M πλήθος συμβόλων (παρατηρήσεις)
|
|
- ÔΠοσειδῶν Φωτόπουλος
- 7 χρόνια πριν
- Προβολές:
Transcript
1 HMM
2 Περιγραφή ενός HMM N πλήθος καταστάσεων Q = {q 1, q 2,,q T } set καταστάσεων M πλήθος συμβόλων (παρατηρήσεις) O = {o 1, o 2,,o T } set συμβόλων
3 Περιγραφή ενός HMM A Πίνακας πιθανοτήτων μετάβασης a ij = P(q t+1 = j q t = i) ) B κατανομή πιθανοτήτων παρατήρησης b j (k) = P(o t = k q t = j) i k M π κατανομή αρχικών καταστάσεων
4 Περιγραφή ενός HMM Άρα ένα HMM περιγράφεται πλήρως από την τριάδα: λ = (A,B,π)
5 Markov Chains Rain Sunny Cloudy States : Three states sunny, cloudy, rainy. State transition matrix : The probability of the weather given the previous dayʹs weather. Initial Distribution ib ti : Dfii Defining the probability bilit of the system being in each of the states at time 0. 5
6 Hidden Markov Models dl Hidden states : the (TRUE) states of a system that may be described by a Markov process (e.g., the weather). Observable states : the states of the process that are `visibleʹ (e.g., seaweed dampness). 6
7 Components of HMM Output matrix : containing the probability of observing a particular observable state given that the hidden model is in a particular hidden state. Initial Distribution : contains the probability of the (hidden) model dlbi being in a particular hidden state t at time t = 1. State transition matrix : holding the probability of a hidden state given the previous hidden state. 7
8 Προβλήματα μοντελοποίησης με Πρόβλημα 1 Αξιολόγηση: η HMM Πιθανότητα εμφάνισης της συγκεκριμένης ακολουθίας παρατήρησης, ης, O = {o 1,,o, k k}, δεδομένου του μοντέλου P(O λ) Πολύπλοκο κρυφές καταστάσεις Χρήσιμο στο classification ακολουθιών
9 Problems With HMM Scoring problem: Given an existing HMM and observed sequence, what is the probability that the HMM can generate the sequence 9
10 Προβλήματα μοντελοποίησης με Πρόβλημα 2 Αποκωδικοποίηση: HMM Βέλτιστη ακολουθία καταστάσεων για την παραγωγή δεδομένων παρατηρήσεων, O = {o 1,,o k }, δεδομένου του μοντέλου Κριτήριο βελτιστοποίησης Χρήσιμο σε προβλήματα αναγνώρισης
11 Problems With HMM Alignment Problem Given a sequence, what is the optimal state sequence that the HMM would use to generate it 11
12 Προβλήματα μοντελοποίησης με Πρόβλημα 3 Μάθηση: HMM Καθορίστε το βέλτιστo μοντέλο, λαμβάνοντας υπόψη τις παρατηρήσεις του συνόλου εκπαίδευσης Βρες λ, τέτοιο ώστε η P(O λ) να μεγιστοποιείται
13 Πρόβλημα 1: απλοϊκή λύση Ακολουθία καταστάσεων Q = (q 1, q T ) Υποθέτουμε ανεξάρτητες παρατηρήσεις: P T ( O q, P( ot qt, ) bq 1( o1 ) bq 2( o2 i 1 )... b Οι παρατηρήσεις είναι ανεξάρτητες μεταξύ τους, δεδομένων των κρυμμένων καταστάσεων. (Η κοινή κατανομή των ανεξάρτητων μεταβλητών παραγοντοποιείται στις κατανομές των ανεξάρτητων ρη μεταβλητών.) qt ( o T )
14 Πρόβλημα 1: απλοϊκή λύση Παρατηρήστε ότι: και: P( q ) a a... a q1 q1q2 q2q3 qt 1qT P ( O ) P( O q, ) P( q ) q
15 Πρόβλημα 1: απλοϊκή λύση Τελικά: P ( O ) P( O q, ) P( q ) q Το πιο πάνω άθροισμα αφορά όλα τις διαδρομές Το πιο πάνω άθροισμα αφορά όλα τις διαδρομές καταστάσεων Υπάρχουν N T διαδρομές καταστάσεων, όπου η καθεμία κοστίζει O(T) υπολογισμούς, που δίνει πολυπλοκότητα O(TN T )
16 Πρόβλημα 1: Αποτελεσματική λύση Forward αλγόριθμος: Ορίζουμε βοηθητική forward μεταβλητή α: ( i) P( o,..., o q i, ) 1 t α t (i) είναι η πιθανότητα παρατήρησης της μερικής ακολουθίας των παρατηρήσεων o 1, o t ώστε τη στιγμή t, η κατάσταση q t =i t t
17 Πρόβλημα 1: Αποτελεσματική λύση Αναδρομικός αλγόριθμος: Αρχικοποίηση: η i Υπολογισμός: P ( i) b ( o ) 1 i 1 N ( j) [ t ( i) aij ] bj ( ot 1) t1 i1 N ( O ) T i 1 ( i) Πολυπλοκότητα O(N 2 T)
18 Πρόβλημα 1: Εναλλακτική Ορίζουμε βοηθητική μεταβλητή β: λύση Backward αλγόριθμος: t ( i) P( o, o,..., o q i, ) t1 t2 T t t (i) είναι η πιθανότητα παρατήρησης της ακολουθίας των παρατηρήσεων o t+1,,o T δεδομένου τη στιγμή t, η κατάσταση q t =i
19 Πρόβλημα 1: Εναλλακτική λύση Αναδρομικός αλγόριθμος: Αρχικοποίηση: T Υπολογισμός: ( j) N 1 t() i t 1 ( j ) aij bj ( ot 1 ) j1 N p( O ) ( i t T 1,..., 1 i1 Πολυπλοκότητα O(N 2 T) 1 )
20 Πρόβλημα 2: Αποκωδικοποίηση Επιλέγουμε ακολουθία καταστάσεων για τη μεγιστοποίηση της πιθανότητας της ακολουθίας παρατήρησης Ο Viterbi είναι επαγωγικός αλγόριθμος που κρατά την καλύτερο ακολουθία καταστάσεων σε κάθε περίπτωση
21 Πρόβλημα 2: Αποκωδικοποίηση Viterbi αλγόριθμος: Ακολουθία καταστάσεων που μεγιστοποιεί το P(O,Q ): P ( 2 q1, q,... qt O, ) Ορίζουμε βοηθητική μεταβλητή δ: ( i ) max P ( q, q,..., q i, o, o,... o ) t ( 1 2 t 1 2 t q δ t (i) το πιο πιθανό μονοπάτι που λήγει στην t( ) μ ήγ η κατάσταση q t =i
22 Αναδρομή: Πρόβλημα 2: Αποκωδικοποίηση Αλγόριθμος: 1. Αρχικοποίηση: Για να πάρουμε την ακολουθία κατάστασεων, πρέπει να παρακολουθούμε τα ορίσματα που τη μεγιστοποιούν, για κάθε t και j. Γίνεται μέσω του πίνακα ψ t (j). ( j) max( t ( i) aij ) b j ( o 1) t1 t i i) b ( ) 1 i N ( 1 i i o1 1( i) 0
