PROFESSIONAL EXAMINATION BOARD Group 05 Pharmacist, Lab technician and other equivalents post Recruitment Test th April :00 PM
|
|
- Ἥβη Βαρνακιώτης
- 6 χρόνια πριν
- Προβολές:
Transcript
1 PROFESSIONAL EXAMINATION BOARD Group 05 Pharmacist, Lab technician and other equivalents post Recruitment Test th April :00 PM Topic: General Studies 1) Choose the appropriate prepositions for the given sentence: We waited the station fifteen minutes. 1. in, for 2. at, for 3. in, upto 4. of, at at, for 2) If IJKLMNO is coded ACTVSRX, then how is MILLION coded? / य द IJKLMNO क ACTVSRX स क डत कय ज त ह, त MILLION क क स क डत कय ज य ग? 1. STAATXR 2. SAVVAXR 3. SATTARC 4. SAVVARX SAVVAXR 3) Complete the sentence choosing the right option: The wonder of wonders is manage to make a living in the face of soaring inflation. 1. how every people 2. how these people
2 3. how all peoples 4. how all that people how these people 4) If the perimeter of a square is 44m, what is its area? / य द एक वग क पδरम प 44 म ह, त इसक ā jफल s ह ग? m / 121म m 2 / 256म m 2 / 121म m 2 / 224 म 2 121m 2 / 121म 2 5) Choose appropriate articles for the given sentence: Dr. Amit Mitra, Secretary General of FICCI will address foreign delegates. 1. a, an 2. the, the 3. a, a 4. the, a the, the 6) If Arun buys 10 pencils for Rs. 5 each, and sells all of them at Rs. 6 each, then how much profit will he make out of it? / य द अħण, 5 i ĸ त प εφल क हस ब स 10 प εφलg खर दत ह, और उन सभ क 6 i ĸ त पg सल मg ब चत ह, त उस कतन ल भ ह ग? 1. Rs. 12 / 12 iपए 2. Rs. 10 / 10 iपए 3. Rs. 15 / 15 iपए 4. Rs. 21 / 21 iपए Rs. 10 / 10 iपए
3 7) Which country hosted the Chitwan Elephant Festival in 2016? / कस द श न 2016 मg चतवन ह थ मह γव क आय जन कय? 1. Bangladesh / ब û द श 2. South Africa / द āण अl क 3. Nepal / न प ल 4. India / भ रत Nepal / न प ल 8) Shyam is working in a fireworks factory. The material to be used in coaĕng his work clothes should be / Ї म एक आ तशब ज क रख न मg क य करत ह उसक क य वЮ क वल पन मg उपय ग ह न व ल स मĭ, ह न च हए 1. Acrylic / ऐ ï लक 2. Rayon / र य न 3. Polyester / प लएЬर 4. Melamine plasĕc / म ल म इन Ю εьक Melamine plasĕc / म ल म इन Ю εьक 9) What is the expansion of the term WAN in computer technology? / कуЭ टर ĸ गक क ā j मg WAN शс द क वЭ त iप s ह? 1. Wide Angle Network / व इड ए गल न टवक 2. Wide Area Network / व इड एδरय न टवक 3. Wide Application Node / व इड एЮ क शन न ड 4. World Application Network / वϋ एЮ क शन न टवक Wide Area Network / व इड एδरय न टवक 10) ज इ ĵय स पर ह इस अन क शо क लए एक शо च नg? 1. अत Κ य 2. अछ त 3. द रदश
4 4. अ۴Ї अत Κ य 11) Choose the correct form of expression to complete the sentence: You'll have to get a / an to get into the factory. 1. leave 2. pass 3. permission 4. admit pass 12) The process of converting a liquid into its vapour by heating followed by condensation of vapour back into liquid is called / त पन र ĵव क उसक व Т मg पδरव त त करन क ĸ ïय, जसक पЖ त व Т क फर स ĵव मg स घनन ह न कहल त ह : 1. Sedimentation / अवस दन 2. Transpiration / दन תּĸ 3. Distillation / आसवन 4. Vapourisation / व Т करण Distillation / आसवन 13) आज द क घ ड़द ड़ द खन य ù थ ĸЭ त व s मg ĸय ő स म सक शо क च नg और बत ए क वह क न स सम स ह? 1. त ħष सम स 2. सम स 3. ग सम स 4. अҐय भ व सम स त ħष सम स
5 14) ) Finger like outgrowths in human intesĕne helps to / म नव य आ त मg उ ग लय क सम न उ ध, सह यत करत ह 1. Make the food soluble / भ जन क वल य मg 2. Absorbs the digested food / प चत भ जन क अवश षत करन मg 3. Absorbs the undigested food / ग र प चत भ जन क अवश षत करन मg 4. Digests the food substances / ख पद थ क पच न मg Absorbs the digested food / प चत भ जन क अवश षत करन मg 16) सम र, स गर, और क स म आ गए हġ रचन क आध र पर सह व s भ द च नए? 1. सरल व s 2. स य ő व s 3. मm व s
6 4. ज टल व s सरल व s 17) The musical instrument that produce music through vibraĕng air columns are called / वह व य j, ज व य Э भ मg क पन क म Єम स स ग त उ Ό करत ह, कहल त ह 1. Percussion instrument / पट व 2. String instrument / त र व 3. Wind instrument / स षर व 4. Electronic instrument / इल ō नक व Wind instrument / स षर व 18) ) What is India s ranking position in the Global Competitiveness Index (GCI) ? / व Ќक
7 20) What is India s ranking position in the Global Competitiveness Index (GCI) ? / व Ќक ĸ तמּध Ϋकत स चक क (ѓ ल बल कεήट टवन स इ ड ۵ स) (GCI), मg भ रत क s रġ क ग ह? th / 55व th / 39व th / 112व th / 88व 39 th / 39व 21) पδरण म शо क सह वĭह s ह? 1. पδर + न म 2. पδर + ण म 3. पδर + म न 4. ĸ + म न पδर + न म 22) Find the mean of the first seven odd numbers? / ĸथम स त वषम स ġ ओ क म Є ŵ त करg? ) In a certain language, fil wil ĕl means tell them now; wil skel feil means now and then. Which is the word for wil in that code language? / कस ख स भ ष मg, fil wil ĕl क मतलब ह tell them now; wil skel feil क मतलब ह now and then. त उस भ ष मg wil क लय क न स शо ह? 1. Now 2. Tell 3. Them 4. Then
8 Now 24) Choose the correct form of tense for the given sentence: Do not distract me at the moment. I to concentrate. 1. was trying 2. am trying 3. try 4. tried am trying 25) Choose the appropriate prepositions for the given sentence: The city Quito lies the equator. 1. of, near 2. in, to 3. on, in 4. by, on of, near Topic: Lab Technician 1) Example for liquid anticoagulant is. / तरल थó र ध क उद हरण ह 1. EDTA / ईड ट ए 2. Oxalate / ऑťल ट 3. Sodium citrate / स डयम सट ट 4. Sodium fluoride / स डयम и र इड Sodium citrate / स डयम सट ट
9 2) Myoglobin is a oxygen binding protein found in / म य ѓ ल बन, मg प य ज न व ल एक ऑ۵ स जन ब к यक र ĸ ट न ह 1. Heart muscle / ह दय क म सप शय 2. Lymphaĕc fluid/ लस क ĵव ( लу फ टक и एड) 3. Liver / ल वर 4. Plasma / п ल म Heart muscle / ह दय क म सप शय 3) Preservative used for 24 hour urine sample is. / 24 घ ट क म j नम न क लए ĸय ő पδररāक ह 1. Conc. HCl / स ĵत एचस एल 2. Glucose / û क स 3. Maltose / म υ स 4. Dextrose / ड ťट स Conc. HCl / स ĵत एचस एल 4) reagent used for occult blood test is carcinogenic. / ग ढ़ रő ज च क लए ĸय ő अ भकम क कġ सरक रक ह 1. Biuret / ब इय र ट 2. Benedict s / ब न डō स 3. Bial s / ब एГ 4. Benzidine / ब εќजड न Benzidine / ब εќजड न 5) Test done for clotting time is called. / Ч दन समय क लए क ज न व ल ज च कहल त ह 1. Capillary tube method / क शक य न लक व ध 2. Duke method / क व ध Template method / ट ήल ट व ध
