τα δύο όμοια μόρια DNA ως αδελφές χρωματίδες παραμένουν ενωμένα στο κεντρομερίδιο. Β. Οι δυο «πρώην» αδελφές χρωματίδες αποχωρίζονται Ο όρος χρωμόσωμα ( μεταφασικό ή μιτωτικό) μέχρι τη μετάφαση.. Α. Περιγράφει 2 πανομοιότυπα μόρια DNA ως αδελφές χρωματίδες Β. Περιγράφει ένα μεμονομένο μόριο DNA που προήλθε από το διαχωρισμό των «πρώην» αδελφών χρωματίδων Ο όρος χρωμόσωμα ( μεταφασικό ή μιτωτικό) μετά τη μετάφαση.. 12

13 Α. Περιγράφει 2 πανομοιότυπα μόρια DNA ως αδελφές χρωματίδες Β. Περιγράφει ένα μεμονομένο μόριο DNA που προήλθε από το διαχωρισμό των «πρώην» αδελφών χρωματίδων Να χαρακτηρίσετε τη παρακάτω φράση ως σωστή ή λανθασμένη : Μετά το τέλος της μίτωσης στα δύο θυγατρικά (νέα) κύτταρα υπάρχει από μία «πρώην» αδελφή χρωματίδα σαν ινίδιο χρωματίνης Στο παρακάτω κείμενο να συμπληρώσετε τα κενά με τους κατάλληλους όρους. Ο όρος «χρωμόσωμα» περιγράφει ένα μεμονωμένο μόριο DNA ως στο στάδιο της μεσόφασης πριν το διπλασιασμό. Ο όρος «χρωμόσωμα» περιγράφει και τις δυο ενωμένες στο στο στάδιο της μεσόφασης μετά το διπλασιασμό. Κατά κυριολεξία ο όρος χρωμόσωμα περιέγραφε τις δύο αδελφές χρωματίδες στο στάδιο της μίτωσης μέχρι τη. Μετά τη οι αδελφές χρωματίδες αποχωρίζονται, ο όρος αναφέρεται πάλι σε ένα μεμονωμένο μόριο DNA. Στο τέλος της μίτωσης κάθε νέο κύτταρο έχει από μια «πρώην» η οποία πλέον αποτελεί Σας δίνεται το παρακάτω υποθετικό ευκαρυωτικό κύτταρο. Να απαντήσετε τις παρακάτω ερωτήσεις που αφορούν το κύτταρο της εικόνας. Α. Στη φάση της μεσόφασης μετά το διπλασιασμό (G2) πόσα μόρια DNA έχει ο πυρήνας του κυττάρου ; α. Δύο β. Τέσσερα Β. Στη φάση της μεσόφασης μετά το διπλασιασμό (G2) πόσες αδελφές χρωματίδες υπάρχουν.. α. Δύο β. Τέσσερις γ. Δεν έχει νόημα ο όρος αδελφές χρωματίδες στη συγκεκριμένη φάση Γ. Στη φάση της μεσόφασης μετά το διπλασιασμό (G2) πόσα χρωμοσώματα υπάρχουν.. α. Δύο β. Τέσσερα Δ. Στη μίτωση μέχρι τη μετάφαση πόσα μόρια DNA έχει το κύτταρο ; α. Δύο β. Τέσσερα Ε. Στη φάση της μίτωσης μέχρι τη μετάφαση πόσες αδελφές χρωματίδες υπάρχουν.. α. Δύο β. Τέσσερις γ. Δεν έχει νόημα ο όρος αδελφές χρωματίδες στη συγκεκριμένη φάση. ΣΤ. Στη φάση της μίτωσης μέχρι τη μετάφαση πόσα χρωμοσώματα υπάρχουν.. α. Δύο β. Τέσσερα Ζ. Στη μίτωση μετά τη μετάφαση πόσα μόρια DNA έχει το κύτταρο ; α. Δύο β. Τέσσερα Η. Στη φάση της μίτωσης μετά τη μετάφαση πόσες αδελφές χρωματίδες υπάρχουν.. α. Δύο β. Τέσσερις γ. Δεν έχει νόημα ο όρος αδελφές χρωματίδες στη συγκεκριμένη φάση. Θ. Στη φάση της μίτωσης μετά τη μετάφαση πόσα χρωμοσώματα υπάρχουν.. α. Δύο β. Τέσσερα 13

14 Ι. Στο τέλος της μίτωσης ποιο από τα παρακάτω σχήμα δείχνει σωστά τη μοιρασιά των μορίων DNA Να συμπληρώσετε κατάλληλα το παρακάτω σχεδιάγραμμα δύο νέα θυγατρικά κύτταρα Ανάφαση Kύτταρο Πρόφαση-Μετάφαση Κυτταρικός κύκλος ζωής σωματικού κυττάρου Φάση G 1 Kύτταρο ΕΡΩΤΗΣΕΙΣ ΑΣΚΗΣΕΙΣ-ΠΡΟΒΛΗΜΑΤΑ Ένα ανθρώπινο σωματικό κύτταρο διαθέτει στο στάδιο της μεσόφασης πριν το διπλασιασμό 46 μόρια DNA ως ινίδια χρωματίνης τα οποία συνολικά διαθέτουν ζεύγη βάσεων. Με βάση το παραπάνω δεδομένο να συμπληρωθεί ο παρακάτω πίνακας. Κύτταρο στη φάση G1 Κύτταρο στη φάση G2 Κύτταρο στη μίτωση μέχρι τη μετάφαση Κύτταρο στη μίτωση μετά τη μετάφαση Γαμέτης Χρωμοσώματα Μόρια DNA Αδελφές χρωματίδες Αριθμός Ζευγών βάσεων _ Φάση G 2 Kύτταρο S δίκλωνο μόριο DNA- χρωμόσωμα -(1) δίκλωνο μόριο DNA- χρωμόσωμα -(2) Α. Ερωτήσεις πολλαπλής επιλογής. Να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση Τα νουκλεοσώματα : α. αποτελούνται αποκλειστικά από DNA. β. δε σχηματίζονται κατά τη μεσόφαση. γ. αποτελούνται από DNA που γύρω από αυτό τυλίγονται πρωτεΐνες δ. είναι ορατά μόνο με το οπτικό μικροσκόπιο Το νουκλεόσωμα αποτελείτε : α. Από 146 ζεύγη βάσεων β. Από ένα οκταμερές πρωτεϊνών. γ. Από 146 ζεύγη βάσεων τυλιγμένα γύρω από ένα οκταμερές πρωτεϊνών. δ. Από 146 βάσεις τυλιγμένες γύρω από μία ιστόνη Τα ινίδια χρωματίνης α. είναι ορατά στο οπτικό μικροσκόπιο κατά τη μεσόφαση β. αποτελούνται από DNA και πρωτεΐνες γ. διπλασιάζονται κατά τη μετάφαση της μιτωτικής διαίρεσης 14

15 δ. αποτελούνται από δύο αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο Σε ποιο στάδιο του κυτταρικού κύκλου έχουμε την μέγιστη συσπείρωση της χρωματίνης : α. Στην μεσόφαση β. Στο στάδιο της μεσόφασης πριν το διπλασιασμό. γ. Στο στάδιο της μεσόφασης μετά το διπλασιασμό. δ. Στη μετάφαση της μίτωσης Οι αδελφές χρωματίδες α. ενώνονται στο κεντρομερίδιο β. παράγονται στο στάδιο μεταγραφής του DNA γ. παραμένουν ενωμένες μετά τη διαίρεση του κυττάρου δ. συσπειρώνονται κατά το τέλος της μίτωσης για να αποκτήσουν τη μορφή των ινιδίων της χρωματίνης Σε ποιο στάδιο του κυτταρικού κύκλου έχουμε τα μόρια DNA, με την μορφή των αδελφών χρωματίδων. α. Στο στάδιο της μεσόφασης πριν το διπλασιασμό. β. Στο στάδιο της μεσόφασης μετά τον διπλασιασμό. γ. Στην κυτταρική διαίρεση (μίτωση) δ. Στο στάδιο της μεσόφασης μετά τον διπλασιασμό και στη μίτωση Σε ποιο στάδιο του κυτταρικού κύκλου,το γενετικό υλικό είναι εύκολο να παρατηρηθεί με το οπτικό μικροσκόπιο : α. Στην μετάφαση της μίτωσης β. Στο στάδιο της μεσόφασης πριν το διπλασιασμό. γ. Στο στάδιο της μεσόφασης κατά το διπλασιασμό. δ. Στο στάδιο της μεσόφασης μετά τον διπλασιασμό Οι δύο αδερφές χρωματίδες συγκροτούν ένα α. μεταφασικό χρωμόσωμα. β. υβρίδωμα. γ. νουκλεόσωμα. δ. κύτταρο Ο όρος χρωμόσωμα χρησιμοποιείται για να περιγράψει : α. Ένα ενιαίο μόριο DNA, ως ινίδιο χρωματίνης, στο στάδιο της μεσόφασης πριν το διπλασιασμό. β. Τις αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο, στο στάδιο της μετάφασης της μίτωσης. γ. Και το α. και το β. δ. Καμία από τις παραπάνω απαντήσεις δεν είναι σωστή Σε ένα διπλοειδές κύτταρο στο τέλος της μίτωσης οι δύο αδελφές χρωματίδες στα θυγατρικά(νέα) κυττάρα : α. διαχωρίζονται με αποτέλεσμα να βρίσκονται σε διαφορετικά κύτταρα β. βρίσκονται και οι δύο στο ένα από τα δύο θυγατρικά κύτταρα,δεν είναι όμως ενωμένες στο κεντρομερίδιο γ. Είναι μόνο στο ένα από τα δύο κύτταρα με την μορφή μεταφασικού χρωμοσώματος δ. Σε κάποιες περιπτώσεις διαχωρίζονται σε διαφορετικά κύτταρα, ενώ σε άλλες βρίσκονται στο ίδιο κύτταρο. Β. Ερωτήσεις τύπου σωστό-λάθος Να ελέγξετε την ορθότητα των παρακάτω προτάσεων ( Σ : σωστή, Λ: λάθος ) Το συνολικό DNA που υπάρχει σε ένα ευκαρυωτικό κύτταρο είναι ένα ενιαίο μόριο Το συνολικό DNA που υπάρχει σε ένα ευκαρυωτικό κύτταρο,αποτελείται από πολλά γραμμικά μόρια. 3. Ένα γονίδιο αποτελείται από πολλά νουκλεοσώματα Ο αριθμός και το μήκος των μορίων DNA είναι χαρακτηριστικά για το κάθε είδος οργανισμού Τα μόρια DNA στα ευκαρυωτικά κύτταρα δεν σχηματίζουν σύμπλεγμα με πρωτεΐνες, σε αντίθεση με τα προκαρυωτικά κύτταρα Το συνολικό DNA, στα σωματικά κύτταρα του ανθρώπου έχει μήκος 2m, και «χωρά» στον πυρήνα διαμέτρου 10μm Στο ηλεκτρονικό μικροσκόπιο είναι ευδιάκριτα τα ινίδια χρωματίνης Κατά την μεσόφαση το γενετικό υλικό εμφανίζει το μέγιστο βαθμό συσπείρωσης Στα ευκαρυωτικά κύτταρα η αντιγραφή του γενετικού υλικού πραγματοποιείται στο στάδιο της μεσόφασης Στο στάδιο της μεσόφασης της μίτωσης οι αδερφές χρωματίδες είναι ορατές με το οπτικό μικροσκόπιο Η μία πολυνουκλεοτιδική αλυσίδα ενός μορίου DNA ονομάζεται αδελφή χρωματίδα Ανάλογα με το στάδιο του κυτταρικού κύκλου που βρισκόμαστε, μεταβάλλεται και η χημική σύσταση του γενετικού υλικού Ανάλογα με το στάδιο του κυτταρικού κύκλου που βρισκόμαστε μεταβάλλεται ο βαθμός συσπείρωσης του γενετικού υλικού, η χημική του σύσταση όμως παραμένει αμετάβλητη Η ποσότητα του DNA σε ένα ευκαρυωτικό κύτταρο είναι σε κάθε χρονική στιγμή σταθερή. 15

16 Γ. Ερωτήσεις συμπλήρωσης κενών. Να συμπληρώσετε τα κενά των παρακάτω προτάσεων με τους κατάλληλους όρους Η βασική μονάδα οργάνωσης της χρωματίνης είναι το Κάθε «χάντρα» των ινιδίων χρωματίνης που βλέπουμε κατά την παρατήρηση τους με το ηλεκτρονικό μικροσκόπιο, αποτελεί ένα Το νουκλεόσωμα αποτελείται από 146 ζεύγη βάσεων τυλιγμένα γύρω από οκτώ μόρια πρωτεϊνών που ονομάζονται Τα νουκλεοσώματα πακετάρονται σχηματίζοντας ινίδια Το γενετικό υλικό εμφανίζεται με διαφορετικές μορφές ανάλογα με το στάδιο του που βρίσκεται Τα ινίδια χρωματίνης αναδιπλώνονται και σχηματίζουν θηλιές, οι οποίες με τη σειρά τους αναδιπλώνονται και σχηματίζουν Τα δύο αντίγραφα μορίων DNA (με την μορφή ινιδίων χρωματίνης) που προκύπτουν μετά την αντιγραφή, συνδέονται στο Ο όρος χρησιμοποιείται για να περιγράψει τα διπλασιασμένα μόρια DNA(χρωμοσώματα) που είναι συνδεδεμένα στο κεντρομερίδιο. Δ. Ερωτήσεις-ανάπτυξης Από τι αποτελείται το νουκλεόσωμα και ποιος είναι ο ρόλος του; Ένα ανθρώπινο σωματικό κύτταρο έχει 46 χρωμοσώματα. α. Πόσα μόρια DNA συνολικά υπάρχουν στα χρωμοσώματα του συγκεκριμένου κυττάρου, στο στάδιο της μετάφασης της μίτωσης; Να δικαιολογήσετε την απάντησή σας. β. Να περιγράψετε τις χαρακτηριστικές μορφές, με τις οποίες εμφανίζεται το γενετικό υλικό ενός ευκαρυωτικού κυττάρου, ανάλογα με το στάδιο του κυτταρικού κύκλου που βρίσκεται Σε τι διαφέρει το γενετικό υλικό των ευκαρυωτικών κυττάρων από εκείνο των προκαρυωτικών; Να αναφέρετε τις διαφορές που παρατηρούνται ανάμεσα: α. στο χρωμόσωμα και στα ινίδια χρωματίνης, β. στο γονίδιο και στο νουκλεόσωμα. Ε. Ερωτήσεις αντιστοίχισης Να αντιστοιχίσετε τους όρους που αναγράφονται στη στήλη Ι με τις έννοιες ή τις φράσεις που αναγράφονται στη στήλη ΙΙ. Στήλη-Ι α. Ινίδια χρωματίνης β.νουκλεοσώματα γ. Ιστόνες δ.χρωμοσώματα Στήλη-ΙΙ 1. Κατά την μεσόφαση μπορούμε να τα διακρίνουμε με την βοήθεια του οπτικού μικροσκοπίου 2. Πρωτεΐνες των νουκλεοσωμάτων 3. Αντιγράφονται κατά την διάρκεια της μίτωσης 4. Αποτελούνται από 2 αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο 5. Πακετάρονται και σχηματίζουν ινίδια χρωματίνης 6. Μόρια DNA του μεσοφασικού πυρήνα πακεταρισμένα με πρωτεΐνες ΣΤ. Ασκήσεις-ερωτήσεις-προβλήματα Δίνεται το παρακάτω σχεδιάγραμμα του κυτταρικού κύκλου, ενός σωματικού κυττάρου του ανθρώπου. M Μ:μίτωση(κυτταρική διαίρεση) G 2 G 1 :στάδιο της μεσόφασης πριν το διπλασιασμό του DNA (ινίδια χρωματίνης) G G 2 :στάδιο της μεσόφασης 1 μετά το διπλασιασμό του DNA (ινίδια χρωματίνης) S : διπλασιασμός G 1 -S-G 2 : μεσόφαση S Να συμπληρώσετε τα κενά που σας δίνονται με τα σύμβολα ( G 1,S,G 2,M) των σταδίων του κυτταρικού κύκλου που σας δίνονται. Α. Σε ποιο(ή ποια) στάδιο(ή στάδια) του κυτταρικού κύκλου συναντάμε το γενετικό υλικό οργανωμένο σε μεταφασικά χρωμοσώματα: Β. Σε ποιο(ή ποια) στάδιο(ή στάδια) του κυτταρικού κύκλου συναντάμε τις αδελφές χρωματίδες: Γ. Σε ποιο(ή ποια) στάδιο(ή στάδια) του κυτταρικού κύκλου συναντάμε ένα μόριο DNA μόνο του, με τη μορφή ινιδίου χρωματίνης :. 16

17 Δ. Σε ποιο(ή ποια) στάδιο(ή στάδια) του κυτταρικού κύκλου συναντάμε το DNA ως σύμπλεγμα με τις ιστόνες και με άλλες πρωτεΐνες ( χρωματίνη) : Ι Να συμπληρώσετε τα κενά πάνω στον κυτταρικό κύκλο G 1 ΙΙ. Ένα σωματικό κύτταρο του ανθρώπου έχει 46 μόρια DNA ( χρωμοσώματα) στα κύτταρα του παγκρέατος ( σωματικά) στην φάση G 1 Α.Πόσα μόρια DNA έχει το συγκεκριμένο κύτταρο στο στάδιο Μ, G 2 ; Β.Πόσα μόρια DNA έχει ένα κύτταρο της καρδιάς στα στάδια G 1, M,G 2 Γ. Πόσα μόρια DNA έχει ένας γαμέτης ; Δ. Πόσα μεταφασικά χρωμοσώματα έχει το κύτταρο της καρδιάς ; Ε.Πόσα μεταφασικά χρωμοσώματα έχουν τα κύτταρα των οστών ; Ζ.Πόσα μόρια DNA έχει ένα σωματικό κύτταρο του ανθρώπου στο στάδιο της μεσόφασης ; Η. Σε ποια φάση του κυτταρικού κύκλου τα μόρια DNA είναι ευδιάκριτα με το οπτικό μικροσκόπιο ; Θ. Σε ποιο τμήμα του κυτταρικού κύκλου τα μόρια DNA βρίσκονται με την μορφή ινιδίων χρωματίνης ; Ένας γαμέτης του ανθρώπου περιέχει συνολικά ζεύγη βάσεων α. Πόσα ζεύγη βάσεων υπάρχουν στα σωματικά κύτταρα του ανθρώπου στο στάδιο της μεσόφασης ; β. Πόσα ζεύγη βάσεων υπάρχουν στα σωματικά κύτταρα του ανθρώπου στο στάδιο της μίτωσης ; 17

18 1.5. Καρυότυπος. Γενετικό υλικό μιτοχονδρίωνχλωροπλαστών. Γενετικό υλικό ιών. Κατασκευή καρυότυπου Να συμπληρωθούν τα κενά με τους κατάλληλους όρους της παρένθεσης Ο καρυότυπος αποτελεί την απεικόνιση των χρωμοσωμάτων ενός κυττάρου στο στάδιο της της μίτωσης. Στο στάδιο αυτό τα χρωμοσώματα είναι ευδιάκριτα με το οπτικό μικροσκόπιο. Για να κατασκευαστεί ο καρυότυπος ενός κυττάρου, αυτό θα πρέπει αρχικά να βρεθεί στο στάδιο της. Στη συνέχεια η μίτωση να σταματήσει στο στάδιο της. Μετά τα πρέπει να εξαχθούν από τον πυρήνα του κυττάρου και αφού χρωματιστούν με ειδικές να παρατηρηθούν στο μικροσκόπιο. ( Όροι που πρέπει να χρησιμοποιηθούν για την συμπλήρωση των κενών : - μίτωσης, -μετάφαση (2 φορές),-χρωστικές,χρωμοσώματα) Σας δίνονται οι διάφορες ουσίες που χρησιμοποιούνται για την κατασκευή του καρυότυπου : Ουσία-1 : Ουσία με μιτογόνο δράση Ουσία-2: Χρωστικές Giemsa Ουσία-4: Ουσία που σταματά την κυτταρική διαίρεση(μίτωση) σε συγκεκριμένο στάδιο Ουσία-3 : Υποτονικό διάλυμα Να αναφέρετε ποια ουσία χρησιμοποιείται για την επίτευξη των «βημάτων» που απαιτούνται για την κατασκευή του καρυότυπου. Βήμα-1 : Επαγωγή της κυτταρικής διαίρεσης, «αναγκάζουμε» το κύτταρο ανεξάρτητα σε ποια φάση του κυτταρικού κύκλου βρίσκεται να περάσει στο στάδιο της κυτταρικής διαίρεσης (μίτωση) Βήμα-2 : Στην κυτταρική διαίρεση το κύτταρο «περνά» διαδοχικά από την πρόφαση στη μετάφαση, από τη μετάφαση στην ανάφαση και τελικά στην τελόφαση. Με ειδική ουσία η διαδικασία σταματά στο στάδιο της μετάφασης. Βήμα-3: Στο κύτταρο μετά από ειδική κατεργασία,εισέρχεται στο εσωτερικό του μεγάλη ποσότητα νερού με αποτέλεσμα την καταστροφή (λύση) του. Τα χρωμοσώματα που υπήρχαν στο εσωτερικό του κυττάρου εξέρχονται από αυτό. Βήμα-4: Τα χρωμοσώματα «βάφονται» και αποκτούν χαρακτηριστικές ζώνες με αποτέλεσμα να παρατηρείται η δομή τους καλύτερα στο μικροσκόπιο. Μορφή ανθρωπίνου καρυότυπου Και με βάση την εικόνα που σας δίνεται να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Πόσα μόρια DNA έχει ένας γαμέτης : α.23 β. 46 Β. Πόσα «χρωμοσώματα» έχει ένας γαμέτης α.23 β. 46 Γ. Πόσα μόρια DNA έχει το σωματικό κύτταρο του οργανισμού που προκύπτει από τη σύντηξη των δύο γαμετών α.23 β. 46 Δ. Πόσα «χρωμοσώματα» έχει το σωματικό κύτταρο του οργανισμού που προκύπτει από τη σύντηξη των δύο γαμετών α.23 β. 46 Ε. Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές ή λάθος Ε-1 «Ο γαμέτης ως απλοειδές κύτταρο έχει το γονιδίωμα σε ένα αντίγραφο, δηλαδή κάθε μόριο DNA είναι διαφορετικό από το άλλο» Ε-2 «Ο γαμέτης ως διπλοειδές κύτταρο έχει το γονιδίωμα σε δύο αντίγραφα, δηλαδή τα μόρια DNA είναι ανά δύο όμοια σε μέγεθος» Ε-3«Το σωματικό κύτταρο ως απλοειδές κύτταρο έχει το γονιδίωμα σε ένα αντίγραφο, δηλαδή κάθε μόριο DNA είναι διαφορετικό από το άλλο» Ε-4«Το σωματικό κύτταρο ως διπλοειδές κύτταρο έχει το γονιδίωμα σε δύο αντίγραφα, δηλαδή τα μόρια DNA είναι ανά δύο όμοια σε μέγεθος» 18