23 2. Αναδρομή: Πρόβλημα 2: Αποκωδικοποίηση t ( j) max( t 1( i) a 1i N ij ) b j ( o t ) t ( j) arg max( t 1( i) a 1i N ij ) 2 t T, 1 j N 3. Τερματισμός: P q T max ( i ) 1iN T arg max 1 ii N T P*: δίνει τη βέλτιστη πιθανότητα ως προς την κατάσταση ( i) Q* βέλτιστη ακολουθία (Q* = {q1*,q2*,,qt*})
24 Πρόβλημα 2: Αποκωδικοποίηση 4. Backtrack ακολουθία: q t t1( qt 1) t T 1, T 2,..., 1 O(N 2 T) πολυπλοκότητα λ
25 Πρόβλημα 3: Μάθηση Εκπαίδευση του HMM ώστε να κωδικοποιήσει ακολουθίες παρατηρήσεων ώστε να εντοπίσει μια παρόμοια ακολουθία στο μέλλον Εύρεση λ=(a,b,π), (,, που μεγιστοποιεί μγ το P(O λ) Αλγόριθμος: Αρχικοποίηση: λ 0 Υπολογίζουμε νέο μοντέλο λ, χρησιμοποιώντας τα λ 0 και O λ 0 λ Επαναλαμβάνουμε τη διαδικασία εώς: log P( O ) log P( O 0) d
26 Πρόβλημα 3: Μάθηση Baum Welch αλγόριθμος Βήμα 1: Έστω ξ(i,j) η πιθανότητα να είμαστε στην κατάσταση i τη στιγμή t και τη j όταν t+1, δεδομένου των λ και O ( i, j) ( i) a t ij b j ( o t1 ) P ( O ) t1 ( j) N ( t N i1 j1 i) a ijb j ( ot 1) t 1( j) ( i) a b ( o ) t ij j t1 t1 ( j)
27 Πρόβλημα 3: Μάθηση Δραστηριότητες που απαιτούνται για τον υπολογισμό ρ ηρ η ς γ γ μ της κοινής περίπτωση που το σύστημα βρίσκεται στην κατάσταση Si για t και Sj για t+1
28 Πρόβλημα 3: Μάθηση Έστω γ t (i) η πιθανότητα να είμαστε στην κατάσταση i τη στιγμή t, δεδομένου του O N t ( i) t ( i, j ) j1 T 1 t1 T 1 t1 () i t () i t αναμενόμενο πλήθος μεταβάσεων από i αναμενόμενο πλήθος μεταβάσεων i j
29 Πρόβλημα 3: Μάθηση Baum Welch αλγόριθμος Βήμα 2: ˆ 1( i ) αναμενόμενη συχνότητα κατάστασης i για t=1 t ( i, j) aˆ ij t ( i) Αναλογία αναμενομένων μεταβάσεων από την κατάσταση i στην j προς αναμενόμενες μεταβάσεις από i ˆ t ( k), ot k j t b ( j) ( j ) t Αναλογία αναμενόμενο πλήθος φορών που στην κατάσταση j παρατηρείται το k προς πλήθος φορών στη j
30 Πρόβλημα 3: Μάθηση Baum Welch αλγόριθμος χρησιμοποιεί τους forward και backward αλγορίθμους για τον υπολογισμό των βοηθητικών μεταβλητών α, β Ο BW είναι μια ειδική περίπτωση του αλγορίθμου EM: E βήμα: υπολογισμός των ξ και γ M βήμα: επαναληπτικός υπολογισμός των Πρακτικά ζητήματα: Μπορεί να κολλήσει σε τοπικά μέγιστα ˆ â ˆ ( k) ij b j
31 HMMs in Biology Gene finding and prediction Protein Profile Profile Analysis Secondary Structure prediction Advantages Limitations 31
32 Relationship Between DNA, RNA And Proteins DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 32
33 Protein Structure Primary Structure of Proteins The primary structure of peptides and proteins refers to the linear number and order of the amino acids present. 33
34 Protein Structure Secondary Structure Protein secondary structure refers to regular, repeated patters of folding of the protein backbone. How a protein folds is largely dictated by the primary sequence of amino acids 34
35 What is a (protein coding) gene? DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 35
36 In more detail (color ~state) (Left) (Removed) 36
37 Gene Finding HMMs Our Objective: To find the coding and non coding regions of an unlabeled string of DNA nucleotides Our Motivation: Assist in the annotation of genomic data produced by genome sequencing methods Gain insight into the mechanisms involved in transcription, splicing and other processes 37
38 Why HMMs Classification: Classifying observations within a sequence Od Order: A DNA sequence is a set of ordered dobservations Grammar : Our grammatical structure (and the beginnings of our architecture) is right here: Success measure: # of complete exons correctly labeled Training i data: Available from various genome annotation projects 38
39 HMMs for gene finding Training Expectation Maximization (EM) Parsing Viterbi algorithm An HMM for unspliced genes. x : non coding DNA c : coding state
40 Protein Profile HMMs Motivation Given a single amino acid target sequence of unknown structure, we want to infer the structure of the resulting protein. Use Profile Similarity What is a Profile? Proteins families of related sequences and structures Same function Clear evolutionary relationship Patterns of conservation, some positions are more conserved than the others 40
41 An Overview Aligned Sequences Build a Profile HMM (Training) Database search Query against Profile HMM database (Forward) Multiple alignments (Viterbi) 41
42 Building from an existing alignment ACA ATG TCA ACT ATC ACA C AGC AGA ATC ACC G ATC Output Probabilities insertion Transition probabilities A HMM model for a DNA motif alignments, The transitions are shown with arrows whose thickness indicate their probability. In each state, the histogram shows the probabilities of the four bases.