10 3. Template method / ट ήल ट व ध 4. Ivy method / आइव व ध Capillary tube method / क शक य न लक व ध 6) Azoospermia refers to. / श ï ण ह नत (एज מּ म य ) क अथ ह 1. Absence of semen / व य क अन पεэथ त 2. Absence of sperm / श ï ण क अन पεэथ त 3. Absence of RBC / आरब स क अन पεэथ त 4. Presence of semen / व य क उपεэथ त Absence of sperm / श ï ण क अन पεэथ त 7) The A in CPD A stands for and it gives better preservation. / स प ड ए मg "ए" क अथ ह और यह ब हतर पδररāण द त ह 1. Adsol / एडस ल 2. Adenine / एड न न 3. Alkaline / ā र य (एπल इन) 4. Anhydrous / नज ल (एनह इड स) Adenine / एड न न 8) method is used to demonstrate motility of bacteria. / व ध, ज व ण क ग तश लत क ĸद श त करन क लए ĸय ő ह त ह 1. India Ink / इεΕय इ क 2. Lactophenol / ल ō फ़ न ल 3. Loeffler / ल लर 4. Hanging drop / हġ ग ग ड प Hanging drop / हġ ग ग ड प
11 9) Enzyme related to heart is. / ňदय स स ब धत ए ज़ इम ह 1. Amylase / ए मल स 2. Lactate dehydrogenase / ल ō ट ड ह यड ज न स 3. Lipase / ल इप स 4. Acid phosphatase / ए सड סּफ ट स Lactate dehydrogenase / ल ō ट ड ह यड ज न स 10) Haem part of haemoglobin consists in ferrous state. / ह म û बन क ह म भ ग, ल ह (फ़ रस) अवэथ मg स य ő ह त ह 1. Iron / ल ह 2. Potassium / प ट शयम 3. Calcium / क εхशयम 4. Magnesium / म Ĭ शयम Iron / ल ह 11) Coagulase test is positive for. / क ऐग ल स ज च क लए सक र Ϋक ह त ह 1. Staphylococcus aureus / Ь फ इल क कस ऑδरयस 2. Staphylococcus epidermidis / Ь फ इल क कस ए पड म डस 3. Staphylococcus saprophyticus / Ь फ इल क कस स ĸ फ टकस 4. Streptococcus pneumoniae / э ट п ट क कस ќ य म न Staphylococcus aureus / Ь फ इल क कस ऑδरयस 12) The specific gravity of urine is determined by using. / म j क व शЊ घन क ĸय ग र नध δरत ह त ह 1. Calorimeter / क ल र म टर Urinometer / य र न म टर
12 2. Urinometer / य र न म टर 3. Spectrophotometer / ō מּ फ़ ट म टर 4. Albuminometer / अхх मन म टर Urinometer / य र न म टर 13) Which is the smallest white blood cell (WBC) seen in blood? / रő मg द ख ज न व ल सबस छ ट Ќ त रő क शक (डα ब स ) क न स ह 1. Neutrophil / ќ य ट फल 2. Eosinophil / इओ सन फल 3. Monocyte / म न स इट 4. Basophil / ā रकर ग (ब स फ़ल) Basophil / ā रकर ग (ब स फ़ल) 14) Nuclear stain used in Papanicolaou stain is. / प प न कल ओ अ भर जक मg ĸय ő न भक य अ भर जक ह 1. Haematoxylin / ह म ट ť लन 2. Trypan Blue / ट इप न ц 3. Neutral Red / उद स न ल ल (Ύ ट ल र ड) 4. Methylene Blue / मथ इ लन ц Haematoxylin / ह म ट ť लन 15) Which theory states that a single trna can recognize more than one codon? / क न स सο त क अन स र, एकल ट आरएनए, एक क डन स अ धक पहच न सकत ह? 1. Watson and Crick / व टसन और ïक 2. Induced fit / इन э ड फट 3. Wobble hypothesis / व с बल ह ईप थ सस 4. Darwin s theory / ड व न ј य र Wobble hypothesis / व с बल ह ईप थ सस
13 Wobble hypothesis / व с बल ह ईप थ सस 16) AFB staining is also called as staining. / एएफब अ भर जन क अ भर जन भ कह ज त ह 1. Gram s / ĭ у स 2. Giemsa / गएमज़ 3. Ziehl Neelsen / ज़ ल न लसन 4. Leishman / ल शम न Ziehl Neelsen / ज़ ल न लसन 17) Complete suppression of urine is known as. / म j क प ण अवर ध क iप मg ज न ज त ह 1. Oliguria / अώम jत (ओ लѓ य δरय ) 2. Anuria / अम jत (अΎ δरय ) 3. Hyposthenuria / ह इप सथ Ύ δरय 4. Hypersthenuria / ह इपरसथ Ύ δरय Anuria / अम jत (अΎ δरय ) 18) Thyroid gland secretes hormone. / अवट (थ इर इड) ĭ थ ह म न ń वत करत ह 1. T 3 2. FSH / एफ़एसएच 3. HCG / एचस ज 4. LH / एलएच T 3 19) PAS stain is used for the demonstration of. / प एएस अ भर जक क ĸदश न मg ĸय ő ह त ह
14 1. Lipid / ल पड 2. Acid phosphatase / ए सड סּफ ट स 3. Glycogen / û इक जन 4. Amyloid / ऐ मल ईड Glycogen / û इक जन 20) Normal range of total bilirubin is. / क ल बल ħ बन क स म Ύ पर स ह mg% / मल ĭ म% mg% / मल ĭ म% mg% / मल ĭ म% mg% / मल ĭ म% mg% / मल ĭ म% 21) VDRL is used for diagnosis of. / व ड आरएल क र ग नद न क लए ĸय ő ह त ह 1. TB / ट ब 2. Diphtheria / डпथ δरय 3. Pneumonia / नम नय 4. Syphilis / स फ लस Syphilis / स फ लस 22) Keeps blood in fluid state / रő क तरल अवэथ मg रखत ह Maintains water balance / जल स त लन बन ए रखत ह Controls body temperature / शर र त पम न क नय jत करत ह Contains antibodies / ĸ तरā य ő ह त ह These are the functions of. / य क क य हġ 1. Plasma / Ю म
15 2. Granulocyte / क णक ण 3. Monocyte / म न स इट 4. Platelet / बѕ ण Plasma / Ю म 23) The type of protein in urine of myeloma patients is called protein. / मź ब द (म इल म ) र गय क म j मg ĸ ट न क ĸक र क ĸ ट न कह ज त ह 1. Albumin / एх ब मन 2. Globulin / û х लन 3. Bence Jones / बgस ज स 4. Nucleoprotien / Ύ εśय ĸ ट न Bence Jones / बgस ज स 24) Fixative used in Leishman stain is. / ल शम न अ भर जक मg ĸय ő εэथरक र ह 1. Acetone free ethanol / एस ट न म ő एथ न ल 2. Acetone free methanol / एस ट न म ő म थ न ल 3. Acetone free butanol / एस ट न म ő х ट न ल 4. Acetone free resorcinol / एस ट न म ő δरज़ रस न ल Acetone free methanol / एस ट न म ő म थ न ल 25) is an example for formalin containing fixative. / फ़ म लन य ő εэथरक र क एक उद हरण ह 1. Carnoy s fluid / क रन य क ĵव 2. 10% Formal saline / 10% फ म ल स ल इन 3. Clarke s fluid / ś ۵ज़ ĵव 4. Flemming s fluid / и म ग ĵव
16 10% Formal saline / 10% फ म ल स ल इन 26) Unexpected antibodies are detected by. / अĸέ शत ĸ तर āय क क र पत लग य ज त ह 1. DAT / ड एट 2. ICT / आईस ट 3. DCT / ड स ट 4. VDRL / व ड आरएल ICT / आईस ट 27) Which is the infective form of the malarial parasite? / मल δरय क परज व क स ï मक ħपתּ क न स ह 1. Oocyst / य uकप ट (ऊ सЬ) 2. Sporozoite / ब ज ण ज ( र ज़ इटמּ) 3. Bradyzoite / ĺ ड ज़ आइट 4. Tachyzoite / ट क ज़ आइट Sporozoite / ब ज ण ज ( र ज़ इटמּ) 28) Lowenstein Jensen medium is used for cultivation of. / ल व नЬ इन ज नसन म к यम क स वध न क लए ĸय ő ह त ह 1. Bacillus anthracis / ब स लस ए ȷ सस 2. Mycobacterium tuberculosis / म इक ब ō δरयम बरś सस 3. Clostridium tetani / ś εь डयम ट ट न 4. Haemophilus influenzae / ह म फल स इќ ल एќज़ Mycobacterium tuberculosis / म इक ब ō δरयम बरś सस 29) Preservative used in ABD antisera is. / एब ड ए ट स र मg ĸय ő पδररāक