19 Σας δίνεται ο καρυότυπος δηλαδή η απεικόνιση των χρωμοσωμάτων του σωματικού κυττάρου της εικόνας της προηγούμενης σελίδας. Με βάση την εικόνα να απαντήσετε τις παρακάτω ερωτήσεις. Α. Το σωματικό κύτταρο που χρησιμοποιήθηκε για τον καρυότυπο σε ποια βάση του κυτταρικού κύκλου βρίσκεται ; α. Μεσόφαση β. Μίτωση Β. Το σωματικό κύτταρο που χρησιμοποιήθηκε για τον καρυότυπο πόσα μόρια DNA έχει ; : α. 23 β.46 γ. 92 Γ. Το σωματικό κύτταρο που χρησιμοποιήθηκε για τον καρυότυπο πόσα μεταφασικά χρωμοσώματα έχει ; α. 23 β.46 γ. 92 Δ. Πόσα «ζευγάρια» χρωμοσωμάτων παρατηρείτε ; α. 23 β.46 γ. 92 Ε. Είναι σωστός ο ισχυρισμός ότι ο αριθμός των «χρωμοσωμάτων» του σωματικού κυττάρου της σελίδας 18 είναι ίσος με των αριθμών των μεταφασικών χρωμοσωμάτων του σωματικού κυττάρου της σελίδας 19. Ζ. Υπάρχει κάποιο «ζευγάρι» χρωμοσωμάτων που δεν αποτελείται από όμοια χρωμοσώματα ; και αν ναι ποιο είναι αυτό ; Με βάση το σωματικό κύτταρο της σελίδας-18 και το σωματικό κύτταρο της σελίδας-19 να απαντήσετε τις ερωτήσεις που ακολουθούν Α. Πόσα ζευγάρια αυτοσωμικών «χρωμοσωμάτων» παρατηρείτε στο κύτταρο της σελίδας-18 ; α. 22 β. 23 γ. 46 Β. Πόσα ζευγάρια αυτοσωμικών μεταφασικών χρωμοσωμάτων παρατηρείτε στο κύτταρο της σελίδας-19 ; α. 22 β. 23 γ. 46 Γ. Πόσα ζευγάρια φυλετικών «χρωμοσωμάτων» παρατηρείται στο σωματικό κύτταρο της σελίδας-18 α. 1 β. 2 γ. 22 δ. 23 Δ. Πόσα ζευγάρια φυλετικών «χρωμοσωμάτων» παρατηρείται στο σωματικό κύτταρο της σελίδας-19 α. 1 β. 2 γ. 22 δ. 23 Ε. Να συγκρίνετε τα αποτελέσματα ανάμεσα στα δύο κύτταρα,το συμπέρασμα που εξάγουμε είναι.. α. Τα αποτελέσματα είναι ίδια, από τον καρυότυπο μπορούμε να γνωρίζουμε τον αριθμό των χρωμοσωμάτων και του σωματικού κυττάρου της σελίδας-18 και του γαμέτη. β. Τα αποτελέσματα είναι διαφορετικά. ΣΤ. Και στα δυο κύτταρα ( σελίδας-18 και 19) ποιος είναι ο αριθμός των αυτοσωμικών χρωμοσωμάτων : α. 22 β. 44 Ζ. Και στα δυο κύτταρα ( σελίδας-18 και 19) ποιος είναι ο αριθμός των φυλετικών χρωμοσωμάτων : α. 1 β Να ελέγξετε την ορθότητα της παρακάτω φράσης : «Από τον καρυότυπο δεν μπορούμε να γνωρίζουμε το φύλο του ατόμου όπου προήλθε το κύτταρο» Σας δίνεται ο καρυότυπος του ινδικού ελαφιού Α. Πόσα μόρια DNA έχει το συγκεκριμένο κύτταρο που χρησιμοποιήθηκε για την κατασκευή του καρυότυπου ; α. 6 β. 12 Β. Σε ποια φάση του κυτταρικού κύκλου βρίσκεται το συγκεκριμένο κύτταρο; α. Μεσόφαση β. Μίτωση Γ. Πόσα μεταφασικά χρωμόσωματα έχει το συγκεκριμένο κύτταρο ; α. 6 β. 3 γ. 12 Δ. Πόσα ζευγάρια χρωμοσωμάτων έχει το συγκεκριμένο κύτταρο ; α. 6 β. 3 γ. 12 Ε. Πόσα ζευγάρια αυτοσωμικών χρωμοσωμάτων έχει το συγκεκριμένο κύτταρο ; α. 6 β. 3 γ. 2 ΣΤ. Πόσα ζευγάρια φυλετικών χρωμοσωμάτων έχει το συγκεκριμένο κύτταρο ; α. 1 β. 2 γ Να απαντήσετε στις ερωτήσεις που ακολουθούν Α. Πόσα μόρια DNA και πόσα «χρωμοσώματα» έχει ένα σωματικό κύτταρο του ινδικού ελαφιού στο στάδιο της μεσόφασης πριν το διπλασιασμό του γενετικού υλικού ; Β. Πόσα μόρια DNA και πόσα «χρωμοσώματα» έχει ένας γαμέτης του ινδικού ελαφιού ; 19

20 Σας δίνεται ο καρυότυπος του κινέζικου ελαφιού. Α. Να βρείτε τον αριθμό των χρωμοσωμάτων ενός σωματικού κυττάρου του κινέζικου ελαφιού Β. Να αναφέρετε τον αριθμό των αυτοσωμικών και φυλετικών χρωμοσωμάτων ενός σωματικού κυττάρου του κινέζικου ελαφιού Γ. Να αναφέρετε τον αριθμό των χρωμοσωμάτων του γαμέτη του κινέζικου ελαφιού Δ. Να αναφέρετε τον αριθμό των μορίων DNA ενός σωματικού κυττάρου του κινέζικου ελαφιού Ε. Να αναφέρετε τον αριθμό των μορίων DNA ενός γαμέτη του κινέζικου ελαφιού Στον φυσιολογικό ανθρώπινο καρυότυπο παρατηρούνται 46 χρωμοσώματα. Με βάση την παραπάνω παρατήρηση να απαντήσετε τις ερωτήσεις πολλαπλής επιλογής που ακολουθούν. 1. Το ανθρώπινο κύτταρο που χρησιμοποιήθηκε για την κατασκευή του καρυότυπου περιέχει.. : α. 46 μόρια DNA ως 46 ινίδια χρωματίνης β. 92 μόρια DNA ως 92 αδελφές χρωματίδες και 46 κεντρομερίδια γ. 92 μόρια DNA ως 92 ινίδια χρωματίνης ή 92 αδελφές χρωματίδες. δ. 23 μόρια DNA ως 23 μεταφασικά χρωμοσώματα 2. Τα θυγατρικά κύτταρα που θα προκύψουν μετά το τέλος της μίτωσης θα περιέχουν : α. 46 μόρια DNA ως 46 ινίδια χρωματίνης ή 46 χρωμοσώματα β. 92 μόρια DNA ως 92 αδελφές χρωματίδες γ. 92 μόρια DNA ως 92 ινίδια χρωματίνης. δ. 23 μόρια DNA ως 23 χρωμοσώματα. 3. Τα κύτταρα που προκύπτουν μετά το τέλος της μείωσης περιέχουν α. 46 μόρια DNA ως 46 ινίδια χρωματίνης ή 46 χρωμοσώματα β. 92 μόρια DNA ως 92 αδελφές χρωματίδες γ. 92 μόρια DNA ως 92 ινίδια χρωματίνης. δ. 23 μόρια DNA ως 23 χρωμοσώματα. 4. Στον πυρήνα ενός σωματικού κυττάρου στη φάση της μεσόφασης πριν το διπλασιασμό υπάρχουν : α. 46 ινίδια χρωματίνης ως 46 αδελφές χρωματίδες. β. 46 ινίδια χρωματίνης ως 46 χρωμοσώματα. γ. 92 ινίδια χρωματίνης ως 92 αδελφές χρωματίδες. δ. 92 ινίδια χρωματίνης ως 92 χρωμοσώματα. 5. Στον πυρήνα ενός σωματικού κυττάρου στη φάση της μεσόφασης μετά το διπλασιασμό υπάρχουν : α. 46 ινίδια χρωματίνης ως 46 αδελφές χρωματίδες. β. 46 ινίδια χρωματίνης ως 46 χρωμοσώματα. γ. 92 ινίδια χρωματίνης ως 92 αδελφές χρωματίδες. δ. 92 ινίδια χρωματίνης ως 92 χρωμοσώματα. 6. Ο όρος «χρωμόσωμα» χρησιμοποιείται.. : α. για ένα ινίδιο χρωματίνης στο στάδιο της μεσόφασης πριν το διπλασιασμό. β. για δύο πανομοιότυπα ινίδια χρωματίνης ενωμένα στο κεντρομερίδιο στο στάδιο της μεσόφασης μετά το διπλασιασμό. γ. για τις δύο αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο στη μετάφαση της μίτωσης. δ. για όλα τα παραπάνω. 7. Στα στάδια της κυτταρικής διαίρεσης όπου τα δύο όμοια μόρια DNA που προήλθαν από τον διπλασιασμό ενός αρχικού παραμένουν ενωμένα στο κεντρομερίδιο (πρόφαση,μετάφαση) έχουμε : α. 92 μόρια DNA ως 92 αδελφές χρωματίδες οργανωμένα σε 92 χρωμοσώματα. β. 92 μόρια DNA ως 92 αδελφές χρωματίδες οργανωμένα σε 46 χρωμοσώματα. γ. 92 μόρια DNA ως 92 χρωμοσώματα. δ. 92 μόρια DNA ως 46 χρωμοσώματα. 8. Στα στάδια της κυτταρικής διαίρεσης όπου τα δύο όμοια μόρια DNA που προήλθαν από τον διπλασιασμό ενός αρχικού διαχωρίζονται(ανάφαση,τελόφαση) έχουμε : α. 92 μόρια DNA ως 92 αδελφές χρωματίδες οργανωμένα σε 92 χρωμοσώματα. β. 92 μόρια DNA ως 92 αδελφές χρωματίδες οργανωμένα σε 46 χρωμοσώματα. γ. 92 μόρια DNA ως 92 χρωμοσώματα. δ. 92 μόρια DNA ως 46 χρωμοσώματα. 9. Στον καρυότυπο ατόμου με σύνδρομο Klinefelter (47 χρωμοσώματα) παρατηρούμε : α. 94 αδελφές χρωματίδες ως 47 μεταφασικά χρωμοσώματα. β. 45 ινίδια χρωματίνης ως 45 χρωμοσώματα.. γ. 90 αδελφές χρωματίδες ως 45 μεταφασικά χρωμοσώματα. δ. 47 ινίδια χρωματίνης ως 47 χρωμοσώματα. 10. Στον καρυότυπο ατόμου με σύνδρομο Turner(45 χρωμοσώματα) παρατηρούμε : α. 94 αδελφές χρωματίδες ως 47 μεταφασικά χρωμοσώματα. β. 45 ινίδια χρωματίνης ως 45 χρωμοσώματα.. 20

21 γ. 90 αδελφές χρωματίδες ως 45 μεταφασικά χρωμοσώματα. δ. 47 ινίδια χρωματίνης ως 47 χρωμοσώματα. Ασκήσεις στον καρυότυπο Κατασκευάστηκε ο καρυότυπος ενός σωματικού κυττάρου που ανήκει στο είδος μύγας δροσόφιλα (Drosophila melanogaster). Ο καρυότυπος διαθέτει 8 χρωμοσώματα. Με δεδομένο ότι το φύλο στη δροσόφιλα κληρονομείται όπως στον άνθρωπο να βρείτε. α. Σε ποιο στάδιο του κυτταρικού κύκλου βρίσκεται το συγκεκριμένο κύτταρο. β. Τον αριθμό των μορίων DNA του σωματικού κυττάρου που χρησιμοποιήθηκε για την κατασκευή του καρυότυπου. γ. Τον αριθμό των αυτοσωμικών και φυλετικών χρωμοσωμάτων της δροσόφιλας δ. Τον αριθμό των μορίων DNA καθώς και τον αριθμό των χρωμοσωμάτων σε ένα σωματικό κύτταρο που βρίσκεται στο στάδιο της μεσόφασης πριν το διπλασιασμό του γενετικού υλικού. ε. Τον αριθμό των μορίων DNA καθώς και τον αριθμό των χρωμοσωμάτων σε ένα γαμετικό κύτταρο. Απάντηση: α. Πάντα ο καρυότυπος κατασκευάζεται από κύτταρα που βρίσκονται στη μετάφαση της μίτωσης. β. Στο συγκεκριμένο κύτταρο ένα χρωμόσωμα (μεταφασικό) αποτελείται από τις δύο αδελφές χρωματίδες, που η κάθε μία είναι ένα μόριο DNA. Αφού κάθε χρωμόσωμα έχει 2 μόρια DNA και συνολικά ο καρυότυπος 8 χρωμοσώματα, το συγκεκριμένο κύτταρο έχει 8 2=16 μόρια DNA. γ. Όπως στον άνθρωπο και στη δροσόφιλα έχουμε ένα ζευγάρι φυλετικών χρωμοσωμάτων δηλαδή 2 φυλετικά χρωμοσώματα.επομένως και 6 αυτοσωμικά χρωμοσώματα,αφού συνολικά ο καρυότυπος έχει 8 χρωμοσώματα. δ. Στο στάδιο της μεσόφασης πριν το διπλασιασμό έχουμε τα μισά μόρια DNA από ότι στο στάδιο της μίτωσης όπου το κάθε μόριο DNA έχει αυτοδιπλαστεί. Άρα έχουμε 8 μόρια DNA που στη συγκεκριμένη φάση αποτελούν και 8 «χρωμοσώματα».άρα ο αριθμός των χρωμοσωμάτων παραμένει σταθερός. ε. Ο γαμέτης έχει τα μισά μόρια DNA από το σωματικό κύτταρο στο στάδιο της μεσόφασης πριν το διπλασιασμό. Επομένως διαθέτει 4 μόρια DNA ή αλλιώς 4 «χρωμοσώματα» Το καλαμπόκι (Zea Mays) διαθέτει στον καρυότυπο του 20 χρωμοσώματα.να βρείτε: α. Σε ποιο στάδιο του κυτταρικού κύκλου βρίσκεται το κύτταρο από το οποίο κατασκευάστηκε ο καρυότυπος. β. Τον αριθμό των μορίων DNA του κυττάρου που κατασκευάστηκε ο καρυότυπος. γ. Τον αριθμό των μορίων DNA και των χρωμοσωμάτων ενός σωματικού κυττάρου στο στάδιο της μεσόφασης πριν το διπλασιασμό του γενετικού υλικού. δ. Τον αριθμό των μορίων DNA και των χρωμοσωμάτων ενός γαμέτη Ο καρυότυπος ενός είδους ελαφιού διαθέτει 100 χρωμοσώματα. Να βρεθούν : α. Σε ποιο στάδιο του κυτταρικού κύκλου βρίσκεται το κύτταρο από το οποίο κατασκευάστηκε ο καρυότυπος. β. Τον αριθμό των μορίων DNA του κυττάρου που κατασκευάστηκε ο καρυότυπος. γ. Ο αριθμός των αδελφών χρωματίδων του κυττάρου που κατασκευάστηκε ο καρυότυπος. δ. Τον αριθμό των μορίων DNA και των χρωμοσωμάτων ενός σωματικού κυττάρου στο στάδιο της μεσόφασης πριν το διπλασιασμό του γενετικού υλικού. ε. Τον αριθμό των μορίων DNA και των χρωμοσωμάτων ενός γαμέτη Ο καρυότυπος της γάτας διαθέτει 38 χρωμοσώματα. Να βρεθούν : α. Ο αριθμός των αδελφών χρωματίδων του συγκεκριμένου κυττάρου που κατασκευάστηκε ο καρυότυπος. β. Ο αριθμός των αδελφών χρωματίδων και των χρωμοσωμάτων ενός σωματικού κυττάρου που βρίσκεται στο στάδιο της μεσόφασης μετά το διπλασιασμό του γενετικού υλικού. Απάντηση. α. Πάντα τα κύτταρα που χρησιμοποιούνται στον καρυότυπο βρίσκονται στο στάδιο της μετάφασης της μίτωσης. Κάθε μεταφασικό χρωμόσωμα αποτελείται από δυο αδελφές χρωματίδες άρα 38 2=76 αδελφές χρωματίδες. β. Θα πρέπει να κατανοήσουμε ότι σε ένα σωματικό κύτταρο στο στάδιο της μεσόφασης μετά το διπλασιασμό του γενετικού υλικού ισχύουν όσον αφορά τον αριθμό των χρωματίδων και των χρωμοσωμάτων ότι ισχύει και για ένα κύτταρο που βρίσκεται στη μετάφαση της μίτωσης (μόνο ο βαθμός συσπείρωσης της χρωματίνης αλλάζει).επομένως 21

22 έχουμε 38 «χρωμοσώματα» και 76 αδελφές χρωματίδες Ο καρυότυπος του σκύλου διαθέτει 52 χρωμοσώματα. Να βρείτε : α. Ο αριθμός των αδελφών χρωματίδων του συγκεκριμένου κυττάρου που κατασκευάστηκε ο καρυότυπος. β. Ο αριθμός των αδελφών χρωματίδων και των χρωμοσωμάτων ενός σωματικού κυττάρου που βρίσκεται στο στάδιο της μεσόφασης μετά το διπλασιασμό του γενετικού υλικού Ένα είδος ζωικού οργανισμού διαθέτει στον καρυότυπο του 16 χρωμοσώματα. Να βρεθούν α. Ο αριθμός των μορίων DNA και των αδελφών χρωματίδων του κυττάρου που χρησιμοποιήθηκε για την κατασκευή του καρυότυπου. β. Ο αριθμός των αυτοσωμικών και φυλετικών χρωμοσωμάτων αν γνωρίζουμε ότι το φύλο στο συγκεκριμένο οργανισμό καθορίζεται όπως στον άνθρωπο. γ. Ο αριθμός των μορίων DNA,των αδελφών χρωματίδων και των χρωμοσωμάτων ενός σωματικού κυττάρου που βρίσκεται στο στάδιο της μεσόφασης μετά το διπλασιασμό του γενετικού υλικού. δ. Ο αριθμός των μορίων DNA και των χρωμοσωμάτων ενός σωματικού κυττάρου που βρίσκεται στο στάδιο της μεσόφασης πριν το διπλασιασμό του γενετικού υλικού ε. Ο αριθμός μορίων DNA και των χρωμοσωμάτων σε ένα γαμετικό κύτταρο Στον άνθρωπο παρατηρούνται 3 είδη κυττάρων όσον αφορά την ποσότητα DNA που περιέχουν. Είδος-1 : ζεύγη βάσεων Είδος-2 : ζεύγη βάσεων Είδος-3: ζεύγη βάσεων Να αιτιολογήσετε την παραπάνω διαφορά στην ποσότητα DNA. Απάντηση : Στον άνθρωπο όπως και σε οποιοδήποτε οργανισμό αναπαράγεται φυλετικά όσον αφορά την ποσότητα DNA παρατηρούμε ότι υπάρχουν τα γαμετικά κύτταρα που έχουν τη μίση ποσότητα DNA από τα σωματικά.επομένως το είδος-1 είναι γαμέτης. Το σωματικό κύτταρο μπορεί να βρίσκεται πριν το διπλασιασμό του γενετικού υλικού ή μετά. Άρα το είδος-2 είναι σωματικό κύτταρο στο στάδιο της μεσόφασης πριν το διπλασιασμό του γενετικού υλικού. Το είδος-3 είναι σωματικό κύτταρο στο στάδιο της μεσόφασης μετά το διπλασιασμό του γενετικού υλικού ή στο στάδιο της κυτταρικής διαίρεσης Από τη μύγα Drosophila απομονώθηκαν τρία διαφορετικά φυσιολογικά κύτταρα στα οποία προσδιορίστηκε το μέγεθος του γονιδιώματος σε ζεύγη βάσεων. Στο πρώτο κύτταρο το μέγεθος του γονιδιώματος υπολογίστηκε σε 3, ζεύγη βάσεων, στο δεύτερο κύτταρο σε 1, ζεύγη βάσεων και στο τρίτο κύτταρο σε 6, ζεύγη βάσεων. Να δικαιολογήσετε γιατί υπάρχουν οι διαφορές αυτές στο μέγεθος του γονιδιώματος των τριών κυττάρων Διαθέτουμε 2 κύτταρα από δυο διαφορετικά είδη οργανισμών το είδος- Α και το είδος- Β. Το γαμετικό κύτταρο του είδους-α διαθέτει 1, ζεύγη βάσεων.ένα σωματικό κύτταρο του είδους-β που χρησιμοποιήθηκε για την κατασκευή του καρυότυπου διαθέτει ζεύγη βάσεων. Ένα σωματικό κύτταρο ενός τρίτου είδους (είδος-γ) διαθέτει ζεύγη βάσεων. Ποιο είδος οργανισμού είναι πιο πολύπλοκο με βάση την ποσότητα του γενετικού υλικού ; Απάντηση : Πάντα όταν συγκρίνουμε και μελετάμε γονιδιώματα οργανισμών, αναφερόμαστε σε απλοειδή κύτταρα,δηλαδή σε οργανισμούς που αναπαράγονται φυλετικά συγκρίνουμε τους γαμέτες. Γαμέτης είδους-α: 1, ζεύγη βάσεων Στο είδος-β το κύτταρο που χρησιμοποιήθηκε για την κατασκευή του καρυότυπου είναι ένα σωματικό κύτταρο στο στάδιο της μετάφασης της μίτωσης,δηλαδή σωματικό κύτταρο μετά το διπλασιασμό του DNA. Επομένως το σωματικό κύτταρο πριν το διπλασιασμό είχε 1, ζεύγη βάσεων και άρα ο γαμέτης του είδους-β θα έχει 0, ζεύγη βάσεων. Στο τρίτο είδος-γ ο γαμέτης έχει τη μισή ποσότητα γενετικού υλικού από το σωματικό κύτταρο στο στάδιο της μεσόφασης πριν το διπλασιασμό, άρα 1, ζεύγη βάσεων. Επομένως περισσότερο γενετικό υλικό έχει ο οργανισμός-α όπου ο γαμέτης του διαθέτει 1, ζεύγη βάσεων μετά κατατάσσουμε το είδος-γ με το γαμέτη του να διαθέτει 1, ζεύγη βάσεων και ο οργανισμός με τη μικρότερη ποσότητα γενετικού 22