43 Database Searching Given HMM, M, for a sequence family, find all members of the family in data base. LL score LL(x) = log P(x M) (LL score is length dependent must normalize or use Z score) 43
44 Query a new sequence Suppose I have a query protein sequence, and I am interested in which family it belongs to? There can be many paths leading to the generation of this sequence. Need to find all these paths and sum the probabilities. Consensus sequence: ACAC ATC P (ACACATC) C) = 0.8x1 08 x 0.8x1 08 x 0.8x x 0.4x0.6 0 x 1x1 x 0.8x1 x 0.8 = 4.7 x 10 2
45 Multiple Alignments Try every possible path through the model that would produce the target sequences Keep the best one and its probability. Output : Sequence of match, insert and delete states Viterbi alg. Dynamic Programming 45
46 Building unaligned sequences Baum Welch Expectation maximization method Start with a model whose length matches the average length of the sequences and with random output and transition probabilities. Align all the sequences to the model. Use the alignment to alter the output and transition probabilities Repeat. Continue until the model stops changing By product: It produced a multiple alignment 46
47 PHMM Example An alignment of 30 short amino acid sequences chopped out of a alignment of the SH3 domain. The shaded area are the most conserved and were represented by the main states in the HMM. The unshaded aea area was represented ese e by an insert state. 47
48 Prediction of Protein Secondary structures Prediction of secondary structures is needed for the prediction of protein function. Analyze the amino acid sequences of proteins Learn secondary structures hli helix, sheet and turn Predict the secondary structures of sequences 48
49 Advantages Characterize e an entire family of sequences. Position dependent character distributions and position dependent insertion and deletion gap penalties. Built on a formal probabilistic bili basis Can make libraries of hundreds of profile HMMs and apply them on a large scale (whole genome) 49
50 Demos Speech synthesis
ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ ΙΙ. Δυναμικός Προγραμματισμός. Παντελής Μπάγκος
ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ ΙΙ Δυναμικός Προγραμματισμός Παντελής Μπάγκος Δυναμικός Προγραμματισμός Στοίχιση (τοπική-ολική) RNA secondary structure prediction Διαμεμβρανικά τμήματα Hidden Markov Models Άλλες εφαρμογές
Διαβάστε περισσότεραΑναγνώριση Προτύπων. Σημερινό Μάθημα
Αναγνώριση Προτύπων Σημερινό Μάθημα Bias (απόκλιση) και variance (διακύμανση) Ελεύθεροι Παράμετροι Ελεύθεροι Παράμετροι Διαίρεση dataset Μέθοδος holdout Cross Validation Bootstrap Bias (απόκλιση) και variance
Διαβάστε περισσότεραThe challenges of non-stable predicates
The challenges of non-stable predicates Consider a non-stable predicate Φ encoding, say, a safety property. We want to determine whether Φ holds for our program. The challenges of non-stable predicates
Διαβάστε περισσότεραΒιοπληροφορική. Ενότητα 14: Μοντέλα Πολλαπλής Στοίχισης (2/2), 1.5ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου
Βιοπληροφορική Ενότητα 14: Μοντέλα Πολλαπλής Στοίχισης (2/2), 1.5ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι παρουσίαση των μοντέλων πολλαπλής στοίχισης. κατανόηση των εφαρμογών
Διαβάστε περισσότεραSection 8.3 Trigonometric Equations
99 Section 8. Trigonometric Equations Objective 1: Solve Equations Involving One Trigonometric Function. In this section and the next, we will exple how to solving equations involving trigonometric functions.
Διαβάστε περισσότεραEM Baum-Welch. Step by Step the Baum-Welch Algorithm and its Application 2. HMM Baum-Welch. Baum-Welch. Baum-Welch Baum-Welch.
Baum-Welch Step by Step the Baum-Welch Algorithm and its Application Jin ichi MURAKAMI EM EM EM Baum-Welch Baum-Welch Baum-Welch Baum-Welch, EM 1. EM 2. HMM EM (Expectationmaximization algorithm) 1 3.
Διαβάστε περισσότεραPhysical DB Design. B-Trees Index files can become quite large for large main files Indices on index files are possible.