17 Preservative used in ABD antisera is. / एब ड ए ट स र मg ĸय ő पδररāक ह % Sodium azide / 0.1% स डयम एज़ इड 2. Sodium chloride / स डयम ś र इड 3. Sodium carbonate / स डयम क ब न ट 4. Sodium bicarbonate / स डयम ब इक ब न ट 0.1% Sodium azide / 0.1% स डयम एज़ इड 30) Cytoplasmic stain used in H&E staining is. / एच एव ई अ भर जन मg ĸय ő क शक ĵґ अ भर जक, ह 1. Eosin / इओ सन 2. Haematoxylin / ह म ट ε۵ स लन 3. Neutral red / उद स न ल ल (Ύ ट ल र ड) 4. Methyl Red / मथ इल र ड Eosin / इओ सन 31) Dealcoholization means. / अπ हल म εőकरण ( डएх क हल इज शन) क अथ ह 1. Dehydration / नज ल करण ( डह ईड शन) 2. Impregration / स स चन (इу ĸ ĭ शन) 3. Clearing / नक स (۵ ल यδर ग) 4. Embedding / अ त эथ पन (इу ब ड ग) Clearing / नक स (۵ ल यδर ग) 32) L in L Block stands for. / "एल ц क" मg एल क अथ ह 1. Length / ल ब ई 2. Label / ल बल Leuckhart s / कह ट ज़
18 3. Leuckhart s / कह ट ज़ 4. Light / ल इट Leuckhart s / कह ट ज़ 33) Diluting fluid used for RBC count is. / आरब स गणन क लए ĸय ő तन क र ĵव ह 1. Dacie s fluid / ड स ज़ ĵव 2. Turk s fluid / ट۵ज़ ĵव 3. Hingleman s fluid / ह गलम ќज़ ĵव 4. 1% Ammonium oxalate / 1% अम नयम ऑťल ट Dacie s fluid / ड स ज़ ĵव 34) Example for supravital staining is. / अ धज व अ भर जन क उद हरण ह 1. New Methylene Blue / नय म थल न ब ल 2. Perls Prussian Blue / पА ĸ शयन ц 3. Gabbets Methylene Blue / ग ब ट स म थल न ц 4. Trypan Blue / ट इप न ц New Methylene Blue / नय म थल न ब ल 35) :XFKHUHULDEDQFURIWL causes. / व उच δरय ब नï г उ Ό करत ह 1. Amoebiasis / अम ब ħħत (अम बय सस) 2. Toxoplasmosis / आ वषĵҐत (ट ť Ю פּ सस) 3. Enterobiasis / एΔ र बयसत 4. Filariasis / फ इल δरय र ग (फ इल δरय सस) Filariasis / फ इल δरय र ग (फ इल δरय सस)
19 36) Immunogens are. / ĸ तरā जन ह त हġ 1. Complete Ag / सή ण ĸ तजन 2. Incomplete Ag / अप ण ĸ तजन 3. Allergens / एलरजन 4. Antibodies / ĸ तरā (ए ट ब ड ) Complete Ag / सή ण ĸ तजन 37) Platelets are store at temperature. / बѕ ण (п ल टल ट स) त पम न पर स ĭ हत कय ज त हġ C C C C C 38) Kidney function test is. / ग दĝ क ïय व ध क ज च ह 1. Albumin / अхх मन 2. Bilirubin / रεőम प वण कत ( बल ħ बन) 3. Serum electrolytes / स रम इल ō ल इट 4. SGOT / एसज ओट Serum electrolytes / स रम इल ō ल इट 39) Gooding and Stewart s fluid is an example for fluid. / ग ड ग एव Ь वट स ĵव, ĵव क एक उद हरण ह 1. Dehydrating / नज लन ( डह ईड ट ग) 2. Clearing / नक स (۵ ल यδर ग) Decalcifying / वक А करण ( डक х स फ इ ग)
20 3. Decalcifying / वक А करण ( डक х स फ इ ग) 4. Impregnating / अ तभ रण (इу ĸ ѓ न ट ग) Decalcifying / वक А करण ( डक х स फ इ ग) 40) Expand the term ELISA. / ए लस शо क वЭ र करg 1. Enzyme Unlinked Immunosorbent Assay / ए ज़ इम अस jत ĸ तरā श षक आम पन (ए ज इम अन ल ۵ ड इу य न स रब ќ ट एэ स ) 2. Enzyme Linked Immunoglobulin Assay / ए ज़ इम स jत ĸ तरā û х लन आम पन (ए ज इम ल ۵ ड इу य न ѓ ल बन एэ स ) 3. Enzyme Linked Immunosorbent Assay / ए ज़ इम स jत ĸ तरā श षक आम पन (ए ज इम ल ۵ ड इу य न स रब ќ ट एэ स ) 4. Enzyme Linked Immunosubstrate Assay / ए ज़ इम स jत ĸ तरā ïय ध र आम पन (ए ज इम ल ۵ ड इу य न सс सट ट एэ स ) Enzyme Linked Immunosorbent Assay / ए ज़ इम स jत ĸ तरā श षक आम पन (ए ज इम ल ۵ ड इу य न स रब ќ ट एэ स ) 41) Example for gram negative cocci is. / ĭ म नक र Ϋक ť क उद हरण ह 1. Neisseria / न इ सर आ 2. Staphylococcus / Ь फल क कस 3. Streptococcus / Ь Ώ क कस 4. Pneumococcus / Ύ म क कस Neisseria / न इ सर आ 42) ह General test for protein is. / ĸ ट न क लए स म Ύ ज च 1. Biuret / ब इय र ट 2. Benedicts / ब न डō स 3. BUN / ब य एन बgज़ ड न
21 4. Benzidine / बgज़ ड न Biuret / ब इय र ट 43) Full form of FNAC is. / एफ़एनएस क प ण iप ह 1. Fire Needle Aspiration Cytology / फ यर न डल एεמּर शन स इट ल ज 2. Fine Needle Aspiration Chemistry / फ इन न डल एεמּर शन क मЬ 3. Fine Needle Aspiration Cytology / फ इन न डल एεמּर शन स इट ल ज 4. Fine Neoplastic Aspiration Cytology / फ इन नय Ю εьक एεמּर शन स इट ल ज Fine Needle Aspiration Cytology / फ इन न डल एεמּर शन स इट ल ज 44) Indicator used in antisera A is. / ए ट स र ए मg ĸय ő स चक ह 1. Acriflavin / एï и व न 2. Trypan Blue / ट इप न ц 3. Bromocresol Blue / ĺ म ï स ल ц 4. Methylene Blue / म थल न ц Trypan Blue / ट इप न ц 45) is an Australia antigen. / एक ऑЬ लय ई ĸ तजन (ए ट जन) ह 1. HIV Ag / एचआईव एज 2. HBE Ag / एचब ई एज 3. HBS Ag / एचब एस एज 4. HCV Ag / एचस व एज HBS Ag / एचब एस एज Neutral red is used as indicator in media. / उद स न ल ल
22 46) Neutral red is used as indicator in media. / उद स न ल ल म डय मg स चक क iप मg ĸय ő ह त ह 1. Blood agar / रő ऐग र 2. MacConkey s agar/ म कक Ά ऐग र 3. Chocolate agar / च कल ट ऐग र 4. SDA / एसड ए MacConkey s agar/ म कक Ά ऐग र 47) Ayer s spatula is used to obtain sample from. / अइयस च ल מּ स नम न ह सल करन क लए ĸय ő ह त ह 1. Uterus / गभ शय (य ट स) 2. Cervix / गभ शय ĭ व (स र व۵ स) 3. Fallopian tube / डѕव हन नल (फ ल पयन ब) 4. Endometrium / गभ शय अ त Эर (ए ड म ट यम) Cervix / गभ शय ĭ व (स र व۵ स) 48) Method of sharpening of knife is. / च क़ क त ज़ करन क व ध ह 1. Stropping / त ज़ करन (Ь प ग) 2. Clearing / नक स (۵ ल δरय ग) 3. Microtomy / म इï ट म 4. Honing / स न द न (ह न ग) Honing / स न द न (ह न ग) 49) Mantoux test is a skin test used for screening of. / म Δ ť ज च एक च ज च ह ज क Ш न ग क लए ĸय ő ह त ह 1. Leprosy / क П र ग 2. Hepatitis / ह प ट इ टस
23 3. AIDS / एड स 4. Tuberculosis / āय र ग Tuberculosis / āय र ग 50) is an example for immune mediated transfusion reaction. / ĸ तरā मЄэथत आध न ĸ त ïय (इу य न म डएट ट सз ज़न δरए۵ शन) क लए एक उद हरण ह 1. Iron overload / ल ह अ धकत 2. Graft v/s host disease / कलम बन म ĭ हयत (ह Ь) र ग 3. Circulatory overload / पδरस च र अ तभ र 4. Bacterial contamination / ज व ण स ïमण Graft v/s host disease / कलम बन म ĭ हयत (ह Ь) र ग 51) LISS stands for. / एलआईएसएस क अथ ह 1. Litre of Ionic Strength Solution / आय नक शεő घ ल क ल टर 2. Level of Ionic Strength Solution / आय नक शεő घ ल क Эर 3. Low Ionic Sugar Solution / नη आय नक शक र घ ल 4. Low Ionic Strength Solution / नη आय नक शεő घ ल Low Ionic Strength Solution / नη आय नक शεő घ ल 52) Reagent used for floatation method of stool is. / मल क и ट शन व ध क लए ĸय ő अ भकम क ह 1. Saline / स ल इन 2. 40% Formaldehyde / 40% फ म х ड ह इड 3. Ether / ईथर 4. Zinc Sulphate / ज़ क सхफ़ ट Zinc Sulphate / ज़ क सхफ़ ट