23 υλικού είναι ο Β που ο γαμέτης του διαθέτει 0, ζεύγη βάσεων Διαθέτουμε 3 κύτταρα από τρία διαφορετικά είδη οργανισμών Σωματικό κύτταρο πριν το διπλασιασμό του γενετικού υλικού στο είδος-α : Ποσότητα DNA = ζεύγη βάσεων Σωματικό κύτταρο μετά το διπλασιασμό του γενετικού υλικού στο είδος-β : Ποσότητα DNA = ζεύγη βάσεων Γαμετικό κύτταρο του είδους-γ : Ποσότητα DNA = ζεύγη βάσεων Να συγκριθούν τα γονιδιώματα των τριών οργανισμών ως προς την ποσότητα DNA. Α. Ερωτήσεις πολλαπλής επιλογής Να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση. Καρυότυπος Το ανθρώπινο γονιδίωμα σε ένα απλοειδές κύτταρο (γαμέτη) αποτελείται από. : α ζεύγη βάσεων που είναι οργανωμένα σε 46 χρωμοσώματα. β ζεύγη βάσεων που είναι οργανωμένα σε 23 χρωμοσώματα. γ ζεύγη βάσεων που είναι οργανωμένα σε 23 χρωμοσώματα. δ ζεύγη βάσεων που είναι οργανωμένα σε 46 χρωμοσώματα Ποια από τις παρακάτω ουσίες χρησιμοποιούνται για την επαγωγή της κυτταρικής διαίρεσης σε κύτταρα που θα χρησιμοποιηθούν για την κατασκευή του καρυότυπου : α. Ουσίες με μιτογόνο δράση β. Υποτονικό διάλυμα γ. Ειδικές χρωστικές δ. Ουσίες που σταματούν την μίτωση στο στάδιο της μετάφασης Ποια από τις παρακάτω ουσίες χρησιμοποιούνται για το σπάσιμο της κυτταρικής μεμβράνης : α. Ουσίες με μιτογόνο δράση β. Υποτονικό διάλυμα γ. Ειδικές χρωστικές δ. Ουσίες που σταματούν την μίτωση στο στάδιο της μετάφασης Οι ουσίες με μιτογόνο δράση : α. Σταματούν την κυτταρική διαίρεση στο στάδιο της μετάφασης β. Επάγουν την κυτταρική διαίρεση γ. Προκαλούν σπάσιμο της κυτταρικής μεμβράνης δ. Χρωματίζουν τα χρωμοσώματα Τα χρωμοσώματα είναι ευδιάκριτα με το οπτικό μικροσκόπιο : α. Σε κάθε φάση του κυτταρικού κύκλου β. Μόνο στην φάση G 1 της μεσόφασης γ. Στην μεσόφαση δ. Στην μετάφαση της μίτωσης Στον πυρήνα ενός ανθρωπίνου κυττάρου στο στάδιο της μεσόφασης πριν τον διπλασιασμό του DNA υπάρχουν : α. 46 χρωματίδες β. 22 χρωμοσώματα γ. 46 χρωμοσώματα δ. 22 αυτοσωμικά χρωμοσώματα και ένα φυλετικό Ο καρυότυπος είναι : α. Η απεικόνιση των χρωμοσωμάτων κατά ελαττωμένο μέγεθος. β. Η απεικόνιση των χρωμοσωμάτων κατά αυξανόμενο μέγεθος. γ. Η απεικόνιση των αυτοσωμικών χρωμοσωμάτων δ. Η απεικόνιση των φυλετικών χρωμοσωμάτων Στον ανθρώπινο καρυότυπο παρατηρούνται : α. 23 χρωμοσώματα β. 22 ζεύγη χρωμοσωμάτων γ. 23 ζεύγη χρωμοσωμάτων δ. 46 ζεύγη χρωμοσωμάτων Ο καρυότυπος ενός φυσιολογικού ανθρώπου περιλαμβάνει : α. 23 ζεύγη αυτοσωμικών χρωμοσωμάτων. β. 46 ζεύγη αυτοσωμικών χρωμοσωμάτων γ. 22 ζεύγη αυτοσωμικών χρωμοσωμάτων και δύο ζεύγη φυλετικών χρωμοσωμάτων δ. 22 ζεύγη αυτοσωμικών χρωμοσωμάτων και ένα ζεύγος φυλετικών χρωμοσωμάτων Ένα φυσιολογικό αρσενικό άτομο έχει : α. 44 αυτοσωμικά χρωμοσώματα και ένα ζεύγος ΧΧ. β. 22 αυτοσωμικά χρωμοσώματα και ένα ζεύγος ΧΧ. γ. 22 αυτοσωμικά χρωμοσώματα και ένα ζεύγος ΧΥ. δ. 44 αυτοσωμικά χρωμοσώματα και ένα ζεύγος ΧΥ Ένα θηλυκό και ένα αρσενικό άτομο έχουν αντίστοιχα : α. ΧΥ και ΧΧ στο 23 ο ζεύγος. β. ΥΥ και ΧΧ στο 23 ο ζεύγος. γ. ΧΥ και ΥΥ στο 23 ο ζεύγος δ. ΧΧ και ΧΥ στο 23 ο ζεύγος Τα φυλετικά χρωμοσώματα του ανθρώπου βρίσκονται: α. μόνο στα μυϊκά κύτταρα β. μόνο στα γεννητικά κύτταρα γ. σε όλα τα κύτταρα δ. μόνο στα ηπατικά κύτταρα Ποια από τις παρακάτω φράσεις ισχύει για το φυλετικό χρωμόσωμα Υ : 23

24 α. Είναι μεγαλύτερο από το χρωμόσωμα Χ β. Είναι μικρότερο από το χρωμόσωμα Χ γ. Είναι μητρικής προέλευσης δ. Υπάρχει μόνο στα θηλυκά άτομα. Μιτοχόνδρια-χλωροπλάστες Το μιτοχονδριακό DNA ενός κυττάρου: α. είναι πατρικής προέλευσης β. περιέχει γονίδια ανθεκτικότητας σε αντιβιοτικά γ. είναι μητρικής προέλευσης δ. είναι μονόκλωνο Στους περισσότερους οργανισμούς ένα μιτοχόνδριο περιέχει α. ένα μόριο κυκλικού DNA. β. δύο έως δέκα μόρια κυκλικού DNA. γ. ένα μόριο γραμμικού RNA. δ. πολλά μόρια γραμμικού RNA Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται α. τα ριβοσώματα και οι χλωροπλάστες. β. οι χλωροπλάστες και τα μιτοχόνδρια. γ. τα χρωμοσώματα και τα ριβοσώματα. δ. ο πυρήνας και οι χλωροπλάστες. Ιοί Ποιο από τα παρακάτω νουκλεϊκά οξέα δεν μπορεί να αποτελεί γενετικό υλικό ενός ιού : α. δίκλωνο κυκλικό μόριο DNA. β. μονόκλωνο μόριο DNA γ. κυκλικό μόριο RNA. δ. καμία από τις παραπάνω απαντήσεις δεν είναι σωστή. Β. Ερωτήσεις τύπου σωστό-λάθος Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) ή λάνθασμένες (Λ). Καρυότυπος Με τον καρυότυπο μπορούμε να μελετήσουμε τη μορφή και τον αριθμό των χρωμοσωμάτων Τα γαμετικά κύτταρα του ανθρώπου περιέχουν 23 ομόλογα χρωμοσώματα Τα χρωμοσώματα μελετώνται στο στάδιο της μεσόφασης Τα κύτταρα που χρησιμοποιούνται για την κατασκευή του καρυότυπου μπορεί να προέρχονται είτε από ιστούς είτε από κυτταροκαλλιέργειες Κάθε φυσιολογικό μεταφασικό χρωμόσωμα αποτελείται από δύο αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο Το κεντρομερίδιο «χωρίζει» κάθε αδελφή χρωματίδα σε δύο ίσους βραχίονες Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν μεταξύ τους μόνο ως προς το μέγεθος Ένα φυσιολογικό θηλυκό άτομο έχει 44 αυτοσωμικά χρωμοσώματα και ένα ζεύγος ΧΧ Το Υ χρωμόσωμα είναι μεγαλύτερο του Χ Στον άνθρωπο η παρουσία του Υ χρωμοσώματος καθορίζει το αρσενικό άτομο, ενώ η απουσία του το θηλυκό Στα αρσενικά άτομα τα φυλετικά χρωμοσώματα των σωματικών κυττάρων είναι ομόλογα Στα απλοειδή κύτταρα, τα ομόλογα χρωμοσώματα είναι μορφολογικά όμοια. Μιτοχόνδρια χλωροπλάστες Στα μιτοχόνδρια επιτελείται η οξειδωτική φωσφορυλίωση και στους χλωροπλάστες η φωτοσύνθεση Το μιτοχονδριακό DNA, στους περισσότερους οργανισμούς είναι ένα γραμμικό μόριο Σε ορισμένα κατώτερα πρωτόζωα το μιτοχονδριακό DNA είναι γραμμικό σε αντίθεση με τους περισσότερους οργανισμούς που αποτελείται από κυκλικά μόρια DNA Το ζυγωτό των ανώτερων οργανισμών περιέχει μόνο τα μιτοχόνδρια που προέρχονται από το ωάριο Η προέλευση των μιτοχονδριακών γονιδίων είναι πατρική Το DNA των χλωροπλαστών έχει μικρότερο μέγεθος από το αντίστοιχο των μιτοχονδρίων Όλα τα οργανίδια ενός ευκαρυωτικού κυττάρου έχουν DNA. Ιοί Το RNA των ιών μπορεί να είναι και δίκλωνο. ( ) Γ. Ερωτήσεις συμπλήρωσης κενών. Να συμπληρώσετε τα κενά των παρακάτω προτάσεων με τους κατάλληλους όρους. Καρυότυπος Η απεικόνιση των χρωμοσωμάτων σε ζεύγη κατά ελαττούμενο μέγεθος αποτελεί τον Στον πυρήνα των ανθρωπίνων σωματικών κυττάρων υπάρχουν Τα ζεύγη χρωμοσωμάτων που είναι μορφολογικά ίδια τόσο στα αρσενικά όσο και στα θηλυκά άτομα ονομάζονται Τα χρωμοσώματα του ανθρώπου που καθορίζουν αν ένα άτομο θα είναι αρσενικό ή θηλυκό λέγονται. Μιτοχόνδρια-χλωροπλάστες Πολλές από τις πρωτεΐνες που είναι υπεύθυνες για την λειτουργία των μιτοχονδρίων και των χλωροπλαστών κωδικοποιούνται από γονίδια που υπάρχουν στο DNA του πυρήνα. Για αυτό τα οργανίδια αυτά χαρακτηρίζονται ως. 24

25 Τα μιτοχόνδρια περιέχουν ως γενετικό υλικό, το οποίο κωδικοποιεί μικρό αριθμό πρωτεϊνών που ελέγχουν τη λειτουργία της. Τα μιτοχόνδρια χαρακτηρίζονται ως οργανίδια και στους ανώτερους οργανισμούς έχουν προέλευση. Δ. Ερωτήσεις ανάπτυξης Τι ονομάζεται καρυότυπος; Ποια χρωμοσώματα στον άνθρωπο ονομάζονται αυτοσωμικά και ποια φυλετικά ; Πώς καθορίζεται το φύλο στον άνθρωπο ; Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα και για ποιο λόγο; Στους ανώτερους οργανισμούς η προέλευση των μιτοχονδριακών γονιδίων είναι μητρική. Πού οφείλεται αυτό; Σε ένα κυτταρολογικό εργαστήριο ενός νοσοκομείου αξιοποιούνται λεφοκύτταρα (κύτταρα αίματος) για την απεικόνιση του καρυότυπου κάποιου ασθενούς: α. Σε ποια φάση του κυτταρικού κύκλου θα πρέπει να βρίσκονται τα κύτταρα αυτά; Να αιτιολογήσετε την απάντησή σας. β. Ποιες χημικές ουσίες θα χρησιμοποιήθουν κατά την εργαστηριακή μελέτη; Ποιος είναι ο ρόλος τους; γ. Τι πληροφορίες προσφέρει ο καρυότυπος; Στα σωματικά κύτταρα ενός ανθρώπου υπάρχουν σαράντα έξι (46) χρωμοσώματα. α. Πόσα χρωμοσώματα κληρονομεί ένα παιδί από τον πατέρα του ; β. Πόσα αυτοσωμικά χρωμοσώματα υπάρχουν στον καρυότυπο μίας γυναίκας Ε. Ασκήσεις -Ερωτήσεις-Προβλήματα Ο καρυότυπος ενός χιμπαντζή αποτελείται από 24 ζεύγη ομολόγων χρωμοσωμάτων. Να βρείτε : α. Τον αριθμό των μορίων DNA ενός σωματικού κυττάρου του χιμπαντζή στο στάδιο της μετάφασης της μίτωσης. β. Τον αριθμό των μορίων DNA ενός σωματικού κυττάρου του χιμπαντζή στο στάδιο της μεσόφασης. γ. Τον αριθμό των μορίων DNA, σε ένα γαμετικό κύτταρο του χιμπαντζή Ο καρυότυπος ενός είδους βατράχου αποτελείται από 200 χρωμοσώματα. Να βρείτε : α. Τον αριθμό των μορίων DNA ενός σωματικού κυττάρου του βατράχου στο στάδιο της μεσόφασης πριν το διπλασιασμό. β. Τον αριθμό των μορίων DNA ενός σωματικού κυττάρου του βατράχου στο στάδιο της μεσόφασης μετά το διπλασιασμό. γ. Τον αριθμό των μορίων DNA ενός σωματικού κυττάρου του βατράχου στο στάδιο της κυτταρικής διαίρεσης. δ. Τον αριθμό των μορίων DNA, σε ένα γαμετικό κύτταρο του βατράχου Με βάση τα δεδομένα του πίνακα που σας δίνεται παρακάτω να απαντήσετε στις ερωτήσεις που ακολουθούν. Πίνακας Οργανισμός Zea mays 10 Homo sapiens 23 Drosophila melanogaster 4 Αριθμός χρωμοσωμάτων (απλοειδές κύτταρο) α. Πόσα ζεύγη ομολόγων χρωμοσωμάτων αναμένουμε να βρούμε στον καρυότυπο του οργανισμού Zea mays,που προήλθε από ένα σωματικό κύτταρο ; β. Πόσα κεντρομερίδια και πόσες αδελφές χρωματίδες υπάρχουν στα μεταφασικά χρωμοσώματα του οργανισμού Drosophila melanogaster ; γ. Πόσα μόρια DNA υπάρχουν σε ένα ανθρώπινο σωματικό κύτταρο (Homo sapiens) στην μεσόφαση και στην μίτωση αντίστοιχα ; Δίνονται στον παρακάτω πίνακα δεδομένα για Κυρίως Γενετικό υλικό 1 μόριο DNA που υπάρχει (1) μέσα σε σχηματοποιημένο πυρήνα (2) 1 δίκλωνο κυκλικό μόριοdna (3) Ένα μόριο νουκλεικού οξέος που περιέχει 56% C (4) Στον πυρήνα του κυττάρου πάρχουν 15 ζεύγη ομολόγων χρωμοσωμάτων Επιπλέον γενετικό υλικό Γραμμικό μόριο μιτοχονδριακού DNA. Επιπλέον κυκλικά μόρια DNA (πλασμίδια) Δεν υπάρχει Κυκλικά μόρια DNA, στους χλωροπλάστες και στα μιτοχόνδρια 3 κύτταρα και έναν ιό. Με βάση τα δεδομένα του πίνακα να βρείτε ποιο είναι το φυτικό κύτταρο, ποιο κύτταρο είναι προκαρυωτικό και ποιο ανήκει σε κατώτερο πρωτόζωο. Ποιο δεδομένο αφορά τον ιό ; 25

26 Ο παρακάτω πίνακας περιέχει πληροφορίες για το γενετικό υλικό τεσσάρων ιών. Τι είδους γενετικό υλικό περιέχει ο καθένας; ΙΟΣ Α ΙΟΣ Β ΙΟΣ Γ ΙΟΣ Δ Φ.φ.δ Αδενίνες Θυμίνες Κυτοσίνες Γουανίνες Ουρακίλες Επαναληπτικές ασκήσεις- 1 ο κεφάλαιο Σας δίνεται το παρακάτω σχεδιάγραμμα με διάφορα υποθετικά δίκλωνα και γραμμικά μόρια DNA Δίνονται οι παρακάτω καρυότυποι ( Α, Β και Γ ) A. B. α. Ποιοι καρυότυποι δεν αντιστοιχούν σε φυσιολογικά άτομα ; β. Ποιοι καρυότυποι αντιστοιχούν σε φυσιολογικά αρσενικά άτομα ; γ. Ποιοι καρυότυποι αντιστοιχούν σε φυσιολογικά θηλυκά άτομα ; Γ. Σε κάθε ένα από τα τρία μόρια DNA αφού μετρήσετε των αριθμό των βάσεων (νουκλεοτιδίων) και των αντίστοιχων φωσφοδιεστερικών δεσμών που συνδέουν τα νουκλεοτίδια(συμβολίζεται με παύλα ανάμεσα σε δύο βάσεις) να επιλέξετε τη σχέση που συνδέει τον αριθμό των βάσεων και τους φωσφοδιεστερικούς δεσμούς Α. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών Β. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών+1 Γ. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών+2 Δ. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών-1 Ε. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών Σας δίνεται το παρακάτω σχεδιάγραμμα με ένα υποθετικό δίκλωνο και κυκλικό μόριο DNA. Αφού μετρήσετε των αριθμό των βάσεων (νουκλεοτιδίων) και των αντίστοιχων φωσφοδιεστερικών δεσμών που συνδέουν τα νουκλεοτίδια(συμβολίζεται με παύλα ανάμεσα σε δύο βάσεις) να επιλέξετε τη σχέση που συνδέει τον αριθμό των βάσεων και τους φωσφοδιεστερικούς δεσμούς 26

27 Α. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών Β. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών+1 Γ. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών+2 Δ. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών-1 Ε. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών Σας δίνεται το παρακάτω σχεδιάγραμμα με δύο υποθετικά μονόκλωνα ιικά μόρια DNA. Ποια σχέση ισχύει για το μονόκλωνο και κυκλικό μόριο DNA και ποια για το μονόκλωνο και γραμμικό ; Α. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών Β. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών+1 Γ. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών+2 Δ. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών-1 Ε. Αριθμός βάσεων=αριθμός φωσφοδιεστερικών δεσμών Διαθέτουμε τα παρακάτω μόρια DNA. Μόριο DNA-1 που απομονώθηκε από τον πυρήνα ευκαρυωτικού κυττάρου : Αριθμός βάσεων Μόριο DNA-2 που απομονώθηκε από βακτήριο : Αριθμός βάσεων Μόριο DNA-3 που απομονώθηκε από ιό (μονόκλωνο και γραμμικό): Αριθμός βάσεων Μόριο DNA-4 που απομονώθηκε από ιό (μονόκλωνο και κυκλικό): Αριθμός βάσεων Για κάθε μόριο DNA να βρεθεί ο αριθμός των φωσφοδιεστερικών δεσμών Δίνεται το παρακάτω υποθετικό μόριο DNA Αν θεωρήσουμε ότι x είναι ο αριθμός των αδενινών (Α) και y ο αριθμός των γουανινών (G). A. Να βρείτε τη τιμή του x και y Β. Να βρείτε τον συνολικό αριθμό των βάσεων. Ποια σχέση συνδέει το x και y με τον αριθμό των βάσεων Β1. x+y=αριθμός βάσεων Β2. 2x+y= αριθμός βάσεων Β1. 2x+2y=αριθμός βάσεων Β2. 2x+3y= αριθμός βάσεων Γ. Να βρείτε τον συνολικό αριθμό των δεσμών υδρογόνου. Ποια σχέση συνδέει το x και y με τον αριθμό των δεσμών υδρογόνου Γ1. x+y=αριθμός δεσμών υδρογόνου Γ2. 2x+y= αριθμός δεσμών υδρογόνου Γ3. 2x+2y=αριθμός δεσμών υδρογόνου Γ4. 2x+3y= αριθμός δεσμών υδρογόνου Το ποσοστό γουανίνης σε ένα μόριο DNA ειναι 20%.Να βρείτε τα αντίστοιχα ποσοστά για τις υπόλοιπες βάσεις. Λύση: Το ποσοστό της γουανίνης είναι 20%.Ισχυει G=C άρα και το ποσοστό της κυτοσίνης είναι 20%. Το σύνολο Α+Τ=100-40=60%. Όμως Α=Τ,άρα 2Α=60% και Α=30%,αντίστοιχα το ποσοστό της θυμίνης (Τ) θα είναι 30% Το ποσοστό της αδενίνης σε ένα μόριο DNA είναι 20%.Να βρείτε τα αντίστοιχα ποσοστά των υπόλοιπων βάσεων Το ποσοστό της κυτοσίνης σε ένα μόριο DNA είναι 40%.Να βρείτε τα αντίστοιχα ποσοστά των υπόλοιπων βάσεων Το ποσοστό της θυμίνης σε ένα μόριο DNA είναι 15%.Να βρείτε τα αντίστοιχα ποσοστά των υπόλοιπων βάσεων Το ποσοστό της γουανίνης σε ένα μόριο DNA που αποτελεί γενετικό υλικό ενός οργανισμού μπορεί να είναι 52%; Μια αλυσίδα ενός δίκλωνου μορίου DNA περιέχει 10% αδενίνη,20% κυτοσίνη. Εάν η συμπληρωματική της αλυσίδα περιέχει 50% κυτοσίνη,να υπολογίσετε τα ποσοστά των βάσεων σε κάθε αλυσίδα ξεχωριστά. Λύση: Το ποσοστό της αδενίνης στην αλυσίδα που μας δίνει το πρόβλημα είναι 10%,αντίστοιχα η συμπληρωματική της αλυσίδα θα έχει 10% θυμίνη.το 27