B-Trees Index files can become quite large for large main files Indices on index files are possible 3 rd -level index 2 nd -level index 1 st -level index Main file 1 The 1 st -level index consists of pairs
Διαβάστε περισσότεραBMI/CS 776 Lecture #14: Multiple Alignment - MUSCLE. Colin Dewey
BMI/CS 776 Lecture #14: Multiple Alignment - MUSCLE Colin Dewey 2007.03.08 1 Importance of protein multiple alignment Phylogenetic tree estimation Prediction of protein secondary structure Critical residue
Διαβάστε περισσότεραΒιοπληροφορική. Ενότητα 14: Μοντέλα Πολλαπλής Στοίχισης (2/2), 1.5ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου
Βιοπληροφορική Ενότητα 14: Μοντέλα Πολλαπλής Στοίχισης (2/2), 1.5ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι παρουσίαση των μοντέλων πολλαπλής στοίχισης. κατανόηση των εφαρμογών
Διαβάστε περισσότεραΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 19/5/2007
Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Αν κάπου κάνετε κάποιες υποθέσεις να αναφερθούν στη σχετική ερώτηση. Όλα τα αρχεία που αναφέρονται στα προβλήματα βρίσκονται στον ίδιο φάκελο με το εκτελέσιμο
Διαβάστε περισσότεραPhys460.nb Solution for the t-dependent Schrodinger s equation How did we find the solution? (not required)
Phys460.nb 81 ψ n (t) is still the (same) eigenstate of H But for tdependent H. The answer is NO. 5.5.5. Solution for the tdependent Schrodinger s equation If we assume that at time t 0, the electron starts
Διαβάστε περισσότεραThe Simply Typed Lambda Calculus
Type Inference Instead of writing type annotations, can we use an algorithm to infer what the type annotations should be? That depends on the type system. For simple type systems the answer is yes, and
Διαβάστε περισσότεραΠρόβλημα 1: Αναζήτηση Ελάχιστης/Μέγιστης Τιμής
Πρόβλημα 1: Αναζήτηση Ελάχιστης/Μέγιστης Τιμής Να γραφεί πρόγραμμα το οποίο δέχεται ως είσοδο μια ακολουθία S από n (n 40) ακέραιους αριθμούς και επιστρέφει ως έξοδο δύο ακολουθίες από θετικούς ακέραιους
Διαβάστε περισσότεραPartial Differential Equations in Biology The boundary element method. March 26, 2013
The boundary element method March 26, 203 Introduction and notation The problem: u = f in D R d u = ϕ in Γ D u n = g on Γ N, where D = Γ D Γ N, Γ D Γ N = (possibly, Γ D = [Neumann problem] or Γ N = [Dirichlet
Διαβάστε περισσότεραC.S. 430 Assignment 6, Sample Solutions
C.S. 430 Assignment 6, Sample Solutions Paul Liu November 15, 2007 Note that these are sample solutions only; in many cases there were many acceptable answers. 1 Reynolds Problem 10.1 1.1 Normal-order
Διαβάστε περισσότεραElements of Information Theory
Elements of Information Theory Model of Digital Communications System A Logarithmic Measure for Information Mutual Information Units of Information Self-Information News... Example Information Measure
Διαβάστε περισσότεραΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΨΥΧΟΛΟΓΙΚΕΣ ΕΠΙΠΤΩΣΕΙΣ ΣΕ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ ΓΕΩΡΓΙΑ ΤΡΙΣΟΚΚΑ Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ
Διαβάστε περισσότεραEE512: Error Control Coding
EE512: Error Control Coding Solution for Assignment on Finite Fields February 16, 2007 1. (a) Addition and Multiplication tables for GF (5) and GF (7) are shown in Tables 1 and 2. + 0 1 2 3 4 0 0 1 2 3
Διαβάστε περισσότεραLecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3
Lecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3 1 State vector space and the dual space Space of wavefunctions The space of wavefunctions is the set of all
Διαβάστε περισσότερα[1] P Q. Fig. 3.1
1 (a) Define resistance....... [1] (b) The smallest conductor within a computer processing chip can be represented as a rectangular block that is one atom high, four atoms wide and twenty atoms long. One
Διαβάστε περισσότεραConcrete Mathematics Exercises from 30 September 2016
Concrete Mathematics Exercises from 30 September 2016 Silvio Capobianco Exercise 1.7 Let H(n) = J(n + 1) J(n). Equation (1.8) tells us that H(2n) = 2, and H(2n+1) = J(2n+2) J(2n+1) = (2J(n+1) 1) (2J(n)+1)
Διαβάστε περισσότεραInstruction Execution Times
1 C Execution Times InThisAppendix... Introduction DL330 Execution Times DL330P Execution Times DL340 Execution Times C-2 Execution Times Introduction Data Registers This appendix contains several tables
Διαβάστε περισσότεραΕΙΣΑΓΩΓΗ ΣΤΗ ΣΤΑΤΙΣΤΙΚΗ ΑΝΑΛΥΣΗ
ΕΙΣΑΓΩΓΗ ΣΤΗ ΣΤΑΤΙΣΤΙΚΗ ΑΝΑΛΥΣΗ ΕΛΕΝΑ ΦΛΟΚΑ Επίκουρος Καθηγήτρια Τµήµα Φυσικής, Τοµέας Φυσικής Περιβάλλοντος- Μετεωρολογίας ΓΕΝΙΚΟΙ ΟΡΙΣΜΟΙ Πληθυσµός Σύνολο ατόµων ή αντικειµένων στα οποία αναφέρονται
Διαβάστε περισσότεραStatistical Inference I Locally most powerful tests
Statistical Inference I Locally most powerful tests Shirsendu Mukherjee Department of Statistics, Asutosh College, Kolkata, India. shirsendu st@yahoo.co.in So far we have treated the testing of one-sided
Διαβάστε περισσότεραΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 24/3/2007
Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Όλοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα μικρότεροι του 10000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Αν κάπου κάνετε κάποιες υποθέσεις
Διαβάστε περισσότεραModels for Probabilistic Programs with an Adversary
Models for Probabilistic Programs with an Adversary Robert Rand, Steve Zdancewic University of Pennsylvania Probabilistic Programming Semantics 2016 Interactive Proofs 2/47 Interactive Proofs 2/47 Interactive
Διαβάστε περισσότεραMath 6 SL Probability Distributions Practice Test Mark Scheme
Math 6 SL Probability Distributions Practice Test Mark Scheme. (a) Note: Award A for vertical line to right of mean, A for shading to right of their vertical line. AA N (b) evidence of recognizing symmetry
Διαβάστε περισσότεραOrdinal Arithmetic: Addition, Multiplication, Exponentiation and Limit