24 53) is the thigh bone. / ज घ क ह` ह 1. Radius / jǿ अεэथ (र डयस) 2. Femur / ऊi अεэथ (फ मर) 3. Ulna / अ त ĸक Пक (उх न ) 4. Carpal / म णब धक (क रपल) Femur / ऊi अεэथ (फ मर) 54) Iron stores are reduced in. / मg ल ह भ ड र कम ह ज त हġ 1. Microcytic hypochromic anemia / स ß ण क अώवण रő Юत (म ईï स य टक ह इप ï मक एन मय ) 2. Macrocytic normochromic anemia / эथ ल ण क स म Ύवण रő ώत (म ï स य टक न म ï मक एन मय ) 3. Pernicious anemia / वघ तक रő ώत (प न शयस एन मय ) 4. Haemolytic anemia / रőल य रő ώत (ह म ल य टक एन मय ) Microcytic hypochromic anemia / स ß ण क अώवण रő Юत (म ईï स य टक ह इप ï मक एन मय ) 55) The site for CSF collection in adult is / वयэ क मg स एसएफ स ĭह क लए эथ न, ह 1. L 2 L 3 2. L 5 L 6 3. L 1 L 2 4. L 3 L 4 L 3 L 4 56) Buffy coat is used for preparation. / बफ़ क ट त य र करन
25 Buffy coat is used for preparation. / बफ़ क ट त य र करन मg ĸय ő ह त ह 1. Sickle cell / सकल क शक 2. LE cell / एलई क शक 3. Parabasal cell / पर ध र क शक 4. Superficial cell / सतह क शक LE cell / एलई क शक 57) Which forms of Plasmodium falciparum are generally absent in peripheral blood film of the patient? / Ю म डयम फ А प रम क क न स ĸक र, स म Ύत र ग क पδरध य रő फ़ स अन पεэथत ह त हġ? 1. Rings / छ (δर ü) 2. Schizonts / εчज़ ट स 3. Crescents / अध च ĵ क र ( ïसgट स) 4. Trophozoite / ट फ ज़ इट Schizonts / εчज़ ट स 58) Normal systolic blood pressure is. / स म Ύ ĸक चन रőच प ह mmhg mmhg mmhg mmhg 120 mmhg 59) The protective outer covering of some bacteria is. / क छ ज व ण ओ क रā Ϋक ब हर आवरण ह त ह 1. Flagella / कश भक (и ग х ल ) 2. Pilli / प Capsule / क б ल
26 3. Capsule / क б ल 4. Inclusion granules / सम व श क णक (इन۵ ल जन ĭ न х स) Capsule / क б ल 60) WIDAL test is a/an. / वड ल ज च एक ह 1. Precipitation reaction / अवā पण अ भ ïय 2. Agglutination reaction / य जन अ भ ïय 3. Complement fixation / प रक εэथर करण 4. Color reaction / र ग ĸ त ïय Agglutination reaction / य जन अ भ ïय 61) Yellow color of CSF is known as./ स एसएफ़ क प ल र ग क iप मg ज न ज त ह 1. Hyperchromia / अ तवण यत (ह इपरï मय ) 2. Xanthochromia / प तवण यत (जġथ ï मय ) 3. Normochromia / स म Ύवण यत (न म ï मय ) 4. Hypochromia / नηवण यत (ह इप ï मय ) Xanthochromia / प तवण यत (जġथ ï मय ) 62) Gas gangrene is caused by. / ग स गġĭ न क र उ Ό ह त ह 1. Clostridium tetani / ś Ь डयम ट टन इ 2. Clostridium septicum / ś Ь डयम स Ώकम 3. Veilonelle / व ल न х ल 4. Gonorrhoea / स ज क (ग न δरय ) Clostridium tetani / ś Ь डयम ट टन इ The molecular formula of glucose is. / û क स क आεˇक स j
27 63) The molecular formula of glucose is. / û क स क आεˇक स j ह 1. C 2 H 4 O 2 2. C 3 H 6 O 3 3. C 6 H 12 O 6 4. C 6 H 12 O 5 C 6 H 12 O 6 64) Immunoglobulin which can cross the placenta is. / ĸ तरā û х लन (इу य न ѓ ल बन) ज गभ न ल क प र कर सकत ह वह ह 1. Ig M / आईज एम 2. Ig G / आईज ज 3. Ig E / आईज ई 4. Ig D / आईज ड Ig G / आईज ज 65) is a ketone body. / एक क ट न ब ड ह 1. Urea / य δरय 2. Creatinine / ïए ट नन 3. Uric acid / य δरक अμ 4. Beta hydroxy butyric acid / ब ट ह यड ť х टδरक अμ Beta hydroxy butyric acid / ब ट ह यड ť х टδरक अμ 66) Standard method to estimate heamoglobin is. / ह म û बन आकलन क म नक व ध ह 1. Sahlis method / स हल ज़ व ध 2. Cyanmeth Hb method / स यनम थ एचब व ध Hemocue / ह म s
28 3. Hemocue / ह म s 4. Copper sulphate method / क पर स ट व ध Cyanmeth Hb method / स यनम थ एचब व ध 67) Life cycle of plasmodium in man is called as. / एक Ґεő मg प ल Ǿ डयम क ज वन चï कहल त ह 1. Schizogony / वख डन जनन (Ч ज ग न ) 2. Plasmiogany / क शक ĵґ स लयन (п ल मओग न ) 3. Sporogony / ब ज ण उψवन (э प र ग न ) 4. Gametogony / य uक उψवन (ग मट ग न ) Schizogony / वख डन जनन (Ч ज ग न ) 68) Anticoagulant that chelates calcium is. / थó र ध ज क εхशयम क क ल ट करत ह, वह ह 1. Heparin / ह पδरन 2. Phosphate / סּफ ट 3. EDTA / ईड ट ए 4. Fluoride / и र इड EDTA / ईड ट ए 69) Sickling test is done for. / रő ώत क लए सक ल ग ज च क ज त ह 1. Haemolytic anemia / रőल य रő ώत (ह म ल टक एन मय ) 2. Sickle cell anemia / द j क शक रő ώत ( सकल स ल एन मय ) 3. Megaloblastic anemia / मह ल हĸस रő ώत (म ग ल ц εьक एन मय ) 4. Iron deficiency anemia / ल ह कम रő ώत (आयरन डफ स एस एन मय ) Sickle cell anemia / द j क शक रő ώत ( सकल स ल एन मय )
29 70) Who invented Bombay Blood group? / ब ѕ с लड ĭ प क आ वМ र कसन कय? 1. K. Landsteiner / क. लġडЬ नर 2. Y.M. Coombs / व ई.एम.क уы 3. R.R. Bhende / आर.आर.भgड 4. Robert Koch / र बट क च R.R. Bhende / आर.आर.भgड 71) Which of the following possess capsule? / नη मg स कसमg क б ल ह त ह? 1. Streptococcus pneumoniae / Ь Ώ क कस नम न 2. Staphylococcus aureus / Ь फल क कस औδरयस 3. Neisseria gonorrhoeae / न इэ स δरय ग न δरय 4. %DFLOOXVDQWKUDFLV/ ब स लस ए ȷ सस Streptococcus pneumoniae / Ь Ώ क कस नम न 72) Chinese letter arrangement of cells is shown by which of the following bacteria? / नη मg स कस ज व ण र च न अāर क Ґवэथ दश ई ज त ह 1. Neisseria gonorrhoeae / न इэ स δरय ग न δरय 2. &RU\QHEDFWHULXPGLSKWKHULDH / क र न ब ō δरयम डпथ δरय 3. Vibrio cholerae / व ĺय क लर 4. Escherichia coli / इэ च र शय क ल ई &RU\QHEDFWHULXPGLSKWKHULDH / क र न ब ō δरयम डпथ δरय 73) Volume of anticoagulant in 350 ml blood bag is. / 350 मल ल टर रő थ ल मg थó र ध क म j ह ml / 50 मल ल टर ml / 30 मल ल टर
30 3. 49 ml / 49 मल ल टर ml / 29 मल ल टर 49 ml / 49 मल ल टर 74) ह Cast seen in urine is. / म j मg दख ई द ज न व ल नā प 1. Calcium oxalate / क εхशयम ऑťल ट 2. Leucine / х य स न 3. Tyrosine / ट ईर सन 4. Waxy / सpवत (व ť ) Waxy / सpवत (व ť ) 75) Hay s test is based on the property of lowering of bile salts. / ह क पर āण, प लवण क क कम करन क ग ण पर आध δरत ह 1. Surface tension / प П तन व 2. Volume / म j 3. Specific gravity / व शЊ घन 4. ph / प एच Surface tension / प П तन व
अ त म www न इस म ह, जस ब ह, वह इस पश क अ क ज ड़ ल, य क मन य क अ क ह, और उसक अ क छ स छय सठ ह
अ त म www अ त म हम एक अ भ त ब त पर वच र कर ग w ह वण म ल क छठ अ र ह द सर श द म w ६ अ क क दश त ह इस लय ह भ ष म आप ६६६ क स लख ग? आपन अन म न लग य ह ग! www! www य व प व ब कस भ वषय जसक क पन क ज सकत ह, अ छ, ब
Διαβάστε περισσότεραΑιτήσεις Συστατική Επιστολή
- Εισαγωγή Αγαπητέ κύριε, Επίσημη επιστολή, αρσενικός παραλήπτης, το όνομα είναι άγνωστο Αγαπητή κυρία, Επίσημη επιστολή, θηλυκός παραλήπτης, το όνομα είναι άγνωστο Αγαπητέ κύριε/κύρια, Επίσημη επιστολή,
Διαβάστε περισσότεραGeschäftskorrespondenz Bestellung
- abgeben Εξετάζουμε την αγορά... हम आपस... खर दन च हत ह. Formell, vorsichtig Είμαστε στην ευχάριστη θέση να δώσουμε την παραγγελία μας στην εταιρεία σας για... हम आपक कम पन स... म गव न म द लचस प रखत ह.