28 ποσοστό της κυτοσίνης στην αλυσίδα που μας δίνει το πρόβλημα είναι 20%,αντίστοιχα η συμπληρωματική της αλυσίδα θα έχει 20% γουανίνη.το ποσοστό της γουανίνης στην αλυσίδα που μας δίνει το πρόβλημα είναι 50% όσο της κυτοσίνης της συμπληρωματικής της. Άρα στην αλυσίδα που μας δίνει το πρόβλημα έχουμε: 10% (Α)+20%(C)+50%(G)+x%(T)=100%. x=20% Αντίστοιχα στην συμπληρωματική της θα έχουμε: 10%(Τ)+20%(G)+50%(C)+20%(A)=100% Το ποσοστό της αδενίνης σε μια αλυσίδα ενός μορίου DNA είναι 20% και ίσο με το ποσοστό της θυμίνης στην ίδια αλυσίδα. Η συμπληρωματική της αντίστοιχα περιέχει 30% γουανίνη. Να υπολογίσετε τα ποσοστά των βάσεων στις 2 αλυσίδες του DNA Σε μια αλυσίδα μορίου DNA ισχύει T C G A Να βρείτε τα ποσοστά των βάσεων και στις 2 αλυσίδες του παρακάτω μορίου Σε μια αλυσίδα ενός μορίου DNA το ποσοστό της αδενίνης είναι 20%,ενώ το ποσοστό της γουανίνης είναι ίδιο με αυτό της κυτοσίνης.αντίστοιχα το ποσοστό της αδενίνης στην συμπληρωματική της είναι 10%.Εαν κάθε αλυσίδα αποτελείται από 100 νουκλεοτίδια, να υπολογίσετε : A T A C A G G C, G T, C T Α) Για κάθε αλυσίδα ξεχωριστά Β) Συνολικά για το μόριο του DNA Σε ένα μόριο DNA οι δεσμοί υδρογόνου είναι Αντίστοιχα ο αριθμός των βάσεων είναι Να βρείτε τον αριθμό της κάθε βάσης στο μόριο του DNA. Λύση: Έστω x ο αριθμός των αδενινών (Α). Σε ένα μόριο DNA γνωρίζουμε ότι Α=Τ άρα και ο αριθμός των θυμινών θα είναι x. Ομοίως θέτοντας y για τον αριθμό των γουανινών έχουμε G=C=y. Άρα Α+Τ+G+C=x+x+y+y=2x+2y 2x+2y= :Σχεση 1. Εξάλλου μια αδενίνη (Α) σχηματίζει 2 δεσμούς υδρογόνου με μια θυμίνη(τ).άρα οι x αδενίνες(α) σχηματίζουν 2x δεσμούς υδρογόνου με x θυμίνες (Τ).Ομοίως οι y γουανίνες (G) σχηματίζουν με y κυτοσίνες (C) 3y δεσμούς υδρογόνου.αρα: 2x+3y= : Σχεση 2. Λύνοντας το σύστημα των 2 εξισώσεων : Αφαιρώντας από την 2 την 1 y=50000 και αντίστοιχα x=50000 ΔΕΥΤΕΡΟΣ ΤΡΟΠΟΣ Έστω x τα ζεύγη Α-Τ και y τα ζεύγη C-G.Οι σχηματίζουν /2= ζεύγη βάσεων,άρα (1)x+y= Ακόμη ένα ζεύγος βάσεων Α-Τ περιέχει 2 δεσμούς υδρογόνου.άρα τα x ζεύγη βάσεων περιέχει 2x δεσμούς υδρογόνου. Ομοίως τα y ζεύγη βάσεων C-G περιέχουν 3y δεσμούς υδρογόνου άρα (2). 2x+3y= Λυνοντας το συστημα των 2 εξισωσεων: (3).=(2).-2 (1). (3).y=50000 και x= Ένα μόριο DNA έχει ζεύγη βάσεων και δεσμούς υδρογόνου.να βρείτε τον αριθμό των Α,Τ,G,C Ένα μόριο DNA στον πυρήνα ενός ευκαρυωτικού κυττάρου περιέχει στο μόριο του δεσμούς υδρογόνου και φωσφοδιεστερικούς δεσμούς. Να βρείτε τον αριθμό των Α,Τ,G,C. (Υπόδειξη:Άσκηση παρόμοια με το παράδειγμα 3.Η μόνη διαφορά είναι ότι τον αριθμό των νουκλεοτιδίων μας τον δινει έμμεσα. Γνωρίζουμε ότι το μόριο DNA στον πυρήνα των ευκαρυωτικών κυττάρων είναι γραμμικό μόριο άρα αριθμός φωσφοδιεστερικών δεσμών+2=αριθμός νουκλεοτιδίων.) Ενα μιτοχονδριακό μόριο DNA σε ένα ευκαρυωτικό κύτταρο ενός θυλαστικού περιέχει στο μόριο του δεσμούς υδρογόνου και φωσφοδιεστερικούς δεσμούς. Να βρείτε τον αριθμό των Α,Τ,G,C. (Υπόδειξη: Άσκηση παρόμοια με την προηγούμενη με την μόνη διαφορά ότι το μιτοχονδριακό DNA είναι κυκλικό,άρα αριθμός φωσφοδιεστερικών δεσμών=αριθμό των νουκλεοτιδίων) Ένα τμήμα DNA αποτελείται από 1000 νουκλεοσώματα. Θεωρώντας ότι ανάμεσα στα νουκλεοσώματα δεν υπάρχουν άλλες βάσεις και με δεδομένο ότι το τμήμα αυτό περιέχει δεσμούς υδρογόνου, να βρείτε τον αριθμό των Α,Τ,G,C.(Υπόδειξη:Μας δίνει τον αριθμό των νουκλεοτιδίων έμμεσα, αφού αριθμός των νουκλεοτιδίων=αριθμός νουκλεοσωμάτων 292. Όπου 292 ο αριθμός των βάσεων ανά νουκλεόσωμα σύμφωνα με την θεωρία.) Σε ένα βακτηριακό κύτταρο το DNA του περιέχει ζεύγη βάσεων.εάν ο αριθμός των ζευγών G-C είναι διπλάσιος από τον αριθμό των ζευγών A-T,να υπολογίσετε τον αριθμό των δεσμών υδρογόνου καθώς και των φωσφοδιεστερικών δεσμών. 28

29 Σε ένα τμήμα ενός μορίου DNA που περιέχει 3 αδενίνες (Α),αποδείχθηκε ότι δεσμοί υδρογόνου=φωσφοδιεστερικοί δεσμοί+6. Να υπολογίσετε τον αριθμό των υπόλοιπων βάσεων του τμήματος αυτού καθώς και των αριθμό των αντίστοιχων δεσμών υδρογόνου και φωσφοδιεστερικών δεσμών Εάν σε ένα δίκλωνο μόριο DNA περιέχονται βάσεις αδενίνης, οι οποίεςαντιπροσωπεύουν το 15% του συνολικού ποσοστού των βάσεων. Να βρεθούν: α. το ποσοστό των υπολοίπων βάσεων β. ο αριθμός κάθε βάσης καθώς και το σύνολο των βάσεων γ. οι φ.φ.δ καθώς και οι δεσμοί υδρογόνου δ. το πλήθος των μορίων νερού που χρειάζεται για να υδρολυθεί το δίκλωνο μόριο DNA ε. ο αριθμός των ατόμων P Δίδονται τα παρακάτω δεδομένα που αφορούν τα νουκλεϊκά οξέα διαφόρων οργανισμών. Να εξηγήσετε από ποιον οργανισμό πιθανόν να προέρχονται. Oργανισμός 1:Α: , Τ : , C: , G: Οργανισμός 2 :Α: , Τ : , C: , G: Οργανισμός 3:Α: , U: , C: , G: Οργανισμός 4 :Α: , U: , C: , G: Οργανισμός 5:Α: , Τ : , U: , G: Δίκλωνο μόριο DNA περιέχει δεσμούς υδρογόνου κι το 20% του συνολικού αριθμού των βάσεων του είναι αδενίνη. Να βρεθούν: α. τα ποσοστά των υπολοίπων βάσεων β. ο συνολικός αριθμός των νουκλεοτιδίων καθώς και ο αριθμός που αναλογεί σε κάθε αζωτούχα βάση Ένα μόριο DNA έχει 3Α και 14 φωσφοδιεστερικούς δεσμούς. α.πόσες Τ, C, G και πόσους δεσμούς υδρογόνου περιέχει; β. Ένα πλασμίδιο έχει Τ και μήκος ζ. β. Πόσους φ.φ.δ και πόσους δεσμούς υδρογόνου περιέχει; Για την πλήρη υδρόλυση ενός μορίου DNA από ανθρώπινο μιτο-χόνδριο χρειάστηκαν μόρια νερού. Αν το μόριο περιέχει C, να υπολογίσετε το μήκος του μορίου και τους δεσμούς υδρογόνου που περιέχει Το γενετικό υλικό ενός οργανισμού περιέχει Α 20%, T 30%, C 30%, G 20%. Αν για την πλήρη υδρόλυση του απαιτούνται μόρια νερού, να υπολογιστεί το μήκος του μορίου και να εξηγηθεί το είδος του οργανισμού Απομονώθηκαν 5 νουκλεοσώματα από ένα ινίδιο χρωματίνης και μετά από ανάλυση βρέθηκε ότι ισχύει A/G =1/ 4, να υπολογίσετε τον αριθμό της κυτοσίνης Σε ένα ινίδιο χρωματίνης έχουμε 88 ιστόνες και δεσμούς υδρογόνου. Ποιος είναι ο αριθμός καθεμιάς από τις 4 βάσεις; (η απόσταση μεταξύ δυο διαδοχικών νουκλεοσωμάτων είναι 54 ζ.) Ο λόγος A +T/C +G σε ένα δίκλωνο μόριο DNA είναι 0,75. Το σύνολο των δεσμών υδρογόνου του μορίου είναι Να βρεθεί ο αριθμός των νουκλεοτιδίων που έχουν για αζωτούχο βάση την Α και αυτός που αντιστοιχεί στα νουκλεοτίδια που έχουν για αζωτούχο βάση την G Μεσοφασικό ανθρώπινο χρωμόσωμα έχει ζεύγη βάσεων. Αν το κομμάτι του DNA που συνδέει δυο νουκλεοσώματα έχει μήκος 54 ζεύγη βάσεων, να βρεις περίπου τον αριθμό των μορίων ιστονών που θα υπάρχουν στο στάδιο της μετάφασης αυτού του χρωμοσώματος. (Να θεωρήσεις ότι στα άκρα του χρωμοσώματος βρίσκονται νουκλεοσώματα. ) Μιτοχονδριακό DNA του ανθρώπου βρέθηκε να έχει ζεύγη βάσεων. Αν ισχύει ο λόγος A/C =1/ 3, να βρεις: α. τον ακριβή αριθμό των αζωτούχων βάσεων του μορίου και β. τα μόρια του νερού που αποσπάστηκαν για την δημιουργία του μορίου Στο DNA ενός νουκλεοσώματος βρέθηκε ότι η διαφορά των βάσεων αδενίνης και κυτοσίνης είναι 80. Να βρεθούν τα ποσοστά των βάσεων στο τμήμα αυτό του DNA Σε ένα δίκλωνο μόριο DNA το ποσοστό της Α είναι 25%, αν ο λόγος A 1 / A 2 =1,5 και C 1 /C 2 =4, να βρεθούν τα ποσοστά: α. A, T, C, G στο συνολικό μόριο και β. Α 1, Τ 1, C 1, G 1, Α 2, Τ 2, C 2, G 2 σε κάθε ένα κλώνο του μορίου Σε δύο κύτταρα έγινε ανάλυση του γενετικού τους υλικού και βρέθηκε η παρακάτω επί τοις % σύσταση σε αζωτούχες βάσεις. 29

30 Α Τ C G β. Ποιος οργανισμός είναι εξελικτικά ανώτερος (χρησιμοποιώντας ως κριτήριο την ποσότητα γενετικού υλικού) ; α. Τα κύτταρα 1, 2 ανήκουν στο ίδιο ή σε διαφορετικά είδη οργανισμών; Να αιτιολογήσετε την απάντησή σας. β.από το φυτό Zea mays (καλαμπόκι) απομονώθηκαν τρία διαφορετικά φυσιολογικά κύτταρα στα οποία προσδιορίστηκε το μέγεθος του γονιδιώματος σε ζεύγη βάσεων. Στο πρώτο κύτταρο το μέγεθος του γονιδιώματος υπολογίστηκε σε 20 x10 9 ζεύγη βάσεων, στο δεύτερο κύτταρο σε 5x10 9 ζεύγη βάσεων και στο τρίτο κύτταρο σε 10x10 9 ζεύγη βάσεων. Να εξηγήσετε γιατί υπάρχουν οι διαφορές αυτές στο μέγεθος του γονιδιώματος των τριών κυττάρων Ένα κύτταρο του οργανισμού Α έχει 22 μεταφασικά χρωμοσώματα. α. Πόσα μόρια DNA έχει στον πυρήνα του το κύτταρο στο στάδιο της μετάφασης της μίτωσης β. Πόσα μόρια DNA έχει στον πυρήνα του στο στάδιο της μεσόφασης γ. Πόσα μόρια DNA περιέχει ο πυρήνας των γαμετικών κύτταρων του οργανισμού Α ; δ. Το μέγεθος του γονιδιώματος του συγκεκριμένου 8 κυττάρου του οργανισμού Α είναι 5 10 ζεύγη 8 βάσεων. Ένας άλλος οργανισμός ο Β έχει 2 10 ζεύγη βάσεων στους γαμέτες του. Ποιος οργανισμός είναι πιο πολύπλοκος με βάση την ποσότητα DNA στα κύτταρα τους ; Δίνονται τα παρακάτω βιοχημικά δεδομένα 3 υποθετικών κυττάρων Α, Β και Γ Α% Τ% G% C% Κύτταρο Α Κύτταρο Β Κύτταρο Γ α. Τα κύτταρα ανήκουν στο ίδιο είδος ή σε διαφορετικά είδη οργανισμών ; Ένας εξελικτικός βιολόγος ερευνά την εξελικτική σχέση μεταξύ 2 σπονδυλοζώων Α και Β. Για το σκοπό αυτό ζητά την συνδρομή ενός βιοχημικού, δίνοντας του δείγμα των ιστών αυτών των ζώων. Η ποσότητα DNA του πυρήνα ενός σωματικού κυττάρου του Α στο στάδιο της μεσόφασης πριν το διπλασιασμό είναι Η ποσότητα DNA ενός μεταφασικού κυττάρου του Β είναι α. Ποια είναι η ποσότητα DNA στους γαμέτες των οργανισμών Α και Β ; 30

31 2 ο Κεφάλαιο-Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας 2.1 Αντιγραφή του DNA Σας δίνονται 2 διαφορετικοί τρόποι αντιγραφής ενός μορίου DNA. Γνωρίζοντας εσείς ότι κατά την αντιγραφή ενός μορίου DNA «ανοίγουν» οι δύο μητρικές αλυσίδες και η καθεμία από αυτές χρησιμοποιείται ως καλούπι για το σχηματισμό μίας νέας, ποιος από τους δύο τρόπους είναι ο σωστός ; Στο παρακάτω σχήμα σας δίνεται η αντιγραφή ( 2 διπλασιασμοί ) ενός μορίου DNA σε περιβάλλον με ραδιενεργά νουκλεοτίδια. β. Το ένα από τα δύο έχει μη ραδιενεργά νουκλεοτίδια και στις δύο αλυσίδες του,ενώ το δεύτερο έχει ραδιενεργά νουκλεοτίδια και στις δύο αλυσίδες του. γ. Και τα δύο έχουν αλυσίδες που έχουν και ραδιενεργά και μη ραδιενεργά νουκλεοτίδια δ. Και τα δύο έχουν μία αλυσίδα που αποτελείται αποκλειστικά από μη ραδιενεργά νουκλεοτίδια και μία αλυσίδα που αποτελείται αποκλειστικά από ραδιενεργά νουκλεοτίδια. Δ. Πόσα μόρια DNA σχηματίστηκαν κατά το δεύτερο διπλασιασμό ; α. Δύο β. Τέσσερα γ. Οκτώ Ε. Πόσες συνολικά αλυσίδες DNA υπάρχουν κατά το δεύτερο διπλασιασμό ; α. 2 β. 4 γ. 8 ΣΤ. Να χαρακτηρίσετε τις παρακάτω φράσεις ως σωστές ή λάθος α.«μετά το δεύτερο διπλασιασμό δεν υπάρχει αλυσίδα DNA με μη ραδιενεργά νουκλεοτίδια» β. «Μετά το δεύτερο διπλασιασμό υπάρχει αλυσίδα που έχει και ραδιενεργά και μη ραδιενεργά νουκλεοτίδια» Ζ. Να επιλέξετε τη σωστή λέξη της παρένθεσης Κατά το δεύτερο διπλασιασμό υπάρχουν ( δυο/έξι) αλυσίδες με μη ραδιενεργά νουκλεοτίδια και ( δύο/έξι) αλυσίδες με ραδιενεργά νουκλεοτίδια Σας δίνεται η αντιγραφή ενός μορίου DNA αρχικά σε περιβάλλον με ραδιενεργά νουκλεοτίδια και στη συνέχεια σε περιβάλλον με μη ραδιενεργά νουκλεοτίδια. Α. Πόσα μόρια DNA υπάρχουν κατά τον 1 ο διπλασιασμό ; α. 2 μόρια β. 4 μόρια Β. Είναι σωστό να ισχυριστούμε ότι υπάρχει μόριο DNA χωρίς ραδιενεργά νουκλεοτίδια ; Γ. Κατά τον 1 ο διπλασιασμό σχηματίστηκαν μόρια DNA όπου α. Και τα δύο έχουν αμιγώς ραδιενεργά νουκλεοτίδια στις αλυσίδες τους. Α. Να συμπληρωθεί ο παρακάτω πίνακας 1 ος διπλασιασμός 2 ος διπλασιασμός Αριθμός μορίων DNA Αριθμός ραδιενεργών Αλυσίδων Αριθμός μη Ραδιενεργών αλυσίδων 31

32 Β. 1 ος διπλασιασμός 2 ος διπλασιασμός Αριθμός μορίων DNA αποκλειστικά με μη ραδιενεργές αλυσίδες Αριθμός μορίων DNA αποκλειστικά με ραδιενεργές αλυσίδες Αριθμός μορίων DNA με μία ραδιενεργός και μία μη ραδιενεργός αλυσίδα Δ. Γνωρίζοντας ότι θηλιά της αντιγραφής αναπτύσσεται συμμετρικά και προς τις 2 κατευθύνσεις ποιο από τα παρακάτω σχήματα είναι σωστά Η DNA ελικάση είναι το ένζυμο που αναγνωρίζει ειδικές θέσεις πάνω σε ένα μόριο DNA και διασπά τους δεσμούς υδρογόνου σχηματίζοντας τις θηλιές της αντιγραφής. Με δεδομένο ότι σε ένα DNA που προέρχεται από προκαρυωτικό κύτταρο υπάρχει μόνο μία θέση έναρξης της αντιγραφής,ενώ σε ένα μόριο DNA που προέρχεται από ευκαρυωτικό κύτταρο πολλές θέσεις έναρξης της αντιγραφής, να απαντήσετε τις ερωτήσεις που ακολουθούν. Α. Με τη βοήθεια της εικόνας να συμπληρώσετε τα κενά Η RNA-πολυμεράση ξεκινά την αντιγραφή συνθέτοντας μικρά τμήμα-τα RNA στις θέσεις έναρξης της αντιγραφής που ονομάζονται πρωταρχικά τμήματα. Η RNA-πολυμεράση συνθέτει μόνο προς μία ορισμένη κατεύθυνση.προσθέτει τα νουκλεοτίδια με φωσφοδιεστερικό δεσμό 3-5 δηλαδή προσθέτει νουκλεοτίδια στο ελεύθερο υδροξύλιο στο 3 άκρο της αλυσίδας που αναπτύσσεται.έτσι πάντα το 1 ο νουκλεοτίδιο που τοποθετεί έχει ελεύθερο το 5 άκρο ενώ το τελευταίο το 3 άκρο (κατεύθυνση 5 3 ) Ποιο σχήμα αποτυπώνει σωστά τη δράση της RNAπολυμεράσης ; Το μόριο DNA- προέρχεται από προκαρυωτικό κύτταρο,ενώ το μόριο DNA- από ευκαρυωτικό κύτταρο. Β. Ποιο μόριο DNA αντιγράφεται με μεγαλύτερη ταχύτητα ; α. Μόριο DNA-1 β. Μόριο DNA-2 Γ. Είναι σωστός ο ισχυρισμός ότι ένα ευκαρυωτικό κύτταρο απαιτεί λιγότερο χρόνο για να αντιγράψει το DNA του,από ένα βακτηριακό κύτταρο. 32

33 2.1.6.Η DNA-πολυμεράση επιμηκύνει τα πρωταρχικά τμήματα προσθέτοντας δεοξυριβονουκλεοτίδια στο ελεύθερο υδροξύλιο στο 3 άκρο της αλυσίδας που αναπτύσσεται.ποιο σχήμα αποτυπώνει σωστά τη δράση της DNA-πολυμεράσης ; Ε. Σε ποια κατεύθυνση συνθέτει στην αλυσίδα που αντιγράφεται συνεχώς η DNA-πολυμεράση ; α. 5-3 β. 3-5 ΣΤ. Τα πρωταρχικά τμήματα αποτελούνται από α. DNA β.rna Ζ. Τα ασυνεχή τμήματα επιμηκύνονται προσθέτοντας η DNA-πολυμεράση νουκλεοτίδια στο ελεύθερο : α. 5 άκρο β. 3 άκρο Η. Ποιο ένζυμο «ανοίγει» τις δύο αλυσίδες του μητρικού DNA ; α. DNA-δεσμάση β. DNA-ελικάση γ. DNA-πολυμεράση δ. Πριμόσωμα Θ. Ποιο ένζυμο συνθέτει τα πρωταρχικά τμήματα ; α. DNA-δεσμάση β. DNA-ελικάση γ. DNA-πολυμεράση δ. Πριμόσωμα Ι. Ποιο ένζυμο αντικαθιστά τα πρωταρχικά τμήματα με DNA ; α. DNA-δεσμάση β. DNA-ελικάση γ. DNA-πολυμεράση δ. Πριμόσωμα Εφαρμογή. Να βρείτε στο παρακάτω μόριο DNA ποια αλυσίδα αντιγράφεται συνεχώς και ποια ασυνεχώς ; Σας δίνονται οι 2 αλυσίδες ενός μορίου DNA που πρόκειται να αντιγραφούν Εφαρμογή. Σας δίνονται σε δυο μόρια DNA, με τον κατάλληλο συμβολισμό,που η αντιγραφή πραγματοποιείται συνεχώς και που ασυνεχώς. Να βρείτε τα άκρα των δύο μητρικών αλυσίδων. Α. Απέναντι από το 3 άκρο της μίας αλυσίδας βρίσκεται το 5 άκρο της άλλης, αυτό οφείλεται στο γεγονός α. Οι δύο αλυσίδες είναι συμπληρωματικές β. Οι δύο αλυσίδες είναι αντιπαράλληλες Β. Είναι δυνατόν το 1 ο νουκλεοτίδιο που τοποθετεί το πριμόσωμα (RNA-πολυμεράση) να έχει ελεύθερο το 3 άκρο ; α. Ναι β. Όχι Γ. Ποια από τις δύο αλυσίδες αντιγράφεται συνεχώς ; α. Αλυσίδα-Ι β. Αλυσίδα-ΙΙ Δ. Ποια από τις δυο αλυσίδες αντιγράφεται ασυνεχώς; α. Αλυσίδα-Ι β. Αλυσίδα-ΙΙ 33