Ordinal Arithmetic: Addition, Multiplication, Exponentiation and Limit Ting Zhang Stanford May 11, 2001 Stanford, 5/11/2001 1 Outline Ordinal Classification Ordinal Addition Ordinal Multiplication Ordinal
Διαβάστε περισσότεραΑΛΓΟΡΙΘΜΟΙ Άνοιξη I. ΜΗΛΗΣ
ΑΛΓΟΡΙΘΜΟΙ http://eclass.aueb.gr/courses/inf161/ Άνοιξη 216 - I. ΜΗΛΗΣ ΔΥΝΑΜΙΚΟΣ ΠΡΟΓΡΑΜΜΑΤΙΣΜΟΣ ΑΛΓΟΡΙΘΜΟΙ - ΑΝΟΙΞΗ 216 - Ι. ΜΗΛΗΣ 9 DP II 1 Dynamic Programming ΓΕΝΙΚΗ ΙΔΕΑ 1. Ορισμός υπο-προβλήματος/ων
Διαβάστε περισσότερα(1) Describe the process by which mercury atoms become excited in a fluorescent tube (3)
Q1. (a) A fluorescent tube is filled with mercury vapour at low pressure. In order to emit electromagnetic radiation the mercury atoms must first be excited. (i) What is meant by an excited atom? (1) (ii)
Διαβάστε περισσότεραExample of the Baum-Welch Algorithm
Example of the Baum-Welch Algorithm Larry Moss Q520, Spring 2008 1 Our corpus c We start with a very simple corpus. We take the set Y of unanalyzed words to be {ABBA, BAB}, and c to be given by c(abba)
Διαβάστε περισσότεραΒιοπληροφορική Ι. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015
Βιοπληροφορική Ι Παντελής Μπάγκος Αναπληρωτής Καθηγητής Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 1 Διάλεξη 4 Hidden Markov Models (HMMs) 2 Μαρκοβιανά μοντέλα εξάρτησης Η πιθανότητα εμφάνισης ενός νουκλεοτιδίου
Διαβάστε περισσότεραAdvanced Subsidiary Unit 1: Understanding and Written Response
Write your name here Surname Other names Edexcel GE entre Number andidate Number Greek dvanced Subsidiary Unit 1: Understanding and Written Response Thursday 16 May 2013 Morning Time: 2 hours 45 minutes
Διαβάστε περισσότεραA Bonus-Malus System as a Markov Set-Chain. Małgorzata Niemiec Warsaw School of Economics Institute of Econometrics
A Bonus-Malus System as a Markov Set-Chain Małgorzata Niemiec Warsaw School of Economics Institute of Econometrics Contents 1. Markov set-chain 2. Model of bonus-malus system 3. Example 4. Conclusions
Διαβάστε περισσότεραSUPERPOSITION, MEASUREMENT, NORMALIZATION, EXPECTATION VALUES. Reading: QM course packet Ch 5 up to 5.6
SUPERPOSITION, MEASUREMENT, NORMALIZATION, EXPECTATION VALUES Readig: QM course packet Ch 5 up to 5. 1 ϕ (x) = E = π m( a) =1,,3,4,5 for xa (x) = πx si L L * = πx L si L.5 ϕ' -.5 z 1 (x) = L si
Διαβάστε περισσότεραΜεταπτυχιακή διατριβή. Ανδρέας Παπαευσταθίου
Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Μεταπτυχιακή διατριβή Κτίρια σχεδόν μηδενικής ενεργειακής κατανάλωσης :Αξιολόγηση συστημάτων θέρμανσης -ψύξης και ΑΠΕ σε οικιστικά κτίρια στην
Διαβάστε περισσότεραΠΕΡΙΕΧΟΜΕΝΑ. Κεφάλαιο 1: Κεφάλαιο 2: Κεφάλαιο 3:
4 Πρόλογος Η παρούσα διπλωµατική εργασία µε τίτλο «ιερεύνηση χωρικής κατανοµής µετεωρολογικών µεταβλητών. Εφαρµογή στον ελληνικό χώρο», ανατέθηκε από το ιεπιστηµονικό ιατµηµατικό Πρόγραµµα Μεταπτυχιακών
Διαβάστε περισσότεραFractional Colorings and Zykov Products of graphs
Fractional Colorings and Zykov Products of graphs Who? Nichole Schimanski When? July 27, 2011 Graphs A graph, G, consists of a vertex set, V (G), and an edge set, E(G). V (G) is any finite set E(G) is
Διαβάστε περισσότερα2 Composition. Invertible Mappings
Arkansas Tech University MATH 4033: Elementary Modern Algebra Dr. Marcel B. Finan Composition. Invertible Mappings In this section we discuss two procedures for creating new mappings from old ones, namely,
Διαβάστε περισσότεραPARTIAL NOTES for 6.1 Trigonometric Identities
PARTIAL NOTES for 6.1 Trigonometric Identities tanθ = sinθ cosθ cotθ = cosθ sinθ BASIC IDENTITIES cscθ = 1 sinθ secθ = 1 cosθ cotθ = 1 tanθ PYTHAGOREAN IDENTITIES sin θ + cos θ =1 tan θ +1= sec θ 1 + cot
Διαβάστε περισσότεραOther Test Constructions: Likelihood Ratio & Bayes Tests
Other Test Constructions: Likelihood Ratio & Bayes Tests Side-Note: So far we have seen a few approaches for creating tests such as Neyman-Pearson Lemma ( most powerful tests of H 0 : θ = θ 0 vs H 1 :
Διαβάστε περισσότερα5.4 The Poisson Distribution.
The worst thing you can do about a situation is nothing. Sr. O Shea Jackson 5.4 The Poisson Distribution. Description of the Poisson Distribution Discrete probability distribution. The random variable
Διαβάστε περισσότεραEvery set of first-order formulas is equivalent to an independent set
Every set of first-order formulas is equivalent to an independent set May 6, 2008 Abstract A set of first-order formulas, whatever the cardinality of the set of symbols, is equivalent to an independent
Διαβάστε περισσότεραΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΠΡΟΣΧΟΛΙΚΗΣ ΑΓΩΓΗΣ ΚΑΙ ΤΟΥ ΕΚΠΑΙ ΕΥΤΙΚΟΥ ΣΧΕ ΙΑΣΜΟΥ «ΠΑΙ ΙΚΟ ΒΙΒΛΙΟ ΚΑΙ ΠΑΙ ΑΓΩΓΙΚΟ ΥΛΙΚΟ» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ που εκπονήθηκε για τη
Διαβάστε περισσότεραBlock Ciphers Modes. Ramki Thurimella
Block Ciphers Modes Ramki Thurimella Only Encryption I.e. messages could be modified Should not assume that nonsensical messages do no harm Always must be combined with authentication 2 Padding Must be
Διαβάστε περισσότεραΣυστήματα Διαχείρισης Βάσεων Δεδομένων
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ Συστήματα Διαχείρισης Βάσεων Δεδομένων Φροντιστήριο 9: Transactions - part 1 Δημήτρης Πλεξουσάκης Τμήμα Επιστήμης Υπολογιστών Tutorial on Undo, Redo and Undo/Redo
Διαβάστε περισσότεραRight Rear Door. Let's now finish the door hinge saga with the right rear door
Right Rear Door Let's now finish the door hinge saga with the right rear door You may have been already guessed my steps, so there is not much to describe in detail. Old upper one file:///c /Documents
Διαβάστε περισσότεραΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 6/5/2006
Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Ολοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα είναι μικρότεροι το 1000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Διάρκεια: 3,5 ώρες Καλή
Διαβάστε περισσότερα2. THEORY OF EQUATIONS. PREVIOUS EAMCET Bits.
EAMCET-. THEORY OF EQUATIONS PREVIOUS EAMCET Bits. Each of the roots of the equation x 6x + 6x 5= are increased by k so that the new transformed equation does not contain term. Then k =... - 4. - Sol.
Διαβάστε περισσότεραΚΥΠΡΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY 21 ος ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ Δεύτερος Γύρος - 30 Μαρτίου 2011
Διάρκεια Διαγωνισμού: 3 ώρες Απαντήστε όλες τις ερωτήσεις Μέγιστο Βάρος (20 Μονάδες) Δίνεται ένα σύνολο από N σφαιρίδια τα οποία δεν έχουν όλα το ίδιο βάρος μεταξύ τους και ένα κουτί που αντέχει μέχρι
Διαβάστε περισσότεραMean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
Διαβάστε περισσότεραAreas and Lengths in Polar Coordinates
Kiryl Tsishchanka Areas and Lengths in Polar Coordinates In this section we develop the formula for the area of a region whose boundary is given by a polar equation. We need to use the formula for the
Διαβάστε περισσότεραSplice site recognition between different organisms
NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE DEPARTMENT OF INFORMATICS AND TELECOMMUNICATIONS INTERDEPARTMENTAL POSTGRADUATE PROGRAM "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY"
Διαβάστε περισσότεραApproximation of distance between locations on earth given by latitude and longitude
Approximation of distance between locations on earth given by latitude and longitude Jan Behrens 2012-12-31 In this paper we shall provide a method to approximate distances between two points on earth
Διαβάστε περισσότεραAreas and Lengths in Polar Coordinates
Kiryl Tsishchanka Areas and Lengths in Polar Coordinates In this section we develop the formula for the area of a region whose boundary is given by a polar equation. We need to use the formula for the
Διαβάστε περισσότεραNumerical Analysis FMN011
Numerical Analysis FMN011 Carmen Arévalo Lund University carmen@maths.lth.se Lecture 12 Periodic data A function g has period P if g(x + P ) = g(x) Model: Trigonometric polynomial of order M T M (x) =
Διαβάστε περισσότερα4.6 Autoregressive Moving Average Model ARMA(1,1)
84 CHAPTER 4. STATIONARY TS MODELS 4.6 Autoregressive Moving Average Model ARMA(,) This section is an introduction to a wide class of models ARMA(p,q) which we will consider in more detail later in this
Διαβάστε περισσότεραST5224: Advanced Statistical Theory II
ST5224: Advanced Statistical Theory II 2014/2015: Semester II Tutorial 7 1. Let X be a sample from a population P and consider testing hypotheses H 0 : P = P 0 versus H 1 : P = P 1, where P j is a known
Διαβάστε περισσότεραΓιπλυμαηική Δπγαζία. «Ανθπυποκενηπικόρ ζσεδιαζμόρ γέθςπαρ πλοίος» Φοςζιάνηρ Αθανάζιορ. Δπιβλέπυν Καθηγηηήρ: Νηθφιανο Π. Βεληίθνο
ΔΘΝΙΚΟ ΜΔΣΟΒΙΟ ΠΟΛΤΣΔΥΝΔΙΟ ΥΟΛΗ ΝΑΤΠΗΓΩΝ ΜΗΥΑΝΟΛΟΓΩΝ ΜΗΥΑΝΙΚΩΝ Γιπλυμαηική Δπγαζία «Ανθπυποκενηπικόρ ζσεδιαζμόρ γέθςπαρ πλοίος» Φοςζιάνηρ Αθανάζιορ Δπιβλέπυν Καθηγηηήρ: Νηθφιανο Π. Βεληίθνο Σπιμελήρ Δξεηαζηική
Διαβάστε περισσότεραTest Data Management in Practice
Problems, Concepts, and the Swisscom Test Data Organizer Do you have issues with your legal and compliance department because test environments contain sensitive data outsourcing partners must not see?
Διαβάστε περισσότεραΑναγνώριση Προτύπων. Σήμερα! Λόγος Πιθανοφάνειας Πιθανότητα Λάθους Κόστος Ρίσκο Bayes Ελάχιστη πιθανότητα λάθους για πολλές κλάσεις
Αναγνώριση Προτύπων Σήμερα! Λόγος Πιθανοφάνειας Πιθανότητα Λάθους Πιθανότητα Λάθους Κόστος Ρίσκο Bayes Ελάχιστη πιθανότητα λάθους για πολλές κλάσεις 1 Λόγος Πιθανοφάνειας Ας υποθέσουμε ότι θέλουμε να ταξινομήσουμε
Διαβάστε περισσότεραPotential Dividers. 46 minutes. 46 marks. Page 1 of 11
Potential Dividers 46 minutes 46 marks Page 1 of 11 Q1. In the circuit shown in the figure below, the battery, of negligible internal resistance, has an emf of 30 V. The pd across the lamp is 6.0 V and
Διαβάστε περισσότεραFigure A.2: MPC and MPCP Age Profiles (estimating ρ, ρ = 2, φ = 0.03)..
Supplemental Material (not for publication) Persistent vs. Permanent Income Shocks in the Buffer-Stock Model Jeppe Druedahl Thomas H. Jørgensen May, A Additional Figures and Tables Figure A.: Wealth and
Διαβάστε περισσότερα3.4 SUM AND DIFFERENCE FORMULAS. NOTE: cos(α+β) cos α + cos β cos(α-β) cos α -cos β
3.4 SUM AND DIFFERENCE FORMULAS Page Theorem cos(αβ cos α cos β -sin α cos(α-β cos α cos β sin α NOTE: cos(αβ cos α cos β cos(α-β cos α -cos β Proof of cos(α-β cos α cos β sin α Let s use a unit circle
Διαβάστε περισσότεραΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ. Ψηφιακή Οικονομία. Διάλεξη 9η: Basics of Game Theory Mαρίνα Μπιτσάκη Τμήμα Επιστήμης Υπολογιστών
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ Ψηφιακή Οικονομία Διάλεξη 9η: Basics of Game Theory Mαρίνα Μπιτσάκη Τμήμα Επιστήμης Υπολογιστών Course Outline Part II: Mathematical Tools Firms - Basics of Industrial
Διαβάστε περισσότεραΠροσομοίωση BP με το Bizagi Modeler
Προσομοίωση BP με το Bizagi Modeler Α. Τσαλγατίδου - Γ.-Δ. Κάπος Πρόγραμμα Μεταπτυχιακών Σπουδών Τεχνολογία Διοίκησης Επιχειρησιακών Διαδικασιών 2017-2018 BPMN Simulation with Bizagi Modeler: 4 Levels
Διαβάστε περισσότεραES440/ES911: CFD. Chapter 5. Solution of Linear Equation Systems
ES440/ES911: CFD Chapter 5. Solution of Linear Equation Systems Dr Yongmann M. Chung http://www.eng.warwick.ac.uk/staff/ymc/es440.html Y.M.Chung@warwick.ac.uk School of Engineering & Centre for Scientific
Διαβάστε περισσότεραΧρήση συστημάτων πληροφορικής στην οδική υποδομή
ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΕΜΠ Εργαστήριο Συγκοινωνιακής Τεχνικής Χρήση συστημάτων πληροφορικής στην οδική υποδομή Συσχέτιση δεδομένων GPS και χάρτη Βύρωνας Νάκος Καθηγήτης ΕΜΠ bnakos@central.ntua.gr
Διαβάστε περισσότεραΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «ΟΛΟΚΛΗΡΩΜΕΝΗ ΑΝΑΠΤΥΞΗ & ΔΙΑΧΕΙΡΙΣΗ ΤΟΥ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ» ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Οικονομετρική διερεύνηση
Διαβάστε περισσότεραΒιοπληροφορική. Ενότητα 13: Μοντέλα Πολλαπλής Στοίχισης (1/2), 1.5ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου
Βιοπληροφορική Ενότητα 13: Μοντέλα Πολλαπλής Στοίχισης (1/2), 1.5ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι παρουσίαση των μοντέλων πολλαπλής στοίχισης. κατανόηση των εφαρμογών
Διαβάστε περισσότεραAssalamu `alaikum wr. wb.
LUMP SUM Assalamu `alaikum wr. wb. LUMP SUM Wassalamu alaikum wr. wb. Assalamu `alaikum wr. wb. LUMP SUM Wassalamu alaikum wr. wb. LUMP SUM Lump sum lump sum lump sum. lump sum fixed price lump sum lump
Διαβάστε περισσότεραΔιπλωματική Εργασία. του φοιτητή του Τμήματος Ηλεκτρολόγων Μηχανικών και Τεχνολογίας Υπολογιστών της Πολυτεχνικής Σχολής του Πανεπιστημίου Πατρών
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ: ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΠΛΗΡΟΦΟΡΙΑΣ ΕΡΓΑΣΤΗΡΙΟ ΕΝΣΥΡΜΑΤΗΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΑΣ Διπλωματική Εργασία του φοιτητή του
Διαβάστε περισσότεραΜηχανική Μάθηση Hypothesis Testing
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ Μηχανική Μάθηση Hypothesis Testing Γιώργος Μπορμπουδάκης Τμήμα Επιστήμης Υπολογιστών Procedure 1. Form the null (H 0 ) and alternative (H 1 ) hypothesis 2. Consider
Διαβάστε περισσότεραBayesian statistics. DS GA 1002 Probability and Statistics for Data Science.
Bayesian statistics DS GA 1002 Probability and Statistics for Data Science http://www.cims.nyu.edu/~cfgranda/pages/dsga1002_fall17 Carlos Fernandez-Granda Frequentist vs Bayesian statistics In frequentist
Διαβάστε περισσότερα14 Lesson 2: The Omega Verb - Present Tense
Lesson 2: The Omega Verb - Present Tense Day one I. Word Study and Grammar 1. Most Greek verbs end in in the first person singular. 2. The present tense is formed by adding endings to the present stem.
Διαβάστε περισσότεραΕισαγωγή στην ανάλυση συνδέσμων
Εισαγωγή στην ανάλυση συνδέσμων Αποθήκες και Εξόρυξη Δεδομένων Διδάσκων: Μαρία Χαλκίδη Why link analysis? Why link analysis? The web is not just a collection of documents its hyperlinks are important!
Διαβάστε περισσότεραReview Test 3. MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Review Test MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Find the exact value of the expression. 1) sin - 11π 1 1) + - + - - ) sin 11π 1 ) ( -
Διαβάστε περισσότεραPartial Trace and Partial Transpose
Partial Trace and Partial Transpose by José Luis Gómez-Muñoz http://homepage.cem.itesm.mx/lgomez/quantum/ jose.luis.gomez@itesm.mx This document is based on suggestions by Anirban Das Introduction This
Διαβάστε περισσότεραChapter 6: Systems of Linear Differential. be continuous functions on the interval
Chapter 6: Systems of Linear Differential Equations Let a (t), a 2 (t),..., a nn (t), b (t), b 2 (t),..., b n (t) be continuous functions on the interval I. The system of n first-order differential equations
Διαβάστε περισσότεραBuried Markov Model Pairwise
Buried Markov Model 1 2 2 HMM Buried Markov Model J. Bilmes Buried Markov Model Pairwise 0.6 0.6 1.3 Structuring Model for Speech Recognition using Buried Markov Model Takayuki Yamamoto, 1 Tetsuya Takiguchi
Διαβάστε περισσότερα«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»
I ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΝΟΜΙΚΩΝ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΠΟΛΙΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ «ΔΙΟΙΚΗΣΗ ΚΑΙ ΟΙΚΟΝΟΜΙΑ» ΚΑΤΕΥΘΥΝΣΗ: ΟΙΚΟΝΟΜΙΚΗ
Διαβάστε περισσότεραMatrices and Determinants
Matrices and Determinants SUBJECTIVE PROBLEMS: Q 1. For what value of k do the following system of equations possess a non-trivial (i.e., not all zero) solution over the set of rationals Q? x + ky + 3z
Διαβάστε περισσότεραSolutions to the Schrodinger equation atomic orbitals. Ψ 1 s Ψ 2 s Ψ 2 px Ψ 2 py Ψ 2 pz
Solutions to the Schrodinger equation atomic orbitals Ψ 1 s Ψ 2 s Ψ 2 px Ψ 2 py Ψ 2 pz ybridization Valence Bond Approach to bonding sp 3 (Ψ 2 s + Ψ 2 px + Ψ 2 py + Ψ 2 pz) sp 2 (Ψ 2 s + Ψ 2 px + Ψ 2 py)
Διαβάστε περισσότεραHomework 3 Solutions
Homework 3 Solutions Igor Yanovsky (Math 151A TA) Problem 1: Compute the absolute error and relative error in approximations of p by p. (Use calculator!) a) p π, p 22/7; b) p π, p 3.141. Solution: For
Διαβάστε περισσότεραLecture 2. Soundness and completeness of propositional logic
Lecture 2 Soundness and completeness of propositional logic February 9, 2004 1 Overview Review of natural deduction. Soundness and completeness. Semantics of propositional formulas. Soundness proof. Completeness
Διαβάστε περισσότερα6.3 Forecasting ARMA processes
122 CHAPTER 6. ARMA MODELS 6.3 Forecasting ARMA processes The purpose of forecasting is to predict future values of a TS based on the data collected to the present. In this section we will discuss a linear
Διαβάστε περισσότεραΣτοίχιση Ακολουθιών. Μέθοδοι σύγκρισης ακολουθιών. Είδος στοίχισης. match. gap. mismatch
Οµολογία ΣΤΟΙΧΙΣΗ ΑΚΟΛΟΥΘΙΩΝ ΑΝΑ ΖΕΥΓΗ Σελίδα 1 Σελίδα 2 Οµολογία Οµολογία Οµολογία κοινή εξελικτική καταγωγή Ορθόλογα γονίδια ειδογένεση συνήθως, ίδια βιολογική λειτουργία Παράλογα γονίδια γονιδιακός
Διαβάστε περισσότεραthe total number of electrons passing through the lamp.
1. A 12 V 36 W lamp is lit to normal brightness using a 12 V car battery of negligible internal resistance. The lamp is switched on for one hour (3600 s). For the time of 1 hour, calculate (i) the energy
Διαβάστε περισσότεραΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ & ΠΛΗΡΟΦΟΡΙΚΗΣ. του Γεράσιμου Τουλιάτου ΑΜ: 697
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ Η/Υ & ΠΛΗΡΟΦΟΡΙΚΗΣ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΣΤΑ ΠΛΑΙΣΙΑ ΤΟΥ ΜΕΤΑΠΤΥΧΙΑΚΟΥ ΔΙΠΛΩΜΑΤΟΣ ΕΙΔΙΚΕΥΣΗΣ ΕΠΙΣΤΗΜΗ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑ ΤΩΝ ΥΠΟΛΟΓΙΣΤΩΝ του Γεράσιμου Τουλιάτου
Διαβάστε περισσότεραLanczos and biorthogonalization methods for eigenvalues and eigenvectors of matrices
Lanzos and iorthogonalization methods for eigenvalues and eigenvetors of matries rolem formulation Many prolems are redued to solving the following system: x x where is an unknown numer А a matrix n n
Διαβάστε περισσότεραCode Breaker. TEACHER s NOTES
TEACHER s NOTES Time: 50 minutes Learning Outcomes: To relate the genetic code to the assembly of proteins To summarize factors that lead to different types of mutations To distinguish among positive,
Διαβάστε περισσότεραFourier Series. MATH 211, Calculus II. J. Robert Buchanan. Spring Department of Mathematics
Fourier Series MATH 211, Calculus II J. Robert Buchanan Department of Mathematics Spring 2018 Introduction Not all functions can be represented by Taylor series. f (k) (c) A Taylor series f (x) = (x c)
Διαβάστε περισσότεραHOMEWORK 4 = G. In order to plot the stress versus the stretch we define a normalized stretch:
HOMEWORK 4 Problem a For the fast loading case, we want to derive the relationship between P zz and λ z. We know that the nominal stress is expressed as: P zz = ψ λ z where λ z = λ λ z. Therefore, applying
Διαβάστε περισσότεραΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΒΑΛΕΝΤΙΝΑ ΠΑΠΑΔΟΠΟΥΛΟΥ Α.Μ.: 09/061. Υπεύθυνος Καθηγητής: Σάββας Μακρίδης
Α.Τ.Ε.Ι. ΙΟΝΙΩΝ ΝΗΣΩΝ ΠΑΡΑΡΤΗΜΑ ΑΡΓΟΣΤΟΛΙΟΥ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ ΚΑΙ ΕΠΙΚΟΙΝΩΝΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Η διαμόρφωση επικοινωνιακής στρατηγικής (και των τακτικών ενεργειών) για την ενδυνάμωση της εταιρικής
Διαβάστε περισσότεραCHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS
CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =
Διαβάστε περισσότεραLTL to Buchi. Overview. Buchi Model Checking LTL Translating LTL into Buchi. Ralf Huuck. Buchi Automata. Example
Overview LTL to Buchi Buchi Model Checking LTL Translating LTL into Buchi Ralf Huuck Buchi Automata Example Automaton which accepts infinite traces δ A Buchi automaton is 5-tuple Σ, Q, Q 0,δ, F Σ is a
Διαβάστε περισσότεραDémographie spatiale/spatial Demography
ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ Démographie spatiale/spatial Demography Session 1: Introduction to spatial demography Basic concepts Michail Agorastakis Department of Planning & Regional Development Άδειες Χρήσης
Διαβάστε περισσότεραGalatia SIL Keyboard Information
Galatia SIL Keyboard Information Keyboard ssignments The main purpose of the keyboards is to provide a wide range of keying options, so many characters can be entered in multiple ways. If you are typing
Διαβάστε περισσότεραExercises 10. Find a fundamental matrix of the given system of equations. Also find the fundamental matrix Φ(t) satisfying Φ(0) = I. 1.
Exercises 0 More exercises are available in Elementary Differential Equations. If you have a problem to solve any of them, feel free to come to office hour. Problem Find a fundamental matrix of the given
Διαβάστε περισσότερα