Διαβάστε περισσότεραBewerbung Zeugnis. Zeugnis - Einleitung. Formell, männlicher Empfänger, Name unbekannt. Formell, weibliche Empfängerin, Name unbekannt
- Einleitung Αγαπητέ κύριε, Formell, männlicher Empfänger, Name unbekannt Αγαπητή κυρία, Formell, weibliche Empfängerin, Name unbekannt Αγαπητέ κύριε/κύρια, Formell, Name und Geschlecht des Empfängers
Διαβάστε περισσότεραBewerbung Zeugnis. Zeugnis - Einleitung. Formell, männlicher Empfänger, Name unbekannt. Formell, weibliche Empfängerin, Name unbekannt
- Einleitung Formell, männlicher Empfänger, Name unbekannt Formell, weibliche Empfängerin, Name unbekannt Αγαπητέ κύριε, Αγαπητή κυρία, Αγαπητέ κύριε/κύρια, Formell, Name und Geschlecht des Empfängers
Διαβάστε περισσότεραGoa University Department of Marathi Taleigaon Plateau, Tiswadi, Goa Syllabus MASTER OF ARTS स ह य-प र गत
APPENDIX A Goa University Department of Marathi Taleigaon Plateau, Tiswadi, Goa 403 206 Syllabus MASTER OF ARTS स ह य-प र गत (Note : Each paper carreies FOUR credits) (Total 80 Credits) (Vide Credit-based
Διαβάστε περισσότεραΑιτήσεις Συνοδευτική Επιστολή
- Εισαγωγή Αξιότιμε κύριε, Επίσημη επιστολή, αρσενικός αποδέκτης, όνομα άγνωστο Αξιότιμη κυρία, Επίσημη επιστολή, θηλυκός αποδέκτης, όνομα άγνωστο Αξιότιμε κύριε/ κυρία, Επίσημη επιστολή, το όνομα και
Διαβάστε περισσότεραPROFESSIONAL EXAMINATION BOARD Group 05 Pharmacist, Lab technician and other equivalents post Recruitment Test th April :00 AM
PROFESSIONAL EXAMINATION BOARD Group 05 Pharmacist, Lab technician and other equivalents post Recruitment Test 2017 20 th April 2017 09:00 AM Topic: General Studies 1) Choose the best option to complete
Διαβάστε περισσότεραApplication Motivational Cover Letter
- Opening Formal, male recipient, name unknown Formal, female recipient, name unknown Formal, recipient name and gender unknown Αξιότιμε κύριε, Αξιότιμη κυρία, Αξιότιμε κύριε/ κυρία, Αγαπητοί κύριοι και
Διαβάστε περισσότεραApplication Motivational Cover Letter
- Opening Αξιότιμε κύριε, Formal, male recipient, name unknown Αξιότιμη κυρία, Formal, female recipient, name unknown Αξιότιμε κύριε/ κυρία, Formal, recipient name and gender unknown Αγαπητοί κύριοι και
Διαβάστε περισσότεραΠροσωπική Αλληλογραφία Ευχές
- Γάμος त म ह र श द क अवसर पर बध ई ह. म र आश र व द ह क त म सद स ख रह. Συγχαρητήρια για ένα νιόπαντρο ζευγάρι स म गल भव Συγχαρητήρια για ένα νιόπαντρο ζευγάρι Συγχαρητήρια. Σας ευχόμαστε όλη την ευτυχία
Διαβάστε περισσότεραΠροσωπική Αλληλογραφία Ευχές
- Γάμος Συγχαρητήρια. Σας ευχόμαστε όλη την ευτυχία του κόσμου. Συγχαρητήρια για ένα νιόπαντρο ζευγάρι Θερμά συγχαρητήρια για τους δυο σας αυτήν την ημέρα του γάμου σας. Συγχαρητήρια για ένα νιόπαντρο
Διαβάστε περισσότεραTrès formel, le destinataire a un titre particulier qui doit être utilisé à la place de son nom
- Ouverture grec hindi Αξιότιμε κύριε Πρόεδρε, म नन य र ष ट र पत ज, Très formel, le destinataire a un titre particulier qui doit être utilisé à la place de son nom Αγαπητέ κύριε, Formel, destinataire masculin,
Διαβάστε περισσότεραMycket formellt, mottagaren har en speciell titel som ska användas i stället för namnet
- Öppning Grekiska Hindi Αξιότιμε κύριε Πρόεδρε, म नन य र ष ट र पत ज, Mycket formellt, mottagaren har en speciell titel som ska användas i stället för namnet Αγαπητέ κύριε, Formellt, manlig mottagare,
Διαβάστε περισσότεραΕμπορική αλληλογραφία Ηλεκτρονική Αλληλογραφία
- Εισαγωγή χίντι म नन य र ष ट र पत ज, γαλλικά Monsieur le Président, Εξαιρετικά επίσημη επιστολή, ο παραλήπτης έχει ένα ειδικό τίτλο ο οποίος πρέπει να χρησιμοποιηθεί αντί του ονόματος του म नन य मह दय,
Διαβάστε περισσότεραBewerbung Anschreiben
- Einleitung Αξιότιμε κύριε, Formell, männlicher Empfänger, Name unbekannt Αξιότιμη κυρία, Formell, weibliche Empfängerin, Name unbekannt Αξιότιμε κύριε/ κυρία, Formell, Name und Geschlecht des Empfängers
Διαβάστε περισσότεραkvclasses.com PROFESSIONAL EXAMINATION BOARD Police Recruitment Test : th September 2016, 02:00 PM Topic: English 1) Question Stimulus :
PROFESSIONAL EXAMINATION BOARD Police Recruitment Test : 2016 8th September 2016, 02:00 PM Topic: English 1) Fill in the blank with the correct option. Everyone save the natural resources of the earth.
Διαβάστε περισσότεραbab.la व क य श क श: व यक त गत श भक मन ए अ ग र ज -ग र क
श भक मन ए : श द Congratulations. Wishing the both of you all the happiness in the world. Συγχαρητήρια. Σας ευχόμαστε όλη την ευτυχία του κόσμου. ह ल ह म ज नक स द ह ई ह, उन ह बध ई Congratulations and warm
Διαβάστε περισσότεραSolliciteren Sollicitatiebrief
- Aanhef Αξιότιμε κύριε, Formeel, mannelijke geadresseerde, naam onbekend Αξιότιμη κυρία, Formeel, vrouwelijke geadresseerde, naam onbekend Αξιότιμε κύριε/ κυρία, Formeel, naam en geslacht van de geadresseerde
Διαβάστε περισσότεραbab.la Frasi: Corrispondenza Auguri Hindi-Greco
Auguri : Matrimonio त म ह र श द क अवसर पर बध ई ह. म र आश र व द ह क त म सद स ख रह. Συγχαρητήρια. Σας ευχόμαστε όλη την ευτυχία του κόσμου. स म गल भव Θερμά συγχαρητήρια για τους δυο σας αυτήν την ημέρα του
Διαβάστε περισσότεραस म गल भव. Συγχαρητήρια για το γάμο σας! Informal, usada para felicitar um casal recém-casado que você conhece bem
- Casamento Συγχαρητήρια. Σας ευχόμαστε όλη την ευτυχία του κόσμου. Frase usada para felicitar um casal recém-casado Θερμά συγχαρητήρια για τους δυο σας αυτήν την ημέρα του γάμου σας. Frase usada para
Διαβάστε περισσότεραCorrispondenza Auguri
- Matrimonio त म ह र श द क अवसर पर बध ई ह. म र आश र व द ह क त म सद स ख रह. Per congratularsi con una coppia appena sposata स म गल भव Per congratularsi con una coppia appena sposata Συγχαρητήρια. Σας ευχόμαστε
Διαβάστε περισσότεραTkho fokku iz u i= 2015 (II) vuqns k. Øekad. Lke; : 3:00?kaVs. Ikw.kkZad : 200 vad. fo k; dksm iqflrdk dksm
fo k; dksm iqflrdk dksm 3 B Lke; : 3:00?kaVs 1 2015 (II) Tkho fokku iz u i= Øekad H Ikw.kkZad : 200 vad vuqns k 1. vkius fgunh dks ek/;e pquk gs A bl ijh{kk iqflrdk esa,d lks isarkyhl (20 Hkkx 'A'esa +
Διαβάστε περισσότεραf=hkqt ds lokzaxle gksus ds fy, 'krsz ज य म त 3 le:irk vksj lokzaxlerk जब द आक त य सम न आक र और सम न आक त क ह ह, व आक त य सव गसम कहल ह द न आक त य क ब च क इस घटन क सव न ग सम कह ह f=hkqt ds lokzaxle gksus
Διαβάστε περισσότεραKorespondencja osobista Życzenia
- Ślub त म ह र श द क अवसर पर बध ई ह. म र आश र व द ह क त म सद स ख रह. Używane, gdy gratulujemy młodej parze स म गल भव Używane, gdy gratulujemy młodej parze Συγχαρητήρια. Σας ευχόμαστε όλη την ευτυχία του
Διαβάστε περισσότεραOn following his advise on the various problems we faced, we found major change in our life & things moving in our favour.
Testimonial/ श ग ज़ र M.L.SHARMA Pandit Sukhdev Prasad Ghildiyal is amongs the third generation Acharya from family of qualified and professionals sanskrit acharyas and astrology. His grandfather and father
Διαβάστε περισσότεραMean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
Διαβάστε περισσότεραHOMEWORK 4 = G. In order to plot the stress versus the stretch we define a normalized stretch:
HOMEWORK 4 Problem a For the fast loading case, we want to derive the relationship between P zz and λ z. We know that the nominal stress is expressed as: P zz = ψ λ z where λ z = λ λ z. Therefore, applying
Διαβάστε περισσότερα2 Composition. Invertible Mappings
Arkansas Tech University MATH 4033: Elementary Modern Algebra Dr. Marcel B. Finan Composition. Invertible Mappings In this section we discuss two procedures for creating new mappings from old ones, namely,
Διαβάστε περισσότεραAreas and Lengths in Polar Coordinates
Kiryl Tsishchanka Areas and Lengths in Polar Coordinates In this section we develop the formula for the area of a region whose boundary is given by a polar equation. We need to use the formula for the
Διαβάστε περισσότεραMath 6 SL Probability Distributions Practice Test Mark Scheme
Math 6 SL Probability Distributions Practice Test Mark Scheme. (a) Note: Award A for vertical line to right of mean, A for shading to right of their vertical line. AA N (b) evidence of recognizing symmetry
Διαβάστε περισσότεραAreas and Lengths in Polar Coordinates
Kiryl Tsishchanka Areas and Lengths in Polar Coordinates In this section we develop the formula for the area of a region whose boundary is given by a polar equation. We need to use the formula for the
Διαβάστε περισσότεραLecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3
Lecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3 1 State vector space and the dual space Space of wavefunctions The space of wavefunctions is the set of all
Διαβάστε περισσότεραCRASH COURSE IN PRECALCULUS
CRASH COURSE IN PRECALCULUS Shiah-Sen Wang The graphs are prepared by Chien-Lun Lai Based on : Precalculus: Mathematics for Calculus by J. Stuwart, L. Redin & S. Watson, 6th edition, 01, Brooks/Cole Chapter
Διαβάστε περισσότερα3.4 SUM AND DIFFERENCE FORMULAS. NOTE: cos(α+β) cos α + cos β cos(α-β) cos α -cos β
3.4 SUM AND DIFFERENCE FORMULAS Page Theorem cos(αβ cos α cos β -sin α cos(α-β cos α cos β sin α NOTE: cos(αβ cos α cos β cos(α-β cos α -cos β Proof of cos(α-β cos α cos β sin α Let s use a unit circle
Διαβάστε περισσότεραMinion Pro Condensed A B C D E F G H I J K L M N O P Q R S T U
Minion Pro Condensed Latin capitals A B C D E F G H I J K L M N O P Q R S T U V W X Y Z & Æ Ł Ø Œ Þ Ð Á Â Ä À Å Ã Ç É Ê Ë È Í Î Ï Ì İ Ñ Ó Ô Ö Ò Õ Š Ú Û Ü Ù Ý Ÿ Ž Ă Ā Ą Ć Č Ď Đ Ě Ė Ē Ę Ğ Ģ Ī Į Ķ Ĺ Ľ Ļ Ń
Διαβάστε περισσότεραStrain gauge and rosettes
Strain gauge and rosettes Introduction A strain gauge is a device which is used to measure strain (deformation) on an object subjected to forces. Strain can be measured using various types of devices classified
Διαβάστε περισσότεραSection 8.3 Trigonometric Equations
99 Section 8. Trigonometric Equations Objective 1: Solve Equations Involving One Trigonometric Function. In this section and the next, we will exple how to solving equations involving trigonometric functions.
Διαβάστε περισσότεραPhys460.nb Solution for the t-dependent Schrodinger s equation How did we find the solution? (not required)
Phys460.nb 81 ψ n (t) is still the (same) eigenstate of H But for tdependent H. The answer is NO. 5.5.5. Solution for the tdependent Schrodinger s equation If we assume that at time t 0, the electron starts
Διαβάστε περισσότεραSection 7.6 Double and Half Angle Formulas
09 Section 7. Double and Half Angle Fmulas To derive the double-angles fmulas, we will use the sum of two angles fmulas that we developed in the last section. We will let α θ and β θ: cos(θ) cos(θ + θ)
Διαβάστε περισσότεραΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 6/5/2006
Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Ολοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα είναι μικρότεροι το 1000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Διάρκεια: 3,5 ώρες Καλή
Διαβάστε περισσότεραCONCENTRATIVE PROPERTIES OF AQUEOUS SOLUTIONS: DENSITY, REFRACTIVE INDEX, FREEZING POINT DEPRESSION, AND VISCOSITY
DENSITY, REFRACTIVE INDEX, FREEZING POINT DEPRESSION, AND VISCOSITY This table gives properties of aqueous solutions of 66 substances as a function of concentration. All data refer to a temperature of
Διαβάστε περισσότεραderivation of the Laplacian from rectangular to spherical coordinates
derivation of the Laplacian from rectangular to spherical coordinates swapnizzle 03-03- :5:43 We begin by recognizing the familiar conversion from rectangular to spherical coordinates (note that φ is used
Διαβάστε περισσότεραΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 19/5/2007
Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Αν κάπου κάνετε κάποιες υποθέσεις να αναφερθούν στη σχετική ερώτηση. Όλα τα αρχεία που αναφέρονται στα προβλήματα βρίσκονται στον ίδιο φάκελο με το εκτελέσιμο
Διαβάστε περισσότεραOther Test Constructions: Likelihood Ratio & Bayes Tests
Other Test Constructions: Likelihood Ratio & Bayes Tests Side-Note: So far we have seen a few approaches for creating tests such as Neyman-Pearson Lemma ( most powerful tests of H 0 : θ = θ 0 vs H 1 :
Διαβάστε περισσότεραFinite Field Problems: Solutions
Finite Field Problems: Solutions 1. Let f = x 2 +1 Z 11 [x] and let F = Z 11 [x]/(f), a field. Let Solution: F =11 2 = 121, so F = 121 1 = 120. The possible orders are the divisors of 120. Solution: The
Διαβάστε περισσότεραΟι αδελφοί Montgolfier: Ψηφιακή αφήγηση The Montgolfier Βrothers Digital Story (προτείνεται να διδαχθεί στο Unit 4, Lesson 3, Αγγλικά Στ Δημοτικού)
Οι αδελφοί Montgolfier: Ψηφιακή αφήγηση The Montgolfier Βrothers Digital Story (προτείνεται να διδαχθεί στο Unit 4, Lesson 3, Αγγλικά Στ Δημοτικού) Προσδοκώμενα αποτελέσματα Περιεχόμενο Ενδεικτικές δραστηριότητες
Διαβάστε περισσότεραHomework 3 Solutions
Homework 3 Solutions Igor Yanovsky (Math 151A TA) Problem 1: Compute the absolute error and relative error in approximations of p by p. (Use calculator!) a) p π, p 22/7; b) p π, p 3.141. Solution: For
Διαβάστε περισσότεραExercises 10. Find a fundamental matrix of the given system of equations. Also find the fundamental matrix Φ(t) satisfying Φ(0) = I. 1.
Exercises 0 More exercises are available in Elementary Differential Equations. If you have a problem to solve any of them, feel free to come to office hour. Problem Find a fundamental matrix of the given
Διαβάστε περισσότεραJesse Maassen and Mark Lundstrom Purdue University November 25, 2013
Notes on Average Scattering imes and Hall Factors Jesse Maassen and Mar Lundstrom Purdue University November 5, 13 I. Introduction 1 II. Solution of the BE 1 III. Exercises: Woring out average scattering
Διαβάστε περισσότερα[1] P Q. Fig. 3.1
1 (a) Define resistance....... [1] (b) The smallest conductor within a computer processing chip can be represented as a rectangular block that is one atom high, four atoms wide and twenty atoms long. One
Διαβάστε περισσότεραC.S. 430 Assignment 6, Sample Solutions
C.S. 430 Assignment 6, Sample Solutions Paul Liu November 15, 2007 Note that these are sample solutions only; in many cases there were many acceptable answers. 1 Reynolds Problem 10.1 1.1 Normal-order
Διαβάστε περισσότεραΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
Διαβάστε περισσότεραFigure 1 T / K Explain, in terms of molecules, why the first part of the graph in Figure 1 is a line that slopes up from the origin.
Q1.(a) Figure 1 shows how the entropy of a molecular substance X varies with temperature. Figure 1 T / K (i) Explain, in terms of molecules, why the entropy is zero when the temperature is zero Kelvin.
Διαβάστε περισσότεραVolume of a Cuboid. Volume = length x breadth x height. V = l x b x h. The formula for the volume of a cuboid is
Volume of a Cuboid The formula for the volume of a cuboid is Volume = length x breadth x height V = l x b x h Example Work out the volume of this cuboid 10 cm 15 cm V = l x b x h V = 15 x 6 x 10 V = 900cm³
Διαβάστε περισσότεραOn a four-dimensional hyperbolic manifold with finite volume
BULETINUL ACADEMIEI DE ŞTIINŢE A REPUBLICII MOLDOVA. MATEMATICA Numbers 2(72) 3(73), 2013, Pages 80 89 ISSN 1024 7696 On a four-dimensional hyperbolic manifold with finite volume I.S.Gutsul Abstract. In
Διαβάστε περισσότεραCHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS
CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =
Διαβάστε περισσότεραNumerical Analysis FMN011
Numerical Analysis FMN011 Carmen Arévalo Lund University carmen@maths.lth.se Lecture 12 Periodic data A function g has period P if g(x + P ) = g(x) Model: Trigonometric polynomial of order M T M (x) =
Διαβάστε περισσότεραNuclear Physics 5. Name: Date: 8 (1)
Name: Date: Nuclear Physics 5. A sample of radioactive carbon-4 decays into a stable isotope of nitrogen. As the carbon-4 decays, the rate at which the amount of nitrogen is produced A. decreases linearly
Διαβάστε περισσότεραk A = [k, k]( )[a 1, a 2 ] = [ka 1,ka 2 ] 4For the division of two intervals of confidence in R +
Chapter 3. Fuzzy Arithmetic 3- Fuzzy arithmetic: ~Addition(+) and subtraction (-): Let A = [a and B = [b, b in R If x [a and y [b, b than x+y [a +b +b Symbolically,we write A(+)B = [a (+)[b, b = [a +b
Διαβάστε περισσότεραANSWERSHEET (TOPIC = DIFFERENTIAL CALCULUS) COLLECTION #2. h 0 h h 0 h h 0 ( ) g k = g 0 + g 1 + g g 2009 =?
Teko Classes IITJEE/AIEEE Maths by SUHAAG SIR, Bhopal, Ph (0755) 3 00 000 www.tekoclasses.com ANSWERSHEET (TOPIC DIFFERENTIAL CALCULUS) COLLECTION # Question Type A.Single Correct Type Q. (A) Sol least
Διαβάστε περισσότερα5- CACGAAACTACCTTCAACTCC-3 beta actin-r 5- CATACTCCTGCTTGCTGATC-3 GAPDH-F GAPDH-R
Table S1 Primers used in this work LncPPARδ-F 5- AGGATCCCAAGGCAGAAGTT -3 LncPPARδ-R 5- GAATAGAAAGGCGGGAAAGG -3 PPARδ-F 5- CACCCAGTGTCCTTCCATCT -3 PPARδ-R 5- CAGAATTGGGTGTGCTGCTT -3 ADRP-F 5- ACAACCGAGTGTGGTGACTC
Διαβάστε περισσότεραThe challenges of non-stable predicates
The challenges of non-stable predicates Consider a non-stable predicate Φ encoding, say, a safety property. We want to determine whether Φ holds for our program. The challenges of non-stable predicates
Διαβάστε περισσότεραSCHOOL OF MATHEMATICAL SCIENCES G11LMA Linear Mathematics Examination Solutions
SCHOOL OF MATHEMATICAL SCIENCES GLMA Linear Mathematics 00- Examination Solutions. (a) i. ( + 5i)( i) = (6 + 5) + (5 )i = + i. Real part is, imaginary part is. (b) ii. + 5i i ( + 5i)( + i) = ( i)( + i)
Διαβάστε περισσότεραΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ : ΧΗΜΙΚΑ ΠΡΟΣΘΕΤΑ ΠΟΥ ΠΡΟΟΡΙΖΟΝΤΑΙ ΓΙΑ ΤΟ ΝΕΡΟ ΤΟΥ ΑΤΜΟΛΕΒΗΤΑ
ΑΚΑ ΗΜΙΑ ΕΜΠΟΡΙΚΟΥ ΝΑΥΤΙΚΟΥ ΜΑΚΕ ΟΝΙΑΣ ΣΧΟΛΗ ΜΗΧΑΝΙΚΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΘΕΜΑ : ΧΗΜΙΚΑ ΠΡΟΣΘΕΤΑ ΠΟΥ ΠΡΟΟΡΙΖΟΝΤΑΙ ΓΙΑ ΤΟ ΝΕΡΟ ΤΟΥ ΑΤΜΟΛΕΒΗΤΑ ΣΠΟΥ ΑΣΤΗΣ : ΑΓΟΡΑΣΤΟΣ ΧΡΥΣΟΒΑΛΑΝΤΗΣ ΕΠΙΒΛΕΠΟΥΣΑ ΚΑΘΗΓΗΤΡΙΑ :
Διαβάστε περισσότεραThe Simply Typed Lambda Calculus
Type Inference Instead of writing type annotations, can we use an algorithm to infer what the type annotations should be? That depends on the type system. For simple type systems the answer is yes, and
Διαβάστε περισσότεραΑπόκριση σε Μοναδιαία Ωστική Δύναμη (Unit Impulse) Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο. Απόστολος Σ.
Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο The time integral of a force is referred to as impulse, is determined by and is obtained from: Newton s 2 nd Law of motion states that the action
Διαβάστε περισσότεραΕπιβλέπουσα Καθηγήτρια: ΣΟΦΙΑ ΑΡΑΒΟΥ ΠΑΠΑΔΑΤΟΥ
EΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΕΚΠΑΙΔΕΥΤΙΚΟ ΤΕΧΝΟΛΟΓΙΚΟ ΙΔΡΥΜΑ ΤΕΙ ΙΟΝΙΩΝ ΝΗΣΩΝ ΤΜΗΜΑ ΔΗΜΟΣΙΩΝ ΣΧΕΣΕΩΝ & ΕΠΙΚΟΙΝΩΝΙΑΣ Ταχ. Δ/νση : Λεωφ. Αντ.Τρίτση, Αργοστόλι Κεφαλληνίας Τ.Κ. 28 100 τηλ. : 26710-27311 fax : 26710-27312
Διαβάστε περισσότεραPARTIAL NOTES for 6.1 Trigonometric Identities
PARTIAL NOTES for 6.1 Trigonometric Identities tanθ = sinθ cosθ cotθ = cosθ sinθ BASIC IDENTITIES cscθ = 1 sinθ secθ = 1 cosθ cotθ = 1 tanθ PYTHAGOREAN IDENTITIES sin θ + cos θ =1 tan θ +1= sec θ 1 + cot
Διαβάστε περισσότεραΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 24/3/2007
Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Όλοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα μικρότεροι του 10000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Αν κάπου κάνετε κάποιες υποθέσεις
Διαβάστε περισσότεραΚΥΠΡΙΑΚΟΣ ΣΥΝΔΕΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY 21 ος ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ Δεύτερος Γύρος - 30 Μαρτίου 2011
Διάρκεια Διαγωνισμού: 3 ώρες Απαντήστε όλες τις ερωτήσεις Μέγιστο Βάρος (20 Μονάδες) Δίνεται ένα σύνολο από N σφαιρίδια τα οποία δεν έχουν όλα το ίδιο βάρος μεταξύ τους και ένα κουτί που αντέχει μέχρι
Διαβάστε περισσότεραOctober. October is a rounded utilitarian typeface designed that handles long texts with ease, and looks elegant in larger sizes. Typotheque.
October October is a rounded utilitarian typeface designed that handles long texts with ease, and looks elegant in larger sizes. October Hairline Thin ExtraLight Light Regular Medium Bold Heavy Black Hairline
Διαβάστε περισσότεραReview Test 3. MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Review Test MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Find the exact value of the expression. 1) sin - 11π 1 1) + - + - - ) sin 11π 1 ) ( -
Διαβάστε περισσότεραthe total number of electrons passing through the lamp.
1. A 12 V 36 W lamp is lit to normal brightness using a 12 V car battery of negligible internal resistance. The lamp is switched on for one hour (3600 s). For the time of 1 hour, calculate (i) the energy
Διαβάστε περισσότεραc Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
Διαβάστε περισσότεραMSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Διαβάστε περισσότερα5.4 The Poisson Distribution.
The worst thing you can do about a situation is nothing. Sr. O Shea Jackson 5.4 The Poisson Distribution. Description of the Poisson Distribution Discrete probability distribution. The random variable
Διαβάστε περισσότερα6.1. Dirac Equation. Hamiltonian. Dirac Eq.
6.1. Dirac Equation Ref: M.Kaku, Quantum Field Theory, Oxford Univ Press (1993) η μν = η μν = diag(1, -1, -1, -1) p 0 = p 0 p = p i = -p i p μ p μ = p 0 p 0 + p i p i = E c 2 - p 2 = (m c) 2 H = c p 2
Διαβάστε περισσότεραConductivity Logging for Thermal Spring Well
/.,**. 25 +,1- **-- 0/2,,,1- **-- 0/2, +,, +/., +0 /,* Conductivity Logging for Thermal Spring Well Koji SATO +, Tadashi TAKAYA,, Tadashi CHIBA, + Nihon Chika Kenkyuusho Co. Ltd., 0/2,, Hongo, Funabashi,
Διαβάστε περισσότεραFourier Series. MATH 211, Calculus II. J. Robert Buchanan. Spring Department of Mathematics
Fourier Series MATH 211, Calculus II J. Robert Buchanan Department of Mathematics Spring 2018 Introduction Not all functions can be represented by Taylor series. f (k) (c) A Taylor series f (x) = (x c)
Διαβάστε περισσότεραΕθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ
Εθνικό Μετσόβιο Πολυτεχνείο Σχολή Μηχανολόγων Μηχανικών ΕΡΓΑΣΤΗΡΙΟ ΕΜΒΙΟΜΗΧΑΝΙΚΗΣ ΚΑΙ ΣΥΣΤΗΜΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΜΗΧΑΝΟΛΟΓΙΚΩΝ ΚΑΤΑΣΚΕΥΩΝ ΚΑΙ ΑΥΤΟΜΑΤΟΥ ΕΛΕΓΧΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ
Διαβάστε περισσότεραSection 9.2 Polar Equations and Graphs
180 Section 9. Polar Equations and Graphs In this section, we will be graphing polar equations on a polar grid. In the first few examples, we will write the polar equation in rectangular form to help identify
Διαβάστε περισσότεραEnantioselective Organocatalytic Michael Addition of Isorhodanines. to α, β-unsaturated Aldehydes
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Enantioselective Organocatalytic Michael Addition of Isorhodanines to α,
Διαβάστε περισσότεραΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΨΥΧΟΛΟΓΙΚΕΣ ΕΠΙΠΤΩΣΕΙΣ ΣΕ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ ΓΕΩΡΓΙΑ ΤΡΙΣΟΚΚΑ Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ
Διαβάστε περισσότεραTMA4115 Matematikk 3
TMA4115 Matematikk 3 Andrew Stacey Norges Teknisk-Naturvitenskapelige Universitet Trondheim Spring 2010 Lecture 12: Mathematics Marvellous Matrices Andrew Stacey Norges Teknisk-Naturvitenskapelige Universitet
Διαβάστε περισσότεραΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΠΕΛΟΠΟΝΝΗΣΟΥ
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΠΕΛΟΠΟΝΝΗΣΟΥ ΣΧΟΛΗ ΔΙΟΙΚΗΣΗΣ ΚΑΙ ΟΙΚΟΝΟΜΙΑΣ ΤΜΗΜΑ ΔΙΟΙΚΗΣΗΣ ΕΠΙΧΕΙΡΗΣΕΩΝ ΚΑΙ ΟΡΓΑΝΙΣΜΩΝ Κατ/νση Τοπικής Αυτοδιοίκησης ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Μοντέλα στρατηγικής διοίκησης και
Διαβάστε περισσότεραDESIGN OF MACHINERY SOLUTION MANUAL h in h 4 0.
DESIGN OF MACHINERY SOLUTION MANUAL -7-1! PROBLEM -7 Statement: Design a double-dwell cam to move a follower from to 25 6, dwell for 12, fall 25 and dwell for the remader The total cycle must take 4 sec
Διαβάστε περισσότεραforms This gives Remark 1. How to remember the above formulas: Substituting these into the equation we obtain with
Week 03: C lassification of S econd- Order L inear Equations In last week s lectures we have illustrated how to obtain the general solutions of first order PDEs using the method of characteristics. We
Διαβάστε περισσότεραParametrized Surfaces
Parametrized Surfaces Recall from our unit on vector-valued functions at the beginning of the semester that an R 3 -valued function c(t) in one parameter is a mapping of the form c : I R 3 where I is some
Διαβάστε περισσότεραMatrices and Determinants
Matrices and Determinants SUBJECTIVE PROBLEMS: Q 1. For what value of k do the following system of equations possess a non-trivial (i.e., not all zero) solution over the set of rationals Q? x + ky + 3z
Διαβάστε περισσότεραΠτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Η ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ ΣΤΗΘΑΓΧΗ Νικόλας Χριστοδούλου Λευκωσία, 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ
Διαβάστε περισσότερα14 Lesson 2: The Omega Verb - Present Tense
Lesson 2: The Omega Verb - Present Tense Day one I. Word Study and Grammar 1. Most Greek verbs end in in the first person singular. 2. The present tense is formed by adding endings to the present stem.
Διαβάστε περισσότεραSupplemental tables and figures
Supplemental tables and figures Supplemental Table S1. Demographic and clinical parameters by quartiles of white Variables blood cell count. WBC quartiles( 1 9 cells/l) Q1(.6-5.3, n=2587) Q2(5.4-6.3, n=263)
Διαβάστε περισσότεραLiving and Nonliving Created by: Maria Okraska
Living and Nonliving Created by: Maria Okraska http://enchantingclassroom.blogspot.com Living Living things grow, change, and reproduce. They need air, water, food, and a place to live in order to survive.
Διαβάστε περισσότεραCHAPTER 48 APPLICATIONS OF MATRICES AND DETERMINANTS
CHAPTER 48 APPLICATIONS OF MATRICES AND DETERMINANTS EXERCISE 01 Page 545 1. Use matrices to solve: 3x + 4y x + 5y + 7 3x + 4y x + 5y 7 Hence, 3 4 x 0 5 y 7 The inverse of 3 4 5 is: 1 5 4 1 5 4 15 8 3
Διαβάστε περισσότεραRegistered Collected 62 Year / Male. Authenticated - TEST NAME RESULT PREVIOUS UNIT BIOLOGICAL RESULT
ا.د عبد العزیز النقلى د. ایات ابراھیم Visit Number: Patient Name: Age / Sex: Referred By: 20917007426 الا ستاذ/حمدى عبد الرحیم محمد. Registered Collected 23-04-2017 00:00:00 62 Year / Male - Reported 29-08-2018
Διαβάστε περισσότεραb. Use the parametrization from (a) to compute the area of S a as S a ds. Be sure to substitute for ds!
MTH U341 urface Integrals, tokes theorem, the divergence theorem To be turned in Wed., Dec. 1. 1. Let be the sphere of radius a, x 2 + y 2 + z 2 a 2. a. Use spherical coordinates (with ρ a) to parametrize.
Διαβάστε περισσότερα(1) Describe the process by which mercury atoms become excited in a fluorescent tube (3)
Q1. (a) A fluorescent tube is filled with mercury vapour at low pressure. In order to emit electromagnetic radiation the mercury atoms must first be excited. (i) What is meant by an excited atom? (1) (ii)
Διαβάστε περισσότεραEE512: Error Control Coding
EE512: Error Control Coding Solution for Assignment on Finite Fields February 16, 2007 1. (a) Addition and Multiplication tables for GF (5) and GF (7) are shown in Tables 1 and 2. + 0 1 2 3 4 0 0 1 2 3
Διαβάστε περισσότερα