34 Εφαρμογή. Αφού συμπληρώσετε τα άκρα των μητρικών αλυσίδων που λείπουν,στη συνέχεια χρησιμοποιώντας τους συμβολισμούς της εφαρμογής 2.1.9, να δείξετε που πραγματοποιείται η αντιγραφή συνεχώς και που ασυνεχώς. Δ. Να σημειώσετε τα άκρα των ασυνεχών τμημάτων στην αλυσίδα που αντιγράφεται ασυνεχώς Παράδειγμα. Σας δίνεται η θηλιά της αντιγραφής. Α. Να βρείτε σε ποιο τμήμα η αντιγραφή πραγματοποιείται συνεχώς και σε ποιο ασυνεχώς. Απάντηση : Άσκηση. Σας δίνεται ένα τμήμα DNA που πρόκειται να αντιγραφεί, αν στην αλυσίδα που αντιγράφεται συνεχώς το πρωταρχικό τμήμα αποτελείται από 5 νουκλεοτίδια, να γραφεί η αλληλουχία του πρωταρχικού τμήματος Άσκηση. Σας δίνεται το παρακάτω τμήμα DNA, όπου στη μία αλυσίδα η αντιγραφή πραγματοποιείται συνεχώς και στην άλλη ασυνεχώς,όπως φαίνεται στο σχήμα Α. Ποια αλυσίδα ( Ι ή ΙΙ) αντιγράφεται συνεχώς και ποια ασυνεχώς; Β. Να σημειώσετε τα άκρα στις αλυσίδες Ι και ΙΙ Γ. Να σημειώσετε τα άκρα του πρωταρχικού τμήματος στην αλυσίδα που αντιγράφεται συνεχώς. Β. Να σχεδιάσετε χρησιμοποιώντας τον κατάλληλο συμβολισμό, τον προσανατολισμό των νέων 34

35 αλυσίδων, των ασυνεχών τμημάτων και την κατεύθυνση που «ανοίγει» η θηλιά Απάντηση Εφαρμογή. Α. Να βρείτε σε ποιο τμήμα η αντιγραφή πραγματοποιείται συνεχώς και σε ποιο ασυνεχώς Β. Να σχεδιάσετε χρησιμοποιώντας τον κατάλληλο συμβολισμό, τον προσανατολισμό των νέων αλυσίδων, των ασυνεχών τμημάτων και την κατεύθυνση που «ανοίγει» η θηλιά Εφαρμογή. Σας δίνεται στην παρακάτω θηλιά της αντιγραφής ότι το τμήμα-γ αντιγράφεται συνεχώς. Α. Να τοποθετήσετε τα άκρα στης αλυσίδες του μητρικού μορίου DNA. Β. Να βρείτε σε ποιο τμήμα η αντιγραφή πραγματοποιείται συνεχώς και σε ποιο ασυνεχώς Γ. Να σχεδιάσετε χρησιμοποιώντας τον κατάλληλο συμβολισμό, τον προσανατολισμό των νέων αλυσίδων, των ασυνεχών τμημάτων και την κατεύθυνση που «ανοίγει» η θηλιά Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές ή λάθος. α. «Επειδή πάντα απέναντι από την αδενίνη τοποθετείται η θυμίνη και αντίστροφα, ομοίως επειδή πάντα απέναντι από τη γουνανίνη τοποθετείται η κυτοσίνη και αντίστροφα δεν γίνονται λάθη κατά την αντιγραφή.» β. «Πραγματοποιούνται λάθη κατά την αντιγραφή αλλά επειδή η συχνότητα τους είναι 1/10 10 δεν είναι αναγκαία η επιδιόρθωση τους.» γ. «Πραγματοποιούνται λάθη κατά την αντιγραφή με συχνότητα 1/10 5 που επιδιορθώνονται απόλυτα από την DNA-πολυμεράση και τα επιδιορθωτικά ένζυμα.» δ. «Πραγματοποιούνται λάθη κατά την αντιγραφή με συχνότητα 1/10 5 που επιδιορθώνονται από την DNA-πολυμεράση και τα επιδιορθωτικά ένζυμα σε μεγάλο βαθμό. Παρόλα αυτά τοποθετείται ένα λάθος νουκλεοτίδιο στα δέκα δισεκατομμύρια ( 1/10 10 )» ε. «Αν πραγματοποιούνταν λάθη με συχνότητα 1/10 5,η γενετική πληροφορία θα χανόταν, αν όμως δεν πραγματοποιούνταν λάθη με συχνότητα 1/10 10 δεν θα είχαμε την εξέλιξη του DNA και κατά συνέπεια των οργανισμών» ΕΡΩΤΗΣΕΙΣ A. Ερωτήσεις πολλαπλής επιλογής Να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση Ποιο από τα παρακάτω ένζυμα διασπά τους δεσμούς υδρογόνου ανάμεσα στις δύο αλυσίδες : α. DNA-ελικάση β. DNA-πολυμεράσες γ. DNA-δεσμάση δ. πριμόσωμα Ποιο από τα παρακάτω ένζυμα είναι υπεύθυνο για την σύνθεση των πρωταρχικών τμημάτων α. DNA-ελικάση β. DNA-πολυμεράσες γ. DNA-δεσμάση δ. πριμόσωμα Ποιο από τα παρακάτω ένζυμα συμμετέχει στην σύνθεση των νέων αλυσίδων DNA : α. DNA-ελικάση β. DNA-πολυμεράσες γ. DNA-δεσμάση δ. πριμόσωμα Ποιο από τα παρακάτω ένζυμα συνδέει μεταξύ τους τα ασυνεχή τμήματα α. DNA-ελικάση β. DNA-πολυμεράσες γ. DNA-δεσμάση δ. πριμόσωμα. 35

36 Ποιο από τα παρακάτω ένζυμα διορθώνει τυχόν λάθη κατά την αντιγραφή του DNA : α. DNA-ελικάση β. DNA-πολυμεράσες γ. DNA-δεσμάση δ. πριμόσωμα Τα ένζυμα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι α. DNA ελικάσες και DNA δεσμάση. β. RNA πολυμεράσες και πριμόσωμα. γ. DNA δεσμάση και επιδιορθωτικά ένζυμα. δ. DNA πολυμεράσες και επιδιορθωτικά ένζυμα Οι DNA πολυμεράσες που συμμετέχουν στην αντιγραφή του DNA μπορούν να ξεκινήσουν τη διαδικασία της αντιγραφής, αν βοηθηθούν από α. τα ένζυμα που διορθώνουν τα λάθη της αντιγραφής. β. το πριμόσωμα. γ. τη DNA δεσμάση. δ. το κωδικόνιο Η DNA δεσμάση α. επιδιορθώνει λάθη της αντιγραφής. β. συνδέει το αμινοξύ με το trna. γ. συνδέει τμήματα DNA. δ. μεταγράφει την πολυνουκλεοτιδική αλυσίδα Η αντιγραφή του DNA αρχίζει με τη βοήθεια ενζύμων που ονομάζονται α. DNA πολυμεράσες. β. DNA ελικάσες. γ. DNA δεσμάσες. δ. RNA πολυμεράσες Ποια από τις παρακάτω προτάσεις δεν ισχύει για την DNA πολυμεράση; α. επιδιορθώνει λάθη κατά την αντιγραφή του DNA β. αποτελείται από αμινοξέα γ. καταλύει το σχηματισμό 3-5 φωσφοδιεστερικών δεσμών δ. αποτελείται από δεοξυριβονουκλεοτίδια Κατά την επιμήκυνση μιας αλυσίδας DNA ή RNA η αλληλουχία των νουκλεοτιδίων καθορίζεται: α. από την DNA ή RNA πολυμεράση β. από τη συμπληρωματικότητα των βάσεων της αλυσίδας καλούπι γ. το πριμόσωμα δ. τη DNA δεσμάση Τα μόρια με τα οποία μεταφέρονται οι γενετικές πληροφορίες από κύτταρο σε κύτταρο, σε έναν οργανισμό είναι: α. πρωτεΐνες β. DNA γ. RNA δ. τίποτε από τα πιο πάνω Το ένζυμο που δεν καταλύει την δημιουργία φωσφοδιεστερικού δεσμού είναι : α. DNA δεσμάση β. DNA ελικάση γ. πριμόσωμα δ. DNA πολυμεράση Η αντιγραφή του DNA λέμε ότι πραγματοποιείται με τον ημισυντηρητικό μηχανισμό γιατί.: α. Ένα από τα θυγατρικά(νέα) μόρια έχει και τις δύο παλιές αλυσίδες. β. Ένα από τα θυγατρικά(νέα) μόρια έχει δύο νέες αλυσίδες γ. Οποιοδήποτε θυγατρικό (μόριο) που προκύπτει έχει μία νέα και μία παλαιά αλυσίδα. δ. Η DNA-πολυμεράση χρησιμοποιεί ως καλούπι τις παλαιές αλυσίδες Το άνοιγμα των δύο αλυσίδων κατά το διπλασιασμό του DNA,απαιτεί..: α. Το σπάσιμο των φωσφοδιεστερικών δεσμών. β. Την ταυτόχρονη υδρόλυση και σύνθεση φωσφοδιεστερικών δεσμών γ. Το σπάσιμο δεσμών υδρογόνου δ. Όλα τα παραπάνω Στα προκαρυωτικά κύτταρα : α. Η αντιγραφή πραγματοποιείται ταυτόχρονα προς δύο αντίθετες κατευθύνσεις,στο κυκλικό μόριο DNA. β. Απαιτείται μεγάλος αριθμός θηλιών αντιγραφής. γ. Οι θηλιές της αντιγραφής που δημιουργούνται επεκτείνονται και συναντιούνται. δ. β και γ Ο λόγος που η μία αλυσίδα του DNA αντιγράφεται συνεχώς, ενώ η άλλη ασυνεχώς είναι α. Η θέσεις έναρξης της αντιγραφής βρίσκονται πάντα στα άκρα των αλυσίδων. β. Η ελικάσες πάντα αναγνωρίζουν το 5 άκρο μίας αλυσίδας γ. Οι DNA-πολυμεράση προσθέτει πάντα νουκλεοτίδια στο 3 άκρο δ. Η DNA-δεσμάση δρά πάντα στην κατεύθυνση Η επιμήκυνση της νέας αλυσίδας που συντίθεται συνεχώς.: α. πραγματοποιείται μακριά από τη θηλιά της αντιγραφής. β. πραγματοποιείται σε τμήματα γ. πραγματοποιείται στην κατεύθυνση 3 5. δ. δεν απαιτείται για την πραγματοποίησή της η αλυσίδα-καλούπι Ένας βιοχημικός πραγματοποίησε τεχνητά σε δοκιμαστικό σωλήνα την αντιγραφή ενός μορίου 36

37 DNA. Όταν πραγματοποιήθηκε η αντιγραφή, σε ένα θυγατρικό μόριο η μία αλυσίδα του δεν ήταν ενιαία αλλά αποτελούταν από πολλά ασυνεχή τμήματα. Τι ξέχασε να εισάγει στο δοκιμαστικό σωλήνα που πραγματοποιούταν η αντιγραφή ; α.dna-πολυμεράση β.dna-δεσμάση γ. Πρωταρχικά τμήματα δ. Νουκλεοτίδια Ένα βακτήριο Ε.coli όπου και οι δύο αλυσίδες DNA του μορίου του αποτελούνται από 15 Ν μεταφέρεται σε περιβάλλον με 14 Ν, όπου πραγματοποιούνται 2 διπλασιασμοί του DNA. Μετά την πραγματοποίηση ειδικής ανάλυσης όλων των μορίων DNA που προέκυψαν βρέθηκε.. : α. Όλα τα μόρια DNA διαθέτουν μία αλυσίδα με 14 Ν και μία αλυσίδα με 15 Ν β. Τα μισά μόρια DNA διαθέτουν μία αλυσίδα με 14 Ν και μία αλυσίδα με 15 Ν, ενώ τα άλλα μισά διαθέτουν αποκλειστικά αλυσίδες με 15 Ν γ. Τα μισά μόρια DNA διαθέτουν μία αλυσίδα με 14 Ν και μία αλυσίδα με 15 Ν, ενώ τα άλλα μισά διαθέτουν αποκλειστικά αλυσίδες με 14 Ν δ. Όλα τα μόρια DNA διαθέτουν αλυσίδες με 14 Ν. Β. Ερωτήσεις τύπου σωστό-λάθος Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) ή λανθασμένες (Λ) Τα δύο θυγατρικά μόρια που προκύπτουν από την αντιγραφή του μητρικού μορίου, έχουν το ένα (από τα δύο) τις δύο αλυσίδες του μητρικού και το δεύτερο θυγατρικό μόριο δύο νέες αλυσίδες Η μεταφορά ενός μορίου DNA σε περιβάλλον με ραδιενεργό 35 S και η αντιγραφή του σε αυτό,μεταβάλλει την αναλογία ραδιενεργών και μη ραδιενεργών κλώνων στα θυγατρικά μόρια Τα ένζυμα που συμμετέχουν στην αντιγραφή του DNA,πραγματοποιούν τις χημικές αντιδράσεις με μικρή ταχύτητα, ώστε να εξασφαλίζεται η ακρίβεια στην αντιγραφή του DNA Ο μηχανισμός της αντιγραφής του DNA, μελετήθηκε στα προκαρυωτικά κύτταρα γιατί το μόριο DNA είναι μικρότερο σε μέγεθος και απλούστερα οργανωμένο από το αντίστοιχο των ευκαρυωτικών Στα βακτηριακά κύτταρα το DNA έχει μόνο μία θέση έναρξης της αντιγραφής, ενώ στα ευκαρυωτικά κύτταρα πολλές Η DNA ελικάση στο DNA ενός ευκαρυωτικού κυττάρου αναγνωρίζει μια συγκεκριμένη θέση πάνω στο μόριο του DNA Η αντιγραφή στα βακτήρια διαρκεί περίπου 30 ώρες Όταν ανοίξει η διπλή έλικα δημιουργείται μία θηλιά που αυξάνεται μόνο προς την μία κατεύθυνση Οι θηλιές που δημιουργούνται κατά την αντιγραφή του DNA, είναι ορατές με το ηλεκτρονικό μικροσκόπιο Οι DNA πολυμεράσες δεν μπορούν από μόνες τους να ξεκινήσουν την αντιγραφή Οι DNA-πολυμεράσες, όταν λανθασμένα τοποθετήσουν νουκλεοτίδια κατά παράβαση του κανόνα της συμπληρωματικότητας, μπορούν να απομακρύνουν τα νουκλεοτίδια που οι ίδιες τοποθέτησαν Οι DNA πολυμεράσες αντικαθιστούν τα πρωταρχικά τμήματα, με τμήματα DNA Οι DNA-πολυμεράσες τοποθετούν τα νουκλεοτίδια στο 5 άκρο του τελευταίου νουκλεοτιδίου της αναπτυσσόμενης νέας αλυσίδας Η RNA πολυμεράση συνδέει τα νουκλεοτίδια με φωσφοδιεστερικό δεσμό Η DNA- πολυμεράση συνθέτει την νέα αλυσίδα στην κατεύθυνση Η μία από τις δύο νεοσυντιθέμενες αλυσίδες έχει προσανατολισμό 5 3, η άλλη νεοσυντιθέμενη αλυσίδα έχει 3 5, έτσι ώστε οι δύο αλυσίδες να είναι αντιπαράλληλες Η DNA δεσμάση εκτός από τα ασυνεχή τμήματα συνδέει και τα τμήματα DNA που προκύπτουν στις διάφορες θέσεις έναρξης της αντιγραφής Η DNA δεσμάση επιδιορθώνει τον φωσφοδιεστερικό δεσμό μεταξύ του 3 -ΟΗ ενός ασυνεχούς τμήματος και της φωσφορικής ομάδας του 5 άκρου του επόμενου ασυνεχούς τμήματος Σε ένα ευκαρυωτικό κύτταρο η αντιγραφή πραγματοποιείται κατά την μεσόφαση. Γ. Ερωτήσεις συμπλήρωσης κενών Να συμπληρώσετε τα κενά των παρακάτω προτάσεων με τους κατάλληλους όρους Οι Watson και Crick πρότειναν ως πιθανό μηχανισμό αντιγραφής του DNA, τον μηχανισμό. Δηλαδή το μόριο του DNA ξετυλίγεται και κάθε μία αλυσίδα χρησιμοποιείται ως καλούπι για την σύνθεση μίας νέας συμπληρωματικής αλυσίδας Η αντιγραφή του DNA αρχίζει από καθορισμένα σημεία που ονομάζονται θέσεις της αντιγραφής Τα ένζυμα που «σπάζουν» τους δεσμούς υδρογόνου ανάμεσα στις δύο αλυσίδες του DNA, ονομάζονται -. 37

38 Οι συμμετέχουν κυρίως στην αντιγραφή του DNA. Όμως η αντιγραφή στις θέσεις έναρξης ξεκινά με την σύνθεση μικρών τμημάτων RNA, συμπληρωματικά των μητρικών αλυσίδων που ονομάζονται, και συνθέτονται από σύμπλοκο ενζύμων το Η DNA πολυμεράση μπορεί να συνθέτει DNA μόνο κατά την κατεύθυνση επομένως σε ένα τμήμα DNA η μία αλυσίδα αντιγράφεται ενώ η συμπληρωματική της. Τα ασυνεχή τμήματα συνδέονται με την βοήθεια του ενζύμου Και με την βοήθεια των, η πιθανότητα λάθους κατά την αντιγραφή του DNA στα ευκαρυωτικά κύτταρα μειώνεται στο ένα στα Δ. Ερωτήσεις αντιστοίχισης Να αντιστοιχίσετε τους όρους που αναγράφονται στη στήλη Ι με τις έννοιες ή τις φράσεις που αναγράφονται στη στήλη ΙΙ. Για το σκοπό αυτό να γράψετε δίπλα από κάθε γράμμα της στήλης Ι τον αριθμό που ταιριάζει από τη στήλη ΙΙ (π.χ. Α-1) Στήλη-Ι Α. DNA πολυμεράση Β. DNA δεσμάση Γ. Πρωταρχικά τμήματα Δ. Πριμόσωμα Ε. Επιδιορθωτικά ένζυμα Ζ. DNA ελικάση Στήλη-ΙΙ 1. Σπάζουν τους δεσμούς υδρογόνου μεταξύ των συμπληρωματικών βάσεων. 2. Συντελεί στην ελικοειδή μορφή του μορίου του DNA. 3. Τοποθετεί τα νουκλεοτίδια το ένα δίπλα στο άλλο στην αναπτυσσόμενη πολυνουκλεοτιδική αλυσίδα. 4. Μικρά τμήματα DNA που συνθέτουν μικρά τμήματα RNA στις θέσεις έναρξης της αντιγραφής. 5. Συμβάλλουν μαζί με την DNA πολυμεράση, στον περιορισμό των λαθών κατά την αντιγραφή του DNA. 6. Πολλά ένζυμα μαζί που συνθέτουν μικρά τμήματα RNA στις θέσεις έναρξης της αντιγραφής. 7. Συνδέει τμήματα της ασυνεχούς αλυσίδας του DNA. 8. Μικρά τμήματα RNA στις θέσεις έναρξης της αντιγραφής συμπληρωματικά προς τις μητρικές αλυσίδες του DNA. Ε. Ερωτήσεις ανάπτυξης Γιατί ο μηχανισμός αυτοδιπλασιασμού του DNA ονομάζεται ημισυντηρητικός; α. Αν ένα μόριο DNA διπλασιαστεί σε περιβάλλον ραδιενεργού αζώτου, πόσες αλυσίδες DNA με ραδιενεργό άζωτο θα υπάρχουν μετά τον πρώτο και πόσες μετά τον δεύτερο διπλασιασμό; β. Αν στη συνέχεια τα μόρια που θα προκύψουν μεταφερθούν σε περιβάλλον με μη ραδιενεργό άζωτο, πόσες αλυσίδες με μη ραδιενεργό άζωτο θα υπάρχουν μετά τον τρίτο διπλασιασμό του αρχικού μορίου; Ποιες ονομάζονται θέσεις έναρξης της αντιγραφής του DNA και γιατί το DNA των ευκαρυωτικών κυττάρων αντιγράφεται πολύ γρήγορα; Ποιες λειτουργίες επιτελούν τα ένζυμα DNA πολυμεράσες κατά την αντιγραφή του DNA; Η διαδικασία της αντιγραφής του DNA χαρακτηρίζεται από μεγάλη ταχύτητα και ακρίβεια, που οφείλεται κυρίως στη δράση ενζύμων και συμπλόκων ενζύμων. α. Ποια από τα παρακάτω συμμετέχουν στην αντιγραφή του DNA: DNA πολυμεράσες, DNA ελικάσες, περιοριστικές ενδονουκλεάσες, πριμόσωμα, επιδιορθωτικά ένζυμα, DNA δεσμάση; β. Να γράψετε ονομαστικά τα ένζυμα που παίρνουν μέρος στην επιδιόρθωση του DNA Να περιγράψετε πως αντιγράφεται μία αλυσίδα συνεχώς και πως ασυνεχώς. Που οφείλεται το γεγονός ότι η μία αλυσίδα αντιγράφεται με διαφορετικό τρόπο από την άλλη ; Να εξηγήσετε το ρόλο των παρακάτω ενζύμων στην αντιγραφή του DNA: α. ελικάση β. DNA-πολυμεράση γ.dna-δεσμάση δ. πριμόσωμα Εξηγήστε πως επιδιορθώνονται τα λάθη κατά την αντιγραφή του DNA. 38

39 Ζ. Ασκήσεις-Ερωτήσεις-Προβλήματα. Και με την βοήθεια των εικόνων που σας δίνονται παρακάτω να προσπαθήσετε να απαντήσετε τις ασκήσεις που ακολουθούν. Εικόνα-Α 3' 3' Κατεύθυνση αντιγραφής Εικόνα-Β συνεχής θέση έναρξης της αντιγραφής 3 ασυνεχής Διχάλα αντιγραφής ασυνεχής συνεχής συνεχής αντιγραφή Κατεύθυνση αντιγραφής 3 ' 3 3' 3' Στα παρακάτω τμήματα DNA που σας δίνονται να αναφέρεται ποια αλυσίδα αντιγράφεται συνεχώς και ποια ασυνεχώς. (Ι) 5 5 Τμήμα-1 Τμήμα-2 (ΙΙ) (ΙΙ) Στις παρακάτω θηλιές αντιγραφής να αναφέρεται στο κάθε τμήμα DNA που σας δίνεται, ποια αλυσίδα αντιγράφεται συνεχώς και ποια ασυνεχώς. Θηλιά-1 (Ι) 3' Μητρική αλυσίδα Μητρική αλυσίδα 3' 3' νέα αλυσίδα Τμήμα-Α Τμήμα-Β αλυσίδα-ι αλυσίδα-ιι ασυνεχής σύνθεση 3' Θηλιά-2 Τμήμα-Α Ασκήσεις Να τοποθετήσετε τα άκρα στις αλυσίδες (Α) και (Β) με δεδομένο ότι η αλυσίδα Α αντιγράφεται συνεχώς. Θηλιά-3 Τμήμα-Β 5 Τμήμα-Α αλυσίδα-ι A 3 αλυσίδα-ι αλυσίδα-ιι Θηλιά-4 Τμήμα-Β αλυσίδα-ιι B Τμήμα-Α αλυσίδα-ι αλυσίδα-ιι Τμήμα-Β 39

40 Σε μια θέση έναρξης αντιγραφής του DNA, η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται στο παρακάτω σχήμα: α. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα, να σχεδιάσετε σ αυτό όλες τις νεοσυντιθέμενες αλυσίδες του DNA και να σημειώσετε τον προσανατολισμό τους, γράφοντας τα 3 και 5 άκρα. β. Η σύνθεση των νέων αλυσίδων του DNA γίνεται είτε με συνεχή είτε με ασυνεχή τρόπο. Γιατί συμβαίνει αυτό; Σε μια θέση τμήματος μορίου DNA με κλώνους Α και Β, έχει ξεκινήσει η αντιγραφή, όπως φαίνεται στο παρακάτω σχήμα. Η DNA-δεσμάση εκτός του ότι συνδέει όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής, δρα κατά την αντιγραφή του κλώνου Β. Σε κάθε κλώνο να συμπληρώσετε τον προσανατολισμό της αντιγραφής και να χαρακτηρίσετε τον τρόπο σύνθεσης των νέων αλυσίδων DNA.Ποιά ένζυμα τοποθετούν τα συμπληρωματικά νουκλεοτίδια και ποιους άλλους ρόλους έχουν; Δίνεται το παρακάτω τμήμα DNA,στο οποίο έχει αρχίσει η διαδικασία της αντιγραφής Γ Δ Α Β Διχάλα αντιγραφής Ε Ζ δ.) Ποια ένζυμα θα επιδιορθώσουν τυχόν λάθη κατά την διαδικασία της αντιγραφής ; Οι αλληλουχίες βάσεων που αναγράφονται παρακάτω αποτελούν στιγμιότυπο σε θέση έναρξη της αντιγραφής ενός τμήματος DNA. U G A A U T C C A T G A C G T G T G A C T T A A G G T A C T G C A G C A α. Να βρείτε την αλληλουχία βάσεων καθώς και τα άκρα του πρωταρχικού τμήματος. β. Να βρείτε τον αριθμό των δεσμών υδρογόνου που θα διασπαστούν και θα αναπτυχθούν κατά την αντιγραφή του συγκεκριμένου τμήματος DNA. γ. Να βρείτε το 5 και 3 άκρο της προγονικής αλυσίδας Στα ανθρώπινα κύτταρα η ταχύτητα της αντιγραφής σε μία θηλιά αντιγραφής είναι 100νουκλεοτίδια το δευτερόλεπτο. Πόσες θέσεις έναρξης της αντιγραφής απαιτούνται ώστε το γονιδίωμα ενός ανθρωπίνου σωματικού κυττάρου να αντιγραφεί σε 24ώρες ; Το ολικό γονιδίωμα ενός ανθρωπίνου σωματικού κυττάρου αποτελείται από ζεύγη βάσεων Ένα βακτήριο αντιγράφει το γονιδίωμα του που αποτελείται από ζεύγη βάσεων. Να βρείτε τον αριθμό των φωσφοδιεστερικών δεσμών που δημιουργήθηκαν με τη βοήθεια των ενζύμων της αντιγραφής. Πόσοι δεσμοί υδρογόνου δημιουργήθηκαν αν στο μητρικό μόριο DNA το 20% των νουκλεοτιδίων είχαν ως βάση την αδενίνη (Α) ; Ποια θα ήταν η επίπτωση σε ένα ευκαρυωτικό χρωμόσωμα αν περιείχε μόνο μία θέση έναρξης της αντιγραφής ; Δίνεται ότι η ταχύτητα της αντιγραφής είναι 100 νουκλεοτίδια το δευτερόλεπτο και ότι το συνηθισμένο μέγεθος ενός ζωικού χρωμοσώματος είναι 1, ζεύγη βάσεων. α.) Στις θέσεις Α,Β,Γ,Δ,Ε και Ζ να αντιστοιχίσετε τις ενδείξεις 5 και 3,ώστε να φαίνεται ο προσανατολισμός των αρχικών και νεοσυντιθέμενων αλυσίδων β.) Τι είναι πρωταρχικά τμήματα και πως επιμηκύνονται ; γ.) Να εξηγήσετε γιατί στην παραπάνω διαδικασία θα πρέπει να συμμετέχει το ένζυμο DNA-δεσμάση 40

41 2.2. Έκφραση της γενετικής πληροφορίας Α. Ποια διαδικασία του σχήματος αφορά την ικανότητα του DNA να δημιουργεί αντίγραφα του εαυτού του ; α. Αντιγραφή β. Μεταγραφή γ. Μετάφραση Β. Ποια διαδικασία του σχήματος αφορά την μεταφορά της γενετικής πληροφορίας από το DNA στο RNA ; α. Αντιγραφή β. Μεταγραφή γ. Μετάφραση Γ. Ποια διαδικασία του σχήματος αφορά την παραγωγή πρωτεΐνης με τη βοήθεια ενός μορίου RNA α. Αντιγραφή β. Μεταγραφή γ. Μετάφραση Α. Ποιο από τα παρακάτω σχήματα δείχνει σωστά την πορεία της γενετικής πληροφορίας α. β. Β. Μπορούμε να ισχυριστούμε ότι η σειρά των βάσεων του DNA(της μίας αλυσίδας) «ξαναγράφεται» σε mrna ; Γ. Μπορούμε να ισχυριστούμε ότι η σειρά των βάσεων του mrna καθορίζει τη σειρά των αμινοξέων της πρωτεΐνης; Δ. Είναι σωστός ο ισχυρισμός ότι το DNA καθορίζει τη σειρά των αμινοξέων της πρωτεΐνης ; Να χαρακτηρίσετε τις παρακάτω φράσεις ως σωστές ή λανθασμένες. α. «Η έκφραση ενός γονιδίου οδηγεί στον σχηματισμό πρωτεΐνης» β. «Η έκφραση ενός γονιδίου αφορά τις διαδικασίες της μεταγραφής και μετάφρασης» γ. «Το μόριο DNA σε όλα τα σημεία του έχει τη γενετική πληροφορία» δ. «Το μόριο DNA έχει τη γενετική πληροφορία σε συγκεκριμένα τμήματα που ονομάζονται γονίδια.» Α. Ποιο σχήμα αφορά το κεντρικό δόγμα πριν την ανακάλυψη των RNA-ιών (F.Crick-1958); α. ΣΧΗΜΑ-Α β. ΣΧΗΜΑ-Β Β. Ποιο σχήμα αφορά το κεντρικό δόγμα μετά την ανακάλυψη των RNA-ιών (σημερινό); α. ΣΧΗΜΑ-Α β. ΣΧΗΜΑ-Β Γ. Να σημειώσετε τις 2 διαδικασίες που προστέθηκαν στο αρχικό δόγμα του F.Crick(1958) και αφορούν τους RNA-ιούς α. Αυτοδιπλασιασμός του DNA β. Αυτοδιπλασιασμός του RNA γ. Μεταγραφή δ.αντίστροφη μεταγραφή ε.μετάφραση 41

42 Δ. Να συμπληρωθούν τα κενά με του όρους αντιγραφή, μεταγραφή και μετάφραση. Η διαιωνίζει τη γενετική πληροφορία, ενώ η χρησιμοποιεί την πληροφορία αυτή για να κατασκευά-σει ένα πολυπεπτίδιο (πρωτεΐνη). Η καθορίζει ποια γονίδια θα εκφραστούν,σε ποιους ιστούς και σε ποια στάδια ανάπτυξης Να χαρακτηρίσετε τις παρακάτω φράσεις ως σωστές ή λανθασμένες Α. «Στο ερυθρό αιμοσφαίριο δεν υπάρχει το γονίδιο που είναι υπεύθυνο για το αντίσωμα» Β. «Στο αιμοπετάλιο υπάρχει το γονίδιο της αιμοσφαιρίνης, είναι όμως ανενεργό (δεν εκφράζεται» Γ. «Στο νευρικό κύτταρο δεν υπάρχει το γονίδιο του παράγοντα που είναι υπεύθυνο για την πήξη του αίματος» Δ. «Στο λεμφοκύτταρο υπάρχει το γονίδιο της πρωτεΐνης που είναι υπεύθυνο για τη νευρική ώση,είναι όμως ανενεργό (δεν εκφράζεται) Ε. «Το κάθε κύτταρο ανάλογα με τις ιδιότητες που έχει, διαθέτει και τα δικά του γονίδια.» ΣΤ. Όλα τα ανθρώπινα κύτταρα έχουν τα ίδια γονίδια, αλλά σε κάθε κύτταρο εκφράζεται και διαφορετικό γονίδιο, ενώ υπάρχουν και ανενεργά γονίδια ( που δεν εκφράζονται) ΕΡΩΤΗΣΕΙΣ. Α. ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ. Α. Ερωτήσεις πολλαπλής επιλογής Ποιες διαδικασίες αποτελούν την γονιδιακή έκφραση : α. Η αντιγραφή, η μεταγραφή και η μετάφραση β. Η αντιγραφή και η μεταγραφή. γ. Η μεταγραφή και η μετάφραση. δ. Η αντιγραφή και η μετάφραση Τα γονίδια που είναι υπεύθυνα για την βιοσύνθεση των πρωτεϊνών, μεταγράφονται σε : α. mrna β. trna γ. rrna δ. snrna Ποιο από τα είδη RNA είναι υπεύθυνο για την μεταφορά της γενετικής πληροφορίας στα ριβοσώματα : α. mrna β. trna γ. rrna δ. snrna Ποιο από τα είδη RNA είναι υπεύθυνο για την μεταφορά των αμινοξέων στα ριβοσώματα : α. mrna β. trna γ. rrna δ. snrna Ποιο από τα παρακάτω είδη RNA δεν το συναντάμε στα προκαρυωτικά κύτταρα : α. αγγελιοφόρο RNA β. μεταφορικό RNA γ. ριβοσωμικό RNA δ. μικρό πυρηνικό RNA Ποιο από τα είδη RNA είναι συστατικό των ριβοσωμάτων α. mrna β. trna γ. rrna δ. snrna Το είδος του RNA που μεταφέρει στα ριβοσώματα την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας είναι το α. ριβοσωμικό RNA (rrna). β. μικρό πυρηνικό RNA (snrna). γ. αγγελιαφόρο RNA (mrna). 42

43 δ. μεταφορικό RNA (trna) Κάθε μεταφορικό RNA α. σχηματίζει το ριβόσωμα. β. περιέχει θυμίνη. γ. καταλύει την ωρίμανση του mrna. δ. μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα Στα προκαρυωτικά κύτταρα έχουν εντοπιστεί α. mrna, snrna, trna β. m RNA, rrna, snrna γ. trna, rrna, mrna δ. snrna, trna, rrna Προϊόν της μεταγραφής είναι: α. το ριβοσωμικό RNA β. το μεταφορικό RNA γ. το αγγελιαφόρο RNA δ. όλα τα παραπάνω Η ωρίμανση του πρόδρομου mrna προκαλείται από: α. το rrna β. το trna γ. το snrna ενωμένο με πρωτεΐνες δ. Κανένα από τα παραπάνω Η αντίστροφη μεταγραφάση καταλύει την μετατροπή RNA σε: α. DNA β. Δίκλωνο RNA γ. Πρωτεΐνες δ. Κανένα από τα παραπάνω Β. Ερωτήσεις τύπου σωστό-λάθος. Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) ή λανθασμένες (Λ) Με τον αυτοδιπλασιασμό του DNA, επιτυγχάνεται η μεταβίβαση της γενετικής πληροφορίας από ένα κύτταρο στα θυγατρικά του και από έναν οργανισμό στους απογόνους του. ( ) Η ροή της γενετικής πληροφορίας σε όλους τους ζωντανούς οργανισμούς γίνεται μόνο προς μία κατεύθυνση,δηλαδή από το DNA προς RNA μέσω της μεταγραφής. ( ) Σε ορισμένους ιούς το RNA αυτοδιπλασιάζεται. ( ) Η αντιγραφή του DNA διαιωνίζει την γενετική πληροφορία, ενώ η μετάφραση χρησιμοποιεί αυτή την πληροφορία για την δημιουργία ενός πολυπεπτιδίου. ( ) Η μεταγραφή καθορίζει ποια γονίδια θα εκφραστούν και σε ποιο ιστό καθώς και σε ποιο στάδιο ανάπτυξης Όλα τα κύτταρα ενός πολυκύτταρου οργανισμού έχουν τα ίδια γονίδια. ( ) Σε κάθε ομάδα κυττάρων εκφράζονται διαφορετικά γονίδια. ( ) Στα ερυθροκύτταρα εκφράζονται τα γονίδια των αντισωμάτων, ενώ στα Β-λεμφοκύτταρα τα γονίδια των αιμοσφαιρινών. ( ) Το μεγαλύτερο ποσοστό του ανθρωπίνου γονιδιώματος μεταγράφεται σε RNA, δηλαδή αποτελεί τα γονίδια Ένα συγκεκριμένο μόριο trna μπορεί να μεταφέρει οποιοδήποτε αμινοξύ στην περιοχή της πρωτεϊνοσύνθεσης. ( ) Στους προκαρυωτικούς οργανισμούς βρίσκονται μόρια rrna και trna. Γ. Ερώτηση συμπλήρωσης κενών Στο κείμενο που σας δίνεται παρακάτω να συμπληρώσετε τα κενά με τους κατάλληλους όρους. Κείμενο : Η γενετική πληροφορία που υπάρχει στο DNA,μεταφέρεται στο RNA με την διαδικασία της. Η πληροφορία που βρίσκεται στο RNA χρησιμοποιείται για την βιοσύνθεση των πρωτεϊνών του κυττάρου, σε μία διαδικασία γνωστή ως.η γενετική πληροφορία είναι οργανωμένη σε που διακρίνονται σε δύο μεγάλες κατηγορίες : Στα γονίδια που είναι υπεύθυνα για την βιοσύνθεση των πρωτεϊνών και μεταγράφονται σε, και στα γονίδια που μεταγράφονται σε,, (ευκαρυωτικά κύτταρα). Οι πορείες της μεταγραφής και της μετάφρασης αποτελούν την. Το 1958 ο Crick διατύπωσε το κεντρικό της βιολογίας,όπου σήμερα συμπληρώθηκε αφού σε κάποιους RNA-ιούς με την βοήθεια του ενζύμου έχουμε ροή της γενετικής πληροφορίας από RNA προς DΝΑ. Δ.ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ Ποιες είναι οι 4 κατηγορίες του RNA; Ποιος είναι ο ρόλος της κάθε κατηγορίας; 43

44 2.3.Μεταγραφή Σας δίνεται στο παρακάτω σχήμα η έναρξη της διαδικασίας της μεταγραφής ενός γονιδίου. ε. Όταν η RNA-πολυμεράση φτάσει σε ειδικές περιοχές στο τέλος του γονιδίου που ονομάζονται αλληλουχίες λήξης της μεταγραφής προκαλείται απελευθέρωση τόσο του RNA, όσο και της RNAπολυμεράσης από το DNA.» Σας δίνονται οι δύο αλυσίδες ενός τμήματος DNA που μεταγράφεται. Α. Να χαρακτηρίσετε την παρακάτω πρόταση ως σωστή ή λάθος. «Ο υποκινητής βρίσκεται στην αρχή του γονιδίου.» Β. Ο υποκινητής είναι. : α. Τμήμα DNA β. RNA γ. Πρωτεΐνη Γ. Η RNA-πολυμεράση είναι α. Τμήμα DNA β. RNA γ. Πρωτεΐνη Δ. Ένας μεταγραφικός παράγοντας είναι. : α. Τμήμα DNA β. RNA γ. Πρωτεΐνη Ε. Το προϊόν της μεταγραφής είναι. : α. Τμήμα DNA β. RNA γ. Πρωτεΐνη Α. Όταν λέμε ότι η κατεύθυνση της μεταγραφής είναι 5-3 εννοούμε :.. α. Ότι το πρώτο νουκλεοτίδιο που προστίθεται στο RNA έχει ελεύθερο το 5 άκρο,ενώ το τελευταίο το 3. β. Ότι η μεταγραφόμενη αλυσίδα που χρησιμοποιείται από τη RNA-πολυμεράση μεταγράφεται από το 5 άκρο της προς το 3. Β. Να χαρακτηρίσετε τις παρακάτω φράσεις ως σωστές ή λάθος. α. «Η RNA-πολυμεράση χρησιμοποιεί μόνο μία από τις δύο αλυσίδες του DNA.» β. «Η RNA-πολυμεράση χρησιμοποιεί μόνο και τις δύο αλυσίδες του DNA.» γ. «Η RNA-πολυμεράση προκαλεί τοπικό «ξετύλιγμα» της διπλής έλικας του DNA στο σημείο που βρίσκεται. Στο τμήμα DNA που δεν χρησιμοποιείται από την RNA-πολυμεράση οι δύο αλυσίδες του DNA παραμένουν ενωμένες.» δ. «Η RNA-πολυμεράση προκαλεί τον διαχωρισμό των δύο αλυσίδων του DNA, που παραμένουν διαχωρισμένες μέχρι να ολοκληρωθεί η μεταγραφή.» Α. Ποια αλυσίδα είναι η μεταγραφόμενη ( που χρησιμοποιεί η RNA-πολυμεράση ως κλώνο εκμαγείο) α. Κωδική β. Μη κωδική Β. Με ποια αλυσίδα είναι συμπληρωματικό το RNA ; α. Κωδική β. Μη κωδική Γ. Με ποια αλυσίδα το RNA έχει την ίδια αλληλουχία βάσεων ; ( όπου το DNA έχει Τ το RNA έχει U ) α. Κωδική β. Μη κωδική Δ. Το RNA μεταφέρει τη γενετική πληροφορία στα ριβοσώματα, αν ως γενετική πληροφορία εννοούμε τη σειρά των βάσεων ( διαβάζοντας από το 5 προς το 3 άκρο), ποια από τις δύο αλυσίδες έχει τη γενετική πληροφορία ; α. Κωδική β. Μη κωδική Να συμπληρώσετε τα κενά στο παρακάτω κείμενο με τους όρους : Αλληλουχίες λήξης, υποκινητές,rna-πολυμεράση, κωδική, μη κωδική. Η μεταγραφή καταλύεται από ένα ένζυμο την. Η προσδένεται σε ειδικές του DNA που ονομάζονται. Η σύνθεση του RNA σταματά στο τέλος του γονιδίου,όπου ειδικές αλληλουχίες που ονομάζονται επιτρέπουν την απελευθέρωση του. Το μόριο DNA είναι συμπληρωματικό προς τη μία αλυσίδα του γονιδίου που ονομάζεται και είναι η μεταγραφόμενη. Η άλλη αλυσίδα του γονιδίου είναι η. 44

45 Α. Σε ποιο από τα δύο κύτταρα η μεταγραφή και η μετάφραση πραγματοποιούνται ταυτόχρονα στο κυτταρόπλασμα ; α. Ευκαρυωτικό β. Προκαρυωτικό Β. Σε ποιο από τα δύο κύτταρα αρχικά πραγματοποιείται η μεταγραφή στον πυρήνα και στη συνέχεια η μετάφραση στο κυτταρόπλασμα; α. Ευκαρυωτικό β. Προκαρυωτικό Γ. Σε ποιο από τα δυο κύτταρα το mrna μετά τη μεταγραφή είναι έτοιμο να μεταφραστεί ; α. Ευκαρυωτικό β. Προκαρυωτικό Δ. Σε ποιο από τα δυο κύτταρα το mrna μετά τη μεταγραφή πρέπει να υποστεί τη διαδικασία της ωρίμανσης πριν μεταφραστεί ; Σε ποιο από τα δυο κύτταρα το mrna μετά τη μεταγραφή είναι έτοιμο να μεταφραστεί ; α. Ευκαρυωτικό β. Προκαρυωτικό Ε. Σε ποιο από τα δύο κύτταρα αναφέρονται οι όροι :εσώνιο και εξώνιο α. Ευκαρυωτικό β. Προκαρυωτικό ΣΤ. Σε ποιο από τα δύο κύτταρα αναφέρονται οι όροι :πρόδρομο και ώριμο mrna ; α. Ευκαρυωτικό β. Προκαρυωτικό A.Ποιες περιοχές του DNA και του RNA είναι υπεύθυνες για την προσθήκη αμινοξέων ; α. Εσώνια β. Εξώνια Β. Ποιες περιοχές του DNA και του RNA δεν κωδικοποιούν αμινοξέα ; α. Εσώνια β. Εξώνια Γ. Είναι σωστό να ισχυριστούμε ότι ένα εσώνιο βρίσκεται ανάμεσα από δύο εξώνια ; Δ. Ποιο μόριο RNA αποτελείται και από εσώνια και από εξώνια ; α. Ώριμο β. Πρόδρομο Ε. Ποιο μόριο RNA αποτελείται αποκλειστικά από εξώνια ; α. Ώριμο β. Πρόδρομο ΣΤ. Είναι σωστό να ισχυριστούμε ότι το ώριμο mrna δε διαθέτει την 5 και 3 αμετάφραστη περιοχή ; Α. Ερωτήσεις πολλαπλής επιλογής Να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση Η μεταγραφή του DNA καταλύεται από το ένζυμο. : α. RNA πολυμεράση β. DNA-πολυμεράση γ. μεταγραφικός παράγοντας δ. υποκινητής Η RNA-πολυμεράση προσδένεται σε ειδικές περιοχές προκειμένου να ξεκινήσει η μεταγραφή που ονομάζονται : α. μεταγραφικοί παράγοντες β. αλληλουχίες λήξης της μεταγραφής γ. υποκινητές δ. εσώνια Ποια από τις παρακάτω προτάσεις δεν ισχύει για την RNA πολυμεράση; α. αποτελείται από αμινοξέα β. αποτελείται από ριβονουκλεοτίδια γ. συντίθεται από ριβοσώματα δ. η πληροφορία για τη σύνθεσή της βρίσκεται στο DNA 45

46 Οι πρωτεΐνες που βοηθούν την RNAπολυμεράση να ξεκινήσει την μεταγραφή ονομάζονται : α. υποκινητές β. μεταγραφικοί παράγοντες γ. εσώνια δ. εξώνια Οι μεταγραφικοί παράγοντες α. είναι ρυθμιστικά στοιχεία αντιγραφής του DNA β. είναι ειδικές περιοχές του DNA που πρόκειται να γίνει η μεταγραφή γ. επιτρέπουν στην RNA πολυμεράση τη σωστή έναρξη της μεταγραφής δ. είναι πρωτεΐνες, οι οποίες ρυθμίζουν τη μεταγραφή του DNA Τα ρυθμιστικά στοιχεία της μεταγραφής του RNA είναι : α. Ο υποκινητής β. Οι μεταγραφικοί παράγοντες γ. Ο υποκινητής και οι μεταγραφικοί παράγοντες δ. Ο υποκινητής οι μεταγραφικοί παράγοντες και οι αλληλουχίες λήξης της μεταγραφής Η αλληλουχία των νουκλεοτιδίων του RNA καθορίζεται: α. από την RNA πολυμεράση β. από τη συμπληρωματικότητα των βάσεων της αλυσίδας καλούπι γ. από τους μεταγραφικούς παράγοντες δ. από τον υποκινητή Η σύνθεση του RNA σταματά σε ειδικές αλληλουχίες του γονιδίου που ονομάζονται : α. κωδική αλυσίδα β. μη κωδική αλυσίδα γ. αλληλουχίες λήξης της μεταγραφής δ. εσώνια Eίναι συμπληρωματικό του RNA.. : α. Η κωδική αλυσίδα του γονιδίου β. Ο υποκινητής γ. Το ώριμο mrna δ. Η μη κωδική αλυσίδα του γονιδίου Ποιο από τα παρακάτω αποτελείται από RNA: α.ο υποκινητής. β.η RNA πολυμεράση. γ.η αλληλουχία λήξης της μεταγραφής. δ.το προϊόν της μεταγραφής του γονιδίου Η διαδικασία μεταγραφής οδηγεί στο σχηματισμό μορίων : α. DNA β. c DNA γ. RNA δ. πρωτεϊνών Ποιο από τα παρακάτω αποτελείται από DNA; α. Οι μεταγραφικοί παράγοντες β. Ο υποκινητής γ. Οι αλληλουχίες λήξης της μεταγραφής δ. Ο υποκινητής και οι αλληλουχίες λήξης της μεταγραφής Η μεταγραφή στα προκαρυωτικά κύτταρα πραγματοποιείται: α. στον πυρήνα. β. στο κυτταρόπλασμα. γ. στα μιτοχόνδρια. δ. στο κυτταρικό τοίχωμα Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο Η μεταγραφή σε ένα ευκαρυωτικό κύτταρο πραγματοποιείται : α. στον πυρήνα β. στα μιτοχόνδρια γ. στους χλωροπλάστες δ. σε όλα τα παραπάνω Η ωρίμανση του mrna α. είναι μια διαδικασία που καταλύεται από DNA ελικάσες. β. συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. γ. συμβαίνει στον πυρήνα των ευκαρυωτικών κυττάρων. δ. είναι μία διαδικασία στην οποία παραμένουν για μετάφραση τα εσώνια Στο πρόδρομο RNA: α. Δεν υπάρχουν τα εσώνια που ορίζουν αμινοξέα β. Απομακρύνονται τα εξώνια γ.περιέχονται εσώνια, εξώνια 3 και 5 αμετάφραστες περιοχές αλλά και το κωδικόνιο λήξης δ.τα ριβονουκλεοπρωτεϊνικά σωματίδια κόβουν τα εξώνια και συρράπτουν τα εσώνια μεταξύ τους Από το μικρό πυρηνικό (SnRNA), με κατάλληλες πρωτεΐνες, α. συρράπτονται τα εσώνια β. κόβονται τα εξώνια και συρράπτονται τα εσώνια του rrna γ. προκαλείται η ωρίμανση του trna δ. κόβονται τα εσώνια και ενώνονται τα εξώνια Δεν περιλαμβάνει το «ώριμο» mrna.. α. εσώνια β. εξώνια γ. 5 και 3 αμετάφραστη περιοχή 46

47 δ. οποιοδήποτε τμήμα RNA που δεν αντιστοιχεί σε αμινοξέα Στα ευκαρυωτικά κύτταρα η μεταγραφή δεν ξεκινά, αν δεν πραγματοποιηθεί : α. Το ολοκληρωτικό άνοιγμα των δύο αλυσίδων του γονιδίου β. Η σύνδεση των μεταγραφικών παραγόντων και της RNA-πολυμεράσης στον υποκινητή γ. Η απομάκρυνση των εσωνίων από τη μη κωδική αλυσίδα. δ. Ο τεμαχισμός του RNA από ειδικά ένζυμα Ποια από τις παρακάτω προτάσεις δεν είναι σωστή; α. Τα εσώνια απομακρύνονται από το RNA,πριν αυτό εγκαταλείψει τον πυρήνα. β. Η RNA-πολυμεράση προσθέτει νουκλεοτίδια και στα δύο άκρα του RNA. γ. Η ωρίμανση του RNA καταλύεται από σωματίδια που αποτελούνται από snrna-πρωτεΐνες. δ. Το πρόδρομο mrna είναι μεγαλύτερο σε μήκος από το ώριμο Το προϊόν της μεταγραφής ενός γονιδίου μπορεί να είναι : α. rrna β. πρωτεΐνη γ. ριβοένζυμα δ. τίποτα από τα παραπάνω Ποια από τις παρακάτω προτάσεις είναι σωστή ; α. Η RNA-πολυμεράση τοποθετεί απέναντι από τη θυμίνη (Τ )της μη κωδικής την ουρακίλη (U) β. Η RNA-πολυμεράση συνθέτει RNA, χρησιμοποιώντας ως καλούπι μία αλυσίδα DNA. γ. Το RNA των ευκαρυωτικών κυττάρων συνθέτεται στο κυτταρόπλασμα. δ. β και γ Β. Ερωτήσεις τύπου σωστό-λάθος. Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) ή λανθασμένες (Λ) Στα ευκαρυωτικά και στα προκαρυωτικά κύτταρα ο μηχανισμός της μεταγραφής είναι ίδιος Και στους ευκαρυωτικούς και στους προκαρυωτικούς οργανισμούς, υπάρχουν 3 είδη RNA-πολυμερασών Υπάρχει ένα είδος RNA πολυμεράσης στους ευκαρυωτικούς οργανισμούς.( ) Οι υποκινητές μπορεί να βρίσκονται είτε στην αρχή είτε στο τέλος κάθε γονιδίου. ( ) Οι υποκινητές και οι μεταγραφικοί παράγοντες αποτελούν τα ρυθμιστικά στοιχεία της μεταγραφής Η μεταγραφή έχει προσανατολισμό 3 5,σε αντίθεση με την αντιγραφή που έχει προσανατολισμό 5 3. ( ) Η RNA-πολυμεράση προσθέτει τα νουκλεοτίδια με φωσφοδιεστερικό δεσμό Το πρώτο νουκλεοτίδιο που τοποθετεί η RNAπολυμεράση έχει ελεύθερο το 3 άκρο. ( ) Το RNA και η κωδική αλυσίδα φέρουν την γενετική πληροφορία ενός γονιδίου. ( ) Ο υποκινητής βρίσκεται στο 3 άκρο του μεταγραφόμενου κλώνου.( ) Στην μεταγραφή συμμετέχουν και οι 2 αλυσίδες DNA. ( ) Το DNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. ( ) Στους προκαρυωτικούς οργανισμούς η μετάφραση του mrna, μπορεί να ξεκινήσει πριν ολοκληρωθεί η μεταγραφή του. ( ) Στα ευκαρυωτικά κύτταρα η ύπαρξη της πυρηνικής μεμβράνης έχει ως συνέπεια να ολοκληρώνεται η μεταγραφή και η μεταφορά του m RNA στο κυτταρόπλασμα, πριν αρχίσει η διαδικασία της μετάφρασης. ( ) Κατά τη διαδικασία της ωρίμανσης, το DNA γίνεται μικρότερο Στα κύτταρα του ανθρώπου, το mrna αρχίζει να μεταφράζεται πριν ολοκληρωθεί η μεταγραφή του. ( ) Η διαδικασία της ωρίμανσης δεν πραγματοποιείται σε προκαρυωτικά κύτταρα. ( ) Οι περιοχές του γονιδίου που αντιστοιχούν σε αμινοξέα αποτελούν τα εσώνια, ενώ οι περιοχές που δεν αντιστοιχούν σε αμινοξέα τα εξώνια Το πρόδρομο mrna περιέχει μόνο εξώνια Το ώριμο mrna είναι μικρότερο σε μήκος από το πρόδρομο mrna Το ώριμο mrna δεν έχει αμετάφραστες περιοχές.( ) Το ώριμο mrna μεταφέρεται από τον πυρήνα στα ριβοσώματα Επειδή οι δύο αλυσίδες του γονιδίου είναι συμπληρωματικές, ως αλυσίδα-καλούπι από την RNA-πολυμεράση μπορούν να χρησιμοποιηθούν και οι 2 κλώνοι του γονιδίου Ένα mrna μπορεί να περιέχει την αλληλουχία : 5 -ΑΤΤG-3. Γ. Ερωτήσεις συμπλήρωσης κενών. Να συμπληρώσετε τα κενά στις παρακάτω προτάσεις με τους σωστούς ορούς Η μεταγραφή καταλύεται από ένα ένζυμο την. 47

48 Η RNA-πολυμεράση προσδένεται σε ειδικές περιοχές του DNA που ονομάζονται με την βοήθεια πρωτεϊνών που ονομάζονται Η σύνθεση του RNA σταματά σε ειδικές αλληλουχίες στο τέλος του γονιδίου που ονομάζονται αλληλουχίες της μεταγραφής Η αλυσίδα που μεταγράφεται ονομάζεται ενώ η συμπληρωματική της Τα περισσότερα γονίδια των ευκαρυωτικών οργανισμών και των ιών που τους προσβάλλουν είναι Οι αλληλουχίες που μεταφράζονται σε αμινοξέα ονομάζονται ενώ οι ενδιάμεσες αλληλουχίες που δεν μεταφράζονται σε αμινοξέα Αρχικά με την μεταγραφή ενός ευκαρυωτικού γονιδίου παράγεται ένα μόριο RNA, που περιέχει και εσώνια και εξώνια, το mrna Το πρόδρομο mrna μετατρέπεται σε mrna με τη διαδικασία της, κατά την οποία τα κόβονται από μικρά ριβονουκλεοπρωτεϊνικά σωματίδια και απομακρύνονται Με την απομάκρυνση των εσωνίων και την συρραφή των εξωνίων από τα ριβονουκλεοπρωτεϊνικά σωματίδια σχηματίζεται το mrna, που αποτελείται αποκλειστικά από εξώνια Το ώριμο mrna στα ευκαρυωτικά κύτταρα μεταφέρεται από τον στα όπου γίνεται η. Δ. Ασκήσεις αντιστοίχισης Να αντιστοιχίσετε κάθε αριθμό της στήλης Α μ ένα γράμμα της στήλης Β και να σημειώσετε την αντιστοιχία. Στήλη-Α 1. Υποκινητές 2.Ριβονουκλεοπρωτεϊνι κά σωματίδια 3.Εσώνια 4. m-rna Στήλη-Β α.μεταφέρει πληροφορία β. sn-rna κ πρωτεΐνες γ.τμήματα DNA δ. Περιοχές που δεν μεταφράζονται Ε. Ερωτήσεις ανάπτυξης Ποια είδη RNA παράγονται κατά τη μεταγραφή του DNA προκαρυωτικού κυττάρου και ποιος είναι ο ρόλος τους ; Ποια είναι τα είδη του RNA και ποιος είναι ο ρόλος κάθε είδους; Πώς σχηματίζεται το ώριμο mrna στα ευκαρυωτικά κύτταρα; Πού εντοπίζονται οι διαφορές ανάμεσα στο κεντρικό δόγμα της Βιολογίας όπως το διατύπωσε ο F. Crick και όπως διατυπώνεται σήμερα; Για ποιο σκοπό γίνεται: α. η αντιγραφή του DNA; β. η μεταγραφή και η μετάφραση της γενετικής πληροφορίας του DNA; Κατά τη ροή της γενετικής πληροφορίας στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς παρατηρούνται ορισμένες διαφορές. α. Να γράψετε αυτές τις διαφορές. β. Σε ποιο σημαντικό συμπέρασμα οδήγησε η ανακάλυψη των διαφορών αυτών; Να συγκριθούν η DNAπολυμεράση και η RNA πολυμεράση ως προς : α. Την κατεύθυνση που δρουν β. Αν απαιτείται για τη δράση τους πρωταρχικό τμήμα γ. Αν απαιτείται για τη δράση τους μία αλυσίδακαλούπι δ. Τον τύπο των νουκλεοτιδίων που χρησιμοποιούν. ε. Τις λειτουργίες που επιτελούν Τι είναι ο υποκινητής; Βρίσκεται, στην αρχή (5 άκρο) ή στο τέλος(3 άκρο) του προϊόντος της μεταγραφής ; Πως η RNA-πολυμεράση ξεκινά πάντα την κατάλληλη χρονική στιγμή να μεταγράφει ένα γονίδιο σε ένα προκαρυωτικό ή ευκαρυωτικό κύτταρο ; Υποθέστε ότι ακτίνες-χ καταστρέφουν την αλληλουχία του υποκινητή που αναγνωρίζει και συνδέεται η RNA-πολυμεράση με τους μεταγραφικούς παράγοντες. Ποια θα είναι η συνέπεια του παραπάνω γεγονότος στην έκφραση του γονιδίου ; Ποιο είναι ο ρόλος της μεταγραφής ; Ένα τμήμα mrna έχει την ακόλουθη αλληλουχία βάσεων : 5 -CCUAGGCUA-3. Να γραφεί η αντίστοιχη αλληλουχία της μη κωδικής και της κωδικής αλυσίδας του γονιδίου Γνωρίζοντας ότι τη γενετική πληροφορία τη φέρει μόνο μία αλυσίδα του γονιδίου, γιατί το γονίδιο είναι τμήμα ενός δίκλωνου DNA; Ποιο είναι το πλεονέκτημα του γονιδίου (DNA), έναντι του μονόκλωνου mrna που φέρει και αυτό τη γενετική πληροφορία ; 48

49 Ένα γονίδιο αποτελείται από 3 εξώνια και 2 εσώνια. Να βρεθεί ο αριθμός των διαφορετικών τρόπων που μπορούν να συρραφούν τα εξώνια μεταξύ τους.ομοίως να βρεθεί ο ίδιος αριθμός για ένα γονίδιο που αποτελείται από 4 εξώνια και 3 εσώνια Μία ομάδα βιοχημικών συνθέτουν τεχνητά μία RNA-πολυμεράση που έχει τα ίδια χαρακτηριστικά όσον αφορά την λειτουργία της με τη DNAπολυμεράση. Η τεχνητή RNA-πολυμεράση όπως η φυσική χρησιμοποιεί ριβονουκλεοτίδια και μπορεί να αναγνωρίζει τον υποκινητή του γονιδίου Να αναφέρετε ένα μειονέκτημα της και ένα πλεονέκτημα της έναντι της φυσικής RNA-πολυμεράσης. ΣΤ. Ερωτήσεις-Ασκήσεις-Προβλήματα : Στα παρακάτω τμήματα DNA να σημειώσετε την κωδική και μη κωδική αλυσίδα την κατεύθυνση της μεταγραφής και τη θέση του υποκινητή (όπου δεν σας δίνονται). 3' Y Γονίδιο 3' 3' Y Γονίδιο 3' Β. Να γράψετε την αλληλουχία των βάσεων για το τμήμα RNA που προκύπτει από την μεταγραφή του τμήματος του γονιδίου που σας δίνεται στο παραπάνω σχήμα (σημειώνοντας το 5 και 3 άκρο.) Δίνεται το παρακάτω μόριο mrna : Να σημειώσετε την αλληλουχία βάσεων και στις δύο αλυσίδες DNA του γονιδίου, που από την μεταγραφή του προέκυψε το παραπάνω RNA. Κωδική Δίνεται το παρακάτω σχήμα που δείχνει την μεταγραφή ενός DNA. Να ορίσετε την κωδική,την μη-κωδική αλυσίδα καθώς και τα άκρα τους. T C A G T C A G T C A G A G T C A G T C A G T C U C A G U C A G U C A G 1o RNA A T 3' Γονίδιο Y 3' 3' Γονίδιο Y 3' 3' 3' 3' mrna 3' 3' μεταγραφόμενη 3' Δίνονται 2 γονίδια με κοινό υποκινητή (Υ), και οι διευθύνσεις μεταγραφής των δύο γονιδίων. 3' μεταγραφόμενη 3' 3' Y 3' 3' 3' μεταγραφόμενη Δίνεται παρακάτω ένα τμήμα DNA που περιέχει ένα γονίδιο. Στο τμήμα DNA τοπικά,όπως φαίνεται στο σχήμα, η RNA-πολυμεράση έχει ξετυλίξει τις δύο αλυσίδες. 5 3 αλυσίδα-ι αλυσίδα-ιι υποκι νητής ATTAGAACCTTC 3 5 Α. Να γράψετε την αλληλουχία των βάσεων της κωδικής και της μη κωδικής αλυσίδας και για τα δύο γονίδια και να σημειώσετε το 5 και το 3 άκρο της κάθε αλυσίδας. Β. Να γράψετε την αλληλουχία των βάσεων για τα μόρια mrna,που προκύπτουν από την μεταγραφή των γονιδίων. Διεύθυνση μεταγραφής Α. Ποια από τις δύο αλυσίδες είναι η κωδική και ποια η μη κωδική; 49

50 2.4.Γενετικός κώδικας Α. Ερωτήσεις πολλαπλής επιλογής Να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση Ο αριθμός των διαφορετικών αμινοξέων που συγκροτούν τις πρωτεΐνες είναι : α. 4 β. 64 γ. 16 δ Ο αριθμός των διαφορετικών τριάδων που σχηματίζονται από τα τέσσερα (4) νουκλεοτίδια του RNA ( ή DNA) είναι : α. 4 1 β. 4 2 γ. 4 3 δ Ο γενετικός κώδικας είναι α. ο αριθμός των γονιδίων του κυττάρου. β. η αντιστοίχιση τριπλετών βάσεων σε αμινοξέα. γ. το σύνολο των ενζύμων ενός κυττάρου. δ. ο τρόπος αντιστοίχισης των νουκλεοτιδίων μεταξύ τους Το κωδικόνιο είναι α. μία τριάδα νουκλεοτιδίων. β. μία τριάδα αμινοξέων. γ. έξι νουκλεοτίδια συνδεδεμένα με δεσμούς υδρογόνου. δ. το αμινοξύ μεθειονίνη Μία τριάδα νουκλεοτιδίων κωδικοποιεί ένα αμινοξύ, σε ποιο χαρακτηριστικό του γενετικού κώδικα οφείλεται το παραπάνω γεγονός : α. Ο γενετικός κώδικας είναι κώδικας τριπλέτας β. Ο γενετικός κώδικας είναι συνεχής γ. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος δ. Ο γενετικός κώδικας είναι σχεδόν καθολικός Ο γενετικός κώδικας διαβάζεται χωρίς να παραλείπεται κάποιο νουκλεοτίδιο, σε ποιο χαρακτηριστικό του γενετικού κώδικα οφείλεται το παραπάνω γεγονός : α. Ο γενετικός κώδικας είναι κώδικας τριπλέτας β. Ο γενετικός κώδικας είναι συνεχής γ. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος δ. Ο γενετικός κώδικας είναι εκφυλισμένος Κάθε νουκλεοτίδιο ανήκει σε ένα μόνο κωδικόνιο, σε ποιο χαρακτηριστικό του γενετικού κώδικα οφείλεται το παραπάνω γεγονός : α. Ο γενετικός κώδικας είναι σχεδόν καθολικός β. Ο γενετικός κώδικας είναι συνεχής γ. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος δ. Ο γενετικός κώδικας είναι εκφυλισμένος To mrna από οποιοδήποτε οργανισμό μπορεί να μεταφραστεί σε βακτηριακά ή φυτικά ή ζωικά κύτταρα και in vitro να παράγει την ίδια πρωτεΐνη, σε ποιο χαρακτηριστικό του γενετικού κώδικα οφείλεται το παραπάνω γεγονός : α. Ο γενετικός κώδικας έχει κωδικόνια έναρξης και λήξης β. Ο γενετικός κώδικας είναι συνεχής γ. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος δ. Ο γενετικός κώδικας είναι σχεδόν καθολικός Ένα αμινοξύ μπορεί να κωδικοποιείται από 2 έως και 6 διαφορετικά κωδικόνια, σε ποιο χαρακτηριστικό του γενετικού κώδικα οφείλεται το παραπάνω γεγονός : α. Ο γενετικός κώδικας είναι σχεδόν καθολικός β. Ο γενετικός κώδικας είναι συνεχής γ. Ο γενετικός κώδικας είναι διφορούμενος δ. Ο γενετικός κώδικας είναι εκφυλισμένος Η αιμοσφαιρίνη, μία πρωτεΐνη που υπάρχει στα ανθρώπινα κύτταρα μπορεί να παραχθεί και σε ζωικά κύτταρα. Σε ποιο χαρακτηριστικό του γενετικού κώδικα οφείλεται το γεγονός αυτό : α ο γενετικός κώδικας είναι εκφυλισμένος β. ο γενετικός κώδικας είναι σχεδόν παγκόσμιος γ. ο γενετικός κώδικας είναι μη επικαλυπτόμενος δ. ο γενετικός κώδικας είναι συνεχής Στο αμινοξύ λευκίνη αντιστοιχούν 6 κωδικόνια. Σε ποιο χαρακτηριστικό του γενετικού κώδικα οφείλεται το γεγονός αυτό : α ο γενετικός κώδικας είναι εκφυλισμένος β. ο γενετικός κώδικας είναι σχεδόν παγκόσμιος γ. ο γενετικός κώδικας είναι μη επικαλυπτόμενος δ. ο γενετικός κώδικας είναι συνεχής Για τις τριπλέτες νουκλεοτιδίων του γενετικού κώδικα ισχύει: α. ότι όλες κωδικοποιούν αμινοξύ β. ότι μία τριπλέτα μπορεί να κωδικοποιεί από ένα μέχρι και τέσσερα διαφορετικά αμινοξέα γ. ότι υπάρχουν συνώνυμα αμινοξέα που κωδικοποιούνται από το ίδιο κωδικόνιο δ. τίποτε από τα παραπάνω Το κωδικόνιο (mrna) που είναι υπεύθυνο για την προσθήκη του αμινοξέος μεθειονίνη είναι : α. 3 -AUG-5 β. 3 -GUA-5 γ. 3 -UAG-5 δ. 3 -UAC Για την αλληλουχία 3 -ΑΑΑ-5 της μη κωδικής αλυσίδας ενός γονιδίου, το κωδικόνιο του mrna που αντιστοιχεί σε αυτή είναι..: α. Το 5 -ΑΑΑ-3 που αντιστοιχεί στη λυσίνη β. Το 5 -ΑΑΑ-3 που αντιστοιχεί στη φαινυλαλανίνη 50

51 γ. Το 5 -ΤΤΤ-3 που αντιστοιχεί στην αργινίνη. δ. Το 5 -UUU-3 που αντιστοιχεί στη φαινυλαλανίνη Να βρείτε τη μη κωδική που από τη μεταγραφή της προκύπτει το mrna που είναι υπεύθυνο για την πολυπεπτιδική αλυσίδα phe-pro-lys. α.5 -UUUGGGAAA-3 β.5 -GAACCCCTT-3 γ. 5 -ΑΑΑΑCCTTT-3 δ. 5 -CTTCGGGAA-3 ε.5 -AAACCCUUU-3 2.Ποια από τις ακόλουθες αλληλουχίες κωδικοποιεί την πεπτιδική αλληλουχία ΝΗ 2 -arg-gly-asp-cooh α.5 -AGA-GGA-GAU-3 β. 5 -ACA-CCC-ACU-3 γ. 5 -GGG-AAA-UUU-3 δ. 5 -CGG-GGU-GAC-3 Β. Ερωτήσεις τύπου σωστό-λάθος. Να χαρακτηρίσετε τις παρακάτω προτάσεις ως σωστές (Σ) ή λανθασμένες (Λ) Με τη διαδικασία της μεταγραφής η γενετική πληροφορία μεταφέρεται από το γονίδιο στο mrna Η αλληλουχία των βάσεων στο γονίδιο και στο mrna καθορίζουν την αλληλουχία των αμινοξέων στην πρωτεΐνη. ( ) Τα τέσσερα νουκλεοτίδια αν συνδυαστούν ανά 2 δεν δίνουν αρκετούς συνδυασμούς για να κωδικοποιηθούν όλα τα αμινοξέα.( ) Και τα είκοσι αμινοξέα κωδικοποιούνται από παραπάνω από ένα κωδικόνια. ( ) Ένα κωδικόνιο μπορεί να αντιστοιχεί και σε παραπάνω από ένα αμινοξέα.( ) Μόνο η μεθειονίνη αντιστοιχεί σε ένα κωδικόνιο. ( ) Η μεθειονίνη και η τρυπτοφάνη κωδικοποιούνται μόνο από ένα κωδικόνιο.( ) Το κωδικόνιο έναρξης AUG δεν αντιστοιχεί σε αμινοξύ.( ) Τα κωδικόνια λήξης UAA,UAG,UGA δεν αντιστοιχούν σε αμινοξέα Ο όρος κωδικόνιο δεν αφορά μόνο το mrna, αλλά και το γονίδιο που παράγεται. ( ) Στα κωδικόνια λήξης αντιστοιχούν τα αμινοξέα βαλίνη, αλανίνη ή μεθειονίνη. ( ) Το mrna της ανθρώπινης προϊνσουλίνης σε εκχυλίσματα βακτηριακών κυττάρων in vitro παράγει προϊνσουλίνη. ( ) Γ. Ερωτήσεις συμπλήρωσης κενών. Να συμπληρώσετε τα κενά στις παρακάτω προτάσεις με τους σωστούς ορούς Ο κώδικας αντιστοίχισης της αλληλουχίας των νουκλεοτιδίων με την αλληλουχία των αμινοξέων στην πρωτεΐνη ονομάζεται Ο γενετικός κώδικας είναι ένα κώδικας, δηλαδή μία τριάδα βάσεων το, κωδικοποιεί ένα αμινοξύ Ο γενετικός κώδικας είναι,δηλαδή διαβάζεται χωρίς να παραλείπεται κανένα νουκλεοτίδιο Ο γενετικός κώδικας είναι, δηλαδή κάθε νουκλεοτίδιο ανήκει σε ένα μόνο κωδικόνιο Ο γενετικός κώδικας είναι, δηλαδή όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα Ο γενετικός κώδικας χαρακτηρίζεται ως, με εξαίρεση δύο αμινοξέα τα υπόλοιπα 18 κωδικοποιούνται από 2 έως και 6 κωδικόνια Τα κωδικόνια που κωδικοποιούν το ίδιο αμινοξύ ονομάζονται Το τμήμα του mrna, και του αντίστοιχου γονιδίου, που είναι υπεύθυνο για την προσθήκη των αμινοξέων ξεκινά με το κωδικόνιο ( AUG) και τελειώνει με το κωδικόνιο ( UAA,UAG UGA ) Η αλληλουχία των στο μόριο ενός mrna καθορίζει την αλληλουχία των αμινοξέων της αντίστοιχης. Δ. Ερωτήσεις ανάπτυξης Τι είναι το κωδικόνιο έναρξης και τι τα συνώνυμα κωδικόνια; Ποια είναι τα βασικά χαρακτηριστικά του γενετικού κώδικα και πώς περιγράφονται; Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση ένα κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. α. Τι σημαίνει η έκφραση «ο γενετικός κώδικας είναι συνεχής και σχεδόν καθολικός»; β. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος; Τι σημαίνει: ο γενετικός κώδικας είναι συνεχής και μη επικαλυπτόμενος ; 51

52 Τι εξυπηρετεί η ύπαρξη συνώνυμων κωδικονίων; Πού βασίζεται το γεγονός ότι η ανθρώπινη ινσουλίνη μπορεί να παραχθεί in vitro και από βακτηριακά κύτταρα; α.αν ένα ζεύγος νουκλεοτιδίων ήταν υπεύθυνο για την προσθήκη ενός αμινοξέος, πόσα είδη αμινοξέων το μέγιστο θα μπορούσε να είχε μία πρωτεΐνη ; β.αν ένα κωδικόνιο ήταν υπεύθυνο για την προσθήκη παραπάνω από του ενός αμινοξέος, τι συνέπεια θα είχε το παραπάνω γεγονός στη γονιδιακή έκφραση ; γ.αν κάθε αμινοξύ αντιστοιχούσε μόνο σε ένα κωδικόνιο, δηλαδή 20 κωδικόνια αντιστοιχούσαν σε 20 αμινοξέα. Τα υπόλοιπα 44 κωδικόνια αν αντιστοι- χούσαν σε κωδικόνια λήξης, τι συνέπεια θα είχε το παραπάνω γεγονός στη γονιδιακή έκφραση ; Ε. Ασκήσεις-Ερωτήσεις -Προβλήματα Και με την βοήθεια του γενετικού κώδικα που σας δίνεται, να απαντήσετε στις ερωτήσεις που ακολουθούν Α. Ποιο είναι το κωδικόνιο έναρξης και σε ποιο αμινοξύ αντιστοιχεί ; Β. Ποια κωδικόνια δεν αντιστοιχούν σε αμινοξύ και ποιος ο ρόλος τους ; Γ. Ποιο (ή ποια) αμινοξέα κωδικοποιούνται μόνο από ένα κωδικόνιο και ποιο (ή ποια ) είναι αυτό ( ή αυτά) ; Δ. Πόσα κωδικόνια αντιστοιχούν στο αμινοξύ σερίνη ( ser ),πόσα στην αργινίνη ( arg) και πόσα στη γλυκίνη ( gly) Ε. Να γράψετε τα κωδικόνια που κωδικοποιούν το γλουταμινικό οξύ ( glu) ΣΤ. Να γράψετε τα κωδικόνια που αντιστοιχούν στο ασπαρτικό οξύ (asp) Ζ. Ποιο αμινοξύ κωδικοποιούν τα κωδικόνια : UUU, GCG, ACU,UAA Με τη βοήθεια του γενετικού κώδικα να βρείτε την αλληλουχία των αμινοξέων που προκύπτει από την μετάφραση των παρακάτω υποθετικών μορίων mrna. i.) 5-GAAAUGCCAAACCACUAAUUU-3 ii.) 5-AUGUUAAAGGCCCCUUAA-3 iii.) 5-GGGGGGAUGGUGUUGUAAAAAAAA Δίνονται τα παρακάτω μόρια mrna. Να βρείτε τα κωδικόνια καθώς και την σειρά των αμινοξέων που αντιστοιχούν σε αυτά : α. 5 AUGGGGGAGGUGGAAUAG-3 β. 5-AUGUUUUAUUUGGGAGAGCCCUAA-3 γ. 5AUGUAUCGCCUUCUCCCAAAGAAAUGA-3 δ. 5-AUGCCACGCCGGGAGGCCCGGCACUAA-3 ε. 5AUGCUAAAAAAGAUUAUAUUCUAA-3 Να γίνει χρήση του γενετικού κώδικα Να γραφούν οι όλες οι πιθανές αλληλουχίες του mrna που αντιστοιχεί στο πεπτίδιο : ΝΗ 2 -tyr-met-gln-cooh + H 3N + H 3N + H 3N + H 2N H 2C + H 3N H C COO - C CH 3 H + H 3N COO - C CH 2 SH H COO - COO - COO - C H COO - + H 3N C H + H 3N C H CH + CH 2 H 3N C H 2 H + H C CH 3 C N H CH CH 2 COO - C CH 2 CH 2 CH 2 CH 2 NH 3 + H COO - C CH 2 COO - C C CH 3 H H OH + H 3N H 3C + H 3N H 2N + H 3N H 3C COO - C CH 2 CH H COO - C CH 2 CH 2 C CH 3 O H COO - C CH H CH 3 1 η θέση 2 η θέση 3 η θέση U C A G U UUU phe UCU ser UAU tyr UGU cys U UUC phe UCC ser UAC tyr UGC cys C UUA leu UCA ser UAA stop UGA stop A UUG leu UCG ser UAG stop UGG trp G C CUU leu CCU pro CAU his CGU arg U CUC leu CCC pro CAC his CGC arg C CUA leu CCA pro CAA gln CGA arg A CUG leu CCG pro CAG gln CGG arg G A AUU ile ACU thr AAU asn AGU ser U AUC ile ACC thr AAC asn AGC ser C AUA ile ACA thr AAA lys AGA arg A AUG met ACG thr AAG lys AGG arg G G GUU val GCU ala GAU asp GGU gly U GUC val GCC ala GAC asp GGC gly C GUA val GCA ala GAA glu GGA gly A GUG val GCG ala GAG glu GGG gly G + H 3N + H 3N + H 3N + H 3N HC C COO - C CH 2 H COO - C N H COO - CH 2 CH 2 S CH 3 COO - CH 2 CH 2 CH 2 NH C NH 2 H COO - C CH 2 C HC H N H NH 2 + H + H 3N + H 3N H 2N + H 3N H + H 3N COO - C CH 2 CH 2 COO - CH 3 COO - C CH 2 C C O H H COO - C H COO - C CH 2 OH H OH H 52

53 2.5.Μετάφραση Να συμπληρώσετε τα κενά του παρακάτω κειμένου, ώστε να προκύπτει το σωστό νόημα, με τις λέξεις-κλειδιά της παρένθεσης. ( trnas, mrna,rrna, νουκλεοτιδίων,αμινοξέων). Κατά τη μετάφραση το κύτταρο αξιοποιεί την αλληλουχία του και τη μεταφράζει σε μία αλληλουχία της πρωτεΐνης.η μετάφραση είναι μία πολύπλοκη διαδικασία όπου συμμετέχουν 3 είδη RNA. Το μεταφέρει τη γενετική πληροφορία στα ριβοσώματα όπου πραγματοποιείται η μετάφραση. Το μαζί με πρωτεΐνες σχηματίζουν το ριβόσωμα. Τα μεταφέρουν τα αμινοξέα από διάφορα σημεία του κυττάρου στα ριβοσώματα όπου πραγματοποιείται η μετάφραση Με βάση το σχήμα που σας δίνεται να απαντήσετε τις ερωτήσεις που ακολουθούν. met UAC αντικωδικόνιο στο trna -AUG-3' Αμινοξύ μεθειονίνη (met) Μόριο trna Κωδικόνιο στο mrna Α. Ποιες είναι οι δύο ειδικές θέσεις που χαρακτηρίζουν οποιοδήποτε μόριο trna ; α. Το κωδικόνιο και το αντικωδικόνιο β. Το κωδικόνιο και μία θέση πρόσδεσης αμινοξέος. γ. Το αντικωδικόνιο και μία θέση πρόσδεσης αμινοξέος. Β. Το trna με αντικωδικόνιο 3 -UAC-5 μεταφέρει πάντα : α. Οποιοδήποτε αμινοξύ β. Το αμινοξύ μεθειονίνη(met) που αντιστοιχεί στο κωδικόνιο 5 -AUG-3 γ. Το αμινοξύ μεθειονίνη (met) που αντιστοιχεί στο κωδικόνιο UAC. Γ. Είναι σωστός ο ισχυρισμός ότι το αμινοξύ γλουταμινικό οξύ (glu) μπορεί να μεταφερθεί στα ριβοσώματα από δύο διαφορετικά trnas; α. Ναι β. Όχι Δ. Είναι σωστός ο ισχυρισμός ότι ένα συγκεκριμένο μόριο trnaμπορεί να μεταφέρει 2 διαφορετικά αμινοξέα (για παράδειγμα αυτό που έχει αντικωδικόνιο το 3 -CUU-5 να μεταφέρει τη μεθειονίνη(met) ή να μεταφέρει το γλουταμινικό οξύ(glu) ); α. Ναι β. Όχι Ε. Είναι σωστός ο ισχυρισμός ότι ένα συγκεκριμένο μόριο trna μπορεί να μεταφέρει μόνο ένα συγκεκριμένο αμινοξύ (για παράδειγμα αυτό που έχει αντικωδικόνιο το 3 -CUU-5 να μεταφέρει πάντα το γλουταμινικό οξύ(glu) ); α. Ναι β. Όχι glu Αμινοξύ γλουταμινικό οξύ (glu) Μόρια trna CUC αντικωδικόνιο στο trna -GAG-3' Κωδικόνιο στο mrna glu CUU αντικωδικόνιο στο trna -GAA-3' Κωδικόνιο στο mrna 53

54 Με βάση την εικόνα να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το ριβόσωμα.. : α. αποτελείται αποκλειστικά από πρωτεΐνες. β. αποτελείται αποκλειστικά από rrna. γ. αποτελείται από rrna και πρωτεΐνες. Β. Το ριβόσωμα. : α. είναι ένα ενιαίο σωματίδιο. β. αποτελείται από δύο υπομονάδες ίσου μεγέθους. γ. αποτελείται από δύο υπομονάδες, μία μικρή και μία μεγάλη. Γ. Είναι σωστός ο ισχυρισμός ότι οι δύο υπομονάδες του ριβοσώματος είναι πάντα ενωμένες μεταξύ τους; α. Ναι β. Όχι Τι διαθέτει το ριβόσωμα.. : α. Δύο θέσεις πρόσδεσης για trna στη μεγάλη υπομονάδα και μία θέση πρόσδεσης για mrna στη μικρή υπομονάδα. β. Δύο θέσεις πρόσδεσης για mrna στη μεγάλη υπομονάδα και μία θέση πρόσδεσης για trna στη μικρή υπομονάδα. γ. Δύο θέσεις πρόσδεσης για trna στη μικρή υπομονάδα και μία θέση πρόσδεσης για trna στη μεγάλη υπομονάδα. δ. Μία θέση πρόσδεσης για mrna στη μεγάλη υπομονάδα και δύο θέσεις πρόσδεσης για trna στη μικρή υπομονάδα Α. Από τι αποτελείται το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης ; α. Από το mrna και τη μικρή υπομονάδα του ριβοσώματος β. Από το mrna και το 1 ο trna που μεταφέρει το αμινοξύ μεθειονίνη(met) γ. Από το mrna, το 1 ο trna που μεταφέρει το αμινοξύ μεθειονίνη (met) και τη μικρή υπομονάδα του ριβοσώματος. δ. Από το mrna, το 1 ο trna που μεταφέρει το αμινοξύ μεθειονίνη (met) τη μικρή και τη μεγάλη υπομονάδα του ριβοσώματος. Β. Τι συνδέεται στο mrna με βάση τον κανόνα της συμπληρωματικότητας : α. Μόνο η μικρή υπομονάδα του ριβοσώματος με τη 5 αμετάφραστη περιοχή του mrna. β. Μόνο το trna με το mrna (αντικωδικόνιοκωδικόνιο) γ. Και η μικρή υπομονάδα του ριβοσώματος και το trna συνδέονται με το mrna με βάση τον κανόνα της συμπληροματικότητας. Γ. Είναι σωστός ο ισχυρισμός ότι πάντα το πρώτο trna έχει αντικωδικόνιο το 3 -UAC-5 και μεταφέρει το αμινοξύ μεθειονίνη (met) ; α. Ναι β. Όχι 54

55 Α. Μετά τη σύνδεση και της μεγάλης υπομονάδας του ριβοσώματος,το ριβόσωμα πόσες θέσεις υποδοχής για trna διαθέτει ; α. Μία β. Δύο γ. Τρεις Β. Πόσες θέσεις του ριβοσώματος είναι ήδη κατειλημμένες ; α. Μία β. Δύο γ. Τρεις Γ. Πόσες θέσεις του ριβοσώματος είναι ελευθέρες ; α. Μία β. Δύο γ. Τρεις Δ. Ποια trna θα μπορούν να συνδεθούν στο ριβόσωμα τη χρονική στιγμή που δείχνει το σχήμα ; α. Στη θέση-α μόνο το trna που μεταφέρει το αμινοξύ glu με αντικωδικόνιο 3 -CUC-5. β. Στη θέση-α μόνο το trna που μεταφέρει το αμινοξύ gly με αντικωδικόνιο 3 -CCC-5. γ. Στη θέση-α ή το trna που μεταφέρει το αμινοξύ glu με αντικωδικόνιο 3 -CUC-5 ή το trna που μεταφέρει το αμινοξύ gly με αντικωδικόνιο 3 -CCC-5. δ. Στη θέση-α και το trna που μεταφέρει το αμινοξύ glu με αντικωδικόνιο 3 -CUC-5 και το trna που μεταφέρει το αμινοξύ gly με αντικωδικόνιο 3 -CCC-5. Σας δίνεται στο παρακάτω σχήμα η επιμήκυνση της πεπτιδικής αλυσίδας. Α. Τι συνδέεται με πεπτιδικό δεσμό ; α. Τα αμινοξέα met-glu μεταξύ τους β. Τα trna που μεταφέρουν τα αμινοξέα met και glu μεταξύ τους γ. Τα trna που μεταφέρουν τα αμινοξέα met και glu με το mrna. δ. Τη μικρή και τη μεγάλη υπομονάδα. Β. Μετά τη πρόσδεση του 2 ο trna.. α. Σχηματίζεται πεπτιδικός δεσμός μεταξύ των αμινοξέων met-glu. β. Σχηματίζεται πεπτιδικός δεσμός μεταξύ των αμινοξέων met-gly. γ. Τα αμινοξέα met και glu δε συνδέονται μεταξύ τους. Γ. Μετά το σχηματισμό του πεπτιδικού δεσμού το ριβόσωμα : α. Παραμένει στη θέση του β. Μετακινείται κατά ένα νουκλεοτίδιο γ. Μετακινείται κατά τρία νουκλεοτίδια. Δ. Μετά τη μετακίνηση του ριβοσώματος το trna που μεταφέρει το αμινοξύ (met) α. Παραμένει στο ριβόσωμα β. Αποχωρίζεται από το ριβόσωμα και επανασυνδέεται με το αμινοξύ met. γ. Αποχωρίζεται από το ριβόσωμα και αυτοκαταστρέφεται. 55

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

1.1. Το γενετικό υλικό είναι το DNA 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ

1.1. Το γενετικό υλικό είναι το DNA 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1.1. Το γενετικό υλικό είναι το DNA ΒΑΣΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1.1.1 Γιατί οι επιστήμονες πίστευαν ότι τα μόρια που μεταφέρουν τη γενετική πληροφορία είναι οι πρωτεΐ νες; Οι επιστήμονες

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Stylianos Kalaitzis A1-1

Stylianos Kalaitzis A1-1 A1-το γενετικό υλικό Stylianos Kalaitzis A1-1 Περιεχόμενα Σημειώσεις Θεωρίας Το γενετικό υλικό Μεθοδολογία ασκήσεων έκφρασης Μεταλλάξεις και οι σχέση τους με τη μενδελική κληρονομικότητα Μενδελική κληρονομικότητα

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. γ Α5. β ΘΕΜΑ B B1. Σε κάθε νουκλεοτίδιο η αζωτούχος βάση συνδέεται με τον 1' άνθρακα της δεοξυριβόζης και η φωσφορική

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΠΩΣ ΚΑΤΑΛΗΞΑΜΕ ΣΤΟ ΣΥΜΠΕΡΑΣΜΑ ΟΤΙ ΤΟ DNA ΕΙΝΑΙ ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ;

DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΠΩΣ ΚΑΤΑΛΗΞΑΜΕ ΣΤΟ ΣΥΜΠΕΡΑΣΜΑ ΟΤΙ ΤΟ DNA ΕΙΝΑΙ ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ; DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΠΩΣ ΚΑΤΑΛΗΞΑΜΕ ΣΤΟ ΣΥΜΠΕΡΑΣΜΑ ΟΤΙ ΤΟ DNA ΕΙΝΑΙ ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ; ΠΕΙΡΑΜΑ GRIFFITH 1928 ΕΠΑΝΑΛΗΨΗ ΠΕΙΡΑΜΑΤΟΣ GRIFFITH IN VITRO ΑΠO ΤΟΥΣ AVERY MAC-CLEOD MC-CARTHY- 1944 ΒΙΟΧΗΜΙΚΑ Ε

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΝΟΤΑ ΛΑΖΑΡΑΚΗ. 2η έκδοση. βιολογία ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ 2η έκδοση βιολογία Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ περιεχόμενα Κεφάλαιο 1 Το γενετικό υλικό...13 Κεφάλαιο 2 Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας... 65 Κεφάλαιο 3 Ιοί...127

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Το σχεδιάγραµµα πιο κάτω παριστάνει τον αυτοδιπλασιασµό και το διαµοιρασµό των χρωµατοσωµάτων στα θυγατρικά κύτταρα.

Το σχεδιάγραµµα πιο κάτω παριστάνει τον αυτοδιπλασιασµό και το διαµοιρασµό των χρωµατοσωµάτων στα θυγατρικά κύτταρα. ΜΙΤΩΣΗ Η διαίρεση του κυττάρου δεν είναι µια απλή διαδικασία, όπως για παράδειγµα µια φυσαλίδα που καθώς µεγαλώνει χωρίζεται στα δύο. Η κυτταρική διαίρεση περιλαµβάνει τον ακριβοδίκαιο διαµοιρασµό του

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2011 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα