«Ανάλυςθ επιγενετικών διεργαςιών ςτθ διαφοροποίθςθ ερυκρολευχαιμικών κυττάρων in vitro»

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "«Ανάλυςθ επιγενετικών διεργαςιών ςτθ διαφοροποίθςθ ερυκρολευχαιμικών κυττάρων in vitro»"

Transcript

1 ΑΡΛΣΟΣΕΛΕΛΟ ΠΑΝΕΠΛΣΘΜΛΟ ΚΕΑΛΟΝΛΚΘ ΧΟΛΘ ΕΠΛΣΘΜΩΝ ΤΓΕΛΑ ΣΜΘΜΑ ΦΑΡΜΑΚΕΤΣΛΚΘ ΜΕΣΑΠΣΤΧΛΑΚΟ ΠΡΟΓΡΑΜΜΑ ΠΟΤΔΩΝ ΚΑΣΕΤΚΤΝΘ: ΦΑΡΜΑΚΟΛΟΓΛΑ ΚΑΛ ΚΕΡΑΠΕΤΣΛΚΘ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: Ιωάννθσ Σ. Βιηιριανάκθσ, Ph.D., Αναπλθρωτισ Κακθγθτισ Μοριακισ Φαρμακολογίασ και Φαρμακογονιδιωματικισ Πειραματικι εργαςία μεταπτυχιακισ ειδίκευςθσ «Ανάλυςθ επιγενετικών διεργαςιών ςτθ διαφοροποίθςθ ερυκρολευχαιμικών κυττάρων in vitro» Ελιςάβετ Γ. Δακι Πτυχιοφχοσ Φαρμακοποιόσ ΚΕΑΛΟΝΛΚΘ 2018

2 Σίτλοσ ςτα Ελλθνικά: «Ανάλυςθ επιγενετικών διεργαςιών ςτθ διαφοροποίθςθ ερυκρολευχαιμικών κυττάρων in vitro» ΣίτλοσςταΑγγλικά: «Assessing epigenetic phenomena in the erythroleukemia cell differentiation program» Εκπονικθκε ςτο Εργαςτιριο Φαρμακολογίασ του τομζα Φαρμακογνωςίασ Φαρμακολογίασ του τμιματοσ Φαρμακευτικισ του Αριςτοτελείου Πανεπιςτθμίου Κεςςαλονίκθσ, ςτα πλαίςια του Μεταπτυχιακοφ Προγράμματοσ πουδϊν τθσ κατεφκυνςθσ: «Φαρμακολογία και Κεραπευτικι» Μεταπτυχιακι φοιτιτρια: Δακι Ελιςάβετ, Φαρμακοποιόσ Μζλθ τριμελοφσ εξεταςτικισ επιτροπισ: 1)Ιωάννθσ Σ. Βιηιριανάκθσ, Ph.D., Αναπλθρωτισ Κακθγθτισ Μοριακισ Φαρμακολογίασ και Φαρμακογονιδιωματικισ (Επιβλζπων Κακθγθτισ) 2) Λευκοκζα Χ. Παπαδοποφλου, Ph.D., Αναπλθρϊτρια Κακθγιτρια Φαρμακολογίασ, Τμιμα Φαρμακευτικισ, Α.Π.Θ. 3) ΕλζνθΝικολακάκθ, Αναπλθρϊτρια κακθγιτρια Βιοχθμείασ, Τμιμα Χθμείασ, ΑΠΘ. 2

3 ΠΛΝΑΚΑ ΠΕΡΛΕΧΟΜΕΝΩΝ ΕΛΛΔΑ ΕΤΧΑΡΛΣΛΕ 6 ΠΕΡΛΛΘΨΘ.. 8 SUMMARY.. 10 Α. ΕΛΑΓΩΓΘ. 12 Α.1. Πακοφυςιολογία και Κεραπευτικι του καρκίνου Α.1.1. Βιολογία του καρκίνου.. 12 Α.1.2. Γενετικι - επιγενετικι βάςθ και ετερογζνεια του καρκίνου.. 14 Α.2. micro-rnas και καρκίνοσ. Θ ρφκμιςθ τθσ ζκφραςθσ γονιδίων ςτθ διαδικαςία διαφοροποίθςθσ. 17 Α.3. Φαρμακολογικι κεραπευτικι προςζγγιςθ του καρκίνου 20 Α.3.1. υμβατικι κεραπεία του καρκίνου.. 20 Α.3.2. τοχευμζνθ κεραπεία του καρκίνου (Targeted cancer therapy). 21 Α.4. Εναλλακτικζσ κεραπευτικζσ προςεγγίςεισ του καρκίνου. 23 Α.5. Απόπτωςθ: θ φαρμακολογικι ςθμαςία τθσ για το ςχεδιαςμό νζων κεραπευτικϊν ςτρατθγικϊν ςτον καρκίνο. 23 Α.6. Κυτταρικι διαφοροποίθςθ και νεοπλαςία. 25 A.7. Κεραπευτικι προςζγγιςθ του καρκίνου μζςω επαγωγισ τθσ διαφοροποίθςθσ (Differentiation Therapy of Cancer) 25 Α.8. Διαδικαςίεσ διαφοροποίθςθσ φυςιολογικϊν αιμοποιθτικϊν κυττάρων. 26 Δ.8.1. Ερυκροποίθςθ. 28 Α.8.2. Μεγακαρυοποίθςθ.. 29 Α.9. Διαδικαςίεσ διαφοροποίθςθσ ςε λευχαιμικά κφτταρα.. 30 Α.10. Ο κυτταρικόσ κφκλοσ.. 31 Α Θ ρφκμιςθ του κυτταρικοφ κφκλου κατά τθν ανάπτυξθ των κυττάρων. 31 Α Ρφκμιςθ του κυτταρικοφ κφκλου 32 Α θμεία ελζγχου του κυτταρικοφ κφκλου.. 34 Α.11. Λευχαιμικά κφτταρα ωσ πρότυπα ςυςτιματα μελζτθσ τθσ διαφοροποίθςθσ των αιμοποιθτικϊν κυττάρων. 36 Α.12. Διακριτά πρότυπα ζκφραςθσ γονιδίων κατά τθ διαφοροποίθςθ των λευχαιμικϊν κυττάρων 41 Α.13. Επαγωγείσ τθσ διαφοροποίθςθσ ςε λευχαιμικά κφτταρα 44 Α.14. Ο ρόλοσ τθσ επιγενετικισ ςτθ διαφοροποίθςθ.. 45 Α.15. Ριβοςωμικζσ πρωτεϊνεσ και ριβοςωμοπάκειεσ 47 Β. ΚΟΠΟ ΣΘ ΠΕΛΡΑΜΑΣΛΚΘ ΜΕΣΑΠΣΤΧΛΑΚΙ ΔΛΠΛΩΜΑΣΛΚΘ ΕΡΓΑΛΑ.. 49 Γ. ΤΛΛΚΑ ΚΑΛ ΜΕΚΟΔΟΛ 50 Γ.1. Τλικά 50 3

4 Γ.1.1. Βιολογικά Τλικά.. 50 Γ.1.2. Τλικά Κυτταρικϊν Καλλιεργειϊν 50 Γ.2. Μζκοδοι.. 51 Γ.2.1. Καλλιζργεια και ανάπτυξθ κυττάρων ςε αιϊρθμα 51 Γ.2.2. Προςδιοριςμόσ του ρυκμοφ κυτταρικισ ανάπτυξθσ 52 Γ.2.3. Προςδιοριςμόσ του κυτταρικοφ κανάτου ςτα κφτταρα Κ-562 με χρϊςθ βαςιηόμενθ ςτο αντιδραςτιριο trypan blue. 53 Γ.2.4. Προςδιοριςμόσ των διαφοροποιθμζνων κυττάρων K562 με τθ χρϊςθ βενηιδίνθσ- Θ₂Ο₂ 54 Γ.2.5. Απομόνωςθ κυτταροπλαςματικοφ RNA με τθ μζκοδο τθσ ιςοκειοκυανικισ γουανιδίνθσ.. 55 Γ.2.6. Ποςοτικόσ και ποιοτικόσ προςδιοριςμόσ του RNA Γ.2.6.α. Ποςοτικόσ προςδιοριςμόσ RNA με εφαρμογι φαςματοφωτομετρίασ (Nanodrop 2000). 56 Γ.2.6.β. Ποιοτικόσ ζλεγχοσ RNA με θλεκτροφόρθςθ ςε πθκτι αγαρόηθσ 59 Γ.2.7. Παραςκευι cdna εκμαγείου από δείγμα RNA 59 Γ.2.7.α. cdna εκμαγείο για ανίχνευςθ τθσ ζκφραςθσ των mirs με Qpcr. 60 Γ.2.7.β. cdna εκμαγείο για ανίχνευςθ ζκφραςθσ γονιδίων με qpcr. 61 Γ.2.8. χεδιαςμόσ των κατάλλθλων εκκινθτϊν για τθν ανάλυςθ mirs και γονιδίων με qpcr. 62 Γ.2.9. Αλυςιδωτι αντίδραςθ πολυμεράςθσ πραγματικοφ χρόνου, realtime PCR (RT-PCR)- Ποςοτικι αλυςιδωτι αντίδραςθ πολυμεράςθσ, quantitative PCR (qpcr) 63 Γ Ποςοτικόσ προςδιοριαμόσ ζκφραςθσ mirnas. 64 Γ Ποςοτικόσ προςδιοριαμόσ ζκφραςθσ γονιδίων 65 Δ. AΠΟΣΕΛΕΜΑΣΑ ΠΕΛΡΑΜΑΣΛΚΙ ΕΡΓΑΛΑ 67 Δ1. χεδιαςμόσ πειραματικισ μεκοδολογίασ 67 Δ.2. Επιλογι mirnas και γονιδίων για τον πειραματατικό ζλεγχο τθσ ζκφραςισ τουσ ςτα K562 κφτταρα 67 Δ.3. Επαγωγι τθσ διαφοροποίθςθσ των Κ562 κυττάρων με HMBA. 70 Δ.3.1. Φαινοτυπικι αξιολόγθςθ των κυττάρων K562 μετά τθν επϊαςι τουσ με HMBA. 70 Δ.3.2. Πειραματικά δεδομζνα ανάπτυξθσ και διαφοροποίθςθσ των Κ562 κυττάρων παρουςία HMBA.. 71 Δ.3.3. Απομόνωςθ RNA και ζλεγχοσ ζκφραςθσ των υπό μελζτθ mirs ςτα Κ562 που επωάςτθκαν με HMBA. 73 Δ.3.4. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων του κυτταρικοφ κφκλου ςτα Κ562 που επωάςτθκαν με HMBA.. 74 Δ.3.5. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων των ριβοςωμικϊν πρωτεϊνϊν ςτα Κ562 που επωάςτθκαν με HMBA. 75 Δ.4. Επαγωγι τθσ διαφοροποίθςθσ των Κ562 κυττάρων με αιμίνθ 76 Δ.4.1. Φαινοτυπικι αξιολόγθςθ των κυττάρων K562 μετά τθν επϊαςι τουσ με αιμίνθ. 77 4

5 Δ.4.2. Πειραματικά δεδομζνα ανάπτυξθσ και διαφοροποίθςθσ των Κ562 κυττάρων παρουςία αιμίνθσ 78 Δ.4.3 Απομόνωςθ RNA και ζλεγχοσ ζκφραςθσ των υπό μελζτθ mirs ςτα Κ562 που επωάςτθκαν με αιμίνθ 80 Δ.4.4. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων του κυτταρικοφ κφκλου ςτα Κ562 που επωάςτθκαν με αιμίνθ.. 81 Δ.4.5. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων των ριβοςωμικϊν πρωτεϊνϊν ςτα Κ562 που επωάςτθκαν με αιμίνθ 82 Δ.5. Επαγωγι τθσ διαφοροποίθςθσ των Κ562 κυττάρων με NaBut. 83 Δ.5.1. Φαινοτυπικι αξιολόγθςθ των κυττάρων K562 μετά τθν επϊαςι τουσ με NaBut.. 83 Δ.5.2. Πειραματικά δεδομζνα ανάπτυξθσ και διαφοροποίθςθσ των Κ562 κυττάρων παρουςία NaBut.. 84 Δ.5.3 Απομόνωςθ RNA και ζλεγχοσ ζκφραςθσ των υπό μελζτθ mirs ςτα Κ562 που επωάςτθκαν με NaBut. 86 Δ.5.4. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων του κυτταρικοφ κφκλου ςτα Κ562 που επωάςτθκαν με NaBut.. 87 Δ.5.5. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων των ριβοςωμικϊν πρωτεϊνϊν ςτα Κ562 που επωάςτθκαν με NaBut. 88 Ε. ΤΗΘΣΘΘ ΑΠΟΣΕΛΕΜΑΣΩΝ.. 89 Σ. ΒΛΒΛΛΟΓΡΑΦΛΑ

6 ΕΤΧΑΡΛΣΛΕ Θ παροφςα εργαςία εκπονικθκε ςτο Εργαςτιριο Φαρμακολογίασ, του Σμιματοσ Φαρμακευτικισ, του Αριςτοτελείου Πανεπιςτθμίου Κεςςαλονίκθσ (Α.Π.Κ.) ςτα πλαίςια του Μεταπτυχιακοφ Προγράμματοσ πουδϊν τθσ κατεφκυνςθσ «Φαρμακολογία και Κεραπευτικι», υπό τθν επίβλεψθ του Αναπλθρωτι Κακθγθτι Μοριακισ Φαρμακολογίασ και Φαρμακογονιδιωματικισ Λωάννθ. Βιηιριανάκθ, ςτον οποίο οφείλω τισ μεγαλφτερεσ ευχαριςτίεσ για τθν επιλογι που ζκανε ςτο πρόςωπό μου να ςυμπεριλθφκεί ςτθν επιςτθμονικι του ομάδα, τθν εμπιςτοςφνθ που μου ζδειξε και τθν άμεςθ και διαρκι κακοδιγθςι του κακ όλθ τθ διάρκεια του μεταπτυχιακοφ προγράμματοσ. Θ διακεςιμότθτά του, θ υπομονι του και θ εμπειρία του τόςο διδακτικά όςο και εργαςτθριακά αποτζλεςαν κφρια ςτοιχεία για τθ διεκπεραίωςθ τθσ παροφςασ εργαςίασ. Παράλλθλα κα ικελα να ευχαριςτιςω όλουσ τουσ κακθγθτζσ μου κατά τθ διάρκεια του μεταπτυχιακοφ προγράμματοσ, κακϊσ κακζνασ ςυντζλεςε με το δικό του τρόπο ςτθν ανάπτυξθ τθσ ερευνθτικισ μου ςκζψθσ, πζρα από τισ νζεσ γνϊςεισ που μου προςζφεραν. Λδιαίτερεσ ευχαριςτίεσ κζλω να εκφράςω ςτο πρόςωπο τθσ κυρίασ Λευκοκζασ Παπαδοποφλου, αναπλθρϊτριασ κακθγιτριασ Φαρμακολογίασ του Σμιματοσ Φαρμακευτικισ του Α.Π.Κ. για τθν τιμι να αποτελεί μζλοσ τθσ τριμελοφσ εξεταςτικισ μου επιτροπισ, αλλά και για τθ φιλικι τθσ διάκεςθ, το ενδιαφζρον και τισ ςυμβουλζσ που μου παρείχε κακ όλθ τθ διάρκεια τθσ εκπόνθςθσ τθσ διπλωματικισ αυτισ εργαςίασ. Επίςθσ, κζλω να ευχαριςτιςω τθν κυρία Ελζνθ Νικολακάκθ, Αναπλθρϊτρια κακθγιτρια Βιοχθμείασ του Σμιματοσ Χθμείασ του ΑΠΚ, για τισ γνϊςεισ που μου παρείχε προκαταρτικά ςτθ διάρκεια των μακθμάτων τθσ κατά το μεταπτυχιακό πρόγραμμα, αλλά και για τθ ςυμμετοχι τθσ ςτθν τριμελι επιτροπι εξζταςθσ. Κερμά ευχαριςτϊ οφείλω ςτθν υποψιφια διδάκτωρα Ακρίβου Μελπομζνθ, θ οποία ιταν δίπλα μου από τθν πρϊτθ ςτιγμι και με μφθςε ςε εργαςτθριακζσ τεχνικζσ και μεκόδουσ. Κακ όλθ τθ διάρκεια τθσ πραγματοποίθςθσ των πειραμάτων, μου παρείχε πολφτιμεσ ςυμβουλζσ, επεξθγιςεισ και διευκολφνςεισ. Να ευχαριςτιςω επίςθσ τισ υποψιφιεσ διδάκτορεσ οφία Γεωργίου και Μθλιϊτου Αντροφλα, κακϊσ θ κακοδιγθςι τουσ υπιρξε εξαιρετικά ςθμαντικι, λόγω εμπειρίασ, γνϊςεων, αλλά και υπομονισ. Εξίςςου πρόκυμα ανταποκρίκθκαν ςε απορίεσ μου και προβλθματιςμοφσ μου και οι υποψιφιοι διδάκτορεσ Χριςτοσ Παπαγιαννόπουλοσ, Κϊςτασ Κυρίτςθσ κακϊσ και ο μεταπτυχιακόσ φοιτθτισ Γιϊργοσ Καϊάφασ. Ευχαριςτϊ τον κφριο Λωάννθ Παςπαλτςι, για τθ φιλικι διάκεςθ και τθ βοικειά του ανά πάςα ςτιγμι, τόςο ςε επίπεδο κατανόθςθσ και εφαρμογισ μεκόδων και τεχνικϊν, όςο και ςε επίπεδο χειριςμοφ οργάνων και ερμθνείασ αποτελεςμάτων. Δε κα μποροφςα να αμελιςω τουσ ςυμφοιτθτζσ μου αλλά και όλα τα μζλθ του εργαςτθρίου Φαρμακολογίασ του τμιματοσ Φαρμακευτικισ για τθν άρτια ςυνεργαςία μασ. Ολοκλθρϊνοντασ, κζλω να ευχαριςτιςω τθν οικογζνειά μου για τθν αμζριςτθ υποτιριξι τθσ ςε όλα μου τα βιματα και ιδιαίτερα ςτθν εκπόνθςθ και τθ ςυγγραφι τθσ παροφςασ μεταπτυχιακισ εργαςίασ. Σόςο οι γονείσ μου, Γιϊργοσ Δακισ και Ελζνθ Καραγιαννίδου, ο αδερφόσ μου Κωνςταντίνοσ Δακισ, αλλά και θ γιαγιά μου Αςθμίνα Καραγιαννίδου και ο Αλζξανδροσ Κιάνασ ςυνζβαλλαν 6

7 ψυχολογικά, αλλά και πρακτικά, τα δφο αυτά χρόνια για τθν ολοκλιρωςθ του μεταπτυχιακοφ προγράμματοσ. Σζλοσ, κζλω να αφιερϊςω τθν παροφςα εργαςία ςτον παπποφ μου, Νικόλαο Καραγιαννίδθ, που δυςτυχϊσ δεν πρόλαβε τθν ολοκλιρωςι τθσ και πιςτεφω κα τον χαροποιοφςε ιδιαιτζρωσ. 7

8 ΠΕΡΛΛΘΨΘ Θ επαγωγι τθσ διαφοροποίθςθσ των καρκινικϊν κυττάρων αποτελεί μια εναλλακτικι κεραπευτικι προςζγγιςθ του καρκίνου, με ολοζνα και μεγαλφτερθ προοπτικι. Ζχει ενδιαφζρον το γεγονόσ ότι κατά τθν κυτταρικι διαφοροποίθςθ παρατθροφνται ςθμαντικζσ επιγενετικζσ τροποποιιςεισ που ζχουν κεντρίςει το ενδιαφζρον για φαρμακολογικι εκμετάλλευςθ μζςω τθσ ανάπτυξθσ νζων κεραπευτικϊν ςτοχευμζνθσ δράςθσ και εκλεκτικισ φαρμακοδυναμικισ ςυμπεριφοράσ. Σα τελευταία χρόνια τα mirnas, μία κατθγορία μικρϊν, μονόκλωνων RNAs (19-23 νουκλεοτίδια), ζχουν ταυτοποιθκεί ωσ επιλεκτικοί ρυκμιςτζσ προϊόντων γονιδιακισ ζκφραςθσ που δρουν μετα-μεταγραφικά. Θ ερυκροδιαφοροποίθςθ, μεταξφ άλλων διεργαςιϊν των κυττάρων, βρζκθκε επίςθσ να ρυκμίηεται από mirnas. Θ ςυςχζτιςθ των mirnas ωσ επιγενετικά ςτοιχεία ελζγχου ςε αντίςτοιχεσ διαδικαςίεσ που ςχετίηονται με τθ διαφοροποίθςθ ερυκρολευχαιμικϊν κυττάρων in vitro, δφναται να αποκαλφψει μοριακοφσ ςτόχουσ οι οποίοι μποροφν να αξιοποιθκοφν κεραπευτικά ζναντι αιματολογικϊν κακοθκειϊν, τθσ λευχαιμίασ και των ριβοςωμοπακειϊν. ε αυτά τα πλαίςια, θ παροφςα διπλωματικι εργαςία αποτελεί μία προςπάκεια κατανόθςθσ πακοφυςιολογικϊν μθχανιςμϊν και επιγενετικϊν μεταβολϊν ςτθν ερυκροποίθςθ, με απϊτερο ςτόχο τθ φαρμακολογικι αξιολόγθςθ και ανάπτυξθ καινοτόμων αντικαρκινικϊν ςτοχευμζνθσ δράςθσ για τθ κεραπεία τθσ λευχαιμίασ και των ριβοςωμοπακειϊν. Για τισ ανάγκεσ των πειραμάτων αξιοποιικθκε θ ερυκρολευχαιμικι κυτταρικι ςειρά των Κ562 ωσ πρότυπο μοντζλο. Διεξιχκθςαν χρονοεξαρτϊμενα πειράματα με διαφορετικοφσ επαγωγείσ διαφοροποίθςθσ και ςυγκεκριμζνα HMBA, αιμίνθ και βουτυρικό νάτριο ςε κατάλλθλεσ ςυγκεντρϊςεισ για επαγωγι τθσ διαφοροποίθςθσ. Αφοφ αξιολογικθκε θ δράςθ των ενϊςεων-χθμικϊν επαγωγζων ωσ προσ τθν κυτταρικι ανάπτυξθ, το κάνατο και τθ διαφοροποίθςθ, πραγματοποιικθκε απομόνωςθ ολικοφ RNA και ςφνκεςθ cdna προκειμζνου να χρθςιμοποιθκεί ςτθ ςυνζχεια ςε ανάλυςθ qpcr για ποςοτικοποίθςθ τθσ ζκφραςθσ για mirs, αλλά και για ςυγκεκριμζνα γονίδια ενδιαφζροντοσ. Θ επιλογι των mirs ςτθρίχκθκε ςτθ βάςθ μιασ ευρφτερθσ ερευνθτικισ προςπάκειασ που αναφζρεται ςτισ διαδικαςίεσ μεταγραφικισ ρφκμιςθστων γονιδίων των ριβοςωμικϊν πρωτεϊνϊν και τθσ λειτουργίασ των ριβοςωμάτων. Σα αποτελζςματα που πάρκθκαν δείχνουν πωσ το ΘΜΒΑ ωκεί τα Κ562 κφτταρα ςτο μονοπάτι τθσ μεγακαρυοποίθςθσ, κακϊσ τα επίπεδα ζκφραςθσ των ςφαιρινϊν α και γ μειϊνονται δραματικά ςτισ 72 ϊρεσ επϊαςθσ, εν αντικζςει με τθν αιμίνθ ι το βουτυρικό νάτριο όπου αυξάνονται. Σα mir-129-5p και mir-663a μειϊνονται εξ αρχισ ςτο 50% τθσ ζκφραςισ τουσ. Σο mir p εμφανίηει επίςθσ μειωμζνθ ζκφραςθ, ςε υψθλότερα όμωσ επίπεδα. Οι ριβοςωμικζσ πρωτεΐνεσ RPS19, RPS14, RPL35a, RPL5 και RPL10 εμφανίηουν ζνα ιδιαίτερο μοτίβο αρχικισ αφξθςθσ τθσ ζκφραςισ τουσ που ακολουκείται από μείωςθ των επιπζδων μετά από 72 ϊρεσ. Κφρια γονίδια του κυτταρικοφ κφκλου όπωσ το CMYC και p53 μειϊνονται, ανεξάρτθτα μάλιςτα από το p21, το οποίο αυξάνεται δραματικά και το ακολουκοφν τα γονίδια των καςπαςϊν 3 και 8. Θ επϊαςθ με αιμίνθ ςτρζφει τα κφτταρα όπωσ είναι γνωςτό προσ ερυκροποίθςθ. Θ ζκφραςθ των mirs επθρεάηεται αφοφ παρατθρείται μζιωςθ, ενϊ 8

9 θ μεγαλφτερθ μείωςθ τθσ ζκφραςθσ καταγράφεται για το mir-129-5p και mir p, παρουςία του επαγωγζα αιμίνθ. Οι ριβοςωμικζσ πρωτεΐνεσ ακολουκοφν το ίδιο μοτίβο αυξομείωςθσ όπωσ και παρουςία του HMBA, με εξαίρεςθ τισ RPL5 και RPL10 τθσ μεγάλθσ υπομονάδασ του ριβοςϊματοσ, οι οποίεσ ςυνεχίηουν να υπερεκφράηονται και μετά τισ 72ϊρεσ. Αντίςτοιχα, θ ζκφραςθ των γονιδίων p53 και p21 αυξάνονται με χρονοεξαρτϊμενο τρόπο, όπωσ επίςθσ και θ καςπάςθ 8. Αντίκετα, τα γονίδια CMYC και CDK2,4,6 εμφανίηουν μείωςθ τθσ ζκφραςισ τουσ που είναι μεγαλφτερθ μετά τισ 72 ϊρεσ. Σζλοσ, θ επϊαςθ με βουτυρικό νάτριο ζδειξε να επθρεάηει αρκετά διαφορετικά τα προφίλ ζκφραςθσ, με εντονότερθ τθν αυξθμζνθ ζκφραςθ των ςφαιρινϊν α και γ. Όλα τα μελετϊμενα mirs αυξάνονται δραματικά ςτισ 72 ϊρεσ, με εντονότερο το mir-663-a. Επίςθσ, θ ζκφραςθ όλων των ριβοςωμικϊν πρωτεϊνϊν αυξάνεται, ιδίωσ των RPL5 και RPL10, ενϊ των καςπαςϊν 3,8 και 9 μειϊνεται. Θ ζκφραςθ των γονιδίων των p21, p53 και CDK2,4,6 παρουςία βουτυρικοφ ομοιάηει με τθν ζκφραςι τουσ παρουςία αιμίνθσ, ενϊ το CMYC ςυμπεριφζρεται όπωσ και παρουςία του HMBA. Σο γεγονόσ ότι οι τρεισ χθμικοί επεγωγείσ τθσ διαφοροποίθςθσ των Κ562 κυττάρων προκαλοφν διαφορετικι επίδραςθ ςτθν ζκφραςθ των mirs και των mrnas ενδιαφζροντοσ δείχνει ότι οι αποφάςεισ δζςμευςθσ των κυττάρων προσ μεγακαρυοποίθςθ ι ευκροποίθςθ ςυνοδεφονται από επιλεκτικι τροποποίθςθ μονοπατιϊν γονιδιακισ ζκφραςθσ. Σα ευριματα είναι ενκαρρυντικά ωσ προσ τθν πικανι ςυςχζτιςθ τθσ ρφκμιςθσ mirs και ριβοςωμικϊν πρωτεϊνϊν κατά τθ διάρκεια τθσ in vitro διαφοροποίθςθσ λευχαιμικϊν κυττάρων. Περιςςότερθ ζρευνα ςε βάκοσ απαιτείται όμωσ προσ επιβεβαίωςθ και περαιτζρω φαρμακολογικι αξιοποίθςθ ςτθ βάςθ και των ιδθ υπαρχόντων μοριακϊν δεδομζνων και προςεγγίςεων κεραπευτικισ πρακτικισ διαταραχϊν τθσ αιμοποίθςθσ. 9

10 SUMMARY The induction of cancer cell differentiation is an alternative therapeutic approach to cancer therapy and the development of innovative selective drugs, with an ever-increasing perspective. Interestingly, upon cellular differentiation several alterations of epigenetic modifications have been observed thus far. In recent years, mirnas (mirs), a class of small, single-stranded RNAs (19-23 nucleotides), have been identified as selective regulators of gene expression that may act posttranscriptionally. Erythroid differentiation, among other cell processes, was also found to be regulated by mirnas. The successful correlation of specific mirnas as epigenetic controllers in relevant processes associated with the differentiation of erythroleukemic cells in vitro, may reveal molecular targets that can be used therapeutically against hematological malignancies, leukemia and ribosomopathies. In this context, this MSc diploma thesis is focused on the way by which the better understanding of pathophysiological mechanisms and epigenetic changes in erythropoiesis, could advance the pharmacological development of innovative antitumor agents of targeted action. In this MSc thesis, the erythroleukemia K562 cell line was used as a model. Time-dependent experiments were performed with three differentchemical inducers of differentiation, i.e. HMBA, hemin and sodium butyrate at appropriate concentrations to induce differentiation. After assessing the effect of these inducers on cell growth, death and differentiation, total RNA was isolated to proceed through cdna synthesis into qpcr analysis of expression of specific mirs and genes of interest. The selection of mirs and genes to be analyzed were selected based on a working research project that focuses on the transcriptional regulation of ribosomal protein gene expression and ribosome function in erythropoiesis. The results obtained have shown that HMBA induces differentiation of cells in the pathway of megakaryopoiesis, as the expression levels of α and γ globins are dramatically reduced at 72 hours of incubation, as opposed of those achieved after treatment with either hemin or sodium butyrate. MiR-129-5p and mir-663a are initially reduced to 50% of their expression, whereas decreased expression was also observed for mir p but at higher level. The ribosomal proteins RPS19, RPS14, RPL35a, RPL5 and RPL10 have shown a biphasic expression pattern with an initial increase of their expression, followed by a decrease after 72 hours of incubation. Cell cycle-related genes, such as CMYC and p53, are reduced, irrespective of p21, whose expression levels dramatically increased at the same period. Similar reduction in the gene expression levels of caspases 3 and 8 were observed during the incubation by HMBA. Exposure of K562 cells to hemin has induced erythroid differentiation, as it is expected. The expression of mirs has been shown to down-regulated, but a greater decrease in expression is recorded for mir-129-5p and mir p, in the presence of hemin. The ribosomal protein gene expression exhibited the same fluctuation pattern as upon the presence of HMBA, except that RPL5 and RPL10, two ribosomal proteins of the large subunit of the ribosome, that have shown to be overexpressed even after 72hours of incubation. Amongst the genes tested by qpcr, the analysis of p21 expression has shown the more dramatic increase upon hemin exposure in a time-dependent manner. Similar by significantly lower increase in their expression 10

11 have been indicated for CASP8, CCND1, CASP3 and p53. On contrary, the gene expression of CMYC and CDK2,4,6 as well as BCL2 have shown a time-dependent decrease in their levels. Finally, incubation with sodium butyrate indicated to affect K562 cells quite differently gene by considering the expression profiles under investigation with a more pronounced increased mrna level of the α and γ globins after 72 hours. Also, in K-562 cells all the mirs studied were increased dramatically after 72 hours exposure to sodium butyrate, with the mir-663-ato exhibit thegreater alteration. Also, the expression of RPL5 and RPL10 has shown a substantial increase whereas the levels of RPS19, RPS14 and RPL35a, slightly increased after 72 hours of incubation.moreover, the expression profile of p21 has shown an initial increase at 24 hours that lowers afterwardsbut still is much higher than that observed for untreated K562 cells after 72 hours. The expression level of CCND1 greatly increases after 72 hours whereas the level of CASP3,8,9, p53 and CDK2,4,6 decreases at the same exposure period. The data presented in this MSc proposes a potential correlation of the cellular decisions taken through the exposure of K562 cells to various chemical inducersand the gene expression profiles of selected mirs and gene profile networks under investigation. Thus, these findings are encouraging in attempting to correlate specific mirs and genes with crucial cellular functions during leukemic cell differentiation. More in-depth research, however, is required to further confirm such a hypothesis, especially by working toward target validation and pharmacological exploitation. 11

12 Α. ΕΛΑΓΩΓΘ Α.1. Πακοφυςιολογία και Κεραπευτικι του καρκίνου Α.1.1. Βιολογία του καρκινικοφ κυττάρου Μετά από πολλά χρόνια ζρευνασ για τον καρκίνο, ζχει δθμιουργθκεί πλοφςια και ςφνκετθ γνϊςθ. Ο καρκίνοσ ορίηεται ωσ μια γενετικι νόςοσ με χαρακτθριςτικι αςτάκεια του γονιδιϊματοσ. Ουςιαςτικά δεν είναι μόνο μία αςκζνεια, αλλά ζνα μωςαϊκό κακοικων νεοπλαςμάτων. Θ ογκογζνεςθ ςτουσ ανκρϊπουσ είναι μια διαδικαςία πολλαπλϊν ςταδίων που αντικατοπτρίηουν τισ γενετικζσ μεταβολζσ που οδθγοφν ςτον προοδευτικό μεταςχθματιςμό φυςιολογικϊν ανκρϊπινων κυττάρων ςε εξαιρετικά κακοικθ. Πρόκειται για μία πολυςταδιακι διαδικαςία πολλϊν ετϊν, όπου θ γενετικι αςτάκεια διαδραματίηει ςθμαντικό ρόλο. Χαρακτθριςτικό του καρκίνου είναι ο άναρχοσ πολλαπλαςιαςμόσ των κυττάρων, ο οποίοσ ξεκινά κατά κανόνα από ζνα μεταλλαγμζνο κφτταρο. Πιο ςυγκεκριμζνα, τα κφτταρα του ςϊματοσ αναπτφςςονται και διαιροφνται με ελεγχόμενο τρόπο, ζτςι ϊςτε να εξαςφαλίηεται θ ανανζωςθ των ιςτϊν. Σα παλαιά κφτταρα αποπίπτουν και αντικακίςτανται από νζα. Ωςτόςο, μερικζσ φορζσ θ διαδικαςία αυτι δεν πραγματοποιείται φυςιολογικά. Σο γενετικό υλικό (DNA) ενόσ κυττάρου μπορεί να υποςτεί βλάβθ ι να τροποποιθκεί, με αποτζλεςμα να προκαλοφνται μεταλλάξεισ που επθρεάηουν τθ φυςιολογικι ανάπτυξθ και διαίρεςθ των κυττάρων. τισ περιπτϊςεισ αυτζσ οι διαδικαςίεσ του κυτταρικοφ πολλαπλαςιαςμοφ και τθσ απόπτωςθσ απορρυκμίηονται με αποτζλεςμα τα επιπλζον κφτταρα να ςχθματίηουν μια μάηα ιςτοφ που ονομάηεται όγκοσ (Hananah and Weinberg, 2011). Σα νεοπλάςματα διακρίνονται ςε καλοικθ και κακοικθ. Σα μεν καλοικθ (αδζνωμα, ίνωμα, λίπωμα) δεν επεκτείνονται, δε διθκοφν τουσ γφρω ιςτοφσ, οφτε μεταςτατοφν (Woodhouse et al., 1997), αντικζτωσ με τα κακοικθ (αδενοκαρκίνωμα, ινοςάρωμα, λιποςάρκωμα, λευχαιμία, λζμφωμα) τα οποία ζχουν και τισ τρεισ παραπάνω ιδιότθτεσ, τόςο αιματογενϊσ όςο και λεμφογενϊσ. Επίςθσ, τα νεοπλάςματα διακρίνονται και ωσ προσ τθ μορφολογία τουσ ςχετικά με τα όρια ςτον ιςτό, το ποςοςτό διαφοροποίθςθσ και το μζγεκοσ του πυρινα. Ο καρκίνοσ περιλαμβάνει πάνω από 200 διαφορετικοφσ τφπουσ, που διαφζρουν κυρίωσ ςτθ γενετικι τουσ ςφςταςθ (genetic profile), τθν αιτιολογία (etiology), τα κλινικά χαρακτθριςτικά, τον τρόπο εξζλιξισ τουσ και ςτο τελικό τουσ αποτζλεςμα (Priestman, 2008). Οι διάφοροι τφποι καρκίνου ζχουν ομαδοποιθκεί ςε ευρφτερεσ κατθγορίεσ, με κυριότερεσ: Καρκίνωμα, καρκίνοσ που ξεκινά από το δζρμα ι ιςτοφσ που βρίςκονται ι καλφπτουν τα εςωτερικά όργανα. άρκωμα, καρκίνοσ που ξεκινά ςε οςτό, χόνδρο, λίποσ, μφεσ, αιμοφόρα αγγεία ι άλλο ςυνδετικό ι υποςτθρικτικό ιςτό. Λευχαιμία, καρκίνοσ που ξεκινά από κάποιο αιμοποιθτικό ιςτό, όπωσ ο μυελόσ των οςτϊν και προκαλεί παραγωγι μεγάλου αρικμοφ μθ φυςιολογικϊν κυττάρων του αίματοσ που ειςζρχονται ςτο αίμα. 12

13 Λζμφωμα και μυζλωμα, καρκίνοι που προζρχονται από κφτταρα του ανοςοποιθτικοφ ςυςτιματοσ. Καρκίνοσ του κεντρικοφ νευρικοφ ςυςτιματοσ, καρκίνοσ που αρχίηει ςτουσ ιςτοφσ του εγκεφάλου και του νωτιαίου μυελοφ. Πολλοί τφποι καρκίνων διαγιγνϊςκονται ςτον ανκρϊπινο πλθκυςμό με μια θλικιακά εξαρτϊμενθ ςυχνότθτα (Renan 1993). Παλαιότερεσ πακολογικζσ αναλφςεισ διάφορων ςθμείων οργάνων αποκαλφπτουν βλάβεσ που φαίνεται να αντιπροςωπεφουν τα ενδιάμεςα ςτάδια ςε μια διαδικαςία μζςω τθσ οποίασ τα κφτταρα εξελίςςονται προοδευτικά από τθν κανονικότθτα μζςω μιασ ςειράσ προκακοθκϊν καταςτάςεων ςε επικετικοφσ καρκίνουσ (Foulds 1954). Αρκετζσ παρατθριςεισ των ανκρϊπινων καρκίνων και των ηωικϊν μοντζλων υποςτθρίηουν ότι θ ανάπτυξθ του όγκου προχωρά μζςω μιασ διαδικαςίασ ανάλογθσ προσ τθ δαρβινικι εξζλιξθ, όπου μια ςειρά γενετικϊν αλλαγϊν, που κακεμιά προςδίδει κάποιο είδοσ πλεονεκτιματοσ ανάπτυξθσ, οδθγεί ςτθν προοδευτικι μετατροπι φυςιολογικϊν ανκρϊπινων κυττάρων ςε καρκινικά κφτταρα (Foulds, 1954, Nowell, 1976). Χωρίσ κεραπευτικι παρζμβαςθ θ ζκβαςθ είναι ο κάνατοσ του ξενιςτι. φμφωνα με τουσ Douglas Hanahan και Robert A. Weinberg (Hanahan D. and Weinberg, 2001, 2011) ο τεράςτιοσ κατάλογοσ των γονότυπων των καρκινικϊν κυττάρων είναι μια εκδιλωςθ ζξι ουςιωδϊν μεταβολϊν ςτθ φυςιολογία των κυττάρων που υπαγορεφουν ςυλλογικά τθν κακοικθ ανάπτυξθ (Εικόνα 1). Πρόκειται για τθν αυτάρκεια ςτα ςιματα ανάπτυξθσ, τθ μθ ευαιςκθςία ςτα αναςταλτικά ςιματα ελζγχου τθσ ανάπτυξθσ, τθν αποφυγι προγραμματιςμζνου κυτταρικοφ κανάτου (απόπτωςθ), τθ δυνατότθτα απεριόριςτου ςυντονιςμοφ αναπαραγωγισ, τθν επαγωγι αγγειογζνεςθσ και τθ διικθςθ ςε ιςτό ωσ και τθ διαδικαςία τθσ μετάςταςθσ. Κάκε μία από αυτζσ τισ φυςιολογικζσ αλλαγζσ - νζεσ δυνατότθτεσ που αποκτικθκαν κατά τθ διάρκεια τθσ ανάπτυξθσ όγκου - αντιπροςωπεφει τθν επιτυχι διάςπαςθ ενόσ αντικαρκινικοφ αμυντικοφ μθχανιςμοφ που ςυνδζεται με τα κφτταρα και τουσ ιςτοφσ. 13

14 Εικόνα 1. Η ςυντριπτικι πλειοψθφία των καρκίνων αποκτοφν κοινό ςφνολο χαρακτθριςτικϊν και λειτουργικϊν ικανοτιτων κατά τθν ανάπτυξι τουσ με διάφορεσ μθχανιςτικζσ ςτρατθγικζσ επικράτθςθσ των ϊριμων χαρακτθριςτικϊν των καρκινικϊν κυττάρων (Hanahan, D. & Weinberg, R.A. 2011). Α.1.2. Γενετικι - επιγενετικι βάςθ και ετερογζνεια του καρκίνου Κάκε μια από τισ πολλζσ υποκατθγορίεσ του καρκίνου ζχει τα δικά τθσ διακριτά ιςτοπακολογικά και βιολογικά χαρακτθριςτικά. υγκεκριμζνα, ζχει παρατθρθκεί ότι τόςο τα καρκινικά κφτταρα ανάμεςα ςτουσ διαφορετικοφσ όγκουσ (intertumour heterogeneity), όςο και τα καρκινικά κφτταρα μζςα ςτον ίδιο όγκο (intratumour heterogeneity) παρουςιάηουν μεγάλθ ετερογζνεια που εκδθλϊνεται ωσ διαφορετικι μορφολογία ι διαφορετικόσ φαινότυποσ των κυττάρων (Meacham and Morrison, 2013). Είναι πλζον γνωςτό ότι, κάκε όγκοσ δεν αποτελεί ζνα ςφνολο από ομοιογενι κφτταρα αλλά είναι ζνα ςφνκετο «οικοςφςτθμα» που περιλαμβάνει τα κφτταρα του όγκου κακϊσ και άλλα είδθ κυττάρων, όπωσ ενδοκθλιακά, ςτρωματικά και αιμοποιθτικά κφτταρα που επθρεάηουν τθ λειτουργία του όγκου. Ωςτόςο ετερογζνεια παρατθρείται ακόμα και μεταξφ των κακοικων κυττάρων του όγκου ωσ προσ τθν ανάπτυξθ, το μεταβολιςμό, τθν απόπτωςθ και άλλουσ μθχανιςμοφσ που ςχετίηονται με τθν καρκινογζνεςθ. Μζςα ςε ζναν όγκο παρατθρείται θ φπαρξθ υποκλϊνων που οδθγοφν ςτθν εμφάνιςθ ετερογζνειασ εντόσ του όγκου. Οι υποκλϊνοι μποροφν είτε να παρεμβάλλονται ο ζνασ ςτον άλλο ι να είναι χωροταξικά διαχωριςμζνοι. Θ διαφορετικι γονιδιακι ζκφραςθ των υποκλϊνων του όγκου μπορεί να οφείλεται τόςο ςε γενετικζσ όςο και επιγενετικζσ μεταβολζσ - μθχανιςμοφσ (Burrell RA et al., 2013). Αυτοί οι μθχανιςμοί μαηί με τθ βιολογία του κυττάρου εντάςςονται ςτουσ ενδογενείσ παράγοντεσ (εγγενείσ ιδιότθτεσ του κυττάρου που ςυμβάλλουν ςτον ογκογόνο φαινότυπό του) πρόκλθςθσ ετερογζνειασ. τουσ εξωγενείσ παράγοντεσ 14

15 (ςτοιχεία του μικροπεριβάλλοντοσ του κυττάρου που επθρεάηουν το φαινότυπό του) εντάςςονται αρκετοί, όπωσ θ ικανότθτα ενόσ όγκου να προςλάβει επαρκι ποςότθτα αίματοσ αλλά και ςτρωματικά κφτταρα για να αναπτυχκεί. Παραδοςιακά, ο καρκίνοσ κεωροφνταν ότι οφείλεται ςε ςυςςϊρευςθ γενετικϊν μεταλλάξεων για τισ οποίεσ επικρατοφςε θ άποψθ ότι αποτελοφν τθν κφρια αιτία πρόκλθςθσ νεοπλαςίασ. Πράγματι, είναι πλζον παραδεκτό ότι τα καρκινικά κφτταρα εμφανίηουν μεταλλάξεισ (γονιδιακζσ ανωμαλίεσ) και καρυοτυπικι αςτάκεια, που είναι υπεφκυνεσ για τον ανεξζλεγκτο κυτταρικό πολλαπλαςιαςμό και το μικρό ποςοςτό διαφοροποίθςθσ των κυττάρων. Ωςτόςο, πρόςφατα κατζςτθ προφανζσ ότι οι γενετικζσ μεταλλάξεισ δεν αποτελοφν το μοναδικό παράγοντα πρόκλθςθσ καρκινογζνεςθσ και ετερογζνειασ των όγκων. Θ ζναρξθ και εξζλιξθ του καρκίνου, ο οποίοσ ζωσ τϊρα κεωροφνταν αποκλειςτικά γενετικι νόςοσ, πλζον είναι γνωςτό ότι μπορεί να οφείλεται και ςε επιγενετκζσ μεταβολζσ, εκτόσ από γενετικζσ μεταλλάξεισ. Ωσ «επιγενετικι», ςφμφωνα με τον C.H.Waddington το 1942(Waddington, C. H., 2012), ορίςτθκε το ςφνολο των αλλθλεπιδράςεων μεταξφ των γονιδίων και των προϊόντων τουσ που ςυνκζτουν το φαινότυπο ενόσ κυττάρου. Με τθν πάροδο του χρόνου ο οριςμόσ τθσ επιγενετικισ εξελίχκθκε ωσ εξισ: «θ επιγενετικι αναφζρεται ςτισ κλθρονομικζσ αλλαγζσ ςτο φαινότυπο ι ςτθν ζκφραςθ γονιδίων, ςε ζναν οργανιςμό ι κφτταρο, που απορρζουν από αλλαγζσ ςε ζνα χρωμόςωμα και οι οποίεσ δεν προκαλοφνται από αλλαγζσ ςτθν αλλθλουχία του DNA» (Ganesan, 2016). Είναι γνωςτό ότι θ κατάςταςθ ζκφραςθσ ενόσ γονιδίου (ενεργό ι ςιωπθλό) προςδιορίηεται από τθν οργάνωςθ του γονιδιϊματοσ ςε μια ςυμπαγι δομι, τθ χρωματίνθ. Θ χρωματίνθ αποτελείται από επαναλαμβανόμενεσ μονάδεσ νουκλεοςωμάτων, κάκε μια από τισ οποίεσ περιλαμβάνει 146 ηεφγθ βάςεων DNA που περιελίςςονται γφρω από το οκταμερζσ των ιςτονϊν. Επιγενετικοί μθχανιςμοί μεταβάλουν τθ δομι τθσ χρωματίνθσ, τροποποιϊντασ κατά ςυνζπεια τθν ζκφραςθ πολλϊν γονιδίων χωρίσ όμωσ να επθρεάςουν τθν αλλθλουχία του DNA. τουσ μθχανιςμοφσ αυτοφσ ςυμπεριλαμβάνονται οι εξισ: θ μεκυλίωςθ του DNA, οι τροποποιιςεισ των ιςτονϊν (μεκυλιϊςεισ, ακετυλιϊςεισ) και τα micro-rnas (mirnas). Και οι τρεισ μθχανιςμοί μποροφν να ρυκμίςουν τθ μεταγραφι των γονιδίων τροποποιϊντασ τθν πρόςβαςθ των μεταγραφικϊν παραγόντων-ςυμπλόκων ςτουσ υποκινθτζσ γονιδίων (gene promoters) και ςτισ ρυκμιςτικζσ περιοχζσ. Σο ςφνολο των τροποποιιςεων αυτϊν, που αναφζρεται ωσ επιγονιδίωμα, είναι υπεφκυνο για τθν πακοφυςιολογικι ενεργοποίθςθ ι παρεμπόδιςθ λειτουργίασ ςθματοδοτικϊν μονοπατιϊν, ςυμβάλλοντασ ζτςι ςτθν ανάπτυξθ του καρκίνου. Από τα παραπάνω λοιπόν κακίςταται εμφανζσ ότι επιγενετικζσ ανωμαλίεσ ςυνθγοροφν ςτθν πρόκλθςθ καρκινογζνεςθσ. Όςον αφορά ςτθν επίδραςθ των επιγενετικϊν μεταλλάξεων ςτθν ετερογζνεια του καρκίνου, κάκε κυτταρικόσ πλθκυςμόσ ενόσ όγκου ςχθματίηεται από ζνα αρχικό κφτταρο, το οποίο ζχει εκφράςει ςυγκεκριμζνο πρόγραμμα διαφοροποίθςθσ πριν τθν ζναρξθ τθσ καρκινογζνεςθσ. Θ κυτταρικι διαφοροποίθςθ αποτελεί προϊόν τροποποίθςθσ του επιγονιδιϊματοσ κατά τθ διάρκεια τθσ φυςιολογικισ ανάπτυξθσ. Θ τροποποίθςθ αυτι οδθγεί ςε αλλαγι του προτφπου ζκφραςθσ των γονιδίων, ενϊ θ αλλθλουχία 15

16 του DNA παραμζνει αναλλοίωτθ. Κατά ςυνζπεια, μζςω των αλλαγϊν αυτϊν παρατθρείται πρόκλθςθ κυτταρικισ ποικιλότθτασ κακϊσ τα διαφοροποιθμζνα κφτταρα διακζτουν διακριτζσ ιδιότθτεσ, ενϊ περιζχουν τισ ίδιεσ γενετικζσ πλθροφορίεσ (Ganesan, 2016). Πρόςφατα δεδομζνα επιςτθμονικϊν μελετϊν υποςτθρίηουν ότι οι γενετικοί και επιγενετικοί μθχανιςμοί δεν αποτελοφν ανεξάρτθτουσ παράγοντεσ πρόκλθςθσ του καρκίνου αλλά πραγματοποιείται ςυγκεραςμόσ μεταξφ αυτϊν (You and Jones, 2012). Κατά τθ διάρκεια τθσ ογκογζνεςθσ, διάφοροι παράγοντεσ μποροφν να οδθγιςουν ςτθν γενετικι τροποποίθςθ ι ςτθ μθ φυςιολογικι δράςθ των επιγενετικϊν μθχανιςμϊν (Εικόνα 2). Θ εμφανιηόμενθ ετερογζνεια ςτουσ πλθκυςμοφσ κυττάρων ςε ζνα όγκο οφείλεται ςτθν απόκτθςθ γενετικϊν ι/και επιγενετικϊν μεταλλάξεων. υγκεκριμζνα, διαφορετικά κφτταρα είναι δυνατόν να υποςτοφν διαφορετικζσ κλθρονομιςιμεσ τροποποιιςεισ και ςτθ ςυνζχεια να πολλαπλαςιαςτοφν και να ςχθματίςουν διαφορετικοφσ υποκλϊνουσ. Ακόμθ πιο ςυγκεκριμζνα, ςε ζνα ιδθ υπάρχοντα όγκο, οι υποκλϊνοι μπορεί να υποςτοφν περαιτζρω γενετικζσ μεταβολζσ (γενετικοί υποκλϊνοι) ι επιγενετικζσ τροποποιιςεισ (επιγενετικοί υποκλϊνοι) ι και τα δφο. Μερικοί υποκλϊνοι, τζλοσ, μποροφν να αποκτιςουν μεταλλάξεισ ςε γονίδια που κωδικοποιοφν τα ζνηυμα που είναι υπεφκυνα για τισ επιγενετικζσ τροποποιιςεισ (γενετικοί/επιγενετικοί υποκλϊνοι). Είτε πρόκειται για γενετικοφσ ι για επιγενετικοφσ υποκλϊνουσ, μποροφν να παρουςιάηουν διαφορετικά λειτουργικά χαρακτθριςτικά από το γονικό κλϊνο από τθν άποψθ τθσ αυτο-ανανεωτικισ ικανότθτασ, τθσ ανκεκτικότθτασ ςτα φάρμακα και ςτο μεταςτατικό δυναμικό. Οι επιγενετικζσ και γενετικζσ τροποποιιςεισ αλλθλεπιδροφν επομζνωσ ςε όλα τα ςτάδια ανάπτυξθσ του καρκίνου και ςυμβάλλουν ςτθν εξζλιξι του. Εικόνα 2. Συνειςφορά γενετικϊν και επιγενετικϊν τροποποιιςεων ςτθν πρόκλθςθ ετερογζνειασ ςτουσ όγκουσ (Easwaran H. et al., 2014). 16

17 A.2. micro-rnas και καρκίνοσ. Θ ρφκμιςθ τθσ ζκφραςθσ γονιδίων ςτθ διαδικαςία διαφοροποίθςθσ. Σα micrornas (mirs) είναι μια κατθγορία μικρϊν (19-23 νουκλεοτίδια), μονόκλωνων, μθ κωδικϊν RNAs που χρθςιμεφουν ωσ ςθμαντικοί ρυκμιςτζσ τθσ γονιδιακισ ζκφραςθσ ςε μετα-μεταγραφικό επίπεδο. Επθρεάηουν ζνα πλικοσ βιολογικϊν διαδικαςιϊν ςυμπεριλαμβανομζνων του κυτταρικοφ πολλαπλαςιαςμοφ, τθσ διαφοροποίθςθσ, τθσ επιβίωςθσ και τθσ κινθτικότθτασ (Ambros V., 2004, Di Leva et al., 2014, Acunzo M. et al.,2015). Είναι ςυντθρθμζνα από τα φυτά μζχρι τον άνκρωπο και κωδικοποιοφνται από τα αντίςτοιχα γονίδια. Σα γονίδια mirna ορίηονται ςε χωριςτοφσ γονιδιακοφσ τόπουσ ι εναλλακτικά μπορεί να βρεκοφν μζςα ςε εςϊνια και εξϊνια άλλων γονιδίων. Είναι ςτακερά ςτα ςωματικά υγρά και παρουςιάηουν μεγάλεσ δυνατότθτεσ να χρθςιμεφςουν ωσ βιοδείκτεσ ςε διαγνωςτικζσ και κεραπευτικζσ προςεγγίςεισ. Όπωσ και με άλλα ρυκμιςτικά μόρια, τα mirnas ςυχνά υπόκεινται ςε αλλαγζσ κατά τθ διάρκεια τθσ ανάπτυξθσ των ανκρϊπινων αςκενειϊν. Μζχρι ςιμερα, δεν υπάρχει ςχεδόν καμία αςκζνεια που δεν ζχει αποκαλφψει ςθμαντικζσ διαφορζσ ςτθν ζκφραςθ των mirnas ςε ςφγκριςθ με το φυςιολογικό ιςτό(bader AG, et al., 2011). Πρόςφατα, απεδείχκθ ο κρίςιμοσ ρυκμιςτικόσ ρόλοσ των mirnas ςτθν αιμοποίθςθ και ο ςθμαντικόσ τουσ ρόλοσ ςτθ διαφοροποίθςθ ςυγκεκριμζνων κυτταρικϊν γραμμϊν (Melkun E. et al., 2002, Azzouzi I. et al.,2015). Ζνασ ςθμαντικόσ αρικμόσ mirnas, όπωσ mir-15a, mir-16, mir-23a, mir-126, mir-144, mir-210, mir-221, mir-223, mir-376a και mir-451, ζχουν αποδειχκεί ότι ζχουν κρίςιμο ρόλο ςτον ζλεγχο τθσ ερυκροποίθςθσ, ςυμπεριλαμβανομζνθσ τθσ ρφκμιςθσ του πολλαπλαςιαςμοφ και τθσ ωρίμανςθσ των πρϊιμων ερυκροειδικϊν κυττάρων και τθσ ζκφραςθσ γονιδίων εμβρυϊκισ γ-ςφαιρίνθσ κατά τθν ερυκροποίθςθ (Sun Z et al., 2015, Felli N et al., 2005). Θ ςθμαςία των mirnas ςτθν αιμοποίθςθ αρχικά αποκαλφφκθκε με τθν ταυτοποίθςθ τριϊν ιςτοειδικισ ζκφραςθσ mirnas αιμοποιθτικϊν ιςτϊν ποντικοφ, των mir-181a, mir-142s και mir-223(chen CZ et al., 2004). Πιο ςυγκεκριμζνα, το mir181a βρζκθκε να εκφράηεται κυρίωσ ςτθ Β-ςειρά και θ ζκτοπθ ζκφραςι του ςε αιμοποιθτικά πρόδρομα κφτταρα είχε ςαν αποτζλεςμα το πολλαπλαςιαςμό Β-κυττάρων. Σο mir-142 βρζκθκε να εκφράηεται ςε Β-κφτταρα και μυελοειδείσ κυτταρικζσ ςειρζσ, ενϊ θ ζκφραςθ του mir-223 περιορίηεται ςε μυελοειδείσ ςειρζσ. Αξιοςθμείωτο είναι πωσ θ ζκτοπθ ζκφραςθ των mir-142s ι mir-223 είχε ωσ αποτζλεςμα τθν αφξθςθ των Σ-κυττάρων κατά 30-50% και όχι των κυττάρων Β ι των μυελοειδϊν κυττάρων. Όπωσ είναι αναμενόμενο, απορρφκμιςθ των mirnas, που αναδεικνφονται ωσ βαςικοί παράγοντεσ ςτθ ρφκμιςθ τθσ φυςιολογικισ αιμοποίθςθσ, ςυμβάλλει ςτθν ανάπτυξθ αιματολογικϊν κακοθκειϊν (Kluiver J et al., 2006). Όςον αφορά τθ ςυςχζτιςθ των mirs με τον καρκίνο, θ πρϊτθ μελζτθ που εμπλζκει mirnas ςτον καρκίνο διεξιχκθ το 2002 από Calin et al. και κατζδειξε τθ ςυμμετοχι των mir-15a και mir-16-1 ςτθ χρόνια λεμφοκυτταρικι λευχαιμία Β κυττάρων. Θ ζκφραςι τουσ βρζκθκε να διακυβεφεται από ςυχνά παρατθροφμενεσ διαγραφζσ των γονιδίων που τα κωδικοποιοφν ςτο γενετικό τόπο 13q14, ο οποίοσ με τθ ςειρά του ςυνδζεται με τθν ίδια τθν πακοφυςιολογία τθσ αςκζνειασ (Calin et al., 2002). Επειδι θ πρωτεϊνικι ζκφραςθ του BCL-2 ςυςχετίςτθκε αντιςτρόφωσ με 17

18 τθν ζκφραςθ του mir- 15a και mir-16-1 ςε 26 περιπτϊςεισ αςκενϊν με CLL, το αντιαποπτωτικό αυτό γονίδιο αποτελεί πικανό ςτόχο των προαναφερκζντων mirs, τα οποία με τθ ςειρά τουσ μποροφν να κεωρθκοφν ωσ ογκοκαταςταλτικά (Cimmino A. et al., 2005, Calin et al., 2002). Ζνα ακόμθ παράδειγμα mirna που δείχνει τθν πολυπλοκότθτα, αλλά και τθ ςθμαντικότθτα τθσ δράςθσ τουσ είναι το mir-663a. Πρόκειται για ζνα mirna που εξετάςτθκε ςτθν παροφςα εργαςία και ζχει βρεκεί να υπερεκφράηεται ςτον καρκίνο του πνεφμονα και του προςτάτθ, κακϊσ και ςτο ρινοφαρυγγικό καρκίνωμα (Jiao L et al., 2014, Yi C et al., 2012), ενϊ ςε άλλουσ καρκίνουσ, ςυμπεριλαμβανομζνου του γαςτρικοφ, τθσ λευχαιμίασ, του μθ μικροκυτταρικοφ καρκίνου του πνεφμονα, του παγκρεατικοφ καρκίνου και του πολλαπλοφ μυελϊματοσ και του γλοιοβλαςτϊματοσ, φαίνεται να λειτουργεί ωσ καταςτολζασ όγκων(pan J et al., 2010, Yan-Fang T. et al., 2013, Yang Y et al., 2013, Shi Y et al., 2014, Zhang Y et al., 2015, Zang W et al., 2015, Shi Y et al., 2015, Bi C et al., 2015). Θ ομάδα των mirnas, όπωσ προκφπτει και μζςα από τα ανωτζρω παραδείγματα, ζχει διερευνθκεί με λεπτομζρεια και αρκετζσ κεραπευτικζσ παρεμβάςεισ ζχουν δοκιμαςτεί. ε γενικζσ γραμμζσ, υπάρχουν δφο διαφορετικζσ προςεγγίςεισ που μεταβάλλουν τα επίπεδα mirna ςτισ ρυκμίςεισ τθσ νόςου. Θ δραςτθριότθτά τουσ μπορεί είτε να είναι ευεργετικι ι επιβλαβισ. Θ λειτουργία τουσ μπορεί είτε να ενιςχυκεί με τθ μίμθςθ mirnas είτε να αναςταλεί με τθ ςτόχευςθ τθσ αλλθλουχίασ mirna από αντινοθματικά ολιγονουκλεοτίδια (ASO) (Julia Beermann, 2016). Ζτςι υπάρχουν δφο προςεγγίςεισ για τθν ανάπτυξθ κεραπευτικϊν με βάςθ mirna: ανταγωνιςμόσ mirna (μόρια ανταγωνιςτζσ) και αντικατάςταςθ mirna (μόρια μιμθτζσ). Θ εφαρμογι αναςτολισ mirna μελετάται κεραπευτικά(esquela-kerscher, A. and Slack, F.J., 2006) και οι μιμθτζσ mirna κεωροφνται πικανά αντικαρκινικά κεραπευτικά, κακϊσ θ ζκφραςθ mirnas ςε όγκουσ απορρυκμίηεται(calin G.A. and Croce C.M., 2006) και μερικά από αυτά ζχουν ογκοκαταςταλτικι ιδιότθτα(hammond, 2007). Πρζπει ωςτόςο να τονιςκεί πωσ θ ευρφτερθ χριςθ τουσ ζωσ τϊρα είναι ωσ βιοδείκτεσ αςκενειϊν, κακϊσ θ δραςτθριότθτα τουσ είναι αιτιολογικόσ παράγοντασ τθσ πακοφυςιολογίασ των 18

19 Εικόνα 3. Το μονοπάτι mirna και ςτόχοι για θεραπευτική παρζμβαςη. Αρχικά, ζνα ςφμπλεγμα Drosha και DGCR8 (Di George Syndrome critical region gene 8) διαςπά το primirna για να παραχκεί το προ-mirna ςτον πυρινα. Εξαγωγι του από τον πυρινα υπό μορφι φουρκζτασ (hairpin) διευκολφνεται από exportin-5. Στο κυτταρόπλαςμα, το προmirna διαςπάται από τθν Dicer και παράγει ζνα RNA duplex ~ 21 bp. Η Dicer είναι μζροσ του RISC μαηί με τθν ago2 πρωτεΐνθ και τθν TAR RNA δζςμευςθσ 2 (TRBP). Ένα ςκζλοσ του duplex δεςμεφεται ςτθν ago2 και ο άλλοσ κλϊνοσ(επιςθμαςμζνο mirna*) ςτθ ςυνζχεια αποικοδομείται. Το RISC ςτθ ςυνζχεια οδθγείται ςε ςυμπλθρωματικι mrnas ςτόχο και προκαλεί μεταγραφικι καταςτολι ι διάςπαςθ του mrna. Όςον αφορά κεραπευτικζσ προςεγγίςεισ, τα μόριαmirna μιμθτζσ ειςζρχονται ςτο μονοπάτι mirna ςε διάφορα ςτάδια. Εκφραςμζνα pri-mirna και προ-mirna μιμθτζσ ειςάγονται ςτθ Drosha και διαςποφν τθ Dicer, αντίςτοιχα. Αντίκετα, ϊριμα mirna μιμθτζσ ειςάγονται ςτο RISC απευκείασ χωρίσ προθγοφμενθ επεξεργαςία. Anti-miRNA ολιγονουκλεοτίδια ι antagomirs δεςμεφονται ςε ϊριμα είδθ mirna ςτο κυτταρόπλαςμα και προκαλοφν αποικοδόμθςθ ι δζςμευςθ του ςτόχου mirna. Παρομοίωσ, ολιγονουκλεοτίδια μπορεί να ςυνδεκοφν με το mrna-ςτόχο και να καλφψουν τθν περιοχι πρόςδεςθσ mirna. Τα mirna ςπόγγοι είναι μετάγραφα που περιζχουν πολλαπλζσ κζςεισ δζςμευςθσ mirna που ανταγωνίηονται με τα ενδογενι mrna ςτθ δζςμευςι των (Thomas C. Roberts and Matthew J.A. Wood, 2013). 19

20 Α.3. Φαρμακολογικι κεραπευτικι προςζγγιςθ του καρκίνου Α.3.1. υμβατικι κεραπεία του καρκίνου Θ κφρια κεραπευτικι αντιμετϊπιςθ του καρκίνου μζχρι ςιμερα περιλαμβάνει τθ χειρουργικι επζμβαςθ, τθ χριςθ ραδιοακτινοβολίασ και τθ φαρμακολογικι χθμειοκεραπευτικι αντιμετϊπιςθ. τισ περιςςότερεσ περιπτϊςεισ θ χειρουργικι επζμβαςθ ι θ ακτινοκεραπεία δεν είναι αποτελεςματικζσ από μόνεσ τουσ ςτθν αναχαίτιςθ του μεταςτατικοφ καρκίνου. Για το λόγο αυτό χρθςιμοποιοφνται ςτθν κλινικι πράξθ διάφορεσ κατθγορίεσ, όπωσ ςυμβατικοί αντικαρκινικοί φαρμακολογικοί παράγοντεσ μεταξφ των οποίων αλκυλιωτικοί παράγοντεσ, αντιμεταβολίτεσ, αντινεοπλαςματικά αντιβιοτικά, cis-πλατίνθ (cisplatin) και παράγωγα, φυςικά και θμιςυνκετικά αλκαλοειδι όπωσ καμπτοκεκίνθ και άλλοι. Ο μθχανιςμόσ με τον οποίο δρουν τα ςυμβατικά χθμειοκεραπευτικά ποικίλλει, ωςτόςο τα περιςςότερα από αυτά είτε «ςκοτϊνουν» τα καρκινικά κφτταρα άμεςα, είτε ςταματοφν τθν ανάπτυξι τουσ ςε ςυγκεκριμζνθ φάςθ του κυτταρικοφ κφκλου (S, M, ι S/G2) (Εικόνα 3). Πιο ςυγκεκριμζνα, οι ενδιαφζρουςεσ κατθγορίεσ των ςυμβατικϊν φαρμάκων είναι οι εξισ: α) Φάρμακα που ςυνδζονται ομοιοπολικά με το DNA (αλκυλιωτικοί παράγοντεσ) β) Αντιμεταβολίτεσ γ) Αναςτολείσ τθσ DNA τοποϊςομεράςθσ δ) Αναςτολείσ των μικροςωλθνίςκων ε) Φάρμακα που ςυνδζονται μθ ομοιοπολικά με το DNA (αντινεοπλαςματικά αντιβιοτικά) 20

21 Εικόνα 4. Θεραπευτικοί ςτόχοι των αντικαρκινικϊν φαρμάκων. Φάρμακα, τα οποία παρεμβαίνουν ςτισ επίκτθτεσ ικανότθτεσ των καρκινικϊν κυττάρων, είναι αναγκαίεσ για τθν ανάπτυξθ του όγκου και τθν εξζλιξι του, ζχουν αναπτυχκεί και είναι ςε κλινικζσ δοκιμζσ ι ςε οριςμζνεσ περιπτϊςεισ ζχουν ιδθ εγκρικεί για κλινικι χριςθ ςτθ φαρμακευτικι αγωγι οριςμζνων μορφϊν καρκίνου ςτον άνκρωπο. Επιπλζον, δοκιμάηονται φάρμακα που ζχουν αναπτυχκεί με βάςθ κακζνα από τα επιπλζον χαρακτθριςτικά, που ζχουν προςτεκεί τα τελευταία χρόνια, προκειμζνου να χρθςιμοποιθκοφν ωσ κεραπευτικά ςε διάφορεσ μορφζσ καρκίνου(hanahan and Weinberg, 2011). Α.3.2. τοχευμζνθ κεραπεία του καρκίνου (Targeted cancer therapy) Θ ανάγκθ για μεγαλφτερθ αποτελεςματικότθτα και αςφάλεια, παράλλθλα με τθν εξειδίκευςθ και τθν εκλεκτικότθτα, οδιγθςε τα τελευταία χρόνια ςτθν ανακάλυψθ πολλϊν νζων μοριακϊν φαρμακολογικϊν ςτόχων για τθν ανάπτυξθ αντικαρκινικϊν φαρμάκων. τθ ςυμβατικι χθμειοκεραπεία του καρκίνου, τα φάρμακα αλλθλεπιδροφν με όλα τα διαιροφμενα κφτταρα, τόςο τα καρκινικά όςο και τα υγιι, και επομζνωσ παρουςιάηουν αυξθμζνεσ ανεπικφμθτεσ ενζργειεσ και τοξικότθτα. Πρόκειται για μια κυτταροτοξικι προςζγγιςθ. Αντίκετα, θ ςτοχευμζνθ κεραπεία δρα κυτταροςτατικά ςε ςυγκεκριμζνουσ μοριακοφσ ςτόχουσ των καρκινικϊν κυττάρων αφινοντασ τα υγιι κφτταρα αβλαβι. Πιο ςυγκεκριμζνα, ςτθν επονομαηόμενθ ςτοχευμζνθ κεραπεία του καρκίνου, χρθςιμοποιοφνται ενϊςεισ 21

22 που μπλοκάρουν τθν ανάπτυξθ ι/ και τθν εξάπλωςθ του καρκίνου μζςω τθσ αλλθλεπίδραςισ τουσ με ςυγκεκριμζνα μόρια (μοριακοί ςτόχοι) που εμπλζκονται ςτισ διαδικαςίεσ αυτζσ(joo et al., 2013). κοπόσ τθσ ςτοχευμζνθσ κεραπείασ είναι να παρεμποδίςει ςυγκεκριμζνεσ οδοφσ που ςχετίηονται με τθν καρκινογζνεςθ και τθν ανάπτυξθ του όγκου, είτε με επαγωγι τθσ απόπτωςθσ των καρκινικϊν κυττάρων, είτε αναςτζλλοντασ ςυγκεκριμζνα ζνηυμα και υποδοχείσ αυξθτικϊν παραγόντων που εμπλζκονται ςτον πολλαπλαςιαςμό των καρκινικϊν κυττάρων, ι ακόμα τροποποιϊντασ τθ λειτουργία πρωτεϊνϊν που ρυκμίηουν τθν ζκφραςθ γονιδίων και άλλων λειτουργιϊν του κυττάρου. Οι δφο κατθγορίεσ ςτοχευμζνθσ κεραπείασ περιλαμβάνουν: α) Μικρά μόρια (οργανικζσ ενϊςεισ μικροφ μοριακοφ βάρουσ) που είναι ικανά να διαπερνοφν τθν κυτταρικι μεμβράνθ και να επιδροφν ςε ςτόχουσ ςτο εςωτερικό του κυττάρου. Χαρακτθριςτικό παράδειγμα θ ιματινίμπθ θ οποία δρα ωσ εκλεκτικόσ αναςτολζασ τθσ Bcr/Abl τυροςινικισ κινάςθσ, μιασ ογκογόνου πρωτεΐνθσ θ οποία αποτελεί το προϊόν ζκφραςθσ του γονιδίου BCR/ABL (Tomasz Sacha, 2014). β) Μονοκλωνικά αντιςϊματα, τα περιςςότερα από τα οποία δεν μποροφν να διαπεράςουν τθν κυτταρικι μεμβράνθ του και ζχουν ςχεδιαςτεί ϊςτε να δρουν ςε ςτόχουσ ςτο εξωκυττάριο πλζγμα ι ςτθν κυτταρικι μεμβράνθ. Θ τραςτουηουμάμπθ (Herceptin) είναι ο πρϊτοσ εγκεκριμζνοσ κεραπευτικόσ αντικαρκινικόσ παράγοντασ με ςτόχευςθ τθν πρωτεΐνθ του γονιδίου HER2. Αποτελεί ανκρωποποιθμζνο μονοφωνικό αντίςωμα, το οποίο αναςτζλλει τθν ανεξάρτθτθ από το ςυνδζτθ ςθματοδότθςθ, μζςω του υποδοχζα HER2, και ςυμβάλλει ςτθ ςιμανςθ των κυττάρων για καταςτροφι από το ανοςοποιθτικό ςφςτθμα. Για αςκενείσ με HER2- κετικό καρκίνο του μαςτοφ που δεν ανταποκρίνονται ςτθ κεραπεία με τραςτουηουμάμπθ, ςχεδιάςτθκε θ περτουηουμάμπθ, θ οποία αποτελεί ανκρωποποιθμζνο μονοκλωνικό αντίςωμα και προςδζνεται ςτθν εξωκυτταρικι περιοχι του HER2, όχι όμωσ ςτθν ίδια κζςθ με τθν τραςτουηουμάμπθ (Nadia et al., 2013). Σο επόμενο βιμα ςτθ ςτοχευμζνθ κεραπεία αποτελεί θ εξατομικευμζνθ κεραπεία κατά τθν οποία προςαρμόηονται θ δοςολογία και θ χοριγθςθ φαρμάκων(δοςολογικό ςχιμα) ιδανικά κακϊσ και οι ςυνδυαςμοί κατά τθ ςυγχοριγθςθ φαρμάκων ςτθν ιδιοςυγκραςία κάκε ατόμου(vizirianakis IS, 2014). Κάκε άτομο ζχει τθ δικι του μοναδικι παραλλαγι του ανκρϊπινου γονιδιϊματοσ και θ κατάςταςθ τθσ υγείασ του προκφπτει από τθ διακφμανςθ αυτι, ςε ςυνδυαςμό με τισ επιρροζσ από το περιβάλλον. Κακίςταται λοιπόν κατανοθτό πωσ είναι αδφνατο να υπάρξει μια μόνο κεραπεία, όχι μόνο για όλουσ τουσ τφπουσ καρκίνου, αλλά ακόμα για τον ίδιο τφπο καρκίνου ςτα διαφορετικά άτομα. Βαςικό ςτοιχείο ςτθν κατεφκυνςθ εξατομικευμζνθσ κεραπείασ είναι πωσ ο κάκε όγκοσ ςτουσ διάφορουσ αςκενείσ ζχει μοναδικό γονότυπο. Επομζνωσ, μετά από τθν αποκάλυψθ ενόσ μορίου που κα μποροφςε να αποτελζςει ςτόχο για τθ κεραπεία ενόσ τφπου καρκίνου κα πρζπει να γίνεται ζλεγχοσ για να διαπιςτωκεί αν ο κάκε αςκενισ ανικει ςτθν κατθγορία αυτϊν που διακζτουν το μοριακό αυτό ςτόχο και επομζνωσ μποροφν να επωφελθκοφν από τθν αντίςτοιχθ αγωγι. 22

23 Α.4. Εναλλακτικζσ κεραπευτικζσ προςεγγίςεισ του καρκίνου Παρόλο που θ χθμειοκεραπεία ζχει αποδειχτεί αποτελεςματικι για οριςμζνεσ μορφζσ καρκίνου, όπωσ το χοριοκαρκίνωμα και θ νόςοσ Hodgkin s, δεν ζχει κατορκϊςει να ςυμβάλλει ςυνολικά ςτθν πλιρθ εξάλειψθ τθσ πλειοψθφίασ των ςυμπαγϊν όγκων και των αιματολογικϊν κακοθκειϊν. Ο μεγάλοσ βακμόσ ετερογζνειασ των νεοπλαςμάτων και το γεγονόσ ότι τα κφτταρα μπορεί να βρίςκονται ςε διαφορετικζσ φάςεισ του κυτταρικοφ κφκλου ςε ςυνδυαςμό με τθν απουςία φπαρξθσ πολλϊν διακζςιμων εξειδικευμζνων αντινεoπλαςματικϊν παραγόντων και τθν υψθλι τοξικότθτα που εκδθλϊνεται από τα ιδθ χρθςιμοποιοφμενα αντικαρκινικά φάρμακα, λόγω μθ εκλεκτικισ δράςθσ ςτον πακολογικό ιςτό και θ ανάπτυξθ αντίςταςθσ των καρκινικϊν κυττάρων ςτα φάρμακα, κατζςτθςε αναγκαία τθν ενίςχυςθ τθσ προςπάκειασ εναλλακτικισ κεραπευτικισ προςζγγιςθσ του καρκίνου(morrison et al., 2011). Οι εναλλακτικζσ αυτζσ ςτρατθγικζσ περιλαμβάνουν: 1. Επαγωγι τθσ διαφοροποίθςθσ των καρκινικϊν κυττάρων 2. Αναςτολι τθσ αγγειογζνεςθσ με φάρμακα που δρουν επί του ςχθματιςμοφ των αιμοφόρων αγγείων 3. Επαγωγι τθσ απόπτωςθσ ςτα νεοπλάςματα. Α.5. Απόπτωςθ: θ φαρμακολογικι ςθμαςία τθσ για το ςχεδιαςμό νζων κεραπευτικών ςτρατθγικών ςτον καρκίνο Θ απόπτωςθ είναι μια πολφπλοκθ κυτταρικι διεργαςία απαραίτθτθ για τθν απομάκρυνςθ τθσ περίςςειασ κατεςτραμμζνων ι επιβλαβϊν κυττάρων ςτουσ πολυκφτταρουσ οργανιςμοφσ (Elmore, 2007). Απορρφκμιςθ τθσ διαδικαςίασ τθσ απόπτωςθσ μπορεί να οδθγιςει ςτθν πακογζνεςθ διαφόρων ανκρϊπινων διαταραχϊν, όπωσ θ νεοπλαςία. Κατά τθν απόπτωςθ λαμβάνει χϊρα μια ςειρά διαδοχικϊν γεγονότων. Αρχικά, διαταράςςονται οι μεμβράνεσ του κυττάρου, ο κυτταροςκελετόσ και ο ςκελετόσ του πυρινα αποδομοφνται, το κυτταρόπλαςμα ςυρρικνϊνεται και ο πυρινασ κατακερματίηεται. Σζλοσ, τα υπολείμματα του κυττάρου που υπζςτθ απόπτωςθ απομακρφνονται με φαγοκυττάρωςθ (Hengartner, 2000). Θ ιδζα ότι ο προγραμματιςμζνοσ κυτταρικόσ κάνατοσ (απόπτωςθ) αποτελεί ζνα φυςικό εμπόδιο ςτθν ανάπτυξθ του καρκίνου ςυνζβαλε ουςιαςτικά ςτθν προςπάκεια διερεφνθςθσ των μθχανιςμϊν, μζςω των οποίων τα κφτταρα οδθγοφνται ςτθν απόπτωςθ. θμαντικό ρόλο ςτθν απόπτωςθ διαδραματίηουν οι καςπάςεσ, οι οποίεσ ανικουν ςτθν ευρφτερθ κατθγορία των πρωτεαςϊν. Αυτζσ διακρίνονται ςε δυο κατθγορίεσ: τισ εναρκτιριεσ καςπάςεσ 2,8,9,10 και τισ εκτελεςτικζσ καςπάςεσ 3,6,7 (Cohen, 1997, Rai et al., 2005). Μζςω μιασ ςειράσ βθμάτων, ςτα οποία ςυμμετζχουν οι εναρκτιριεσ καςπάςεσ και οι καςπάςεσ κακοριςτζσ, ενεργοποιοφνται ενδοκυττάριεσ πρωτεΐνεσ υπεφκυνεσ για τθν απόπτωςθ. Θ απόπτωςθ αρχίηει και πραγματοποιείται μζςω δφο ςθμαντικϊν οδϊν ςθματοδότθςθσ, τθσ εξωγενοφσ και τθσ ενδογενοφσ οδοφ. Όςον αφορά τθν εξωγενι οδό ςθματοδότθςθσ, οι ςυνδζτεσ Fas, TNFa και ο ςχετικόσ με τον TNF ςυνδζτθσ που επάγει τθν απόπτωςθ (TNFrelated apoptosis-inducing ligand, TRAIL) προςδζνονται ςτουσ υποδοχείσ τουσ 23

24 (υποδοχζασ του ςυνδζτθ Fas, υποδοχζασ του TNFa ι TRAIL1 και TRAIL2 υποδοχείσ, αντίςτοιχα) ςτθν κυτταρικι επιφάνεια και ςχθματίηονται ςφμπλοκα του υποδοχζα με το ςυνδζτθ (Locksley et al., 2001, Ashkenazi et al., 1998 ). Ακολουκεί πρόςλθψθ των ενδοκυτταρικϊν πρωτεϊνϊν FADD/TRADD ι RAIDD ςτθν κυτταροπλαςματικι πλευρά του υποδοχζα, μζςω διεργαςιϊν που οδθγοφν ςτο ςχθματιςμό του ςθματοδοτικοφ ςυμπλόκου που επάγει τθν απόπτωςθ (death inducing signaling complex, DISC) και ςτθν ενεργοποίθςθ τθσ καςπάςθσ 8, θ οποία, ςτθ ςυνζχεια, ενεργοποιεί αντίςτοιχα τισ καςπάςεσ 3, 6, 7 και πυροδοτείται θ «εκτζλεςθ» τθσ απόπτωςθσ (Wajant, 2002, Kischkel et al., 1995). τθν ενδογενι οδό ςθματοδότθςθσ ςθμαντικό ρόλο διαδραματίηουν τα μιτοχόνδρια. Θ οδόσ αυτι μπορεί να οφείλεται ςε ςτζρθςθ αναπτυξιακϊν παραγόντων, ςε δράςθ από κορτικοςτεροειδι, χθμειοκεραπευτικοφσ παράγοντεσ, ακτινοβολία UV, γενοτοξικοφσ παράγοντεσ του DNA, κακϊσ επίςθσ και ςτο οξειδωτικό ςτρεσ. Όλοι αυτοί οι παράγοντεσ μποροφν να επθρεάςουν τθ διαπερατότθτα τθσ μιτοχονδριακισ μεμβράνθσ. υγκεκριμζνα, διακρίνονται δφο διακριτά ενδογενι μονοπάτια, τα οποία ςυνδζουν τα μιτοχόνδρια με τθν προκαλοφμενθ απόπτωςθ. φμφωνα με το πρϊτο μονοπάτι, μιτοχονδριακζσ πρωτεΐνεσ, όπωσ θ lendonuclease-g, θ Smac/Diablo, και τα ςφμπλοκα OMI/HtrA2, απελευκερϊνονται ςτο κυτταρόπλαςμα ωσ αποτζλεςμα τθσ αφξθςθσ τθσ διαπερατότθτασ τθσ εξωτερικισ μιτοχονδριακισ μεμβράνθσ. Οι πρωτεΐνεσ αυτζσ προςδζνονται ςε πρωτεΐνεσ αναςτολείσ τθσ απόπτωςθσ (ΛΑΡ, inhibition apoptosis proteins) και τισ απενεργοποιοφν, με αποτζλεςμα οι ΛΑΡ να αδυνατοφν να ςταματιςουν τθ διαδικαςία τθσ απόπτωςθσ. Προκειμζνου να γίνει κατανοθτό το δεφτερο μονοπάτι είναι απαραίτθτθ θ αναφορά ςε μια οικογζνεια πρωτεϊνϊν που ςυμμετζχουν ςε αυτό. Πρόκειται για τθν οικογζνεια πρωτεϊνϊν του γονιδίου Bcl-2 που αποτελοφν ηωτικισ ςθμαςίασ ρυκμιςτζσ του κυτταρικοφ κανάτου (Cory and Adams, 2002). Δομικά, οι πρωτεΐνεσ τθσ οικογζνειασ Bcl-2 διακζτουν μεταβλθτζσ ποςότθτεσ των ςυντθρθμζνων περιοχϊν BH και άλλων αλλθλουχιϊν και ταξινομοφνται ςε τρεισ (3) κφριεσ ομάδεσ: 1. Οι αντι-αποπτωτικζσ: Bcl-2, Bcl-xL, Bcl-w, Mcl-1, που διακζτουν τισ περιοχζσ ΒΘ1, ΒΘ2, ΒΘ3 και ΒΘ4 2. Οι προ-αποπτωτικζσ: Bax, Bak, Box, που ζχουν τισ ΒΘ1, ΒΘ2 και ΒΘ3 περιοχζσ και 3. Οι BH3-πρωτεΐνεσ που είναι πρωτεΐνεσ που φζρουν μόνο τθν περιοχι ΒΘ3, όπωσ Bim, Bid, Bad, Bik / Nbk και HRK. Οι Bcl-2, Bcl-xL και Mcl-1 είναι αναςτολείσ τθσ απόπτωςθσ και δρουν ςε μεγάλο βακμό ςυνδεόμενεσ με δφο προαποπτωτικζσ πρωτεΐνεσ (Bax και Bak) που βρίςκονται ςτθν εξωτερικι μιτοχονδριακι μεμβράνθ, καταςτζλλοντασ τθ δράςθ τουσ. Οι προαποπτωτικζσ αυτζσ πρωτεΐνεσ, όταν απαλλαγοφν από τθν αναςτολι που προκαλείται από τισ αντιαποπτωτικζσ ςυγγενικζσ τουσ πρωτεΐνεσ, διαταράςςουν τθν ακεραιότθτα τθσ εξωτερικισ μιτοχονδριακισ μεμβράνθσ ςχθματίηοντασ ζνα δίαυλο γνωςτό ωσ MAC (mitochondrial apoptosis-induced channel) και ζτςι προκαλοφν τθν απελευκζρωςθ προαποπτωτικϊν ςθματοδοτικϊν πρωτεϊνϊν, θ ςθμαντικότερθ από τισ οποίεσ είναι το κυτόχρωμα C (cyt-c). Αντίκετα, οι πρωτεΐνεσ Bcl-2, Bcl-xL ι Mcl-1 εμποδίηουν το ςχθματιςμό του διαφλου. Θ 24

25 απελευκζρωςθ του cyt-c από τα μιτοχόνδρια, διεγείρει το ςχθματιςμό του τριμεροφσ ςυμπλόκου (Apaf-1/cyt-c/caspase-9) που ονομάηεται αποπτϊςωμα. Οι ΒΘ3-πρωτεΐνεσ παρουςιάηουν ιδιαίτερο ενδιαφζρον κακϊσ ενεργοφν είτε ςυνδεόμενεσ με τισ αντιαποπτωτικζσ Bcl-2 πρωτεΐνεσ ι διεγείροντασ άμεςα τα προαποπτωτικά μζλθ αυτισ τθσ οικογζνειασ, λόγω τθσ μοναδικισ διπλισ ικανότθτάσ τουσ να προάγουν ι να αναςτζλλουν τθν απόπτωςθ, αποτελοφν ζνα πολφτιμο ςτόχο για τθν ανάπτυξθ αποτελεςματικϊν αντικαρκινικϊν παραγόντων. Θ κατανόθςθ ςε βάκοσ των μθχανιςμϊν, μζςω των οποίων πραγματοποιείται θ απόπτωςθ μπορεί να οδθγιςει ςτθν επιτυχι ανάπτυξθ νζων αντικαρκινικϊν παραγόντων. Αυτό είναι πικανό κακϊσ τα κφρια, ενδιάμεςα ςυςτατικά των δφο κφριων οδϊν ςθματοδότθςθσ τθσ απόπτωςθσ παρζχουν πολφτιμουσ ςτόχουσ για τθν ανάπτυξθ ςτρατθγικϊν για τθ κεραπεία των διαφόρων τφπων καρκίνου μζςω πρόκλθςθσ απόπτωςθσ. Α.6. Κυτταρικι διαφοροποίθςθ και νεοπλαςία Ζχει ενδιαφζρον ότι από νωρίσ άρχιςε να υποςτθρίηεται θ άποψθ ότι οριςμζνα νεοπλάςματα αποτελοφν ανωμαλίεσ τθσ φυςιολογικισ κυτταρικισ διαφοροποίθςθσ (Pierce, 1974). υγκεκριμζνα, θ απορρφκμιςθ των μθχανιςμϊν που ελζγχουν το φυςιολογικό κυτταρικό πολλαπλαςιαςμό και τθ διαφοροποίθςθ που μπορεί να οφείλεται ςτθν επίδραςθ διαφόρων παραγόντων, όπωσ χθμικά καρκινογόνα, ακτινοβολία, ογκογόνοι ιοί κ.λ.π., ςε οριςμζνεσ τουλάχιςτον περιπτϊςεισ, οδθγεί ςτθ δθμιουργία των νεοπλαςματικϊν κυττάρων. Αυτι θ ανάπτυξθ των νεοπλαςματικϊν κυττάρων ςυνοδεφεται από ανϊμαλθ ζκφραςθ ςυγκεκριμζνων γενετικϊν πλθροφοριϊν, που διαμορφϊνουν το νεοπλαςματικό φαινότυπο. Πειραματικζσ μελζτεσ ζδειξαν ότι ο προκαλοφμενοσ νεοπλαςματικόσ φαινότυποσ δεν είναι πάντα μόνιμοσ, αλλά ςυχνά αναςτρζψιμοσ και αςτακισ. Δθλαδι ζνα νεοπλαςματικό κφτταρο μπορεί να μετατραπεί ςε φυςιολογικό διαφοροποιθμζνο κφτταρο, εάν κατά κάποιο τρόπο «διορκωκοφν» οι μθχανιςμοί ελζγχου τθσ διαφοροποίθςθσ που το οδιγθςαν ςε αυτι τθν κατάςταςθ(tsiftsoglou et al., 2003b). A.7. Κεραπευτικι προςζγγιςθ του καρκίνου μζςω επαγωγισ τθσ διαφοροποίθςθσ (Differentiation Therapy of Cancer) Σο 1971 θ Charlotte Friend και οι ςυνεργάτεσ τθσ διαπίςτωςαν ότι αιμοποιθτικά κφτταρα ςπλινασ, μεταςχθματιςμζνα από ιό (Friend leukemia cells), όταν καλλιεργθκοφν ςε κατάλλθλεσ ςυνκικεσ υπό τθν επίδραςθ του πολικοφ διαλφτθ, διμεκυλοςουλφοξείδιο (DMSO), μποροφν να οδθγθκοφν ςε τελικι διαφοροποίθςθ, προσ ϊριμα ερυκρά αιμοςφαίρια, χωρίσ ικανότθτα διαίρεςθσ. Θ ανακάλυψθ αυτι υπιρξε εξζχουςασ ςθμαςίασ, κακϊσ ζδωςε μια νζα διάςταςθ ςτθν ζρευνα και αντιμετϊπιςθ του καρκίνου, ειςάγοντασ τθν επονομαηόμενθ «Κεραπεία τθσ νεοπλαςίασ μζςω επαγωγισ τθσ διαφοροποίθςθσ» (Differentiation Therapy of Cancer; Sachs, 1987, Leszczyniecka et al., 2001). Θ ανακάλυψθ αυτι ςυνζβαλε ςθμαντικά ςτθν αξιοποίθςθ καλλιεργειϊν νεοπλαςματικϊν κυττάρων ωσ πρότυπων ςυςτθμάτων (models) μελζτθσ τθσ διαφοροποίθςθσ των αρχζγονων αιμοποιθτικϊν κυττάρων κακϊσ και τθσ ςχζςθσ 25

26 μεταξφ των μθχανιςμϊν τθσ κυτταρικισ διαφοροποίθςθσ και τθσ νεοπλαςίασ. Ζωσ τϊρα, ζχουν χρθςιμοποιθκεί αρκετά είδθ λευχαιμικϊν κυττάρων ωσ μοντζλα για τθ μελζτθ των μθχανιςμϊν κυτταρικισ διαφοροποίθςθσ των αιμοποιθτικϊν κυττάρων, όπωσ προμυελοκυτταρικά λευχαιμικά κφτταρα ανκρϊπινθσ προζλευςθσ, HL-60 (Collins et al. 1978), ανκρϊπινα λευχαιμικά, Κ562 (Anderson et al. 1979), ερυκρολευχαιμικά κφτταρα ποντικοφ, MEL (Friend et al. 1971), και κφτταρα λεμφοκυτταρικισ λευχαιμίασ, U937. Ωσ επακόλουκο, ανακαλφφκθκε μια νζα ομάδα χθμικϊν ουςιϊν, των επονομαηόμενων «χθμικϊν επαγωγζων τθσ διαφοροποίθςθσ», που ζχοντασ τθν ικανότθτα επαγωγισ τθσ διαφοροποίθςθσ νεοπλαςματικϊν κυττάρων (Calabresi and Parks, 1985, Tsiftsoglou et al., 2003b), οδθγοφν ςε αναςτροφι του νεοπλαςματικοφ φαινοτφπου in vitro και αναςτζλλουν τθν ικανότθτα των κυττάρων για περαιτζρω πολλαπλαςιαςμό. Σα τελευταία χρόνια κακίςταται εμφανζσ ότι οι χθμικζσ ι φαρμακευτικζσ ουςίεσ, που ζχουν τθν ικανότθτα να επάγουν τθ διαφοροποίθςθ νεοπλαςματικϊν κυττάρων in vitro, κα μποροφςαν να χρθςιμοποιθκοφν, ωσ μονοκεραπεία, είτε ωσ ςυνδυαςτικι κεραπεία με ιδθ υπάρχοντα αντινεοπλαςματικά φάρμακα για τθν αςφαλζςτερθ και αποτελεςματικότερθ αντιμετϊπιςθ νεοπλαςματικϊν καταςτάςεων (Waxman et al.,1998, Lotan et al.,1990). Με βάςθ αυτά τα in vitro μοντζλα ζχει αποκτθκεί μεγάλοσ βακμόσ γνϊςεων, ενϊ παράλλθλα δθμιουργοφνται νζα ερωτιματα για βακφτερθ μελζτθ ενδότερων λειτουργιϊν των ςυςτθμάτων. ιμερα ςε αυτά τα ερωτιματα δφνανται να απαντιςουν τα micrornas (mirs), ςτοιχεία επιγενετικϊν τροποποιιςεων που φζρνουν όλο και νεότερθ γνϊςθ ςτθν επιφάνεια, ωσ ρυκμιςτικά μόρια. ε αυτι τθν κατεφκυνςθ, βαςικό εργαλείο πλζον αποτελεί θ βιοπλθροφορικι - επιςτιμθ που βρίςκεται ςτθν περιοχι επαφισ τθσ βιολογίασ με τα μακθματικά και τθν επιςτιμθ υπολογιςτϊν και κεωρϊντασ τα βιολογικά δεδομζνα (DNA, RNA, πρωτεΐνεσ) ωσ ψθφιακι πλθροφορία, εφαρμόηει αλγορίκμουσ για τθν επεξεργαςία τουσ και τθν παραγωγι χριςιμων ςυμπεραςμάτων με αποδοτικό τρόπο. Α.8. Διαδικαςίεσ διαφοροποίθςθσ φυςιολογικών αιμοποιθτικών κυττάρων ε κάκε ιςτό ςυνυπάρχουν αρχζγονα ι ςτελεχιαία κφτταρα και τελικϊσ διαφοροποιθμζνα κφτταρα. Σα αρχζγονα κφτταρα ζχουν τθν ικανότθτα να διαιροφνται απεριόριςτα. Από τθ διαίρεςθ των αρχζγονων κυττάρων προκφπτουν κυγατρικά κφτταρα, τα οποία μποροφν να ακολουκιςουν δφο εναλλακτικζσ πορείεσ: να παραμείνουν ωσ αρχζγονα ι να προχωριςουν προσ τθν τελικι διαφοροποίθςθ. Είναι δυνατόν από ζνα αρχζγονο κφτταρο να ςχθματίηονται διαφορετικά είδθ διαφοροποιθμζνων απογόνων, όπωσ τα διαφορετικά κφτταρα του αίματοσ που προκφπτουν κατά τθ διαδικαςία τθσ αιμοποίθςθσ, προζρχονται από ζνα κοινό αρχζγονο κφτταρο, ςτο μυελό των οςτϊν (Εικόνα 5). 26

27 Εικόνα 5. Το αρχζγονο αιμοποιητικό κφτταρο και οι απόγονοι του. Το αρχζγονο αιμοποιθτικό κφτταρο διαιρείται και παράγει πιο εξειδικευμζνα κφτταρα τα οποία διαιροφνται με τθ ςειρά τουσ και αποδίδουν τα ϊριμα κφτταρα που βρίςκονται ςτθν κυκλοφορία του αίματοσ (Mahalingaiah et al., doi: /cptx.45). H «αιμοποίθςθ» αποτελεί μια φυςιολογικι διαδικαςία των αιμοποιθτικϊν βλαςτικϊν κυττάρων (Hematopoietic Stem Cells, HSC) και μζςω διαφόρων ςταδίων διαφοροποίθςθσ καταλιγει ςτθ δθμιουργία των διαφόρων κυτταρικϊν ςειρϊν που απαντϊνται ςτο αίμα (Wu et al., 1967, Metcalf, 1998, Orkin, 2000). Επομζνωσ, είναι προφανισ θ φπαρξθ μιασ αναπτυξιακισ ιεραρχίασ, ςτθν κορυφι τθσ οποίασ βρίςκονται τα πολυδφναμα αιμοποιθτικά βλαςτοκφτταρα και ςτθ βάςθ τθσ τα τελικϊσ διαφοροποιθμζνα κφτταρα του αίματοσ. Σα HSCs εντοπίηονται ςτον μυελό των οςτϊν και ζχουν τθν ικανότθτα να αυτοανανενϊνονται. Όταν πολλαπλαςιάηονται, οριςμζνα από τα κυγατρικά κφτταρα παραμζνουν βλαςτικά, ενϊ άλλα διαφοροποιοφνται περαιτζρω. Ζτςι, υπό τθν επίδραςθ ςυγκεκριμζνων μεταγραφικϊν παραγόντων, τα αιμοποιθτικά βλαςτικά κφτταρα δίνουν γζνεςθ ςε πολυδφναμα πρϊιμα κφτταρα του αιμοποιθτικοφ, από τα οποία προκφπτει τόςο θ μυελοβλαςτικι όςο και θ λεμφοβλαςτικι ςειρά κυττάρων του αίματοσ (Socolovsky et al., 1998, Cantor and Orkin, 2001, Fisher, 2002). Πιο ςυγκεκριμζνα, τα αρχζγονα πολυδφναμα αιμοποιθτικά κφτταρα (pluripotent stem cells) είναι μικρά, μονοπφρθνα και αδιαφοροποίθτα κφτταρα, που ζχουν τθν ικανότθτα να αυτοανανεϊνονται (self renewal capacity) αλλά και να διαφοροποιοφνται και να ωριμάηουν ςε διάφορεσ κατθγορίεσ κυττάρων. Αυτά τα πολυδφναμα κφτταρα διαιροφνται ςε δφο κατθγορίεσ κυττάρων: τα αρχζγονα λεμφικά κφτταρα, από τα οποία κα προκφψουν τα Β- και Σ-λεμφοκφτταρα και τα αρχζγονα μυελοειδι κφτταρα, από τα οποία κα προκφψουν τα ερυκρά και λευκά αιμοςφαίρια, κακϊσ και τα μεγακαρυοκφτταρα, που κα δϊςουν τα αιμοπετάλια. Θ αιμοποίθςθ αρχίηει πολφ γριγορα ςτθν διάρκεια τθσ εμβρυϊκισ ανάπτυξθσ και εντοπίηεται ςτο εμβρυϊκό ιπαρ. τουσ ενιλικεσ λαμβάνει χϊρα ςτον μυελό των 27

28 οςτϊν, ςε ειδικζσ κζςεισ που ονομάηονται «φωλιζσ» βλαςτικϊν κυττάρων (stem cell niches). Μεταγραφικοί παράγοντεσ και ςιματα από το μικροπεριβάλλον των φωλιϊν παίηουν κακοριςτικό ρόλο ςτθν αιμοποίθςθ (Tsiftsoglou et al., 2003b). Α.8.1. Ερυκροποίθςθ Θ ερυκροποίθςθ είναι θ αναπτυξιακι διαδικαςία του οργανιςμοφ που οδθγεί ςτθν παραγωγι νζων ερυκροκυττάρων. Πραγματοποιείται ςτο μυελό των οςτϊν. Κατά τθν ερυκροποίθςθ, από τα αρχζγονα πολυδφναμα αιμοποιθτικά κφτταρα προκφπτουν οι πρόδρομεσ μορφζσ των ερυκρϊν αιμοςφαιρίων, που ονομάηονται ερυκροβλάςτεσ, κι από αυτζσ προκφπτουν όλα τα κφτταρα τθσ ερυκρισ ςειράσ, δθλαδι: 1. Προερυκροβλάςτθσ: ζχει πυρινα με πυρθνίςκουσ και ςτο κυτταρόπλαςμα, ριβοςωμάτια και ςυςκευι Golgi. 2. Άωροσ ερυκροβλάςτθσ: ζχει πυρινα χωρίσ πυρθνίςκουσ. 3. Ενδιάμεςθ ερυκροβλάςτθ: ζχει πυκνό πυρινα και περιζχει αιμοςφαιρίνθ. 4. Όψιμοσ ερυκροβλάςτθσ: ζχει μικρό πυρινα και περιζχει αιμοςφαιρίνθ, ενϊ φυςιολογικά, δεν ανευρίςκονται ςτο περιφερικό αίμα. 5. Δικτυοερυκροκφτταρο: είναι απφρθνο και ζχει μιτοχόνδρια. Περιζχει υπολείμματα ενδοπλαςματικοφ δικτφου και παράγει ακόμα αιμοςφαιρίνθ. Κυκλοφοροφν ςτο περιφερικό αίμα 1-2 θμζρεσ και ςτθ ςυνζχεια ωριμάηουν ςε ερυκροκφτταρα. 6. Ερυκρό αιμοςφαίριο: δεν ζχει πυρινα, μιτοχόνδρια και ριβοςωμάτια και δεν παράγει αιμοςφαιρίνθ. Έχει διάρκεια ηωισ θμζρεσ (Γκίμπα - Τηιαμπίρθ Ολυμπία, 2000). Κατά τθν ωρίμανςθ των κυττάρων αυτϊν επζρχεται πφκνωςθ του πυρινα, κακϊσ ςταδιακά ςταματά θ ςφνκεςθ RNA και DNA, και εξαφάνιςι του. Επίςθσ, το κυτταρόπλαςμα μετατρζπεται από βαςεόφιλο ςε οξφφιλο, κακϊσ μειϊνεται το RNA (που είναι βαςεόφιλο) και τθν αυξάνεται το ποςό τθσ αιμοςφαιρίνθσ (που είναι οξφφιλθ). Θ όλθ διαδικαςία επάγεται από τθν ορμόνθ ερυκροποιθτίνθ (Epo), μια γλυκοπρωτεΐνθ μοριακοφ βάρουσ 34.4 Kd, θ ζκφραςθ του γονιδίου τθσ οποίασ επθρεάηεται αντιςτρόφωσ ανάλογα από τθν τάςθ του οξυγόνου. Ο ρόλοσ τθσ Epo δεν είναι να οδθγιςει τα αρχζγονα αιμοποιθτικά κφτταρα προσ κάποια ςυγκεκριμζνθ κατεφκυνςθ διαφοροποίθςθσ, αλλά να μειϊςει τθν πικανότθτα κανάτου των κυττάρων εκείνων που ζχουν υποδοχείσ γι' αυτιν, ϊςτε τελικά να αυξθκεί ο αρικμόσ των παραγόμενων ερυκρϊν. Χωρίσ τθν παρουςία τθσ Epo τα κφτταρα τθσ ερυκράσ ςειράσ και κυρίωσ τα CFU-E, πεκαίνουν και θ ερυκροποίθςθ κακίςταται αδφνατθ. Εξίςου ςθμαντικι είναι και θ ςυμβολι ςιδιρου και βιταμίνθσ Β12, πζραν του οξυγόνου και τθσ ερυκροποιθτίνθσ, για τθν ολοκλιρωςθ τθσ ερυκροποίθςθσ. 28

29 Α.8.2. Μεγακαρυοποίθςθ Θ διαδικαςία τθσ μεγακαρυοποίθςθσ (Εικόνα 6) και τθσ παραγωγισ αιμοπεταλίων είναι ςφνκετθ, με δυνατότθτα ρφκμιςθσ ςε πολλαπλά ςτάδια. Σα μεγακαρυοκφτταρα προζρχονται από τα αιμοποιθτικά βλαςτοκφτταρα διαμζςου διαδοχικϊν βθμάτων δζςμευςθσ γενετικοφ υλικοφ και υποβάλλονται ςε μια μοναδικι διαδικαςία ωρίμανςθσ που περιλαμβάνει ενδομίτωςθ και πολυπολιδοποίθςθ, ανάπτυξθ ενόσ εκτεταμζνου εςωτερικοφ ςυςτιματοσ οριοκζτθςθσ μεμβράνθσ και τζλοσ ςχθματιςμό προ-αιματοπεταλίων (Amy E. Geddis, 2010). Σα ϊριμα μεγακαρυοκφτταρα μποροφν να ζχουν διάμετρο μεγαλφτερθ των 150 μμ και είναι τα μεγαλφτερα αιμοποιθτικά κφτταρα ςτον μυελό των οςτϊν. Θ ωρίμανςθ των μεγακαρυοκυττάρων χαρακτθρίηεται περαιτζρω από τον προοδευτικό ςχθματιςμό και εμφάνιςθ τριϊν κφριων τφπων κόκκων ζκκριςθσ: 1. άλφα (a) κόκκουσ 2. πυκνά (δ) -κοκκία και 3. λυςοςϊματα. Οι άλφα κόκκοι είναι οι πλζον άφκονοι και περιζχουν βαςικζσ πρωτεΐνεσ για προςκόλλθςθ αιμοπεταλίων κατά τθν αιμόςταςθ (Patel SR et al., 2014). Σα προ-αιμοπετάλια είναι μακρά, με διακλαδιςμζνεσ κυτταροπλαςματικζσ προεκτάςεισ, οι οποίεσ ςχθματίηουν τελικά τα αιμοπετάλια. Οι κυτταροςκελετικζσ πρωτεΐνεσ είναι ςθμαντικζσ κατά τθ διάρκεια του ςχθματιςμοφ αιμοπεταλίων. Μικροςωλθνίςκοι, νθμάτια ακτίνθσ και άλλεσ κυτταροςκελετικζσ πρωτεΐνεσ παίηουν βαςικό ρόλο ςτθ μεταφορά οργανιδίων και ειδικϊν κοκκίων αιμοπεταλίων κατά μικοσ αυτϊν των επεκτάςεων των προ-αιμοπεταλίων. τθ ςυνζχεια, τα προαιμοπετάλια αποβάλλονται ςε αγγειακά κολποειδι εντόσ του μυελοφ των οςτϊν, όπου κραφονται ςτα αιμοπετάλια(szalai G. et al., 2006, Thon J and Italiano JE, 2014). Ο κατακερματιςμόσ του κυτταροπλάςματοσ των μεγακαρυοκυττάρων ςε αιμοπετάλια ελζγχεται ςτενά και ξεκινά με τθν επαγωγι τθσ απόπτωςθσ(kaluzhuny Y. and Ravid K., 2004). Θ διαφοροποίθςθ των μεγακαρυοκυττάρων ρυκμίηεται τόςο κετικά όςο και αρνθτικά με παράγοντεσ μεταγραφισ και ςθματοδότθςθ κυτοκίνθσ. Θ κρομβοποιθτίνθ (TPO) είναι θ ςθμαντικότερθ αιμοποιθτικι κυτοκίνθ για τθν παραγωγι αιμοπεταλίων. Οι κλινικϊσ αποκτθμζνεσ και κλθρονομικζσ μεταλλάξεισ που επθρεάηουν τουσ παράγοντεσ μεγακαρυοκυτταρικισ μεταγραφισ και τθ ςθματοδότθςθ τθσ κρομβοποιθτίνθσ ζχουν ταυτοποιθκεί ςε διαταραχζσ κρομβοκυτταροπενίασ και κρομβοκυττάρωςθσ. 29

30 Εικόνα 6. Διαγραμματική απεικόνιςη τησ μεγακαρυοποίηςησ. Τα μεγακαρυοκφτταρα προζρχονται από τα αιμοποιθτικά βλαςτοκφτταρα, πολλαπλαςιάηονται και διαφοροποιοφνται προκειμζνου να δθμιουργθκοφν τα αιμοπετάλια τα οποία αποβάλλονται ςε αγγειακά κολποειδι εντόσ του μυελοφ των οςτϊν [Amy E. Geddis et al., doi: /j.seminhematol ]. Α.9. Διαδικαςίεσ διαφοροποίθςθσ ςε λευχαιμικά κφτταρα Οι λευχαιμίεσ αντιπροςωπεφουν ζνα μεγάλο ποςοςτό αιματολογικϊν κακοθκειϊν που εμφανίηονται ωσ οξείεσ ι χρόνιεσ αςκζνειεσ ςε ςχετικά χαμθλι ςυχνότθτα (5-8 / 105) (Canellos, 1982, Wiernik, 1982). Τπάρχουν ςτοιχεία που δείχνουν ότι οι λευχαιμίεσ οφείλονται ςε διαταραχι τθσ διαφοροποίθςθσ των αιμοποιθτικϊν κυττάρων (Bonnet and Dick, 1997, Enver and Greaves, 1998, Tenen, 2003). υνικωσ, τα HSCs, αιμοποιθτικά βλαςτοκφτταρα ςτον ανκρϊπινο μυελό των οςτϊν που αυτοανανεϊνονται και γεννοφν διάφορουσ τφπουσ κυττάρων αίματοσ (Wu et al., 1967, Metcalf, 1998; Orkin, 2000), προγραμματίηονται να διαφοροποιιςουν ςε περιοριςμζνεσ οδοφσ κυτταρικισ γραμμισ τθν ανάπτυξθ κυττάρων αίματοσ από εξωτερικοφσ αυξθτικοφσ παράγοντεσ που διατθροφν ιςορροπία κυτταρικισ ανάπτυξθσ, διαφοροποίθςθσ και προγραμματιςμζνου κυτταρικοφ κανάτου ςτον μυελό των οςτϊν ςτοχαςτικά, διδακτικϊσ ι αλλιϊσ (Socolovsky κ.ά. Cantor & Orkin, 2001, Fisher, 2002). Θ δζςμευςθ του HSC ςε μονοπάτια διαφοροποίθςθσ ςυνοδεφεται από μθ αναςτρζψιμθ ωρίμανςθ, διακοπι ανάπτυξθσ κυτταρικοφ κφκλου ι απόπτωςθ (Enver et al., 1998, Metcalf, 1998). Ο επαναπρογραμματιςμόσ των HSCs ςε περιοριςμζνουσ φαινοτφπουσ κυτταρικισ γραμμισ κατά τθ διάρκεια τθσ αιμοποίθςθσ ζχει ενοχοποιιςει τθν φπαρξθ παραγόντων μεταγραφισ (Cantor and Orkin, 2001, Graf, 2002). ε πακολογικζσ καταςτάςεισ, όπωσ ςτισ λευχαιμίεσ, τα αρχζγονα αιμοποιθτικά κφτταρα δεν ανταποκρίνονται ςτα εξωτερικά ερεκίςματα του μικροπεριβάλλοντοσ του μυελοφ των οςτϊν ϊςτε να διαφοροποιθκοφν ςτα διάφορα κφτταρα του αίματοσ (Fialkow et al., 1981). Αυτό ζχει ωσ αποτζλεςμα τα λευχαιμικά κφτταρα να πολλαπλαςιάηονται και να αυτo-ανανεϊνονται ανεξζλεγκτα, να αναπτφςςονται ςε μεγάλουσ αρικμοφσ ςτο μυελό των οςτϊν και ςτθ ςυνζχεια να διαςπείρονται ςτο περιφερικό αίμα. Σζλοσ, ςθμειϊνεται ότι οι λευχαιμίεσ αποτελοφν διαταραχζσ τόςο τθσ κυτταρικισ διαφοροποίθςθσ όςο και τθσ απόπτωςθσ των αιμοποιθτικϊν κυττάρων, κακϊσ τα λευχαιμικά κφτταρα δεν υποβάλλονται ςε προγραμματιςμζνο κυτταρικό κάνατο (απόπτωςθ) και 30

31 αποτυγχάνουν να διαφοροποιθκοφν (Domen, 2001). Παρά το γεγονόσ ότι αρκετά δεδομζνα ζχουν υπάρξει διαχρονικά ςε μοριακό επίπεδο για τισ λευχαιμίεσ που ζχουν οδθγιςει ςτθν επιλογι πολλϊν φαρμακολογικϊν ςτόχων και ςτθν ανάπτυξθ νζων αντιλευχαιμικϊν φαρμάκων, εν τοφτοισ θ ανάγκθ ανακάλυψθσ νζων καινοτόμων αντιλευχαιμικϊν κεραπευτικϊν ςυνεχίηει να αποτελεί μια ανάγκθ(vizirianakis et al., 2010). Εικόνα 7. Διαδικαςία τησ αιμοποίηςησ ςε ζνα φυςιολογικό και ζνα λευχαιμικό κφτταρο. Τα φυςιολογικά, μακροχρόνια αρχζγονα αιμοποιθτικά κφτταρα (LT-HSCs, long-term HSCs) ζχουν τθ δυνατότθτα αυτο-ανανζωςθσ, αλλά και τθσ παραγωγισ βραχυπρόκεςμων αρχζγονων αιμοποιθτικϊν κυττάρων, που διαφοροποιοφνται προσ όψιμουσ προγόνουσ και ϊριμα κφτταρα του αίματοσ. Στθν περίπτωςθ λευχαιμίασ, short-term HSCs (ST-HSCs) παράγουν πρϊιμουσ προγόνουσ που δεν ανταποκρίνονται ςε ερεκίςματα διαφοροποίθςθσ. Τα κφτταρα αυτά διαιωνίηονται, αναπτφςςονται ςε μεγάλουσ αρικμοφσ, και διαςπείρονται ςτο περιφερικό αίμα (Tsiftsoglou et al., 2003a). Α.10. Ο κυτταρικόσ κφκλοσ Α Θ ρφκμιςθ του κυτταρικοφ κφκλου κατά τθν ανάπτυξθ των κυττάρων Κυτταρικόσ κφκλοσ ονομάηεται το διάςτθμα μεταξφ δυο διαδοχικϊν μιτωτικϊν διαιρζςεων ενόσ κυττάρου (φυςιολογικοφ ι μθ) και ζχει άμεςθ ςχζςθ με τθν ταχφτθτα αναπαραγωγισ του νεοπλάςματοσ και το βακμό διαφοροποίθςισ του. Όπωσ γίνεται αντιλθπτό κατά τθν παρατιρθςθ ςτο μικροςκόπιο, τα βαςικά μζρθ ςτα οποία διακρίνεται ο κυτταρικόσ κφκλοσ είναι δφο (2): θ μίτωςθ και θ μεςόφαςθ (Alberts et al., 2002). Θ μίτωςθ αφορά ςτθ διαίρεςθ του πυρινα (mitosis), ενϊ θ μεςόφαςθ είναι το διάςτθμα μεταξφ του τζλουσ τθσ κυτταρικισ διαίρεςθσ και τθσ αρχισ τθσ επόμενθσ. 31

32 Θ μεςόφαςθ αποτελεί τθ φάςθ «θρεμίασ» του κυττάρου, κατά τθ διάρκεια τθσ οποίασ γίνεται μεταγραφι γονιδίων και παραγωγι πρωτεϊνϊν που ανταποκρίνονται ςτθ λειτουργία του κυττάρου. Χωρίηεται περαιτζρω ςε τρεισ (3) φάςεισ: 1. Φάςθ G1 (gap 1): παρεμβάλλεται μεταξφ του τζλουσ τθσ μίτωςθσ και τθσ αρχισ τθσ αντιγραφισ του DNA και αποτελεί ζνα διάκενο, κατά το οποίο το κφτταρο είναι μεταβολικά ενεργό και αυξάνει το μζγεκόσ του. 2. Φάςθ S (synthesis): κατά τθ διάρκεια τθσ οποίασ το κφτταρο αντιγράφει το DNA του. 3. Φάςθ G2 (gap 2): αποτελεί το μεςοδιάςτθμα μεταξφ του τζλουσ τθσ φάςθσ S και τθσ αρχισ τθσ φάςθσ M. τθ φάςθ αυτι το κφτταρο ςυνεχίηει να αυξάνει ςε μζγεκοσ και να ςυνκζτει πρωτεΐνεσ για τθν προετοιμαςία τθσ μίτωςθσ. Θ μίτωςθ ακολουκείται από τθν κυτταροκίνθςθ (διαίρεςθ του κυττάρου, cytokinesis). Θ μίτωςθ και θ κυτταροκίνθςθ μαηί αποτελοφν τθ φάςθ Μ του κυτταρικοφ κφκλου, κατά τθν οποία διαιρείται αρχικά ο πυρινασ και ςτθ ςυνζχεια το κυτταρόπλαςμα. Θ φάςθ Μ διαρκεί ελάχιςτα, περίπου μία ϊρα, ενϊ ολόκλθροσ ο κυτταρικόσ κφκλοσ ςτα περιςςότερα ευκαρυωτικά κφτταρα διαρκεί περίπου εικοςιτζςςερισ ϊρεσ. Επομζνωσ, το μεγαλφτερο μζροσ του κυτταρικοφ κφκλου αποτελεί θ μεςόφαςθ, θ περίοδοσ δθλαδι που παρεμβάλλεται μεταξφ των δφο φάςεων Μ. ε αντίκεςθ με το γριγορο πολλαπλαςιαςμό των εμβρυϊκϊν κυττάρων, οριςμζνα κφτταρα, όπωσ τα νευρικά, παφουν να διαιροφνται ενϊ πολλά άλλα διαιροφνται μόνο περιςταςιακά, ςτθ βάςθ των απαιτιςεων αντικατάςταςθσ των κυττάρων που ζχουν χακεί λόγω τραυματιςμοφ ι κανάτου. Σα κφτταρα αυτά δθλαδι εξζρχονται από τθ φάςθ G1 και ειςζρχονται ςε μια κατάςταςθ θρεμίασ του κυτταρικοφ κφκλου που ονομάηεται G₀, όπου παραμζνουν μεταβολικά ενεργά, αλλά δεν πολλαπλαςιάηονται. Αν διεγερκοφν από μιτογονικοφσ (τροφικοφσαναπτυξιακοφσ) παράγοντεσ, τα κφτταρα αυτά μποροφν να εξζλκουν από τθ φάςθ G₀ και να διαγράψουν τον κυτταρικό κφκλο (Garrett, 2001). Α Ρφκμιςθ του κυτταρικοφ κφκλου Ζνα πολφπλοκο δίκτυο ρυκμιςτικϊν πρωτεϊνϊν αποτελεί το ςφςτθμα ελζγχου του κυτταρικοφ κφκλου, και ορίηει τον τρόπο και το ρυκμό μετάβαςθσ από το ζνα ςθμείο αυτοφ ςε ζνα άλλο (Vermeulen& Van Bockstaele et al., 2003). Σο ρυκμιςτικό αυτό δίκτυο, εξαςφαλίηει τον ακριβι προγραμματιςμό τθσ ζναρξθσ του κυτταρικοφ κφκλου, τθ διατιρθςθ τθσ κάκε φάςθσ ςτθ ςωςτι ςειρά κακϊσ και τθν τιρθςθ ςυγκεκριμζνων μεςοδιαςτθμάτων ϊςτε να ζχουν ολοκλθρωκεί όλεσ οι διεργαςίεσ κάκε βιματοσ πριν τθ μετάβαςθ ςτο επόμενο (Morgan, 2007). Σο ςφςτθμα ελζγχου του κυτταρικοφ κφκλου περιλαμβάνει τισ κυκλινοεξαρτϊμενεσ κινάςεσ (cyclin-dependent protein kinases, CDKs) και τισ κυκλίνεσ (cyclins). Οι πρωτεϊνικζσ αυτζσ κινάςεσ καταλφουν τθ φωςφορυλίωςθ διαφόρων πρωτεϊνϊν, ενϊ οι κυκλίνεσ είναι απαραίτθτεσ για τθν ενεργοποίθςθ των CDK κιναςϊν. Θ φωςφορυλίωςθ από τισ CDKs πραγματοποιείται με τθν προςκικθ 32

33 φωςφορικϊν ομάδων από ATP ςτισ κυκλίνεσ (πρωτεϊνικά υποςτρϊματα), με αποτζλεςμα τθ μεταβολι τθσ ενηυμικισ τουσ δραςτθριότθτασ. Κατά τθ διάρκεια του κυτταρικοφ κφκλου, τα επίπεδα των κυκλινϊν αυξομειϊνονται, οδθγϊντασ ςε ενεργοποίθςθ και απενεργοποίθςθ των CDKs, των οποίων τα επίπεδα δεν παρουςιάηουν αυξομειϊςεισ αλλά παραμζνουν ςτακερά. Σα ανκρϊπινα κφτταρα περιζχουν πολλοφσ γενετικοφσ τόπουσ, υπεφκυνουσ για τθν κωδικοποίθςθ CDK κιναςϊν και κυκλινϊν. Ωςτόςο, μόνο ζνασ οριςμζνοσ αρικμόσ ςυμπλόκων κινάςθσ-κυκλίνθσ ςχετίηεται με τθ ρφκμιςθ του κυτταρικοφ κφκλου. Όπωσ φαίνεται και ςτθν παρακάτω εικόνα, κατά τθ φάςθ G 1 ενεργοποιοφνται οι CDK4, CDK6 και οι κυκλίνεσ D 1 D 2 D 3. Αντίςτοιχα, κατά τθ μετάβαςθ από G 1 ςε S θ CDK2 και θ κυκλίνθ E, ςτθ φάςθ S θ CDK2 και θ κυκλίνθ A, θ οποία παραμζνει ενεργι ςτθ μετάβαςθ από G 2 ςε M και ενεργοποιείται και θ CDK1. Σζλοσ, ςτθ φάςθ M παραμζνει θ CDK1 και από κυκλίνεσ ενεργοποιείται θ Β (Εικόνα 8). Να ςθμειωκεί ότι θ CDK7 με τθν κυκλίνθ Θ είναι ενεργοποιθμζνεσ ςε όλεσ τισ φάςεισ του κυτταρικοφ κφκλου. Εικόνα 8. Οι κυκλίνεσ και οι κινάςεσ που ενεργοποιοφνται ςε κάκε φάςθ του κυτταρικοφ κφκλου (Vermeulen et al., 2003). Εκτόσ από τισ κυκλίνεσ, αντιρροπιςτικι ρφκμιςθ ςτον κυτταρικό κφκλο αςκοφν οι αναςτολείσ των CDKs (CDKI - Cdks Inhibitors) που διαχωρίηονται ςε δφο οικογζνειεσ γονιδίων: 1. θ οικογζνεια CIP/KIP (p21, p27, p57) και 33

34 2. θ οικογζνεια INK4α (p14, p15, p16 και p18) (Sherr & Roberts 1995, Vermeulen et al., 2003). Οι αναςτολείσ των CDKs προςδζνονται ςτισ CDKs απευκείασ ι ςτο ςφμπλοκο που ςχθματίηουν με τισ κυκλίνεσ. Οι οικογζνειεσ CIP/KIP αναςτζλλουν τθ δράςθ των κιναςϊν CDK2 και CDC2, αδρανοποιϊντασ τα αντίςτοιχα ςυμπλζγματα κυκλινϊνκιναςϊν ςτθν φάςθ G1 του κυτταρικοφ κφκλου. Θ οικογζνεια INK4α δρα αναςταλτικά ςτθ δράςθ των κυκλινϊν CDK4/6 μετά από πρόςδεςθ ςε ελεφκερεσ CDKs. Α θμεία ελζγχου του κυτταρικοφ κφκλου Ο κυτταρικόσ κφκλοσ είναι μια εξαιρετικά πολφπλοκθ αλλά παράλλθλα καυμάςια οργανωμζνθ διαδικαςία, για τθν πιςτότθτα τθσ οποίασ υπάρχουν ςυγκεκριμζνα κακοριςτικά ςθμεία ελζγχου που χρθςιμοποιοφνται από το κφτταρο για να παρακολουκοφν και να ρυκμίηουν τθν πρόοδο του κυτταρικοφ κφκλου, εξαςφαλίηοντασ τθν αλλθλεξάρτθςθ τθσ S φάςθσ με τθ μίτωςθ, τθν ακεραιότθτα του γονιδιϊματοσ και τθν πιςτότθτα του διαχωριςμοφ των χρωμοςωμάτων. Απαραίτθτθ προχπόκεςθ για τθν πρόοδο του κυτταρικοφ κφκλου και τθ μετάβαςθ ςε επόμενθ φάςθ είναι θ επαλικευςθ των απαραίτθτων διαδικαςιϊν και θ επιδιόρκωςθ των βλαβϊν του DNA ςε κακοριςμζνα ςθμεία (Schafer 1998, Ho A. and Dowdy S.F., 2002, Sanchez et al., 2005). Αρκετά ςθμεία ελζγχου ζχουν ςχεδιαςτεί για να εξαςφαλίςουν ότι το ελαττωματικό ι ελλιπζσ DNA δεν μεταφζρεται προσ τα κυγατρικά κφτταρα. Σο ςθμείο ελζγχου G 1 Κατά τθ διάρκεια τθσ φάςθσ G 1, το κφτταρο καλείται ν αποφαςίςει εάν κα ςυνεχίςει εκτελϊντασ ζναν ακόμα κυτταρικό κφκλο, αν κα ςταματιςει ζωσ ότου οι ςυνκικεσ γίνουν κατάλλθλεσ ι αν κα αποςυρκεί μόνιμα ι προςωρινά από τον κυτταρικό κφκλο ςε μθ διαιροφμενθ κατάςταςθ. Tο ςθμείο αυτό τθσ φάςθσ G 1, ςτο οποίο πραγματοποιείται θ δζςμευςθ για τθν ζναρξθ του κυτταρικοφ κφκλου, ονομάηεται ςθμείο περιοριςμοφ R (restriction point). Σα κφτταρα που δεν ξεπερνοφν το όριο αυτό, μπαίνουν ςε φάςθ θρεμίασ- κατάςταςθ G 0, ενϊ αντίκετα τα κφτταρα που ξεπερνοφν το περιοριςτικό αυτό ςθμείο ςυνεχίηουν ανεπθρζαςτα τον κυτταρικό κφκλο (Schafer 1998, Pardee 1974). Εν τζλθ, κατά τθ διάρκεια τθσ G 1 φάςθσ, το κφτταρο παίρνει τθν απόφαςθ να διαιρεκεί, να διαφοροποιθκεί ι να πεκάνει (Schafer 1998, Ho A. and Dowdy S.F., 2002, Sanchez et al. 2005). H διεκπεραίωςθ τθσ ςωςτισ απόφαςθσ περιλαμβάνει πολφπλοκα, αλλθλοεξαρτϊμενα μονοπάτια, ςτα οποία οποιοδιποτε λάκοσ μπορεί να οδθγιςει ςε καρκινογζνεςθ. Σα αρχικά γεγονότα, που οδθγοφν ςτθ δζςμευςθ των κυττάρων για διαίρεςθ, περιλαμβάνουν τθν απόκριςθ των κυκλινϊν D ςε αναπτυξιακοφσ παράγοντεσ και ςτθ ςυςτατικι φωςφορυλίωςθ τθσ πρωτεΐνθσ του ρετινοβλαςτϊματοσ (prb) από το ςφμπλοκο G 1 κυκλίνθ/cdk κινάςθ (Massague, 2004). Αυτό είναι απαραίτθτο για να προχωριςει το κφτταρο ςτθν φάςθ G 1. το μζςο τθσ φάςθσ G 1, θ επίδραςθ εξωτερικϊν αναπτυξιακϊν παραγόντων είναι δυνατόν να μειϊςει τα επίπεδα κυκλίνθσ D μζςα ςτο κφτταρο και να περάςει ςτθ φάςθ G 0. 34

35 τα ηωικά κφτταρα, θ δθμιουργία δφο ςυμπλόκων των CDKs τθσ G 1 φάςθσ (CDK4/6-κυκλίνθ D και CDK2-κυκλίνθ Ε) είναι απαραίτθτθ για το πζραςμα των κυττάρων από τθ φάςθ G 1 ςτθ φάςθ S. Οι κυκλίνεσ τφπου D (D1, D2 και D3), φυςιολογικά αλλθλεπιδροφν με τισ πρωτεϊνικζσ κινάςεσ CDK4 και CDK6 δθμιουργϊντασ ςφμπλοκα, που φωςφορυλιϊνουν τθν πρωτεΐνθ Rb (retinoblastoma) (Sherr 1995) ι μζλθ τθσ οικογζνειασ, ςτθν οποία ανικει. Θ οικογζνεια αυτι, ονομάηεται «πρωτεΐνεσ τςζπθσ» και εκτόσ από τθν Rb, περιλαμβάνει τισ πρωτεΐνεσ p107 και p130 (Stevaux et al. 2002). Θ φωςφορυλίωςθ τθσ πρωτεΐνθσ prb (με τθν επίδραςθ των ετεροδιμερϊν κυκλίνθσ D- CDK4/6) είναι απαραίτθτθ για τθν μετάβαςθ ςτθν φάςθ S. υγκεκριμζνα, ςτθ φάςθ G 0 και ςτθν αρχι τθσ φάςθσ G 1, θ prb είναι ςυνδεδεμζνθ και με τθν ομάδα μεταγραφικϊν παραγόντων E2F (Early gene Factor 2), μζλθ τθσ οποίασ ςυνδζονται με το DNA, αλλά είναι ανενεργι λόγω τθσ ταυτόχρονθσ δζςμευςισ τουσ με τθν prb. Κατά τθ μετάβαςθ ςτθ G 1 φάςθ, τα ςφμπλοκα κυκλίνθσ D/CDK φωςφορυλιϊνουν τθ prb. τθν υπερφωςφορυλιωμζνθ μορφι θ prb αποδεςμεφεται από το ςφμπλεγμα Ε2F με αποτζλεςμα το τελευταίο να μπορεί να προάγει τθ μεταγραφι γονιδίων απαραίτθτων για τον κυτταρικό κφκλο(massague, 2004). αφϊσ, το μονοπάτι Rb/E2F δεν είναι το μόνο που παίηει ρόλο ςτθ μετάβαςθ του κυττάρου από τθ G 1 ςτθν S φάςθ. τθν πραγματικότθτα, ζνασ μεγάλοσ αρικμόσ μονοπατιϊν μεταγωγισ ςιματοσ παίρνει μζροσ ςτθν απόφαςθ του κυττάρου να διαιρεκεί ι όχι. Για παράδειγμα το p53 παίηει ιδιαίτερα ςθμαντικό ρόλο ςτον ζλεγχο των βλαβϊν του DNA ςτο τζλοσ τθσ G 1 και πριν το κφτταρο προχωριςει ςτθν S (DNA damage G 1 checkpoint). Φυςιολογικά, τα επίπεδα του p53 είναι χαμθλά, ςε περιπτϊςεισ όμωσ που διαπιςτϊνονται από τον κυτταρικό μθχανιςμό βλάβεσ ςτο DNA, θ ςφνκεςι του επάγεται. Αυτι θ διαδικαςία με τθ ςειρά τθσ οδθγεί ςε διζγερςθ τθσ μεταγραφισ γονιδίων, όπωσ τα p21, MDM2 και BAX. Σο p21, δρϊντασ ωσ CDKI, οδθγεί ςε παφςθ τον κυτταρικό κφκλο και διακοπι τθσ αντιγραφισ του ελαττωματικοφ DNA (Ko and Prives 1996). ε περίπτωςθ ανεπιτυχοφσ επιδιόρκωςθσ, το p53 ςυμμετζχει ςτθν ενεργοποίθςθ άλλων μονοπατιϊν που οδθγοφν το κφτταρο ςε απόπτωςθ. Σο ςθμείο ελζγχου S Όπωσ ςτθ φάςθ G 1, ζτςι και ςτθν S, υπάρχουν μθχανιςμοί ελζγχου των βλαβϊν του DNA. τθ φάςθ S ωςτόςο, ςε περίπτωςθ που διαπιςτωκεί βλάβθ ςτο DNA, δεν ςταματάει ο κυτταρικόσ κφκλοσ, αλλά υπάρχει επιμικυνςθ τθσ φάςθσ αυτισ. Οποιαδιποτε βλάβθ του DNA ςε αυτι τθ φάςθ ανιχνεφεται κατά κφριο λόγο από δφο κινάςεσ: τθν ATM (ataxia-telangiectasia - mutated) και Nibrin (NBS1- Nijmgen-breakage-syndrome). Θ ATM μαηί με τθν ATR (Rad-3 related) και τθ DNA- PK (DNA dependent protein kinase) προκαλοφν φωςφορυλίωςθ του p53 με αποτζλεςμα να αποςυνδζεται από τθν ογκοπρωτεΐνθ MDM2 ςυμμετζχοντασ με τον τρόπο αυτό και ςτο G1/S ςθμείο ελζγχου (Houtgraaf, Versmissen et al., 2006). Όςον αφορά τθ Nibrin φαίνεται πωσ ςυμμετζχει ςε ςφμπλοκα που προκαλοφν ATPεξαρτϊμενο ξετφλιγμα του DNA, ϊςτε να είναι αυτό προςβάςιμο από τα επιδιορκωτικά ζνηυμα (Vermeulen, Van Bockstaele et al. 2003). 35

36 Σο ςθμείο ελζγχου G2 τθ φάςθ G2 το κφτταρο αποφαςίηει αν κα προχωριςει ι όχι ςε ζναν επόμενο κυτταρικό κφκλο, αν είναι αςφαλζσ να προχωριςει ςε ολοκλιρωςθ του κυτταρικοφ κφκλου με τισ διαδικαςίεσ τθσ μίτωςθσ και του διαχωριςμοφ των αδερφϊν χρωματίδων. Σα κφτταρα χρθςιμοποιοφν το ςθμείο ελζγχου G2, που είναι γνωςτό ωσ G2-M, για τθν παρεμπόδιςθ τθσ διαδικαςίασ τθσ μίτωςθσ ςε περίπτωςθ βλάβθσ κατά τθ διάρκεια τθσ G2 φάςθσ ι εάν ζχουν ειςζλκει ςτθ φάςθ αυτι με κάποια βλάβθ από τισ προθγοφμενεσ, S ι G1. Θ ςυςςϊρευςθ των κυττάρων ςτθ φάςθ μπορεί επίςθσ να αντανακλά το ςθμείο ελζγχου τθσ αντιγραφισ του DNA (intra S checkpoint) κατά το οποίο γίνονται αντιλθπτά τμιματα DNA που ςτθν προθγοφμενθ φάςθ S δεν αντιγράφθκαν ςωςτά ι πλιρωσ. Για τθν επαγωγι τθσ παφςθσ ςτο ςθμείο G 2 /M, μια πρϊτθ οδό αποτελεί θ ενεργοποίθςθ των Chk1 και Chk2 (μζςω ATM). Αυτζσ, ςτθ ςυνζχεια, φωςφορυλιϊνουν τθ φωςφατάςθ Cdc25, που αποτελεί βαςικό επαγωγζα τθσ μίτωςθσ και τθν αδρανοποιοφν (Houtgraaf, Versmissen et al., 2006, Vermeulen, Van Bockstaele et al. 2003). Επιπλζον, το p53 μπορεί να ςυμμετζχει ςτο μθχανιςμό ελζγχου και ςτθ φάςθ αυτι. Θ ςυμμετοχι του p53 ςχετίηεται και εδϊ με τθ βλάβθ του DNA και τθν προκαλοφμενθ αφξθςθ του αναςτολζα p21, ο οποίοσ αναςτζλλει τθν ζναρξθ τθσ πρόφαςθσ, απενεργοποιϊντασ το ςφμπλεγμα CDK1-κυκλίνθσ Α. Ο αναςτολζασ αυτόσ αποικοδομείται με oυβικιτυνιλίωςθ διαμζςου του ςυμπλζγματοσ APC/C (Anaphase Promoting Complex ι Cyclosome) (Amador et al., 2007). Σζλοσ, κατά τθ διάρκεια τθσ μίτωςθσ και τθσ επακόλουκθσ κυτταροκίνθςθσ, τα χρωμοςϊματα και το κυτταρόπλαςμα διαιροφνται ςε δφο κυγατρικά κφτταρα. Μθχανιςμόσ ελζγχου εντοπίηεται και ςτθ φάςθ αυτι, όπου πραγματοποιείται εκτίμθςθ τθσ ικανότθτασ του κυττάρου να ολοκλθρϊςει τον κυτταρικό κφκλο με τθ μίτωςθ. Σο ςθμείο αυτό ονομάηεται επίςθσ και ςθμείο ελζγχου τθσ μιτωτικισ ατράκτου (spindle checkpoint) κακϊσ κακυςτερεί το διαχωριςμό των αδερφϊν χρωματίδων, μζχρισ ότου τα χρωμοςϊματα ευκυγραμμιςτοφν πλιρωσ ςτθ μιτωτικι άτρακτο. Γνωρίηοντασ όλα όςα αναφζρκθκαν για τα ςτάδια και τθ ρφκμιςθ του κυτταρικοφ κφκλου γίνεται ςαφζσ πωσ υπάρχουν πάρα πολλά κυτταρικά μονοπάτια που αλλθλοςυνδζονται, ελζγχοντασ τον πολλαπλαςιαςμό, τθν απόπτωςθ και τθ διαφοροποίθςθ των κυττάρων. Επομζνωσ, κακίςταται αναγκαία θ κατανόθςθ του κυτταρικοφ κφκλου, προκειμζνου να γίνει αντιλθπτι θ ςυςχζτιςθ τθσ απορρφκμιςισ του με τον καρκίνο, ο μθχανιςμόσ δράςθσ των αντινεοπλαςματικϊν φαρμάκων που δρουν μζςω των φάςεων του κυτταρικοφ κφκλου και θ ανάπτυξθ κατάλλθλων κεραπευτικϊν αγωγϊν. Α.11. Λευχαιμικά κφτταρα ωσ πρότυπα ςυςτιματα μελζτθσ τθσ διαφοροποίθςθσ των αιμοποιθτικών κυττάρων Πολλζσ ανκρϊπινεσ κυτταρικζσ ςειρζσ οξείασ μυελογενοφσ λευχαιμίασ παρζχουν χριςιμα μοντζλα για τθ μελζτθ του ελζγχου τθσ διαφοροποίθςθσ ςτθν ανκρϊπινθ μυελογενι λευχαιμία και τθσ φυςιολογικισ μυελοειδοφσ ανάπτυξθσ ευρφτερα. Θ καλλιζργεια των κυττάρων αυτϊν παρουςία ςυγκεκριμζνων ουςιϊν, των λεγόμενων χθμικϊν επαγωγζων τθσ διαφοροποίθςθσ, οδθγεί ςτθν ζξοδο από 36

37 τον κυτταρικό κφκλο και τθ μετατροπι αυτϊν ςε ϊριμα ερυκρά αιμοςφαίρια, χωρίσ ικανότθτα διαίρεςθσ. Θ ςειρά K562, κφτταρα χρόνιασ μυελογενοφσ λευχαιμίασ, ανκρϊπινθσ προζλευςθσ, αποτελείται από αδιαφοροποίθτα βλαςτικά κφτταρα με διάμετρο περίπου 20μm και είναι το κφριο μοντζλο διαφοροποίθςθσ του ανκρϊπινου ερυκροειδοφσ και τθσ ζκφραςθσ του γονιδίου τθσ ςφαιρίνθσ. Σα K-562 κφτταρα απομονϊκθκαν αρχικά το 1975 από τουσ Lozzio και Lozzio (Lozzio and Lozzio, 1975). Πρόκειται για καρκινικά κφτταρα ανκρϊπινθσ προζλευςθσ, από το μυελό των οςτϊν αςκενοφσ 53 ετϊν με χρόνια μυελογενι λευχαιμία ςε βλαςτικι κρίςθ (CML). Φζρουν τθ χαρακτθριςτικι αμοιβαία χρωμοςωμικι μετατόπιςθ t (9,22) το επονομαηόμενο χρωμόςωμα τθσ Φιλαδζλφειασ (Philadelphia Chromosome). ΠΛΝΑΚΑ 1 Χαρακτηριςτικά κυτταρικήσ ςειράσ K562 Κ 562 Προζλευςθ Βλαςτικά CML Μορφολογία και ιςτοχθμεία Αδιαφοροποίθτα βλαςτικά κφτταρα Μζςοσ χρόνοσ διπλαςιαςμοφ 12 ϊρεσ (ανάλογα τον κλϊνο) Αρικμόσ χρωμοςϊματοσ Modal 70 (χρωμόςωμα Φιλαδζλφειασ) Δείκτεσ λεμφοκυττάρων Όχι Ανταπόκριςθ CSF Όχι Επαγωγι τθσ διαφοροποίθςθσ Ερυκροποίθςθ H. P. Koeffler and D. W. Golde, Human myeloid leukemia and cell lines, Blood. Vol.56, No 3 (September), 1980 Θ ανκρϊπινθ ερυκρολευχαιμικι κυτταρικι γραμμι Κ562 ςυνεκφράηει ερυκροειδι και μεγακαρυοκυτταρικά γονίδια, αλλά θ επϊαςθ με κατάλλθλουσ επαγωγείσ διαφοροποίθςθσ όπωσ εςτζρεσ φορβόλθσ ι αιμίνθ μετατοπίηει τα κφτταρα αυτά προσ μονοπάτια διαφοροποίθςθσ μεγακαρυοκυττάρων ι ερυκροειδϊν, αντίςτοιχα (Belhacène N. et al.,1998). Και ςτισ δφο περιπτϊςεισ, θ διαφοροποίθςθ ςυνοδεφεται από τθ ρφκμιςθ διαφόρων ςχετικϊν γονιδίων. Θ διαφοροποίθςθ ςτθ μεγακαρυοκυτταρικι οδό οδθγεί ςε ςίγαςθ ειδικϊν γονιδίων τθσ ερυκροειδοφσ ςειράσ όπωσ θ γ-ςφαιρίνθ και ενεργοποίθςθ μεγακαρυοκυτταρικϊν ειδικϊν γονιδίων(hong Y. et al., 1996). Αντίςτροφα, θ διαφοροποίθςθ τθσ ερυκροειδοφσ ςειράσ οδθγεί ςε αφξθςθ τθσ ρφκμιςθσ του mrna τθσ γ-ςφαιρίνθσ. Όςο τα κφτταρα K562 διαφοροποιοφνται προσ ωριμότερεσ μορφζσ κατά μικοσ τθσ ερυκράσ ςειράσ, επζρχεται ςταδιακά προοδευτικι απϊλεια τθσ ικανότθτασ πολλαπλαςιαςμοφ των κυττάρων, κακϊσ και εξαρτϊμενθ από διαφοροποίθςθ απόπτωςθ (DDA). Tα διαφοροποιθμζνα κφτταρα Κ562 ςυνκζτουν τθ νεογνικι και εμβρυικι αιμοςφαιρίνθ, αλλά όχι των ενθλίκων, αν και φζρουν ακζραιο το γονίδιο τθσ β-ςφαιρίνθσ (Fordis et al., 1984). Παρουςία βουτυρικοφ νατρίου μερικά από τα κφτταρα κακίςτανται κετικά ςτθ βενηιδίνθ(andersson LC. et al., 1979, Hoffman R. et al., 1979) και θ αιμοςφαιρίνθ μπορεί να ανιχνευκεί ςε αυτά τα κφτταρα χρθςιμοποιϊντασ τθν τεχνικι τθσ ραδιοανοςοδοκιμαςίασ. Επίςθσ, τα κφτταρα Κ562 παράγουν εμβρυϊκι αιμοςφαιρίνθ όταν αναπτφςςονται με 0,1 mm αιμίνθ (Rutherford TR et al., 1979). 37

38 Είναι ςαφζσ ωςτόςο ότι υπάρχουν αρκετζσ καλλιζργειεσ Κ562 ςε διαφορετικά εργαςτιρια και αυτοί οι διάφοροι κλϊνοι μπορεί να ζχουν διαφορετικι κυτταρικι ςυμπεριφορά. Σα κφτταρα μυελοειδοφσ λευχαιμίασ ζχουν ζνα πλεονζκτθμα ανάπτυξθσ ζναντι των φυςιολογικϊν κυττάρων. Σο πλεονζκτθμα ανάπτυξθσ δεν οφείλεται ςτον ταχφ ρυκμό πολλαπλαςιαςμοφ των βλαςτικϊν κυττάρων λευχαιμίασ, κακϊσ αυτά τα κφτταρα ςυνικωσ διαιροφνται πιο αργά από τα φυςιολογικά κφτταρα. Σα λευχαιμικά κφτταρα ςυςςωρεφονται λόγω τθσ ανικανότθτάσ τουσ να ωριμάηουν ςε λειτουργικά τελικά διαφοροποιθμζνα κφτταρα. Δεδομζνου ότι θ ωρίμανςθ και ο πολλαπλαςιαςμόσ είναι ςυνδεόμενα γεγονότα, θ ανάπτυξθ των λευχαιμικϊν κυττάρων κα μποροφςε να μειωκεί ςθμαντικά αν μποροφςε να προκλθκεί κυτταρικι ωρίμανςθ. Οι γλυκοπρωτεΐνεσ κυτταρικισ μεμβράνθσ K562 παρουςιάηουν πολλζσ ομοιότθτεσ με τα ερυκροκφτταρα και, ειδικότερα, τα κφτταρα ςυνκζτουν γλυκοφορίνθ Α, θ οποία βρίςκεται αποκλειςτικά ςε ανκρϊπινα ερυκροκφτταρα. Πρότυπο ςφςτθμα κυτταροκαλλιζργειασ αποτελοφν και τα ερυκρολευχαιμικά κφτταρα ποντικοφ, MEL *murine erythroleukemia (MEL) cells+ (Sherton et al., 1976, Tsiftsoglou et al., 2003a, 2003b). Σα κφτταρα MEL απομονϊκθκαν αρχικά το 1966 από τθ Dr. Charlotte Friend και τουσ ςυνεργάτεσ τθσ (Patuleia and Friend, 1967) από τθ διογκωμζνθ ςπλινα ποντικϊν τα οποία είχαν επιμολυνκεί με τον ιό Friend Leukemia Virus (FLV) (Scher, Jing et al. 2009). Πρόκειται για ζνα ιό που αποτελεί ςφμπλεγμα από δφο ρετροϊοφσ. Ο πρϊτοσ ζχει τθν ικανότθτα αντιγραφισ (Friend Murine Leukemia Virus- F-MuLV), αλλά μόνοσ του δεν είναι πακογόνοσ για ενιλικα ποντίκια ενϊ ο δεφτεροσ ςτοχεφει το ςπλινα (Spleen Focus Forming Virus- SFFV). Αρχικά, απομονϊκθκε ο κλϊνοσ MEL-745. To 1976 οι Gusella και Housman απομόνωςαν τον κλϊνο MEL-745-PC-A4, όπωσ επονομάςτθκε, από τον αρχικό κλϊνο (Harrison, 1976, Housman et al., 1980, Tsiftsoglou and Robinson, 1985, Tsiftsoglou and Wong, 1985, Tsiftsoglou et al., 2003a,b). Σα μεταςχθματιςμζνα με τον ιό αιμοποιθτικά κφτταρα από τθ ςπλινα ποντικοφ, αναπτφςςονται ςε καλλιζργεια εναιωριματοσ και διαφοροποιοφνται ςε τελικά διαφοροποιθμζνα ερυκροειδι κφτταρα που μοιάηουν με ορκοχρωματικοφσ νορμοβλάςτεσ (Marks and Rifkind, 1978, Tsiftsoglou and Robinson, 1985, Tsiftsoglou and Wong, 1985, Tsiftsoglou et al., 2003a,b). Θ χρθςιμοποίθςθ των κυττάρων αυτϊν κατζςτθςε δυνατι τθ διερεφνθςθ των μοριακϊν μθχανιςμϊν που ελζγχουν τόςο τθν ανάπτυξθ των λευχαιμικϊν κυττάρων, όςο και τθ φυςιολογικι διαδικαςία τθσ ερυκροποίθςθσ. Παράλλθλα, τα κφτταρα αυτά αποτελοφν ζνα in vitro μοντζλο διερεφνθςθσ των μοριακϊν μθχανιςμϊν που κακορίηουν τθ διαφοροποίθςθ των φυςιολογικϊν αιμοποιθτικϊν κυττάρων κακϊσ ζχουν τθν ικανότθτα να διαφοροποιοφνται και να παράγουν αιμοςφαιρίνθ μετά τθν προςκικθ επαγωγζων διαφοροποίθςθσ, όπωσ το HMBA και το DMSO (Tsiftsoglou et al., 2003a,b). Θ τελικι διαφοροποίθςθ πραγματοποιείται μζςω μιασ ςυντονιςμζνθσ διαδικαςίασ που ακολουκείται από ςωρεία μεταβολϊν, παρόμοιων με εκείνεσ που ςυντελοφνται ςτθ φυςιολογικι διαφοροποίθςθ κατά μικοσ τθσ ερυκράσ ςειράσ από το ςτάδιο του προερυκροβλάςτθ προσ ορκοχρωματικό νορμοβλάςτθ (Reuben et al. 1981). Πρόκειται τόςο για μορφολογικζσ όςο και βιοχθμικζσ αλλαγζσ. Οριςμζνεσ από τισ μορφολογικζσ αλλαγζσ είναι δυνατόν να γίνουν άμεςα αντιλθπτζσ, μετά τθν 38

39 προςκικθ επαγωγζα τθσ διαφοροποίθςθσ ςτθν καλλιζργεια, με τθ μικροςκοπικι παρατιρθςθ των κυττάρων. Όταν γίνει προςκικθ του επαγωγζα για διάςτθμα ωρϊν (λανκάνουςα περίοδοσ), τα κφτταρα δεςμεφονται προσ τθν τελικι διαφοροποίθςθ και είναι δυνατόν να διαπιςτωκοφν οι ακόλουκεσ μορφολογικζσ μεταβολζσ(αντίςτοιχα και για τα κφτταρα K562): 1. ελάττωςθ του κυτταρικοφ μεγζκουσ, 2. μεταβολι τθσ ςφςταςθσ τθσ μεμβράνθσ, 3. διαπίςτωςθ δυςδιάκριτων πυρθνίςκων ι εξαφάνιςθ αυτϊν, 4. ελάττωςθ του λόγου πυρινα κυτταροπλάςματοσ, 5. ςυμπφκνωςθ πυρινα. Όςον αφορά τθ ςυμπφκνωςθ του πυρινα τα διαφοροποιθμζνα κφτταρα MEL υπό κατάλλθλεσ ςυνκικεσ καλλιζργειασ είναι δυνατόν να αποβάλουν τον πυρινα τουσ και να ςχθματίςουν φυςικϊσ αςτακι κφτταρα που μοιάηουν με δικτυοερυκροκφτταρα (Tsiftsoglou et al., 1979, Volloch and Housman, 1982). Εκτόσ όμωσ από τισ μορφολογικζσ μεταβολζσ, κάποιεσ από τισ οποίεσ μποροφν να γίνουν αντιλθπτζσ με τθ βοικεια μικροςκοπίου, ςυντελοφνται και βιοχθμικζσ, όπωσ μεταβολζσ τθσ κυτταρικισ μεμβράνθσ, του μεταβολιςμοφ και πυρθνικζσ μεταβολζσ. Θ επαγωγι τθσ διαφοροποίθςθσ πυροδοτείται ςτο επίπεδο τθσ κυτταρικισ μεμβράνθσ μζςω μιασ διαδικαςίασ που ςχετίηεται με τθ μεταφορά ιόντων Ca2+ (Levenson et al.,1979) και καταλιγει ςε μεταγραφικό επίπεδο ςτον πυρινα πικανϊσ μζςω ςθματοδότθςθσ. Αποτζλεςμα όλων αυτϊν των αλλαγϊν είναι θ ζκφραςθ του ερυκροφ φαινοτφπου, ο οποίοσ ςυνοψίηεται ςε δφο ςθμεία: αφξθςθ τθσ παραγωγισ και ςυςςϊρευςθ των mrnas τθσ αιμοςφαιρίνθσ και παράλλθλα αφξθςθ τθσ παραγωγισ των αντίςτοιχων πρωτεϊνϊν (α και β ςφαιρίνθσ για τα MEL, α και γ ςφαιρίνθσ για τα K562 κφτταρα) και ςταδιακι, προοδευτικι απϊλεια τθσ ικανότθτασ πολλαπλαςιαςμοφ των κυττάρων όςο διαφοροποιοφνται προσ ωριμότερεσ μορφζσ κατά μικοσ τθσ ερυκράσ ςειράσ. Θ ιςορροπία αυτι ανάμεςα ςτθν ικανότθτα πολλαπλαςιαςμοφ και διαφοροποίθςθσ είναι χαρακτθριςτικό των αρχζγονων κυττάρων. Για τθν εμφάνιςθ του ερυκροφ φαινοτφπου υπεφκυνθ είναι θ αφξθςθ τθσ ζκφραςθσ οριςμζνων γονιδίων, μεταξφ των οποίων τα γονίδια που κωδικοποιοφν τισ ςφαιρίνεσ, υποδοχζα τθσ ερυκροποιθτίνθσ (EPOR), υποδοχζα τθσ τρανςφερίνθσ (TfR) και άλλα (Tsiftsoglou et al. 2003a,b). Ωςτόςο, εκτόσ από τθν αφξθςθ τθσ ζκφραςθσ των γονιδίων αυτϊν, κατά τθ διαφοροποίθςθ των ερυκρολευχαιμικϊν κυττάρων, υιοκετοφνται ςυγκεκριμζνα πρότυπα ζκφραςθσ γονιδίων, τα οποία ςυμπεριλαμβάνουν τθν εκλεκτικι ενεργοποίθςθ οριςμζνων γονιδίων και αποςιϊπθςθ κάποιων άλλων και τα οποία αναφζρονται εκτενζςτερα ςε επόμενθ ενότθτα. φμφωνα με πειράματα που πραγματοποιικθκαν, τόςο ςε λευχαιμικά κφτταρα ανκρϊπινθσ προζλευςθσ (HL-60 cells), όςο και ςε κφτταρα ποντικοφ (MEL cells), τα κφτταρα αυτά μετά από ζκκεςθ ςε ζνα χθμικό επαγωγζα διαφοροποίθςθσ δεςμεφονται να υποβλθκοφν ςε μθ αντιςτρεπτι ερυκροειδικι ωρίμανςθ. H πραγματικι πρόοδοσ ςτον τομζα τθσ διαφοροποίθςθσ των λευχαιμικϊν κυττάρων προιλκε από διαφορετικζσ περιοχζσ ζρευνασ, οι οποίεσ περιλαμβάνουν τα ακόλουκα: 39

40 (α) Μεςολαβοφμενα από μεμβράνθ γεγονότα και μονοπάτια μεταγωγισ ςιματοσ, (β) Διεργαςίεσ με μεςολάβθςθ υποδοχζα, (γ) Αναδιαμόρφωςθ τθσ εξαιρετικά λεπτισ δομισ τθσ χρωματίνθσ, (δ) Μεταβολζσ ςτθ διαμεκυλίωςθ του DNA και του RNA, (ε) περιοριςμζνοι μεταγραφικοί παράγοντεσ κυτταρικισ γραμμισ που δρουν ωσ ρυκμιςτζσ του επαναπρογραμματιςμοφ τθσ μοίρασ των αιμοποιθτικϊν κυττάρων υπό φυςιολογικι και λευχαιμικι κατάςταςθ και (ςτ) Ο δυνθτικόσ ρόλοσ των πρωτοογκογόνων ςτθ διαφοροποίθςθ και τθν απόπτωςθ. Για τα κφτταρα MEL και K562 θ δζςμευςθ πραγματοποιείται αρκετζσ ϊρεσ μετά τθν ζκκεςθ, ενϊ τα κφτταρα HL-60 δεςμεφονται αμζςωσ μετά τθν ζκκεςθ. Σα λευχαιμικά αυτά κφτταρα ολοκλθρϊνουν το πρόγραμμα προσ τθν τελικι διαφοροποίθςθ ακόμα και απουςία του επαγωγζα κακϊσ διακζτουν «μνιμθ», όπωσ αναφζρκθκε προθγουμζνωσ, και κυμοφνται τθν πρϊτθ ζκκεςθ ςτον επαγωγζα. Θ δζςμευςθ αποτελεί κεντρικό γεγονόσ ςτο πρόγραμμα διαφοροποίθςθσ και οδθγεί ςε περιοριςμό του κυτταρικοφ πολλαπλαςιαςμοφ και ςτθν ζκφραςθ ερυκροειδϊν δεικτϊν διαφοροποίθςθσ (αιμοςφαιρίνθ β για τα κφτταρα MEL και γ για τα K562, NBT-αναγωγάςθ για τα κφτταρα HL-60). Ωςτόςο, από τα αποτελζςματα μελετϊν ςτισ οποίεσ χρθςιμοποιικθκαν αναςτολείσ τθσ βιοςφνκεςθσ τθσ αιμοςφαιρίνθσ, ςυνάγεται το ςυμπζραςμα ότι θ δζςμευςθ των κυττάρων MEL μπορεί να πραγματοποιθκεί ανεξάρτθτα από τθ βιοςφνκεςθ ερυκροειδϊν δεικτϊν. Ολοκλθρϊνοντασ, το πρόγραμμα ανάπτυξθσ των κυττάρων MEL περιλαμβάνει δφο επιμζρουσ υποπρογράμματα: το πρϊτο ςχετίηεται με τθ δζςμευςθ και το άλλο με τθν παραγωγι αιμοςφαιρίνθσ και άλλων παρόμοιων δεικτϊν, και είναι ανεξάρτθτα μεταξφ τουσ. 40

41 Εικόνα 9. Το πρόγραμμα διαφοροποίηςησ των κυττάρων MEL. Ο επαγωγζασ διαφοροποίθςθσ (Ι) αλλθλεπιδρά εκλεκτικά με ζνα κυτταροπλαςματικό υποδοχζα (R) και διεγείρει τθν ζναρξθ τθσ διαφοροποίθςθσ των κυττάρων, που πραγματοποιείται με πικανότθτα P. Μετά από μια λανκάνουςα περίοδο που ποικίλλει από κλϊνο ςε κλϊνο κυττάρων MEL, τα κφτταρα δεςμεφονται μθ αναςτρζψιμα προσ τελικι ερυκροειδικι ωρίμανςθ και θ ικανότθτα τουσ για πολλαπλαςιαςμό περιορίηεται μόνο ςε 4 ζωσ 5 κυτταρικζσ διαιρζςεισ (subprogram I). Κάκε κφτταρο που ζχει δεςμευτεί μπορεί να αποδϊςει ζωσ 32 κφτταρα. Η δζςμευςθ ςυνοδεφεται από τθν ζκφραςθ ερυκροειδικϊν δεικτϊν (subprogram II), πυρθνικι ςυμπφκνωςθ, και διακριτά πρότυπα γονιδιακισ ζκφραςθσ. Τζλοσ, θ διαφοροποίθςθ των κυττάρων MEL είναι πικανό να ςυνοδεφεται από απόπτωςθ (αυκόρμθτθ ι/ και εξαρτϊμενθ από τθ διαφοροποίθςθ απόπτωςθ). Τζλοσ, ςφμφωνα με αποτελζςματα ερευνϊν τα κφτταρα MEL μποροφν επίςθσ να επαχκοφν για να διαφοροποιθκοφν ςε μεγακαρυοκφτταρα (Tsiftsoglou et al., 2003b). Α.12. Διακριτά πρότυπα ζκφραςθσ γονιδίων κατά τθ διαφοροποίθςθ των λευχαιμικών κυττάρων ε καλλιζργειεσ κυττάρων MEL, μετά από ζκκεςθ ςε χθμικοφσ επαγωγείσ διαφοροποίθςθσ, παρατθρικθκαν αλλαγζσ των προτφπων ζκφραςθσ διαφόρων γονιδίων. υγκεκριμζνα, ο αρικμόσ των RNA μεταγράφων οριςμζνων γονιδίων μειϊνεται πριν και μετά τθ δζςμευςθ, ενϊ για άλλα γονίδια ο αρικμόσ αυτόσ αρχικά αυξάνει και ςτθ ςυνζχεια μειϊνεται. Οι αλλαγζσ αυτζσ παρατθροφνται ςτο χρονικό διάςτθμα μεταξφ τθσ λανκάνουςασ περιόδου πριν τθ δζςμευςθ αλλά και μετά τθ δζςμευςθ για διαφοροποίθςθ. Επομζνωσ, θ αλλαγι ςτθν ζκφραςθ οριςμζνων γονιδίων που λαμβάνει χϊρα πριν από τθ δζςμευςθ ενδεχομζνωσ να είναι υπεφκυνθ για αυτι, ενϊ αλλαγζσ ςτθ γονιδιακι ζκφραςθ μετά τθ δζςμευςθ μπορεί να προκφπτουν ωσ αποτζλεςμα αυτισ. Οριςμζνα παραδείγματα κατθγοριϊν 41

42 γονιδίων, των οποίων το πρότυπο ζκφραςθσ μεταβάλλεται ανάλογα με τθ χρονικι ςτιγμι (πριν ι μετά τθ δζςμευςθ) αποτελοφν τα εξισ: 1. Γονίδια που κωδικοποιοφν προϊόντα ογκογονιδίων/ ογκοκαταςταλτικϊν γονιδίων 2. Γονίδια που κωδικοποιοφν μεταγραφικοφσ παράγοντεσ 3. Γονίδια που κωδικοποιοφν ζνηυμα του κυτταρικοφ κφκλου 4. Λδιοςυςτατικά γονίδια 5. Γονίδια που κωδικοποιοφν μιτοχονδριακζσ αιμοπρωτεΐνεσ, και διάφορεσ άλλεσ νουκλεοπρωτεΐνεσ Ζχουν παρατθρθκεί (Εικόνα 11) τουλάχιςτον πζντε πρότυπα γονιδιακισ ζκφραςθσ κατά τθ διάρκεια του προγράμματοσ ανάπτυξθσ των κυττάρων MEL. Αυτά είναι τα ακόλουκα: I. Επαγωγι, παράλλθλα με τθν ωρίμανςθ των δεςμευμζνων κυττάρων, των γονιδίων που είναι αποκλειςτικά υπεφκυνα για τθν ζκφραςθ του ερυκροφ φαινοτφπου *α- και β-ςφαιρίνθ, υποδοχζασ τθσ ερυκροποιθτίνθσ (EPOR), υποδοχζασ τθσ τρανςφερίνθσ (TfR), erythroid Krüppel-like factor (EKLF), GATA-1 και άλλοι+. II. Ελάττωςθ των επιπζδων ζκφραςθσ κατά τα τελικά ςτάδια διαφοροποίθςθσ των γονιδίων που κωδικοποιοφν μεταγραφικοφσ παράγοντεσ (PU.1, c-myc, c- fos, p53, κ.α.), ρυκμιςτζσ του κυτταρικοφ κφκλου (cyclin-dependent kinases *CDK+ CDK2, CDK4, and cyclin D3) και μιτοχονδριακζσ πρωτεΐνεσ, όπωσ θ μιτοχονδριακι υπομονάδα IV τθσ οξειδάςθσ του κυτοχρϊματοσ c (mitochondrial cytochrome c oxidase [COX], subunit IV). III. Αρχικά αφξθςθ και κατά τα τελευταία ςτάδια τθσ διαφοροποίθςθσ ελάττωςθ τθσ ζκφραςθσ των γονιδίων ριβοςωμικϊν πρωτεϊνϊν (RpS5 και RpL35a) και άλλων, όπωσ των ιςτονϊν, τθσ heat shock protein *HSP+ 70, τθσ 3- φωςφορικισ αφυδρογονάςθσ *GAPDH+ και τθσ vimentin. IV. Μεταγραφικι ενεργοποίθςθ γονιδίων, όπωσ τα γονίδια για τθσ πρωτεΐνεσ PrP, Bax, Bcl-XL, retinoblastomaprotein (prb), και p21 ςε τελικά διαφοροποιθμζνα κφτταρα ωσ αποτζλεςμα ενεργοποίθςθσ αποπτωτικϊν μθχανιςμϊν. V. Μερικά γονίδια όπωσ αυτά που κωδικοποιοφν το μεταγραφικό παράγοντα EKLF, ck-ras, τθν Θ3.3 ιςτόνθ και τθν Θ2-μικροςφαιρίνθ παραμζνουν ςτακερά ςε διαφοροποιθμζνα κφτταρα MEL. τθν Εικόνα που παρατίκεται ακολοφκωσ παρουςιάηονται ςχθματικά τα πζντε αυτά πρότυπα ζκφραςθσ. 42

43 Εικόνα 10. Διακριτά πρότυπα γονιδιακήσ ζκφραςησ που παρατηρείται ςτο αναπτυξιακό πρόγραμμα των κυττάρων MEL. Πρόκειται για πζντε (5) διαφορετικά πρότυπα ζκφραςθσ κατά τθ διάρκεια τθσ διαφοροποίθςθσ των κυττάρων MEL ςτθν καλλιζργεια. Τα γονίδια που ανικουν ςτθν κάκε κατθγορία εμφανίηονται δίπλα ςε κάκε διάγραμμα (Tsiftsoglou et al., 2003a, b). Όςον αφορά τον κυτταρικό κφκλο των κυττάρων MEL, ζχει βρεκεί, πωσ θ ζναρξθ τθσ διαφοροποίθςθσ των κυττάρων αυτϊν πραγματοποιείται κατά τθ φάςθ G1/S του κυτταρικοφ κφκλου, ενϊ τα κφτταρα που ζχουν επιτφχει τελικά ςτάδια διαφοροποίθςθσ, ςυςςωρεφονται ςτθ φάςθ G1/G0 (Geller, Levenson et al., 1978, Friedman and Schildkraut 1977). Σζλοσ, θ επϊαςθ των MEL κυττάρων με το χθμικό επαγωγζα τθσ διαφοροποίθςθσ DMSO, ζχει ωσ αποτζλεςμα τθν αφξθςθ τθσ διάρκειασ τθσ φάςθσ G1 του κυτταρικοφ κφκλου. 43

44 Α.13. Επαγωγείσ τθσ διαφοροποίθςθσ ςε λευχαιμικά κφτταρα Μια πλθκϊρα ενϊςεων (χθμικϊν, φυςικϊν, φαρμακολογικϊν και βιολογικϊν) οι οποίεσ διαφζρουν μεταξφ τουσ ωσ προσ τθ δομι, τισ φυςικοχθμικζσ ιδιότθτεσ και ωσ προσ τον τφπο των λευχαιμικϊν κυττάρων ςτα οποία δρουν, ζχει βρεκεί ότι είναι ικανζσ να προκαλζςουν διαφοροποίθςθ ςε λευχαιμικά κφτταρα. Σθν αρχι των διαδοχικϊν αυτϊν ανακαλφψεων νζων ενϊςεων που δρουν ωσ επαγωγείσ τθσ διαφοροποίθςθσ ςθματοδότθςε θ ανακάλυψθ του DMSO ωσ επαγωγζα το Ακολοφκθςε ςυςτθματικι μελζτθ για τθν ανεφρεςθ νζων ουςιϊν ωσ επαγωγζων τθσ διαφοροποίθςθσ και θ διερεφνθςθ του μθχανιςμοφ δράςθσ τουσ. Μεταξφ των παραγόντων που επάγουν τθ διαφοροποίθςθ ςε λευχαιμικά κφτταρα ςυγκαταλζγονται και οι εξισ: δισ-ακεταμίδιο, παράγωγα πυριδίνθσ, κυκλικζσ ουρίεσ και κειουρίεσ, βενηοδιαηεπίνεσ, δισ-υδροξαμικά οξζα, DMSO, ανάλογα πουρίνθσ και πυριδίνθσ, υποκατεςτθμζνα αμίδια, και άλλοι. Οι χθμικοί αυτοί παράγοντεσ, αν και ζχουν διαφορετικι δομι και φυςικοχθμικζσ ιδιότθτεσ, φαίνεται ότι ζχουν και κοινά δομικά χαρακτθριςτικά που τουσ επιτρζπουν να αναγνωρίηονται από κυτταρικά μόρια και με αυτόν τον τρόπο να δρα ο κακζνασ ςε διαφορετικό κυτταρικό ςφςτθμα (Tsiftsoglou, 2003a,b). Οι ακριβείσ μθχανιςμοί, μζςω των οποίων επάγεται θ διαφοροποίθςθ, δεν ζχουν διευκρινιςκεί πλιρωσ για όλουσ αυτοφσ τουσ παράγοντεσ. ε αυτοφσ τουσ μθχανιςμοφσ, ςυγκαταλζγονται αλλθλεπιδράςεισ με υποδοχείσ και ενεργοποίθςθ ςθματοδοτικϊν μονοπατιϊν, τροποποίθςθ τθσ δομισ τθσ χρωματίνθσ, μεταβολζσ τθσ μεκυλίωςθσ νουκλεϊκϊν οξζων και απενεργοποίθςθ πρωτοογκογονιδίων κατά τθ διαφοροποίθςθ ι τθν απόπτωςθ του κυττάρου. Οι πολλοί και διαφορετικοί μοριακοί μθχανιςμοί, ςτουσ οποίουσ επιδροφν οι παράγοντεσ που αναφζρκθκαν φαίνονται να ςχετίηονται όλοι με τθν ικανότθτα ερυκροδιαφοροποίθςθσ των κυττάρων (Tsiftsoglou, 2003a,b). Οι τρεισ (3) ενϊςεισ-επαγωγείσ που επιλζχκθςαν για τθ διεξαγωγι των πειραμάτων τθσ παροφςασ ερευνθτικισ εργαςίασ αναπτφςςονται ςτθ ςυνζχεια. Σο εξαμεκυλενο διςακεταμίδιο (HMBA) ζχει μοριακό τφπο C10H20N2O2 και ανικει ςτθν οικογζνεια των ιμινϊν. Αυτζσ είναι ενϊςεισ που περιζχουν μία λειτουργικι ομάδα ιμίνθσ, με τθ γενικι δομι RN = CR2 (R = Θ, υδροκαρβφλιο). Πρόκειται για μια πολφ πολικι ζνωςθ θ οποία επάγει κφτταρα MEL να εκφράςουν τον ερυκροειδι φαινότυπο, με ταυτόχρονθ διακοπι του πολλαπλαςιαςμοφ. Θ δζςμευςθ με τθ μεςολάβθςθ HMBA για τελικι διαφοροποίθςθ ανιχνεφεται αρχικά ςε περίπου 12 ϊρεσ και αυξάνεται με ςτοχαςτικό τρόπο μζχρισ ότου πάνω από το 95% του πλθκυςμοφ ςτρατολογθκεί ςτθν τελικι διαφοροποίθςθ κατά 48 ζωσ 60 ϊρεσ(marks, P. A., & Rifkind, R. A., 1988). Όςον αφορά τα κφτταρα K562, επϊαςι τουσ με HMBA μπορεί να οδθγιςει είτε ςε ερυκροποίθςθ είτε ςε μεγακαρυοποίθςθ (Green et al., 1992), με ςυχνότερθ τθν πρϊτθ οδό και ςε ςαφϊσ χαμθλότερο ποςοςτό διαφοροποίθςθσ απ ότι ςτα MEL. Θ διαφοροποίθςθ που προκαλείται από HMBA ςυνοδεφεται από διακοπι κυτταρικοφ κφκλου, διζγερςθ τθσ CDKI p21cip-1 / mda-6 / sdi-1 / Waf-1 και prb υποφωςφορυλίωςθ (Kiyokawa et al., 1993) για να ενεργοποιιςουν το πρόγραμμα διαφοροποίθςθσ (Zhuo et al., 1995). Θ ενεργοποίθςθ τθσ PKC (Mallia et al., 1999), θ διαταραχι τθσ ςυγκζντρωςθσ κυτταρικοφ αςβεςτίου (Sparatore et al., 1995) και θ ενεργοποίθςθ των φωςφαταςϊν τυροςίνθσ (Kume et al., 1994) ςυμβάλλουν επίςθσ ςτθ 44

45 διαφοροποίθςθ των λευχαιμικϊν κυττάρων. Σο HMBA, όπωσ και αρκετοί επαγωγείσ, προάγουν τον προγραμματιςμζνο κυτταρικό κάνατο (απόπτωςθ) εκτόσ από τθν πρόκλθςθ τερματικισ διαφοροποίθςθσ (Tsiftsoglou A.S. 2003b). Θ αίμθ είναι ζνασ φυςικόσ ρυκμιςτισ τθσ ερυκροποίθςθσ. Μεταφζρεται ςε κφτταρα Κ562 με αιμοπεξίνθ μζςω υποδοχζα κυτταρικισ επιφάνειασ και δεςμεφεται με ενδοκυτταρικζσ και πυρθνικζσ πρωτεΐνεσ που ονομάηονται πρωτεΐνεσ δζςμευςθσ αιμίνθσ (HeBP) (Tsiftsoglou et al., 1993). τον πυρινα, θ αιμίνθ ρυκμίηει τισ αλλθλεπιδράςεισ γνωςτϊν μεταγραφικϊν παραγόντων όπωσ NF- E2, Oct-1 και GATA-1 ενεργϊντασ επιλεκτικά ςτον υποκινθτι του γονιδίου γ- ςφαιρίνθσ (Palma et al., 1994, Aries et al., 1996). Παρουςία αιμίνθσ τα K562 κφτταρα παράγουν εμβρυϊκι αιμοςφαιρίνθ ακολουκϊντασ το μονοπάτι τθσ ερυκροποίθςθσ(rutherford et al., 1979). Σο βουτυρικό νάτριο, ζνασ επαγωγζασ διαφοροποίθςθσ των κυττάρων MEL, HL-60 και K562, επιτρζπει τθ διαδικαςία διαφοροποίθςθσ μζςω τθσ αναςτολισ τθσ αποακετυλάςθσ των ιςτονϊν. Θ ακετυλίωςθ ιςτόνθσ οδθγεί ςε λιγότερο ςτενι δζςμευςθ του DNA ςτισ ιςτόνεσ και προάγει τθν ζναρξθ τθσ μεταγραφισ. Αντίκετα, θ απομάκρυνςθ των ακετυλομάδων από τισ ιςτόνεσ από τθν αποακετυλάςθ των ιςτονϊν (HDAC) επιτρζπει ςτισ ιςτόνεσ να δεςμεφονται πιο ςτενά με το DNA και να αποτρζπουν τθν ενεργοποίθςθ τθσ μεταγραφισ του γονιδίου. Οι αλλαγζσ ςτθ γονιδιακι μεταγραφι λόγω τθσ νουκλεοςωματικισ ςυςκευαςίασ του DNA είναι ζνα από τα κρίςιμα βιματα ςτθ ρφκμιςθ τθσ γονιδιακισ ζκφραςθσ που επθρεάηουν τθν κυτταρικι διαφοροποίθςθ, τον πολλαπλαςιαςμό και τθν απόπτωςθ (Lin et al., 1998). Σα λιπαρά οξζα βραχείασ αλφςου ζχουν δείξει αναςταλτικζσ επιδράςεισ ςτθν αποακετυλάςθ των ιςτονϊν, με το πιο ενεργό μζλοσ αυτισ τθσ ομάδασ να είναι το βουτυρικό οξφ. Σο βουτυρικό νάτριο, ςε ςυγκεντρϊςεισ mm, όταν προςτίκεται ςε κυτταρικζσ καλλιζργειεσ, παράγει πολλζσ μορφολογικζσ και βιοχθμικζσ τροποποιιςεισ κατά αναςτρζψιμο τρόπο. Αυτζσ οι τροποποιιςεισ αφοροφν ρυκμιςτικοφσ μθχανιςμοφσ γονιδιακισ ζκφραςθσ και κυτταρικισ ανάπτυξθσ: παρατθρείται ςχεδόν ςτακερά μια υπερακετυλίωςθ ιςτόνθσ που προκφπτει από αναςτολι τθσ αποακετυλάςθσ ιςτόνθσ και διακοπι του κυτταρικοφ πολλαπλαςιαςμοφ. Μεταξφ οριςμζνων άλλων μεταβολϊν προκαλείται επαγωγι τθσ διαφοροποίθςθσ, θ οποία ακολουκείται από αφξθςθ του camp (Tai et al., 1996), ενεργοποίθςθ του καταρράκτθ PKC (Rickard et al., 1999) και μεταβολζσ ςτθ γονιδιακι ζκφραςθ p21cip-1 / mda-6 / sdi-1 / Waf-1 (Archer et al., 1998). Σα περιςςότερα αν όχι όλα τα αποτελζςματα του βουτυρικοφ μπορεί να προκφψουν από υπερακετυλίωςθ τθσ ιςτόνθσ, από μεταβολζσ ςτισ δομζσ χρωματίνθσ όπωσ μετρικθκαν με τθν προςβαςιμότθτα ςτισ DNAάςεσ και από τισ τροποποιιςεισ ςτθ ςυναρμολόγθςθ του κυτταροςκελετοφ (Kruh J., 1982). Α.14. Ο ρόλοσ τθσ επιγενετικισ ςτθ διαφοροποίθςθ Θ κυτταρικι διαφοροποίθςθ είναι μια από τισ πιο ςθμαντικζσ ςυνιςτϊςεσ τθσ εμβρυϊκισ ανάπτυξθσ, τθσ ςυντιρθςθσ και επιδιόρκωςθσ των ιςτϊν. Παρά το γεγονόσ ότι όλα τα εμπφρθνα κφτταρα περιζχουν τθν ίδια γενετικι πλθροφορία, οι πολυκφτταροι οργανιςμοί ζχουν αναπτφξει περίτεχνουσ μθχανιςμοφσ οι οποίοι επιτρζπουν τθ διαφοροποίθςθ των πολυδφναμων κυττάρων ςε διακριτοφσ κυτταρικοφσ τφπουσ μζςω τθσ ζκφραςθσ εξειδικευμζνων μοτίβων γονιδίων. Σο 45

46 τελευταίο αποτελεί ζνα ενδιαφζροντα φαρμακολογικό ςτόχο για τθν ανάπτυξθ καινοτόμων αντικαρκινικϊν φαρμάκων ςτοχευμζνθσ δράςθσ (Sweis et al., 2014, Gillingham et al., 2016). τα ευκαρυωτικά κφτταρα, θ διαδικαςία τθσ διαφοροποίθςθσ αποτελεί ζνα από τα πιο γνωςτά παραδείγματα επιγενετικϊν αλλαγϊν. Επιγενετικι είναι θ μελζτθ κλθρονομιςιμων αλλαγϊν ςτθν ζκφραςθ των γονιδίων, ςε ζναν οργανιςμό ι κφτταρο, χωρίσ αλλαγζσ ςτθν αλλθλουχία του DNA. Σο γεγονόσ αυτό, επιτρζπει τθν εξειδίκευςθ τθσ λειτουργίασ των κυττάρων χωρίσ μεταβολι τθσ αλλθλουχίασ του DNA (Ganesan, 2016). Θ επιγενετικι ρφκμιςθ τθσ μεταγραφισ των γονιδίων διαμεςολαβείτε από εκλεκτικζσ, ενηυμικά καταλυόμενεσ, ομοιοπολικζσ τροποποιιςεισ ςυγκεκριμζνων νουκλεοτιδίων εντόσ των γονιδίων και επίςθσ από μετα-μεταφραςτικζσ τροποποιιςεισ των ιςτονϊν. Θ τροποποίθςθ του DNA μπορεί να καταςτείλει άμεςα τθ μεταγραφι των γονιδίων, ενϊ οι μετα-μεταφραςτικζσ τροποποιιςεισ των ιςτονϊν ελζγχουν τθν μετάβαςθ τθσ χρωματίνθσ μεταξφ των δφο διαμορφϊςεϊν τθσ (ετεροχρωματίνθ και ευχρωματίνθ). Σα ζνηυμα, τα οποία ομοιοπολικά τροποποιοφν το DNA και τισ ιςτόνεσ, είναι οι βαςικοί διαμεςολαβθτζσ τθσ επιγενετικισ ρφκμιςθσ τθσ γονιδιακισ μεταγραφισ και ςυνιςτοφν το επιγονιδίωμα. Σα επιγενετικά ζνηυμα που κωδικοποιοφνται ςτο ανκρϊπινο γονιδίωμα καταλφουν αντιδράςεισ μεταφοράσ ομάδασ και μποροφν να ταξινομθκοφν ανάλογα με τθ φφςθ τθσ ομοιοπολικισ τροποποίθςθσ που προκαλοφν και τα υποςτρϊματα ςτα οποία δρουν. τον άνκρωπο, τα ζνηυμα αυτά περιλαμβάνουν: μεκυλοτρανςφεράςεσ DNA (DNMTs), μεκυλτρανςφεράςεσ πρωτεϊνϊν (ΡΜΣs), απομεκυλάςεσ πρωτεϊνϊν, ακετυλoτρανςφεράςεσ ιςτονϊν, αποακετυλάςεσ ιςτονϊν (HDACs), λιγάςεσ ουϊβικιτίνθσ και ειδικζσ κινάςεσ (Ganesan, 2016, Liu et al., 2014, 2015). τα αρχζγονα αιμοποιθτικά κφτταρα υπάρχει ζνασ αρικμόσ γονιδίων των οποίων θ επιγενετικι ρφκμιςθ διατθρεί τθν ιςορροπία ανάμεςα ςτθ διαφοροποίθςθ και τθν αυτοανανζωςθ. Ζχει αποδειχκεί πωσ, όπωσ είναι αναμενόμενο, θ μθ φυςιολογικι μεταγραφικι ενεργοποίθςθ και απενεργοποίθςθ των γονιδίων, οφειλόμενθ ςε διαταραχι των επιγενετικϊν τροποποιιςεων, μπορεί να οδθγιςει ςε καρκινογζνεςθ. ιμερα, θ προςζγγιςθ πωσ ο ςυνδυαςμόσ γενετικϊν και επιγενετικϊν μεταβολϊν είναι υπεφκυνοσ για τθν πρόκλθςθ ογκογζνεςθσ ζχει επιβεβαιωκεί από τα υποςχόμενα κλινικά δεδομζνα ςτθ κεραπεία του καρκίνου. Θ κατανόθςθ των επιγενετικϊν μθχανιςμϊν πίςω από τθ διαφοροποίθςθ των κυττάρων και θ δυνατότθτα ελζγχου τουσ μζςω τθσ αναςτολισ των ενηφμων που τροποποιοφν τθ χρωματίνθ δίνει πολλζσ υποςχζςεισ για τθν καταπολζμθςθ διαφόρων αςκενειϊν ςτον άνκρωπο και ιδιαιτζρωσ του καρκίνου. H διαδικαςία τθσ μεκυλίωςθσ αποτελεί ζνα ςθμαντικό μθχανιςμό επιγενετικισ ρφκμιςθσ τθσ 46

47 μεταγραφισ και μπορεί να οδθγιςει είτε ςτθν ενεργοποίθςθ ι ςτθν καταςτολι τθσ μεταγραφισ ςυγκεκριμζνων γονιδίων που εμπλζκονται ςε ηωτικισ ςθμαςίασ διεργαςίεσ. Για το λόγο αυτό θ μεκυλίωςθ του DNA είναι ο εκτενζςτερα μελετθμζνοσ επιγενετικόσ μθχανιςμόσ. Α.15. Ριβοςωμικζσ πρωτεΐνεσ και ριβοςωμοπάκειεσ Θ βιογζνεςθ ριβοςϊματοσ είναι μια ιδιαίτερα ςυντονιςμζνθ διαδικαςία που οδθγεί ςτθ ςτοιχειομετρικι ςυναρμολόγθςθ όλων των ριβοςωμικϊν ςυςτατικϊν. τα ευκαρυωτικά κφτταρα παράγονται, επεξεργάηονται και ςυναρμολογοφνται 4 rrnas και 80 διαφορετικζσ ριβοςωμικζσ πρωτεΐνεσ (RPs) ςε λειτουργικά ριβοςϊματα (Tafforeau L. et al., 2013, Kressler D. et al.,2010). Θ βιοςφνκεςθ ριβοςωμικϊν πρωτεϊνϊν ρυκμίηεται ςε πολλαπλά επίπεδα με μεταγραφικοφσ, μεταφραςτικοφσ και μετα-μεταφραςτικοφσ μθχανιςμοφσ ζτςι ϊςτε να επιτυγχάνεται ιςορροπία των ριβοςωμικϊν πρωτεϊνϊν (Perry RP., 2007, Lam YW et al., 2007). Πάντωσ, είναι γεγονόσ ότι ςτουσ ευκαρυϊτεσ που λίγα είναι γνωςτά για τθ μεταγραφικι ρφκμιςθ των γονιδίων ριβοςωμικϊν πρωτεϊνϊν τα οποία είναι διαςκορπιςμζνα ςε διαφορετικά χρωμοςϊματα και ζχουν διακριτοφσ υποκινθτζσ που μοιράηονται οριςμζνα δομικά χαρακτθριςτικά αλλά δεν ζχουν κοινά μοτίβα (Perry RP., 2005, Ishii K. et al., 2006). Παρά τθν πανταχοφ παροφςα ζκφραςθ των γονιδίων των ριβοςωμικϊν πρωτεϊνϊν και τισ λειτουργίεσ ςε όλουσ τουσ ιςτοφσ, θ αναποτελεςματικότθτα τουσ δεν είναι ςπάνια και οδθγεί ςε διαταραχι τθσ ιςορροπθμζνθσ ςυναρμολόγθςθσ του ριβοςϊματοσ με αποτζλεςμα κλινικά ςφνδρομα με ιδιαίτερα ειδικοφσ φαινότυπουσ ςτον άνκρωπο, ςυμπεριλαμβανομζνθσ τθσ απλαςίασ του μυελοφ των οςτϊν και τθσ ευαιςκθςίασ ςτον καρκίνο(narla A. and Ebert BL, 2010). Για παράδειγμα, θ υπολειτουργία τθσ RPS14 οδθγεί ςε υποπλαςτικι / μακροκυτταρικι αναιμία ςτο ςφνδρομο διαγραφισ 5q (5q-), μια επίκτθτθ αιματολογικι διαταραχι ωσ προσ τθ διαδικαςία τθσ διαφοροποίθςθσ και τάςθ για οξεία λευχαιμία(elbert BL et al., 2008). Πρόςφατα το γονίδιο RPS14 και το ςφνδρομο διαγραφισ 5q ζχει ςυςχετιςτεί με τα mir145 και mir146, όπου βρζκθκε ότι ταυτόχρονθ εξάλειψθ των mir-145 και mir- 146a ςε αιμοποιθτικά ςτελζχθ και προγονικά κφτταρα ποντικοφ (HSPC) οδθγεί ςε μεγακαρυοκυτταρικι δυςπλαςία, κρομβοκυττάρωςθ και ουδετεροπενία(komrokji RS et al., 2013). Επιπλζον, θ αναιμία Diamond-Blackfan (DBA) είναι ζνα γενετικό ςφνδρομο που προκαλείται από ετερόηυγεσ μεταλλάξεισ ςε αρκετά γονίδια ριβοςωμικϊν πρωτεϊνϊν που εμπλζκονται ςτθ βιογζνεςθ των μικρϊν και μεγάλων ριβοςωμικϊν υπομονάδων, όπωσ RPS10, RPS26, RPS24, RPS17, RPS7, RPL35a, RPL11, RPL5, RPL26, RPL15 και RPS19, τα οποία αντιπροςωπεφουν περίπου 60-70% των περιπτϊςεων DBA (DraptchinkaiaN. et al., 1999, Boria I. et al., 2010, Ruggero D. And Shimamura A., 2014). Είναι γνωςτό ότι θ DBA ςχετίηεται ςυγκεκριμζνα με τθν παρακμι ι τθν απουςία ερυκροειδικϊν προγονικϊν κυττάρων ςε ζναν κατά τα άλλα κανονικό κυτταρικό μυελό των οςτϊν, με το ελάττωμα να εμφανίηεται ςτο ςτάδιο των προγονικϊν κυττάρων BFU-E και των πρϊιμων προγόνων CFU-E που αποτυγχάνουν να διαφοροποιθκοφν ςε ϊριμα ερυκρά αιμοςφαίρια(nathan DG et al., 1978, Ohene-Abuakwa Y et al., 2005). Ο αρικμόσ και θ δραςτθριότθτα των ριβοςωμάτων εμφανίηονται να διαμορφϊνονται ςε μεγάλο βακμό κατά τθ διάρκεια τθσ φυςιολογικισ τελικισ 47

48 ερυκροειδοφσ διαφοροποίθςθσ, κακϊσ οι αρικμοί των ριβοςωμάτων κορυφϊνονται ςτθν πρϊιμθ διαφοροποίθςθ των προκυττάρων, ακολουκοφμενθ από τθ ςταδιακι πτϊςθ τθσ μεταγραφισ του γονιδίου των ριβοςωμικϊν πρωτεϊνϊν και το ςχθματιςμό ριβοςωμάτων με τελικι διαφοροποίθςθ(sieff CA et al., 2010, Quigley JG MRJ and Glader B., 2013). Είναι λοιπόν ενδιαφζρουςα θ εμπλοκι των γονιδίων των ριβοςωμικϊν πρωτεϊνϊν και τθσ ζκφραςισ τουσ ςε πακολογικζσ καταςτάςεισ, ιδίωσ όπωσ ο καρκίνοσ, αλλά και κατά τθ διαδικαςία διαφοροποίθςθσ ερυκρολευχαιμικϊν κυττάρων, θ οποία μελετάται ςτθν παροφςα διπλωματικι εργαςία. 48

49 Β. ΚΟΠΟ ΣΘ ΠΕΛΡΑΜΑΣΛΚΘ ΜΕΣΑΠΣΤΧΛΑΚΙ ΔΛΠΛΩΜΑΣΛΚΘ ΕΡΓΑΛΑ Όπωσ προαναφζρκθκε, τα mirs εμπλζκονται ςτθν πλειονότθτα αςκενειϊν και νόςων, με ζναν μεγάλο κατάλογο διακζςιμο, με τθν ιδιότθτα ςυμμετοχισ τουσ ςτουσ επιγενετικοφσ μθχανιςμοφσ ρφκμιςθσ τθσ γονιδιακισ λειτουργίασ. Σο ενδιαφζρον είναι ότι ςτθν παροφςα ςτθ διπλωματικι εργαςία γίνεται προςπάκεια ςυςχζτιςθσ ςυγκεκριμζνων mirnas με ριβοςωμικζσ πρωτεΐνεσ και κατ επζκταςθ με ριβοςωμοπάκειεσ, λόγω τθσ ομαδοποίθςθσ των τελευταίων ωσ αιμοποιθτικζσ διαταραχζσ, όπωσ και θ λευχαιμία. Ζτςι, θ ςυγκεκριμζνθ πειραματικι μεταπτυχιακι διπλωματικι εργαςία αποτελεί ςυνζχεια τθσ ςυςτθματικισ ερευνθτικισ προςπάκειασ τθσ ερευνθτικισ ομάδασ του Αναπλθρωτι κακθγθτι Μοριακισ Φαρμακολογίασ και Φαρμακογονιδιωματικισ ςτο εργαςτιριο Φαρμακολογίασ, Σμιμα Φαρμακευτικισ, ΑΠΚ, με εςτίαςθ τθν κατανόθςθ πακοφυςιολογικϊν μθχανιςμϊν ςτθν ερυκροποίθςθ και τθ φαρμακολογικι αξιολόγθςθ και ανάπτυξθ καινοτόμων αντικαρκινικϊν ςτοχευμζνθσ δράςθσ για τθ κεραπεία τθσ λευχαιμίασ και των ριβοςωμοπακειϊν. ε αυτιν τθν κατεφκυνςθ τα τελευταία χρόνια, με τθν αξιοποίθςθ γονιδιωματικϊν δεδομζνων μεγάλθσ κλίμακασ και τθν εφαρμογι ςυςτθματικισ βιοπλθροφορικισ ανάλυςθσ υπιρξε θ δυνατότθτα ταυτοποίθςθσ μορίων micrornas (mirs), που ςυςχετίηονται με κρίςιμουσ μοριακοφσ ςτόχουσ και ςθματοδοτικά μονοπάτια μεταγωγισ ςιματοσ για τθν ζναρξθ τθσ διαφοροποίθςθσ ερυκρολευχαιμικϊν κυττάρων in vitro. Με αυτόν τον τρόπο επθρεάηοντασ επιγενετικά φαινόμενα αναμζνεται θ διαλεφκανςθ επιγενετικϊν μθχανιςμϊν με φαρμακολογικό και κεραπευτικό ενδιαφζρον. Ο ςκοπόσ λοιπόν τθσ παροφςασ ερευνθτικισ προςπάκειασ είναι θ μελζτθ τθσ ζκφραςθσ ςυγκεκριμζνων mirs που ταυτοποιικθκαν, όπωσ αναφζρκθκε παραπάνω, ωσ κρίςιμα μόρια για τθ μεταγραφικι ρφκμιςθ των γονιδίων των ριβοςωμικϊν πρωτεϊνϊν. Θ ςυςχζτιςθ των mirs ωσ επιγενετικά ςτοιχεία ελζγχου ςε αντίςτοιχεσ διαδικαςίεσ που ςχετίηονται με τθ διαφοροποίθςθ ερυκρολευχαιμικϊν κυττάρων in vitro, και κατ επζκταςθ θ ςυςχζτιςι τουσ με τθν ζκφραςθ ριβοςωμικϊν πρωτεϊνϊν, δίνει νζεσ πικανζσ κεραπευτικζσ προςεγγίςεισ ζναντι τθσ λευχαιμίασ και των ριβοςωμοπακειϊν. τθ μεκοδολογία τθσ παροφςασ εργαςίασ αξιοποιικθκε θ ερυκρολευχαιμικι κυτταρικι ςειρά των Κ562 ωσ πρότυπο μοντζλο που ζχει αποτελζςει ςθμαντικό εργαλείο τα προθγοφμενα χρόνια για τθν ανακάλυψθ βαςικϊν μοριακϊν μθχανιςμϊν τθσ ερυκροδιαφοροποίθςθσ και τθσ μεγακαρυοποίθςθσ, αλλά και τθσ φαρμακολογικισ αξιολόγθςθσ αντιλευχαιμικϊν κεραπευτικϊν. υμπεραςματικά, θ όλθ προςπάκεια ςτθν ςυγκεκριμζνθ διπλωματικι εργαςία ιταν ο εμπλουτιςμόσ γνϊςεων για τα mirs ςτθν κατανόθςθ μοριακϊν διαδικαςιϊν τθσ διαφοροποίθςθσ ερυκρολευχαιμικϊν κυττάρων ςε επιγενετικό επίπεδο, κακϊσ και θ ςυςχζτιςθ αυτϊν των πλθροφοριϊν με ιδθ υπάρχουςεσ γνϊςεισ ςτθν εμπλοκι ριβοςωμικϊν πρωτεϊνϊν ς αυτι τθ διαδικαςία. Αυτι θ προςπάκεια επικεντρϊκθκε και πραγματοποιικθκε κυρίωσ μζςω ςυςχζτιςθσ τθσ ζκφραςθσ mirs και γονιδίων ριβοςωμικϊν πρωτεϊνϊν, προκειμζνου να υπάρξει περαιτζρω επιςτθμονικι προςπάκεια για ςτοχευμζνθ αξιοποίθςθ κεραπευτικά ςε μετζπειτα ερευνθτικό και κλινικό επίπεδο. 49

50 Γ. ΤΛΛΚΑ ΚΑΛ ΜΕΚΟΔΟΛ Γ.1. Τλικά Γ.1.1. Βιολογικά Τλικά τα πειράματα που διεκπεραιϊκθκαν ςτα πλαίςια τθσ μεταπτυχιακισ αυτισ εργαςίασ χρθςιμοποιικθκε καρκινικι κυτταρικι ςειρά θ οποία χρθςιμοποιείται εδϊ και αρκετά χρόνια ωσ πρότυπθ ςτο εργαςτιριο Φαρμακολογίασ του τμιματοσ Φαρμακευτικισ, ΑΠΚ. Πρόκειται για τα Κ-562, κφτταρα χρόνιασ μυελογενοφσ λευχαιμίασ, ανκρϊπινθσ προζλευςθσ. Θ επιλογι ζγινε επειδι τα κφτταρα αυτά χρθςιμοποιοφνται εκτεταμζνα ωσ μοντζλο ανάπτυξθσ καινοτόμων αντικαρκινικϊν φαρμάκων ςτο χϊρο των αιματολογικϊν πακιςεων. Θ κυτταρικι αυτι ςειρά αναπτφςςεται ςε υγρζσ καλλιζργειεσ, δίχωσ τα κφτταρα να προςκολλϊνται ςτο ςτερεό υπόςτρωμα του υποδοχζα (suspension culture). Οι καλλιζργειεσ των Κ-562 κυττάρων διατθροφνται εντόσ επωαςτιρα (water-jacketed incubator, Forma Scientific), ςε ςτακερι κερμοκραςία 37:C, ςε κορεςμζνθ με υδρατμοφσ ατμόςφαιρα και ςυνεχι παροχι 5% CO2. Σα κφτταρα καλλιεργικθκαν ςε πλαςτικζσ φλάςκεσ διαφόρων μεγεκϊν τθσ εταιρείασ Corning. Προκειμζνου οι αρχικζσ καλλιζργειεσ να διατθροφνται ςυνεχϊσ ςε εκκετικι φάςθ ανάπτυξθσ, τα κφτταρα αραιϊνονταν με καινοφριο κρεπτικό υλικό κάκε ϊρεσ. Σο κρεπτικό υλικό ςτο οποίο αναπτφχκθκαν ςτα κφτταρα K562 είναι το RPMI (Roswell Park Memorial Institute) x (Gibco, τθσ εταιρείασ Invitrogen), ςτο οποίο ζγινε προςκικθ 10% v/v οροφ εμβρφου μόςχου (FBS, Fatal Bovine Serum), και 1% v/v διαλφματοσ βενηυλο-πενικιλίνθ- ςτρεπτομυκίνθ (PS, Penicillin-Streptomycin). Γ.1.2. Τλικά Κυτταρικών Καλλιεργειών Για το χειριςμό των κυτταρικϊν καλλιεργειϊν, ςυμπεριλαμβανομζνθσ τθσ ανάπτυξθσ και διατιρθςθσ των κυττάρων αλλά και τθσ εκτίμθςθσ τθσ κυτταρικισ ανάπτυξθσ και του κυτταρικοφ κανάτου τουσ, χρθςιμοποιικθκαν τα παρακάτω υλικά και αντιδραςτιρια: 1. Πλαςτικζσ φλάςκεσ καλλιζργειασ και τριβλία διαφόρων μεγεκϊν κακϊσ και πιάτα 6, 24 και 96 πθγαδιϊν (6 well-late, 24 well-plate, 96 well-plate) τθσ εταιρείασ Corning. 2. Ρυκμιςτικό διάλυμα Φωςφορικϊν (Phosphate Buffered Saline PBS 10x, ph 7.2, Gibco, Cat. No ) για πλφςεισ των κυττάρων. 3. Βόειοσ Εμβρυϊκόσ Ορόσ (Fetal Bovine Serum E.U approved Gibco, τθσ εταιρείασ Invitrogen, Cat. No ). Προςτίκεται ςε ποςοςτό 10% του ςυνολικοφ όγκου του κρεπτικοφ που χρθςιμοποιείται για να προςδϊςει ςτο κρεπτικό μζςο τα απαραίτθτα ςυςτατικά (μεταφορικζσ πρωτεΐνεσ-τρανςφερίνθ, αναπτυξιακοφσ παράγοντεσ-efg και κυτοκίνεσ-ιντερλευκίνεσ, βιταμίνεσ, μζταλλα κ.α.). Θ διάρκεια ηωισ του κρεπτικοφ μειϊνεται ςτουσ 6 μινεσ μετά τθν προςκικθ του FBS. 4. Μίγμα αντιβιοτικϊν πενικιλίνθσ ςτρεπτομυκίνθσ (GIBCO Laboratories, NY, USA, ) ςε ποςοςτό 1% ςτον τελικό όγκο του κρεπτικοφ. 50

51 5.Κρεπτικό υλικό καλλιζργειασ DMEM 1x (Dulbecco s Modified Eagle Medium) με L Γλουταμίνθ (Gibco, τθσ εταιρείασ Invitrogen, Cat. No ) 6. Κρεπτικό υλικό καλλιζργειασ RPMI (Roswell Park Memorial Institute) x (Gibco, τθσ εταιρείασ Invitrogen). Σα κρεπτικό υλικό RPMI παραλαμβάνεται ςε μορφι ςκόνθσ και ςτθ ςυνζχεια διαλφεται ςε απεςταγμζνο, αποςτειρωμζνο νερό. Ακολουκεί προςκικθ τθσ απαιτοφμενθσ ποςότθτασ NaHCO3 και ρφκμιςθ τθσ οξφτθτασ του διαλφματοσ ςε φυςιολογικό ph (~7). Μετά τθν παραςκευι, το κρεπτικό υλικό διθκείται μζςω ειδικοφ φίλτρου με πόρουσ διαμζτρου 0,22μm (Sterivex-GS) τθσ εταιρίασ Milipore Corporation. Διατθρείται ςτουσ 4:C για χρονικό διάςτθμα 6 μθνϊν. Πριν τθ χριςθ του κρεπτικοφ υγροφ γίνεται προςκικθ 10% v/v οροφ εμβρφου μόςχου (FBS, Fatal Bovine Serum) και 1% v/v διαλφματοσ βενηυλο-πενικιλίνθ-ςτρεπτομυκίνθ (PS, Penicillin-Streptomycin). Μετά τθν προςκικθ των FBS και PS το κρεπτικό υγρό είναι κατάλλθλο για χριςθ για 1 μινα. Για οριςμζνα από τα πειράματα που πραγματοποιικθκαν ζτοιμα, παραςκευαςμζνα κρεπτικά υλικά προμθκεφτθκαν από τθν εταιρεία Invitrogen. Γ.2. Μζκοδοι Γ.2.1. Καλλιζργεια και ανάπτυξθ κυττάρων ςε αιώρθμα Οι καλλιζργειεσ των Κ-562 κυττάρων διατθροφνται εντόσ επωαςτιρα ςτισ κατάλλθλεσ ςυνκικεσ κερμοκραςίασ και παροχισ CO2 όπωσ ιδθ αναφζρκθκε. Προκειμζνου οι αρχικζσ καλλιζργειεσ να διατθροφνται ςυνεχϊσ ςε εκκετικι φάςθ ανάπτυξθσ τα κφτταρα αραιϊνονταν με καινοφριο κρεπτικό υλικό κάκε ϊρεσ. Για τθν αραίωςθ τα κφτταρα επαναιωροφνται ςτθ φλάςκα και ςτθ ςυνζχεια το μεγαλφτερο μζροσ τθσ καλλιζργειασ (9ml) απομακρφνεται από αυτι ενϊ διατθροφνται μόνο 1-2 ςταγόνεσ (1ml) και τζλοσ ςτθν καλλιζργεια προςτίκεται το κατάλλθλο κρεπτικό υλικό μζχρι τελικό όγκο 10ml (αραίωςθ1:10). Ακολοφκωσ, ϊρεσ μετά τθν αραίωςθ θ φλάςκα παρατθρείται ςτο μικροςκόπιο για να επιβεβαιωκεί θ φυςιολογικι ανάπτυξθ των κυττάρων και ςτθ ςυνζχεια υπολογίηεται θ ςυγκζντρωςθ τουσ ςε αυτι. Σα υλικά που χρθςιμοποιοφνται για τθν μζτρθςθ είναι το μικροςκόπιο, το αιμοκυτταρόμετρο (πλάκα Neubauer) και οι καλυπτρίδεσ (Thomas) (θ διαδικαςία περιγράφεται λεπτομερϊσ ςτθν ενότθτα «Προςδιοριςμόσ του ρυκμοφ κυτταρικισ ανάπτυξθσ των κυττάρων»). τα πλαίςια τθσ ςυγκεκριμζνθσ πειραματικισ εργαςίασ τα κφτταρα τοποκετοφνται ςε well-plate ςε αρχικι ςυγκζντρωςθ 1x105 κφτταρα/ml. τθ ςυνζχεια βάςει του τφπου C1* V1 = C2* V2 και γνωρίηοντασ: α) τθν αρχικι ςυγκζντρωςθ των κυττάρων θ οποία μετρικθκε, β) τθ ςυγκζντρωςθ των κυττάρων που είναι επικυμθτι για το πείραμα και γ) τον τελικό όγκο ςτον υποδοχζα του wellplate, υπολογίηεται ο όγκοσ των κυττάρων που πρζπει να λθφκεί από τθν αρχικι καλλιζργεια (V1). Ο όγκοσ αυτόσ προςτίκεται ςε κάκε υποδοχζα ο οποίοσ ςτθ ςυνζχεια πλθρϊνεται με κατάλλθλο όγκο κρεπτικοφ υλικοφ μζχρι τελικό όγκο. Ακολοφκωσ, ςε κάκε υποδοχζα προςτίκεται μια ςυγκεκριμζνθ ςυγκζντρωςθ των ουςιϊν επαγωγζων. ε κάκε πείραμα υπιρχαν και οριςμζνοι υποδοχείσ κελιά που δεν περιείχαν τισ ενϊςεισ, τα λεγόμενα κελιά ελζγχου (control). 51

52 Γ.2.2. Προςδιοριςμόσ του ρυκμοφ κυτταρικισ ανάπτυξθσ Ο ρυκμόσ κυτταρικισ ανάπτυξθσ των κυττάρων Κ-562 προςδιορίηεται μετά από μζτρθςθ του αρικμοφ των κυττάρων ανά μονάδα όγκου κρεπτικοφ υγροφ (cells/ml) ςε δεδομζνεσ χρονικζσ ςτιγμζσ (24, 48, 72 ϊρεσ). Για τθ μζτρθςθ χρθςιμοποιείται το οπτικό μικροςκόπιο (American Optical Corp., U.S.A.) και το αιμοκυτταρόμετρο (πλάκα Neubauer), το οποίο προςομοιάηει μια αντικειμενοφόρο πλάκα (Εικόνα 11). Αποτελείται από δφο μζρθ τα οποία είναι διαιρεμζνα ςε εννζα τετράγωνα του ενόσ χιλιοςτοφ (1mm). Όταν τα τετράγωνα καλφπτονται από μια καλυπτρίδα ςχθματίηουν φψοσ 0,1mm. Επομζνωσ, ο ςυνολικόσ όγκοσ υγροφ που εγκλωβίηεται είναι: 1mm* 1mm* 0,1mm=10 ⁴cmᶟ. Επειδι 1cmᶟ είναι περίπου ίςο με 1ml θ ςυγκζντρωςθ των κυττάρων κα είναι: Συγκζντρωςθ κυττάρων (κφτταρα/ml) = μετρθκζντα κφτταρα/ τετράγωνο * 10⁴ Εικόνα 11. Απεικόνιςη αιματοκυτταρόμετρου και άποψη του οπτικοφ του πεδίου όπωσ φαίνεται ςτο μικροςκόπιο. Για τθ μζτρθςθ προτιμϊνται τα τζςςερα γωνιακά τετράγωνα, όπωσ φαίνεται ςτο ςχιμα. Σα ςτάδια που ακολουκοφνται κατά τθ μζτρθςθ είναι τα εξισ: 1) Αρχικά θ καλφπτρα και θ επιφάνεια του αιμοκυτταρόμετρο κακαρίηονται με νερό και αικανόλθ. 2) τθ ςυνζχεια, θ καλυπτρίδα τοποκετείται ςτο αιμοκυτταρόμετρο. 3) Σα κφτταρα τθσ κυτταροκαλλιζργειασ επαναιωροφνται ςτο κρεπτικό υλικό με τθ χριςθ πιπζτασ, κακϊσ λόγω του βάρουσ τουσ κακιηάνουν. 4) Με τθν πιπζτα φορτϊνονται 8μl αιωριματοσ κυττάρων ςτο αιμοκυτταρόμετρο, ςτο χϊρο ανάμεςα ςτθν καλυπτρίδα και ςτθν πλάκα Neubauer με προςοχι, ζτςι ϊςτε να αποφευχκεί ο ςχθματιςμόσ φυςαλίδων και θ υπερχείλιςθ του υγροφ. 52

53 5) Σζλοσ, το αιμοκυτταρόμετρο τοποκετείται ςτο μικροςκόπιο και με τθ βοικεια χειροκίνθτου καταμετρθτι πραγματοποιείται θ μζτρθςθ των κυττάρων ςτα 4 γωνιακά τετράγωνα όπωσ αναφζρκθκε προθγουμζνωσ. 6) Θ ςυνολικι ςυγκζντρωςθ των κυττάρων ςτθν καλλιζργεια προκφπτει από το μζςο όρο των μετριςεων. Γ.2.3. Προςδιοριςμόσ του κυτταρικοφ κανάτου ςτα κφτταρα Κ-562 με χρώςθ βαςιηόμενθ ςτο αντιδραςτιριο trypan blue Για τον προςδιοριςμό του κυτταρικοφ κανάτου πραγματοποιείται χρϊςθ των κυττάρων με τθ χρωςτικι Trypan Blue 0,4%. Σο αντιδραςτιριο αυτό περιζχει μια χθμικι ζνωςθ με τφπο C₃₄H₂₄N₆NaO₁₄S₄ θ οποία ζχει τθν ικανότθτα να προκαλεί εκλεκτικι βαφι των νεκρϊν κυττάρων. Θ ικανότθτα αυτι οφείλεται ςτθ διαρρθγμζνθ κυτταρικι μεμβράνθ των νεκρϊν κυττάρων, που επιτρζπει τθν είςοδο τθσ χρωςτικισ ςτο εςωτερικό του κυττάρου, με αποτζλεςμα αυτό να μετατρζπεται ςε ζνα χαρακτθριςτικό μπλε ςκοφρο χρϊμα (Εικόνα 12). Αντίκετα, ςτα ηωντανά κφτταρα θ φπαρξθ τθσ ακζραιθσ κυτταρικισ μεμβράνθσ παρεμποδίηει τθν είςοδο τθσ χρωςτικισ ςτο εςωτερικό τουσ, κατά ςυνζπεια, ςτα ηωντανά κφτταρα το χρϊμα παραμζνει αμετάβλθτο. Σο γεγονόσ ότι θ κυτταρικι μεμβράνθ των κυττάρων δεν παραμζνει ακζραιθ τόςο κατά τθν απόπτωςθ όςο και κατά τθ νζκρωςθ ενόσ κυττάρου (τφποι κανάτου) κακιςτά τθν τεχνικι αυτι αναποτελεςματικι ςτο διαχωριςμό των αποπτωτικϊν από τα νεκρωτικά κφτταρα. Λεπτομερϊσ τα βιματα που ακολουκοφνται για τθ μζτρθςθ είναι τα εξισ: 1) Αρχικά, τα κφτταρα επαναιωροφνται ςτθ φλάςκα με πιπετάριςμα. 2) τθ ςυνζχεια, λαμβάνεται 1ml με το ςιφϊνιο και τοποκετείται ςε κατάλλθλο υποδοχζα. 3) Με τθν πιπζτα λαμβάνονται από τον υποδοχζα eppendorf 15μl και τοποκετοφνται ςε μια υποδοχι ςτο 96 well-plate. 4) Ζπειτα, λαμβάνονται 15μl από τθ χρωςτικι, τα οποία τοποκετοφνται ςτθν ίδια υποδοχι. 5) Σα κφτταρα με τθ χρωςτικι επαναιωροφνται και μετά από τθν πάροδο 5 λεπτϊν λαμβάνονται από τον υποδοχζα 8μl και ακολουκεί επίςτρωςθ τθσ πλάκασ Neubauer, όπωσ ςτθν περίπτωςθ τθσ μζτρθςθσ τθσ κυτταρικισ ανάπτυξθσ. 6) Για τθν εξαγωγι του αποτελζςματοσ χρθςιμοποιοφνται δφο χειροκίνθτοι καταμετρθτζσ, με τθ βοικεια των οποίων γίνεται ταυτόχρονθ μζτρθςθ των νεκρϊν κυττάρων (βαμμζνων μπλε) και των ολικϊν κυττάρων. 7) Σο αποτζλεςμα προκφπτει από τον αρικμό των χρωματιςμζνων κυττάρων προσ τον αρικμό του ςυνόλου των κυττάρων *100%. 53

54 Εικόνα 12. Μικροςκοπική παρατήρηςη κυττάρων μετά τη χρϊςη με trypan blue. [Goran N. Kaluđerovid et al., 2010 Synthesis and biological applications of ionic triphenyltin(iv) chloride carboxylate complexes with exceptionally high cytotoxicity] θμειϊνεται ότι κατά τον προςδιοριςμό του κυτταρικοφ κανάτου πρζπει να μετρϊνται περίπου 250 κφτταρα ςε κάκε ςταυρό. Θ μζτρθςθ των κυττάρων πραγματοποιείται ςε οπτικά πεδία και όχι απαραίτθτα ςε τεταρτθμόρια. Γ.2.4. Προςδιοριςμόσ των διαφοροποιθμζνων κυττάρων K562 με τθ χρώςθ βενηιδίνθσ- Θ₂Ο₂ Προκειμζνου να επιτευχκεί ο προςδιοριςμόσ των διαφοροποιθμζνων κυττάρων MEL πραγματοποιείται χρϊςθ με διάλυμα βενηιδίνθσ-θ₂ο₂. Με τθ μζκοδο αυτι, τα διαφοροποιθμζνα κφτταρα, τα οποία περιζχουν αιμοςφαιρίνθ λόγω εκλεκτικισ ιςτοχθμικισ αντίδραςθσ, βάφονται κυανά (Bz+), ενϊ τα αδιαφοροποίθτα κφτταρα παραμζνουν άχρωμα. Για τθ μζκοδο αυτι χρθςιμοποιοφνται τα εξισ τρία διαλφματα: (1) Διάλυμα βενηιδίνθσ: Τδροχλωρικι βενηιδίνθ 0,1gr - Παγόμορφο οξικό οξφ 1,5ml - Θ₂Ο μζχρι 50,0ml. Σο διάλυμα αυτό φυλάςςεται ςε ςκουρόχρωμο φιαλίδιο, ςτο ψυγείο (4: C) για διάςτθμα 1-2 μθνϊν. (2) Διάλυμα υπεροξειδίου: Θ₂Ο₂ 30% 20-50μl - Θ₂Ο 500 μl. Σο διάλυμα αυτό μπορεί να χρθςιμοποιθκεί μόνο για μιςι ϊρα γι αυτό κάκε φορά πριν από κάκε προςδιοριςμό παραςκευάηεται φρζςκο. (3) Διάλυμα κυτταροκαλλιζργειασ. Για τθ χρϊςθ των κυττάρων προςτίκενται ςε ζνα eppendorf ίςοι όγκοι διαλφματοσ βενηιδίνθσ και διαλφματοσ υπεροξειδίου και επωάηονται ςε κερμοκραςία δωματίου για πζντε(5) λεπτά. ε μια υποδοχι του 96 well-plate προςτίκενται ςε αναλογία 1:2 με ςειρά προςκικθσ το Διάλυμα κυτταροκαλλιζργειασ και νζο, ϊριμο πλζον, Διάλυμα βενηιδίνθσ υπεροξειδίου. Μετά τθν αντίδραςθ, το μίγμα χρωματίηεται κυανό. Ακολουκεί ανακίνθςθ και ςτθ ςυνζχεια το διάλυμα αφινεται ςε κερμοκραςία δωματίου για πζντε(5) λεπτά. Μετά το πζρασ αυτοφ του χρόνου επϊαςθσ, λαμβάνονται από τον υποδοχζα 8μl και ακολουκεί επίςτρωςθ τθσ πλάκασ Νeubauer, όπωσ ςτθν περίπτωςθ τθσ μζτρθςθσ τθσ κυτταρικισ ανάπτυξθσ και του κυτταρικοφ κανάτου. Σζλοσ, χρθςιμοποιοφνται δφο χειροκίνθτοι καταμετρθτζσ με τθ βοικεια των οποίων γίνεται ταυτόχρονθ μζτρθςθ των κυττάρων που χρωματίηονται κυανά και του ςυνόλου των κυττάρων. Θ μζτρθςθ των κυττάρων και ςε αυτι τθν περίπτωςθ πραγματοποιείται ςε πεδία (περίπου ανά 250 κφτταρα). Κεωρϊντασ ότι τα κυανά 54

55 κφτταρα αντιςτοιχοφν ςε αυτά που περιζχουν αιμοςφαιρίνθ (διαφοροποιθμζνα), υπολογίηεται το % ποςοςτό των διαφοροποιθμζνων κυττάρων ςτθν καλλιζργεια. Γ.2.5.Απομόνωςθ κυτταροπλαςματικοφ RNA με τθ μζκοδο τθσ ιςοκειοκυανικισ γουανιδίνθσ Για τθ διαπίςτωςθ αλλαγϊν που προκαλοφνται ςε μοριακό επίπεδο ςτα κφτταρα μετά από επϊαςθ με τισ υπό μελζτθ ουςίεσ αρχικά πραγματοποιείται απομόνωςθ του RNA. Για τθν απομόνωςθ ακολουκικθκε το πρωτόκολλο που χρθςιμοποιείται εδϊ και χρόνια ςτο εργαςτιριο Φαρμακολογίασ του τμιματοσ Φαρμακευτικισ, ΑΠΚ. Θ βαςικι αρχι, ςτθν οποία ςτθρίηεται θ μζκοδοσ αυτι, είναι θ απομόνωςθ υγροφ από υγρό (liquid-liquid extraction). υγκεκριμζνα, πραγματοποιείται ανάμειξθ και ζντονθ ανάδευςθ δφο φάςεων: μιασ οργανικισ φάςθσ, θ οποία περιζχει τουσ οργανικοφσ διαλφτεσ φαινόλθ και χλωροφόρμιο και μιασ υδατικισ φάςθσ θ οποία είναι θ κυτταροκαλλιζργεια. Ακολουκεί φυγοκζντρθςθ και διαχωριςμόσ των δφο φάςεων με αποτζλεςμα τθν ζκλουςθ όλθσ τθσ ποςότθτασ του RNA προσ απομόνωςθ ςτθν υδατικι φάςθ. Αυτό οφείλεται ςτο γεγονόσ ότι τα πολικά νουκλεϊκά οξζα, λόγω των αρνθτικά φορτιςμζνων φωςφορικϊν ομάδων είναι διαλυτά ςτθν ανϊτερθ υδατικι φάςθ κακϊσ το νερό είναι πολικότερο και με μικρότερθ πυκνότθτα από τθν αικανόλθ και το χλωροφόρμιο. Οι ςυνκικεσ κάτω από τισ οποίεσ πραγματοποιείται θ διαδικαςία τθσ απομόνωςθσ κα πρζπει να είναι υπερκάκαρεσ, οι χειριςμοί ιδιαίτερα προςεκτικοί και μζςα ςε πάγο για να εξαςφαλίηονται χαμθλζσ κερμοκραςίεσ και τα αναλϊςιμα που χρθςιμοποιοφνται κα πρζπει να ζχουν αποςτειρωκεί πρόςφατα. Οι περιοριςμοί αυτοί οφείλονται ςτο γεγονόσ ότι το RNA είναι ζνα μακρομόριο ιδιαιτζρωσ ευπακζσ και ευαίςκθτο ςτθν υδρολυτικι δράςθ των RNαςϊν. Θ λφςθ των κυττάρων επιτυγχάνεται με τθ χριςθ του διαλφματοσ Solution D το οποίο περιζχει το χαοτροπικό παράγοντα κειοκυανικι γουανιδίνθ. Για τθν παραςκευι 100ml Solution D χρθςιμοποιοφνται: Guanidinethiocyanate 50gr 1M Sodiumcitrate (ph=7) 3,52ml 10% Sarcosyl 5,28ml ddh2o (DEPC) 58,6ml (ζωσ τα 100ml) Θ διαδικαςία τθσ απομόνωςθσ είναι πολυςταδιακι και λεπτομερισ και για τθν πραγματοποίθςθ τθσ ακολουκείται πρωτόκολλο ςυνολικισ διάρκειασ δφο θμερϊν. Ολοκλθρωμζνο το πρωτόκολλο παρατίκεται ακολοφκωσ: 1θ θμζρα: 1. Φυγοκζντρθςθ και ςυλλογι των κυττάρων που βρίςκονται ςε αιϊρθμα ςτθν καλλιζργεια. 2. Απόχυςθ υπερκειμζνου κρεπτικοφ υγροφ και πλφςθ των κυττάρων με 3-5ml ψυχρό ιςότονο διάλυμα φωςφορικϊν, PBS 1x βιολογικισ κακαρότθτασ. 3. Απόχυςθ υπερκειμζνου και επανάλθψθ τθσ πλφςθσ. 4. Απόχυςθ και προςκικθ 4ml διαλφματοσ λφςθσ (solution D) για κάκε 107 κφτταρα. 55

56 5. Για κάκε 1ml Solution D, προςκικθ 7,2μl μερκαπτοαικανόλθσ. Θ μερκαπτοαικανόλθ δρα ωσ αναγωγικόσ παράγοντασ και προςτίκεται για να αποφευχκεί θ υδρόλυςθ του RNA από τισ RNAάςεσ. Σα υπόλοιπα βιματα πραγματοποιοφνται ςτον πάγο και με ψυχρά αντιδραςτιρια για τθν αποφυγι υδρόλυςθσ. 6. Ζντονο vortex και προςκικθ 10% του όγκου του Solution D διαλφματοσ Sodium Acetate 2M, ph=4. 7. Σο vortex ςυμβάλλει ςτθν ευκολότερθ πραγματοποίθςθ τθσ λφςθσ. 8. Vortex. 9. Προςκικθ όξινθσ φαινόλθσ κεκορεςμζνθσ ςε H2O. Ο όγκοσ τθσ όξινθσ φαινόλθσ που προςτίκεται είναι ίςοσ με αυτόν του Solution D. 10. Ζντονο vortex. 11. Προςκικθ όγκου ίςου με το 20% αυτοφ του Solution D μίγματοσ CHCl3:Λςοαμυλικισ (24:1), για αποφυγι αφριςμοφ. 12. Ζντονο vortex. 13. Άφεςθ των δειγμάτων ςτον πάγο για 20 λεπτά. 14. Μεταφορά του γαλακτϊματοσ που ζχει προκφψει ςε πρόςφατα αποςτειρωμζνα eppendorfs και φυγοκζντρθςθ ςτισ ςτροφζσ ςτουσ 4 C για 20 λεπτά. 15. Μεταφορά τθσ ανϊτερθσ, υδατικισ ςτιβάδασ ςε νζα eppendorfs και προςκικθ ίςθσ ποςότθτασ ιςοπροπανόλθσ. 16. Ελαφριά ανακίνθςθ και τοποκζτθςθ των eppendorfs για 24h ςτουσ -20 C. 2θ θμζρα: Σθ δεφτερθ θμζρα πραγματοποιείται θ κατακριμνιςθ του RNA ωσ εξισ: 1. Φυγοκζντρθςθ των eppendorfs ςτουσ 4 C, ςτθ μζγιςτθ ταχφτθτα τθσ φυγοκζντρου (20.512g) για 10 λεπτά και αφαίρεςθ του υπερκειμζνου με πιπζτα, με ιδιαίτερθ προςοχι, για να μθν επθρεαςτεί το ευπακζσ ίηθμα RNA. 3. Προςκικθ 1ml ψυχρισ EtOH 70%, πιπετάριςμα για πλφςθ του ιηιματοσ και φυγοκζντρθςθ ςτισ ςτροφζσ, ςτουσ 4 C για 10 λεπτά. 5. Αφαίρεςθ όλθσ τθσ ποςότθτασ τθσ EtOH με πιπζτα εξαιρετικά προςεκτικά. 6. Άφεςθ των eppendorfs ςτον πάγο για περίπου 10 λεπτά με τα καπάκια ανοιχτά ϊςτε να εξατμιςτοφν τα υπολείμματα τθσ EtOH. 7. Προςκικθ από 20-50μl DEPC-H2O, και διάλυςθ του ιηιματοσ του RNA ςε αυτό. Θ ποςότθτα του DEPC-H2O εξαρτάται από τθν ποςότθτα του ιηιματοσ και ςυνικωσ θ μικρι αραίωςθ είναι θ επικυμθτι. 8. Άφεςθ ςτον πάγο για 15 λεπτά. 9. Σοποκζτθςθ επ αόριςτον ςτουσ -80οC. Γ.2.6. Ποςοτικόσ και ποιοτικόσ προςδιοριςμόσ του RNA Γ.2.6.α.Ποςοτικόσ προςδιοριςμόσ RNA με εφαρμογι φαςματοφωτομετρίασ (Nanodrop 2000) Ο προςδιοριςμόσ τθσ ςυγκζντρωςθσ των νουκλεϊνικϊν οξζων κακίςταται δυνατόσ με τθ χριςθ του φαςματοφωτόμετρου. Θ αρχι τθσ λειτουργίασ του για τον προςδιοριςμό τθσ ποςότθτασ του DNA ι του RNA ςε υδατικά διαλφματα, βαςίηεται ςτο νόμο του Beer-Lambert που προβλζπει τθ γραμμικι εξάρτθςθ τθσ ςυγκζντρωςθσ ενόσ δείγματοσ ςε ςχζςθ με τθν απορρόφθςθ του. Ο ζλεγχοσ 56

57 πραγματοποιείται ςτα 260 και 280 nm. Όλεσ οι βάςεισ πουρίνθσ και πυριμιδίνθσ απορροφοφν ιςχυρά ςτθν υπεριϊδθ περιοχι του φάςματοσ και ςυγκεκριμζνα τα διαλφματα νουκλεϊνικϊν οξζων απορροφοφν ςτο υπεριϊδεσ με μζγιςτο ςτα 260nm. Θ ποςότθτα του αντίςτοιχου νουκλεϊνικοφ οξζοσ προςδιορίηεται λαμβάνοντασ υπόψθ ότι μια μονάδα οπτικισ πυκνότθτασ ςτα 260nm αντιςτοιχεί ςε 40μg/ml διαλφματοσ RNA και 50μg/ml DNA. Ο λόγοσ τθσ απορρόφθςθσ ςτα 260 και 280 nm χρθςιμοποιείται για τθν εκτίμθςθ τθσ ποιότθτασ και κακαρότθτασ του από προςμίξεισ με πρωτεϊνικά μόρια που απορροφοφν ςτο ςυγκεκριμζνο μικοσ κφματοσ, όπωσ θ φαινυλαλανίνθ και θ τρυπτοφάνθ. Για δείγματα υψθλισ κακαρότθτασ ο λόγοσ 260/280 κυμαίνεται μεταξφ 1.8-2, με βζλτιςτο λόγο των δφο απορροφιςεων, A260/A280 2,1. Επιπλζον, ο λόγοσ A260/A230 είναι αντιπροςωπευτικόσ για προςμίξεισ από υδατάνκρακεσ, πρωτεΐνεσ, το χαοτροπικό παράγοντα κειοκυανικι γουανιδίνθ και από τθ φαινόλθ. Οι αποδεκτζσ τιμζσ του λόγου αυτοφ κυμαίνονται μεταξφ 1,8-2. Σο φαςματοφωτόμετρο που χρθςιμοποιικθκε είναι το Nanodrop 2000 τθσ εταιρίασ Thermo Scientific Inc. Πρόκειται για ζνα μθχάνθμα υψθλισ ακρίβειασ με ενςωματωμζνθ μικροκυψελίδα που επιτρζπει ποςοτικό προςδιοριςμό με χριςθ ελάχιςτων ποςοτιτων τθσ τάξθσ των 1-2μl ( Θ διαδικαςία που ακολουκείται για τον ποςοτικό προςδιοριςμό και τθν εκτίμθςθ τθσ κακαρότθτασ των δειγμάτων RNA που απομονϊκθκαν είναι θ εξισ: o Σα δείγματα του RNA που βρίςκονται διαλυμζνα ςε DEPC-H2O ςτουσ -20 C τοποκετοφνται και ξεπαγϊνουν ςτον πάγο. o Σο όργανο Nanodrop 2000 ςυνδζεται με τον υπολογιςτι που φζρει το αντίςτοιχο λογιςμικό. Από τισ επιλογζσ που δίνονται επιλζγεται το «Nucleic Acid» και ακολοφκωσ το «RNA» και θ απόδοςθ των ςυγκεντρϊςεων ςε «μg/μl». o Πρϊτα γίνεται μθδενιςμόσ του οργάνου με DEPC-H2O που αποτελεί τον διαλφτθ ςτον οποίο είναι διαλυμζνο το δείγμα. τα δείγματα ομογενοποιοφνται με ελαφρά ανακίνθςθ του eppendorf (flicking) και ςτθ ςυνζχεια, φορτϊνονται ποςότθτεσ 2μl του RNA ςτθν κυψελίδα του οργάνου και γίνεται θ μζτρθςθ. Οι προδιαγραφζσ που ςχετίηονται με τουσ λόγουσ A260/A280 και A260/A230 πλθροφνταν για κάκε δείγμα RNA που χρθςιμοποιικθκε ςτθν παροφςα εργαςία. Γ.2.6.β. Ποιοτικόσ ζλεγχοσ RNA με θλεκτροφόρθςθ ςε πθκτι αγαρόηθσ Θ εκτίμθςθ τθσ ακεραιότθτασ του RNA επιτυγχάνεται με τθν θλεκτροφόρθςθ του ςε πθκτι (gel) αγαρόηθσ, μετά τθν απομόνωςθ. ε περίπτωςθ που ςτο gel δεν εμφανίηονται ακζραιεσ οι φκορίηουςεσ ηϊνεσ 28S, 18S και 5S του RNA, με τθν τρίτθ από αυτζσ να είναι ςχεδόν διπλάςια ςε ζνταςθ από τθν πρϊτθ, ςυμπεραίνουμε ότι το RNA ζχει υδρολυκεί. Θ θλεκτροφόρθςθ ςε gel αγαρόηθσ είναι θ ςυνθκζςτερθ τεχνικι διαχωριςμοφ νουκλεϊνικϊν οξζων και θ αρχι τθσ βαςίηεται ςτθν ικανότθτα των τελευταίων να κινοφνται προσ το κετικό πόλο τθσ ςυςκευισ, κάτω από τθν επίδραςθ θλεκτρικοφ πεδίου, λόγω τθσ παρουςίασ αρνθτικά φορτιςμζνων 57

58 φωςφορικϊν ομάδων ςτο ςκελετό τουσ. Θ τεχνικι αυτι εφαρμόηεται κατά κόρον προκαταρκτικά τθσ PCR για τθν διαπίςτωςθ τθσ αρτιότθτασ του δείγματοσ RNA αλλά και διαπίςτωςθ απουςίασ ι παρουςίασ επιμολφνςεων του δείγματοσ RNA από DNA, που επίςθσ αποτελεί εκμαγείο για τθν παραςκευι cdna, δίνοντασ ζτςι παραπλανθτικά αποτελζςματα ςτθν επακόλουκθ PCR. Σα προσ διαχωριςμό δείγματα φορτϊνονται ςτο gel αγαρόηθσ και ο διαχωριςμόσ του DNA από το RNA επιτυγχάνεται λόγω τθσ διαφοράσ ςτα μοριακά μεγζκθ των δφο. Θ κατάλλθλθ πυκνότθτα που επιλζγεται για το gel (1%w/v) επιτρζπει τθν γριγορθ κίνθςθ των τμθμάτων RNA, που ζχουν μικρό μζγεκοσ, μζςα από τουσ πόρουσ του gel, ενϊ κακυςτεροφν τθν κίνθςθ του μεγαλφτερου μοριακοφ βάρουσ DNA. Ζτςι ςε περίπτωςθ μίγματοσ των δφο προκφπτουν διακριτζσ φκορίηουςεσ ηϊνεσ για κακζνα από τα ςυςτατικά. Οι ηϊνεσ αυτζσ εμφανίηονται κάτω από λαμπτιρα UV. Επιπλζον, θ πυκνότθτα του gel επιτρζπει το ςαφι διαχωριςμό των τμθμάτων RNA ανάλογα με το μζγεκοσ των ηευγϊν βάςεων από τισ οποίεσ αποτελοφνται. Σα μεγάλου μοριακοφ μεγζκουσ τμιματα μετακινοφνται λιγότερο, ςε αντίκεςθ με τα μικρότερου μεγζκουσ που όντασ πιο ελαφριά, προςεγγίηουν περιςςότερο το κετικό πόλο τθσ ςυςκευισ ( (Crommelin et al., 2011). Προκειμζνου να λθφκεί το φκορίηον ςιμα και να πραγματοποιθκεί θ εμφάνιςθ του gel χρθςιμοποιείται το EtBr, το οποίο, ζχει τθν ικανότθτα να δεςμεφεται μθ εκλεκτικά ςτισ βάςεισ των νουκλεϊνικϊν οξζων και να φκορίηει κατόπιν ακτινοβόλθςθσ με υπεριϊδεσ φωσ. τάδια θλεκτροφόρθςθσ: 1) Για τθν παραςκευι του gel αγαρόηθσ πυκνότθτασ 1% ηυγίηονται 0,5gr ςκόνθσ αγαρόηθσ και διαλφονται ςε 50ml ΣΑΕ 1x. Θ αγαρόηθ που χρθςιμοποιείται για τθν παραςκευι τθσ πθκτισ (γζλθσ) είναι βιολογικισ κακαρότθτασ 99,9%. Σο μίγμα αυτϊν τοποκετείται για 2 λεπτά ςτο φοφρνο μικροκυμάτων με ςκοπό τθν πλιρθ διάλυςθ τθσ ςκόνθσ αγαρόηθσ ςτο ΣΑΕ. 2) Σο διάλυμα ψφχεται ςταδιακά κάτω από ροι νεροφ και μόλισ φτάςει ςε κερμοκραςία ανεκτι από το ανκρϊπινο χζρι (προςοχι για αποφυγι ςτερεοποίθςθσ του gel) προςτίκενται 5μl EtBr. 3) Σο gel, που βρίςκεται ακόμα ςε υγρι μορφι, αποχφνεται ςτο εκμαγείο τθσ ςυςκευισ θλεκτροφόρθςθσ και προςαρμόηεται θ ειδικι πλαςτικι μιτρα (χτενάκι) για να ςχθματιςτοφν οι κζςεισ ειςαγωγισ ςτισ οποίεσ φορτϊνονται τα δείγματα παράλλθλα με τθ ςτερεοποίθςθ τθσ γζλθσ. 4) τα πθγαδάκια που ςχθματίηονται φορτϊνονται 10μl από κάκε δείγμα ςτα οποία περιζχεται o όγκοσ RNA ςε μl που αντιςτοιχεί ςε 2μg, 2μl Loading Buffer 10X και DEPC μζχρι να ςυμπλθρωκοφν τα 10μl (Εικόνα 39). Με τθ βοικεια τθσ μπλε χρωςτικισ που περιζχεται ςτο Loading Buffer παρακολουκείται θ πορεία τθσ θλεκτροφόρθςθσ με ζλεγχο του μετϊπου τθσ κίνθςθσ των δειγμάτων. Επιπλζον, λόγω τθσ περιεχόμενθσ γλυκερόλθσ αποτρζπεται θ διάχυςθ του δείγματοσ ςτο gel. Μετά τθν ολοκλιρωςθ τθσ θλεκτροφόρθςθσ (όταν το μζτωπο προχωριςει μζχρι τθ μζςθ του gel) το gel αφαιρείται από τθν ςυςκευι και εμφανίηεται κάτω από λάμπα UV. τα ςθμεία που υπάρχουν νουκλεϊκά οξζα εμφανίηονται φωτεινζσ ηϊνεσ. Θ ςυςκευι θλεκτροφόρθςθσ πλζνεται ςχολαςτικά πριν τθν θλεκτροφόρθςθ 58

59 RNA με SDS και αποςτειρωμζνο αποςταγμζνο νερό για να αποτραπεί τυχόν αποικοδόμθςθ του RNA από RNάςεσ. τθν περίπτωςθ που το απομονωμζνο δείγμα RNA δεν ζχει επικυμθτοφσ λόγουσ A260/A280 ι/και Α260/230 ι δε δίνει επικυμθτι εικόνα κατά τθσ θλεκτροφόρθςθ ςε πθκτι αγαρόηθσ, πραγματοποιείται κακαριςμόσ του με τθ διεργαςία του φαινολιςμοφ. Πρόκειται για μια διαδικαςία που διαχωρίηει το δείγμα ςε δφο φάςεισ και πάλι, μια οργανικι και μια υδατικι, προσ απομάκρυνςθ τυχόν υπολειμμάτων DNA ι πρωτεϊνϊν μζςω τθσ οργανικισ φάςθσ και διατιρθςθ του RNA ςτθν υδατικι. Πιο ςυγκεκριμζνα, ακολουκοφνται τα εξισ βιματα: I. Προςκικθ DEPC-H 2 O ςε τελικό όγκο 100μl προκειμζνου να αυξθκεί ο υδατικόσ όγκοσ και να πραγματοποιθκοφν οι εκχυλίςεισ. II. Προςκικθ 50μl όξινθσ φαινόλθσ κεκορεςμζνθσ ςε H 2 O και 50μl μίγματοσ CHCl 3 :Λςοαμυλικισ (24:1). III. Vortex και παρατιρθςθ λευκοφ γαλακτϊματοσ IV. Φυγοκζντρθςθ ςτισ ςτροφζσ ςτουσ 4 ο C για 5 λεπτά. V. Μεταφορά ανϊτερθσ υδατικισ ςτιβάδασ ςε νζα eppendorfs. VI. Επανάλθψθ των βθμάτων ΛΛ (2) ζωσ V (5). Εάν χρειάηεται επαναλαμβάνεται και το πρϊτο βιμα για αφξθςθ όγκου υδατικισ φάςθσ. VII. Προςκικθ 1/10 του όγκου τθσ υδατικισ φάςθσ Sodium Acetate 3M, προκειμζνου να προκλθκεί κατακριμνιςθ. VIII. Προςκικθ 2,5 x τον όγκο τθσ υδατικισ φάςθσ κακαρισ αικανόλθσ (EtOH 100%) και ιπια ανάδευςθ με τθν πιπζτα. IX. Επϊαςθ ςτουσ -80 ο C για τουλάχιςτον 45 λεπτά. X. Φυγοκζντρθςθ ςτισ ςτροφζσ για 15 λεπτά ςτουσ 4 ο C. XI. Προςεκτικι αφαίρεςθ υπερκειμζνου. XII. Προςκικθ 500μl EtOH 70% και ιπια ανάδευςθ. XIII. Φυγοκζντρθςθ ςτισ ςτροφζσ για 10 λεπτά ςτουσ ςτουσ 4 ο C. XIV. Προςεκτικι απομάκρυνςθ αικανόλθσ και επϊαςθ ςε κερμοκραςία δωματίου με ανοιχτά καπάκια για 15 λεπτά, προκειμζνου να εξατμιςτεί πλιρωσ θ αικανόλθ. XV. Προςκικθ 20μl DEPC-H 2 O και ιπια ανάδευςθ. XVI. Ποςοτικόσ προςδιοριςμόσ RNA με εφαρμογι φαςματοφωτομετρίασ ι/και με θλεκτροφόρθςθ ςε πθκτι αγαρόηθσ. XVII. Αποκικευςθ ςτουσ -20 C. Γ.2.7. Παραςκευι cdna εκμαγείου από δείγμα RNA Για τθ ςφνκεςθ μονόκλωνου cdna από δείγμα μονόκλωνου RNA είναι απαραίτθτο το ζνηυμο τθσ αντίςτροφθσ μεταγραφάςθσ προκειμζνου να μετατραπεί το RNA ςε DNA, αντιςτρόφωσ απ ότι γίνεται φυςιολογικά μεταξφ αυτϊν των μορίων. υνοπτικά, θ αντίςτροφθ μεταγραφάςθ (RT) είναι ζνα πολυ-λειτουργικό 59

60 ζνηυμο με 3 ξεχωριςτζσ ενηυματικζσ δραςτθριότθτεσ. Θ RT μπορεί να δρα ωσ RΝΑεξαρτϊμενθ DNA πολυμεράςθ, RNase Θ και DNA-εξαρτϊμενθ DNA πολυμεράςθ. Σο kit τθσ Qiagen εκμεταλλεφεται δφο από τισ ενηυματικζσ αυτζσ ιδιότθτεσ για τθ ςφνκεςθ του μονόκλωνου cdna. Δρϊντασ ωσ «RNA-εξαρτϊμενθ-DNA-πολυμεράςθ» μεταγράφει το cdna από εκμαγείο RNA και ζτςι επιτρζπει τθ ςφνκεςι του, ενϊ μζςω τθσ δράςθ τθσ ωσ «RNaseH» εκλεκτικά αποικοδομεί μόνο το RNA που βρίςκεται υπό τθ μορφι υβριδίου δίκλωνου RNA-DNA. Ζτςι, το «κακαρό» RNA παραμζνει ανζπαφο και χρθςιμοποιείται ωσ εκμαγείο για τθ ςφνκεςθ του cdna. Θ δράςθ τθσ «RNase H» δεν απαιτείται να τερματιςτεί πριν τθν ζναρξθ τθσ qpcr, αντικζτωσ είναι πικανό να δρα βελτιϊνοντασ τθν ευαιςκθςία τθσ μεκόδου. Γ.2.7.α. cdna εκμαγείο για ανίχνευςθ τθσ ζκφραςθσ των mirs με qpcr Για τθ ςφνκεςθ του cdna χρθςιμοποιικθκε το miscript II RT Kit από τθν εταιρεία Qiagen (218161). Σο kit αυτό περιλαμβάνει δφο (2) ρυκμιςτικά διαλφματα: 5x miscript HiSpec Buffer και 5x miscript HiFlex Buffer. τθν παροφςα ερευνθτικι εργαςία, χρθςιμοποιικθκε το πρϊτο ρυκμιςτικό διάλυμα (5x miscript HiSpec Buffer), προκειμζνου να αναλυκεί το προφίλ των ϊριμων mirnas ςτθν πορεία μζςω qpcr. Αυτό το πρωτόκολλο (5x mirna HiSpec Buffer) χρθςιμοποιείται για χριςθ ζωσ και 2 μg RNA, ενϊ παρζχει τθ δυνατότθτα παραςκευισ cdna από ποςότθτεσ RNA 10ng. Θ ςφνκεςθ του cdna περιλαμβάνει ωσ πρϊτο βιμα τθν κατεργαςία του RNA με DNάςθ (genomic wipe-out buffer) προκειμζνου να απομακρυνκεί οποιαδιποτε υπόνοια γενωμικισ επιμόλυνςθσ από τα δείγματα και ακολουκεί θ προςκικθ τθσ ανάςτροφθσ μεταγραφάςθσ (Quantiscript Reverse Transcriptase) για τθν ζναρξθ ςφνκεςθσ του cdna. Σο μονόκλωνο DNA (cdna) που παράχκθκε, χρθςιμοποιικθκε περαιτζρω ςτθν ανάλυςθ μζςω qpcr. Θ διαδικαςία που ακολουκείται είναι θ εξισ: I. Σοποκζτθςθ του RNA από τουσ -20 C ςτον πάγο. Σα ςυςτατικά του kit αφινονται να ξεπαγϊςουν ςε κερμοκραςία δωματίου, ενϊ θ RTMix τοποκετείται τελευταία ςτιγμι ςτον πάγο. Ανάδευςθ των ςυςτατικϊν ςτα μικροςωλθνάρια, ςτα οποία βρίςκονται τοποκετθμζνα, με ελαφρφ χτφπθμα με το δάχτυλο (flicking). φντομθ φυγοκζντρθςθ για απομάκρυνςθ πικανϊν υπολειμμάτων από τα τοιχϊματα των ςωλθναρίων. II. Προετοιμαςία κφριου μείγματοσ ανάςτροφθσ μεταγραφισ (MasterMix) ςτον πάγο ςφμφωνα με το εγχειρίδιο του kit. Ανάμειξθ και αποκικευςθ ςτον πάγο. Σο κφριο μείγμα ανάςτροφθσ μεταγραφισ περιζχει όλα τα ςυςτατικά που απαιτοφνται για τθν ςφνκεςθ πρϊτου κλϊνου cdna εκτόσ από το πρότυπο RNA. φμφωνα με το επίςθμο πρωτόκολλο τθσ εταιρείασ, που ςυνοδεφει το kit αναμιγνφονται 4μl Hispec Buffer, 2μl Nucleic Mix, RNase free water (10μl, αναλόγωσ τον όγκο του template RNA) και 2μl miscript RTMix. 60

61 III. Προςκικθ του δείγματοσ RNA (2μl) ςτο MasterMix και ιπια ανάδευςθ και ςφντομθ φυγοκζντρθςθ. Σοποκζτθςθ πίςω ςτον πάγο. IV. Επϊαςθ των μικροςωλθναρίων για 60 λεπτά ςτουσ 37 o C. V. Επϊαςθ των μικροςωλθναρίων για 5 λεπτά ςτουσ 95 o C, για να απενεργοποιθκεί θ αντίςτροφθ μεταγραφάςθ (RT). VI. Για άμεςθ χριςθ με qpcr, πραγματοποιείται κατάλλθλθ αραίωςθ (1:10) όπωσ περιγράφεται ςτο πρωτόκολλο του kit, ιπια ανάδευςθ και ςφντομθ φυγοκζντρθςθ. Εναλλακτικά, αποκικευςθ πριν από qpcr ςτουσ -20 ο C για μακροπρόκεςμθ φφλαξθ. Γ.2.7.β. cdna εκμαγείο για ανίχνευςθ ζκφραςθσ γονιδίων με qpcr Για τθ ςφνκεςθ του cdna χρθςιμοποιικθκε το QuantiTect Reverse Transcription Kit τθσ Qiagen (205311). Θ χριςθ του kit παρζχει τθ δυνατότθτα παραςκευισ cdna από ποςότθτεσ RNA 10pg-1μg. Θ ςφνκεςθ του cdna περιλαμβάνει ωσ πρϊτο βιμα τθν κατεργαςία του RNA με DNάςθ (genomic wipeout buffer) προκειμζνου να απομακρυνκεί οποιαδιποτε υπόνοια γενωμικισ επιμόλυνςθσ από τα δείγματα και ακολουκεί θ προςκικθ τθσ ανάςτροφθσ μεταγραφάςθσ (Quantiscript Reverse Transcriptase) για τθν ζναρξθ ςφνκεςθσ του cdna. Σο μονόκλωνο DNA (cdna) που παράχκθκε, χρθςιμοποιικθκε περαιτζρω ςτθν ανάλυςθ μζςω qpcr. Σο επίςθμο πρωτόκολλο τθσ εταιρείασ που ςυνοδεφει το kit δίνει τισ ακόλουκεσ οδθγίεσ για τθν παραςκευι cdna: ΤΣΑΣΛΚΑ (κατά ςειρά προςκικθσ) gdna Wipeout Buffer Template RNA RNase-Free Water υνολικόσ όγκοσ ΠΟΟΣΘΣΕ 2 μl Ποικίλο (10pg 1μg) Ποικίλο (ζωσ τα 14 μl) 14 μl I. Σοποκζτθςθ του RNA από τουσ -20 C ςτον πάγο, ζωσ ότου ξεπαγϊςει. Σα ςυςτατικά του kit αφινονται να ξεπαγϊςουν ςε κερμοκραςία δωματίου. Ανάδευςθ των ςυςτατικϊν ςτα μικροςωλθνάρια, ςτα οποία βρίςκονται τοποκετθμζνα, με ελαφρφ χτφπθμα με το δάχτυλο (flicking). φντομθ φυγοκζντρθςθ για απομάκρυνςθ πικανϊν υπολειμμάτων από τα τοιχϊματα των ςωλθναρίων. II. Ανάμειξθ των ακολοφκων ςε υπερκάκαρα μικροςωλθνάρια για πραγματοποίθςθ τθσ αντίδραςθσ απομάκρυνςθσ του γενωμικοφ DNA. III. Μετά από ελαφρό flicking, επϊαςθ των μικροςωλθναρίων ςτουσ 42 ο C για 2 λεπτά και άμεςθ επανατοποκζτθςθ ςτον πάγο. το ςτάδιο αυτό ζχει ολοκλθρωκεί θ διαδικαςία προετοιμαςίασ του template RNA. IV. Προετοιμαςία του master mix τθσ αντίςτροφθσ μεταγραφισ ςτον πάγο ςφμφωνα με τον πίνακα που ακολουκεί: 61

62 V. Ανάμιξθ και διατιρθςθ ςτον πάγο. VI. Προςκικθ του template RNA ςε κάκε ζνα μικροςωλθνάριο που περιζχει master mix για τθν αντίςτροφθ μεταγραφι. VII. Επϊαςθ για 15 λεπτά ςτουσ 42 ο C, για ολοκλιρωςθ τθσ αντίςτροφθσ μεταγραφισ. VIII. Επϊαςθ για 3 λεπτά ςτουσ 95οC, για απενεργοποίθςθ τθσ Quantiscript Reverse Transcriptase. IX. Σοποκζτθςθ ςτουσ 4 ο C για βραχυπρόκεςμθ χριςθ ι ςτουσ -20 ο C για μακροπρόκεςμθ φφλαξθ. Γ.2.8. χεδιαςμόσ των κατάλλθλων εκκινθτών για τθν ανάλυςθ mirs και γονιδίων με qpcr τα πλαίςια τθσ ερευνθτικισ αυτισ εργαςία πραγματοποιικθκε μοριακι ανάλυςθ των επιπζδων οριςμζνων mirnas και γονιδίων μζςω qpcr ςε κφτταρα Κ Ο ςχεδιαςμόσ των εκκινθτϊν (primers) τθσ ςφνκεςθσ του δίκλωνου DNA είχε ιδθ προθγθκεί ςε προθγοφμενθ διπλωματικι εργαςία του εργαςτθρίου, ενϊ μερικοί ςυντζκθκαν λόγω τθσ παροφςασ εργαςίασ. Σο ηεφγοσ των εκκινθτϊν οριοκετεί τθν περιοχι-ςτόχο που κα πολλαπλαςιαςτεί εκκετικά. Οι υβριδοποιθμζνοι εκκινθτζσ λειτουργοφν ωσ υπόςτρωμα για τθν DNA πολυμεράςθ, θ οποία καταλφει τθν επιμικυνςθ τθσ νζασ αλυςίδασ, τοποκετϊντασ δεοξυνουκλεοτίδια ςυμπλθρωματικά προσ τον κλϊνοςτόχο με κατεφκυνςθ 5 3. Θ χριςθ τουσ βαςίηεται ςτθν αρχι τθσ υβριδοποίθςθσ των ςυμπλθρωματικϊν βάςεων του DNA ςε ςυγκεκριμζνθ κερμοκραςία τιξθσ (Tm). Σο μικοσ των εκκινθτϊν δεν υπερβαίνει τα 30 νουκλεοτίδια και αυτοί πρζπει να είναι ςυμπλθρωματικοί και εκλεκτικοί ωσ προσ το τμιμα του DNA που πρόκειται να ενιςχυκεί. Θ επιλογι τθσ αλλθλουχίασ των εκκινθτϊν είναι ιδιαίτερα ςθμαντικι για τθν επιτυχία τθσ αντίδραςθσ. Ο ςχεδιαςμόσ τουσ, λοιπόν, πρζπει να είναι πολφ προςεκτικόσ, ιδιαίτερα ωσ τθν εκλεκτικότθτα και ειδικότθτα *Berg et al. 2011; Πατρινόσ-Κατςίλα, Σο πρϊτο βιμα αφορά ςτον προςδιοριςμό τθσ αλλθλουχίασ-ςτόχου του DNA που κα ενιςχυκεί και θ επιλογι τθσ ςε κατάλλθλθ μορφι (FASTA format) για το ςχεδιαςμό των εκκινθτϊν. Αυτό το βιμα ζγινε με τθ χριςθ τθσ βάςθσ δεδομζνων BLAST-Nucleotide ( τθ ςυνζχεια, γίνεται χριςθ του υπολογιςτικοφ προγράμματοσ Primer3, το οποίο εμφανίηει τζςςερα πικανά ηεφγθ εκκινθτϊν, με ςειρά καταλλθλότθτασ, λαμβάνοντασ υπόψθ όλεσ τισ βαςικζσ παραμζτρουσ και τουσ περιοριςμοφσ τουσ. Εναλλακτικά, θ βάςθ δεομζνων Blast προςφζρει τθ δυνατότθτα επιλογισ εκκινθτϊν από δικό τθσ μενοφ ( pick primers ). Βαςικόσ είναι ο ζλεγχοσ των ηευγϊν ωσ προσ τθν ειδικότθτά τουσ, αλλά και ωσ προσ τισ δευτεροταγείσ δομζσ των εκκινθτϊν. Ζνα ηεφγοσ εκκινθτϊν δεν πρζπει να ζχει ςυμπλθρωματικά 3 ι 5 άκρα, αλλά οφτε να παρουςιάηει εςωτερικι ςυμπλθρωματικότθτα, διότι κα εμποδιςτεί θ αποτελεςματικι πρόοδοσ τθσ αντίδραςθσ PCR. τθν πρϊτθ περίπτωςθ, κα ςχθματιςτοφν διμερι εκκινθτϊν, τα οποία πολυμερίηονται ευκολότερα ςτθν PCR, απ ότι θ μεγαλφτερθ αλλθλουχία-ςτόχοσ, ενϊ ςτθ δεφτερθ, κα ςχθματιςτοφν κθλιζσ (loops). Επίςθσ, οι εκκινθτζσ πρζπει να πλθροφν τισ εξισ προδιαγραφζσ: 62

63 Μικοσ= νουκλεοτίδια Περιεκτικότθτα GC%= % Μζγεκοσ προϊόντοσ= bp ΣM εκκινθτι= ο C Ο ζλεγχοσ των ανωτζρω γίνεται με τθ χριςθ του προγράμματοσ OligoAnalyzer, το οποίο μάλιςτα παρουςιάηει και γραφικά τουσ εκκινθτζσ και τα χαρακτθριςτικά τουσ. Γ.2.9. Αλυςιδωτι αντίδραςθ πολυμεράςθσ πραγματικοφ χρόνου, real-time PCR (RT-PCR)- Ποςοτικι αλυςιδωτι αντίδραςθ πολυμεράςθσ, quantitative PCR (qpcr) Θ αλυςιδωτι αντίδραςθ πολυμεράςθσ πραγματικοφ χρόνου (RT-PCR), είναι μια ςφγχρονθ εργαςτθριακι παραλλαγι τθσ μοριακισ τεχνικι τθσ αλυςιδωτισ αντίδραςθσ πολυμεράςθσ (PCR). τθ βιβλιογραφία απαντάται και ωσ ποςοτικι αλυςιδωτι αντίδραςθ πολυμεράςθσ, quantitative PCR (qpcr) γιατί εξαςφαλίηει τθν ποςοτικοποίθςθ τθσ ενίςχυςθσ του DNA-ςτόχου κακϊσ θ αντίδραςθ εξελίςςεται ςε «πραγματικό χρόνο». Αντικζτωσ, ςτθν κλαςςικι PCR, το προϊόν τθσ αντίδραςθσ ανιχνεφεται μετά το τζλοσ τθσ ενίςχυςθσ. Κάκε κφκλοσ τθσ qpcr ολοκλθρϊνεται ςε τρία ςτάδια. Σα τρία ςτάδια κάκε κφκλου είναι τα εξισ: 1. αποδιάταξθ του δίκλωνου DNA ςε υψθλι κερμοκραςία προσ ςχθματιςμό μονόκλωνων αντιπαράλλθλων κλϊνων. 2. ςφνδεςθ των εκκινθτϊν (primers) ςτο μονόκλωνο DNA του δείγματοσ 3. επιμικυνςθ του DNA με τθ δράςθ τθσ DNA πολυμεράςθσ και τθν προςκικθ dntps ςτο 3' άκρο κάκε νεοςυντικζμενθσ αλυςίδασ. Οι κφκλοι ολοκλθρϊνονται όταν ενιςχυκεί επαρκϊσ το DNA-ςτόχοσ. υγκεκριμζνα, όςον αφορά τθν ενίςχυςθ ςτθν RT-PCR διακρίνονται 3 φάςεισ: Εκκετικι (Exponential), ςτθν οποία ο διπλαςιαςμόσ των αντιγράφων ςε κάκε κφκλο είναι απόλυτοσ κακϊσ υπάρχει επάρκεια αντιδραςτθρίων. Γραμμικι (Linear), ςτθν οποία θ αντίδραςθ επιβραδφνεται κακϊσ τα αντιδραςτιρια αρχίηουν να καταναλϊνονται. τατικι (Plateau), όπου θ ενίςχυςθ ζχει πλζον ολοκλθρωκεί και δεν παράγονται άλλα αντίγραφα. Θ ςτατικι φάςθ τθσ κυτταρικισ ανάπτυξθσ αποτελεί το χρονικό ςθμείο κατά το οποίο πραγματοποιείται θ ανίχνευςθ των προϊόντων και θ ποςοτικοποίθςθ τθσ ενίςχυςθσ του DNA-ςτόχου. τθ φάςθ όμωσ αυτι παρατθρείται μείωςθ τθσ ευαιςκθςίασ τθσ μεκόδου και μάλιςτα αν θ φάςθ αυτι διαρκζςει πολφ μπορεί να ζχουμε και αποικοδόμθςθ των προϊόντων (Applied Biosystems). Αντίκετα, ςτθν real-time PCR θ ποςοτικοποίθςθ του αποτελζςματοσ λαμβάνει χϊρα ςτθν εκκετικι φάςθ, με αποτζλεςμα θ τεχνικι να χαρακτθρίηεται από εξαιρετικι ευαιςκθςία. Αυτι είναι και θ βαςικι διαφορά τθσ κλαςςικισ PCR από τθν real-time PCR. Λόγω του ςυγκριτικοφ αυτοφ πλεονεκτιματοσ τθσ qpcr ζναντι τθσ κλαςικισ PCR, ςτα πλαίςια τθσ πειραματικισ αυτισ εργαςίασ, επιλζχκθκε ο μοριακόσ ζλεγχοσ των επιπζδων των επιλεχκζντων mirs και γονιδίων με qpcr. Οι 63

64 εκκινθτζσ και ςτισ δφο περιπτϊςεισ, παραλαμβάνονται από τθν εταιρεία ςε λυοφιλοποιθμζνθ μορφι και κατόπιν κατάλλθλθσ αραίωςθσ ςε PCR-grade H2O παίρνουμε τθν επικυμθτι ςυγκζντρωςθ. Σο εκμαγείο cdna αφοφ παραςκευαςτεί όπωσ προαναφζρκθκε αραιϊνεται με PCR-grade H2O ςε κατάλλθλθ ςυγκζντρωςθ (1:10). Σα ςυςτατικά φορτϊνονται ςτα κελιά του 96 well-plate με τελευταίο το cdna εκμαγείο. Θ διαδικαςία διζπεται από ςυνκικεσ εξαιρετικισ κακαρότθτασ. Γ Ποςοτικόσ προςδιοριςμόσ ζκφραςθσ mirnas Σο πρόγραμμα ενίςχυςθσ του ςτόχου, βάςθ του οποίου πραγματοποιικθκαν οι qpcr, παρατίκεται ςτο παρακάτω διάγραμμα και πιο αναλυτικά ςτον Πίνακα 3. Εικόνα 13. Πρόγραμμα qpcr για ενίςχυςη ςτόχου mirna. Για τθ real time PCR για ενίςχυςθ των επιλεγμζνων mirnas χρθςιμοποιικθκε το kit miscript SYBR Green PCR Kit (218073) τθσ εταιρείασ Qiagen, το οποίο περιλαμβάνει όλα τα απαραίτθτα αντιδραςτιρια εκτόσ από το δείγμα DNA και τον εμπρόςκιο εκκινθτι. Θ αντίδραςθ πραγματοποιείται ςε ειδικισ καταςκευισ 96 well plates. Κάκε κελί του πιάτου αντιςτοιχεί ςε μια ολοκλθρωμζνθ αντίδραςθ. Ο τελικόσ όγκοσ τθσ αντίδραςθσ, ο όγκοσ δθλαδι που τοποκετείται ςε κάκε κελί, είναι 20μl και περιζχει τα εξισ αντιδραςτιρια ςτισ αντίςτοιχεσ αναλογίεσ με ςειρά προςκικθσ (το πρωτόκολλο του kit ηθτά 25μl και τισ αντίςτοιχεσ αναλογίεσ): ΑΝΣΛΔΡΑΣΘΡΛΑ ΟΓΚΟ ςε Vτελ=20μl (μl) ΟΓΚΟ ςε Vτελ=25μl (μl) RNase-free water x miscript Universal 2 2,5 Primer 10x miscript Primer Assay 2 2,5 2x QuantiTect SYBR Green 10 12,5 PCR Master Mix Template RNA 2 2,5 64

65 Οι παράμετροι τθσ κερμοκραςίασ ςτθν οποία κα γίνει θ αντίδραςθ ρυκμίηονται με βάςθ το εξισ πρωτόκολλο: ΠΛΝΑΚΑ 2 ΒΘΜΑ ΧΡΟΝΟ ΚΕΡΜΟΚΡΑΛΑ ( ο C) Αρχικό βιμα ενεργοποίθςθσ ενηφμου ΧΟΛΛΑ 15 λεπτά 95 Ενεργοποίθςθσ HotStarTaq DNA Polymerase Αποδιάταξθ 15 δευτερόλεπτα 94 Τβριδιςμόσ 30 δευτερόλεπτα 55 Επιμικυνςθ 30 δευτερόλεπτα 70 υλλογι δεδομζνων φκοριςμοφ Σα παραπάνω βιματα (αποδιάταξθ, υβριδιςμόσ, επιμικυνςθ) επαναλαμβάνονται για 40 φορζσ (Cycling stage), όςο και οι κφκλοι τθσ qpcr. Σο τελικό ςτάδιο ςτουσ 95 ο C εξαςφαλίηει τθν τιξθ των προϊόντων τθσ qpcr (Melt curve stage) και τθν επιβεβαίωςθ ι όχι τθσ εκλεκτικισ ενίςχυςθσ του DNA ςτόχου μζςω του ςχθματιςμοφ ενόσ μοναδικοφ προϊόντοσ. Γ Ποςοτικόσ προςδιοριςμόσ ζκφραςθσ γονιδίων Σο πρόγραμμα ενίςχυςθσ του DNA-ςτόχου, βάςθ του οποίου πραγματοποιικθκαν οι qpcr, παρατίκεται ςτο παρακάτω διάγραμμα. Σο πρϊτο ςτάδιο (Holding stage) για τα 3 λεπτά ςτουσ 95 ο C απαιτείται για τθν ενεργοποίθςθ τθσ DNA πολυμεράςθσ (hotstart) και ακολουκοφν 3 δευτερόλεπτα ςτθν ίδια κερμοκραςία τα οποία απαιτοφνται για τθν αποδιάταξθ των δίκλωνων μορίων DNA. Ακολουκοφν 20 δευτερόλεπτα ςτουσ 60 ο C όπου οι primers ςυνδζονται με το DNA ςτόχο (Annealing) και ζπειτα 20 δευτερόλεπτα ςτουσ 72 ο C όπου πραγματοποιείται θ επιμικυνςθ των μονόκλωνων αλυςίδων DNA, κακϊσ θ κερμοκραςία αυτι εξαςφαλίηει τθ βζλτιςτθ δράςθ τθσ DNA πολυμεράςθσ. Σα 10 δευτερόλεπτα ςτουσ 78 ο C αφοροφν ςτθν ανίχνευςθ φκοριςμοφ των προϊόντων μετά τθ λιξθ κάκε κφκλου. Σα τρία παραπάνω βιματα επαναλαμβάνονται για 40 φορζσ (Cycling stage), όςο και οι κφκλοι τθσ qpcr και μετά το τζλοσ των ακολουκεί ζνα βιμα 3 λεπτϊν ςτουσ 72 ο C, όπου πραγματοποιείται θ τελικι επιμικυνςθ του μονόκλωνου DNA που δεν πραγματοποίθςε ςτο προθγοφμενο ςτάδιο θ DNA πολυμεράςθ (Holding stage). Σο τελικό ςτάδιο των 15 δευτερολζπτων ςτουσ 95 ο C εξαςφαλίηει τθν τιξθ των προϊόντων τθσ qpcr (Melt curve stage) και τθν επιβεβαίωςθ ι όχι τθσ εκλεκτικισ ενίςχυςθσ του DNA ςτόχου μζςω του ςχθματιςμοφ ενόσ μοναδικοφ προϊόντοσ. 65

66 Εικόνα 14. Πρόγραμμα qpcr για ενίςχυςη DNA-ςτόχου. Για τθ real time PCR για ενίςχυςθ των επιλεγμζνων γονιδίων χρθςιμοποιικθκε το kit KAPA SYBRFAST qpcr Kit (ΚΚ4602) τθσ εταιρείασ KAPA BIOSYSTEMS, το οποίο περιλαμβάνει όλα τα απαραίτθτα αντιδραςτιρια εκτόσ από το δείγμα DNA και το ηεφγοσ των εκκινθτϊν. Θ αντίδραςθ πραγματοποιείται ςε ειδικισ καταςκευισ 96 well plates. Κάκε κελί του πιάτου αντιςτοιχεί ςε μια ολοκλθρωμζνθ αντίδραςθ. Ο τελικόσ όγκοσ τθσ αντίδραςθσ, ο όγκοσ δθλαδι που τοποκετείται ςε κάκε κελί, είναι 10μl (το πρωτόκολλο του kit ηθτά 20μl και τισ αντίςτοιχεσ αναλογίεσ) και περιζχει τα εξισ αντιδραςτιρια ςτισ αντίςτοιχεσ αναλογίεσ (KAPA BIOSYSTEMS): ΑΝΣΛΔΡΑΣΘΡΛΑ ΟΓΚΟ ςε Vτελ=10μl (μl) ΟΓΚΟ ςε Vτελ=20μl (μl) PCR-grade H2O 3,1 6,2 Νοθματικόσ εκκινθτισ 0,2 0,4 (forward) Αντινοθματικόσ εκκινθτισ 0,2 0,4 KAPA SYBR Fast qpcr 5 10 Master Mix (2x) Universal Template RNA

67 Δ. AΠΟΣΕΛΕΜΑΣΑ ΠΕΛΡΑΜΑΣΛΚΙ ΕΡΓΑΛΑ Δ1. χεδιαςμόσ πειραματικισ μεκοδολογίασ τα πλαίςια εξυπθρζτθςθσ των ςτόχων που ιδθ αναφζρκθκαν ςτθ ςχετικι ενότθτα «κοπόσ τθσ πειραματικισ εργαςίασ», ο κφριοσ άξονασ των πειραμάτων που ακολουκικθκε ιταν ο εξισ: Αρχικά, επιλζχκθκε θ κυτταρικι ςειρά K562 (passages <25) ωσ ζνα in vitro μοντζλο διαφοροποίθςθσ του αιμοποιθτικοφ ςυςτιματοσ, κακϊσ τα κφτταρα αυτά ζχουν τθν ικανότθτα να ωριμάηουν αναπτυξιακά και να παράγουν αιμοςφαιρίνθ μετά τθν προςκικθ χθμικϊν επαγωγζων τθσ διαφοροποίθςθσ. Ζτςι, πραγματοποιικθκαν κατά ςειρά τα παρακάτω: I. Χρονοεξαρτϊμενα πειράματα με διαφορετικοφσ επαγωγείσ διαφοροποίθςθσ και ςυγκεκριμζνα HMBA, αιμίνθ (Heme) και Βουτυρικό Νάτριο (NaBut) ςε κατάλλθλεσ ςυγκεντρϊςεισ για επαγωγι τθσ διαφοροποίθςθσ. II. Αξιολόγθςθ των παρατθροφμενων διαφορϊν ςτθ μορφολογία με λιψθ εικόνων και μικροςκοπικι παρατιρθςθ μετά τθν επϊαςθ των κυττάρων με τισ ενϊςεισ-επαγωγείσ ςτισ 24 και 72 ϊρεσ επϊαςθσ. III. Αξιολόγθςθ επιρροισ ενϊςεων-επαγωγζων ςε τρεισ (3) βαςικζσ παραμζτρουσ: κυτταρικι ανάπτυξθ, κάνατοσ και διαφοροποίθςθ ςτισ 24 και 72 ϊρεσ επϊαςθσ. IV. Απομόνωςθ ολικοφ RNA ςτισ 24 και 72 ϊρεσ επϊαςθσ. V. φνκεςθ cdna εκμαγείου για mirs, αλλά και για mrna για κάκε δείγμα. VI. qpcr για ποςοτικοποίθςθ ζκφραςθσ ςτόχων (mirs, γονιδίων) Να ςθμειωκεί πωσ απομονϊκθκε δείγμα ολικοφ RNA καλλιζργειασ κυττάρων K562 48h χωρίσ τθν προςκικθ επαγωγζα, προκειμζνου να υπάρχει δείγμα ςε εκκετικι φάςθ για χριςθ ωσ control ςτθν πορεία διερεφνθςθσ με qpcr. Δ.2. Επιλογι mirnas και γονιδίων για τον πειραματικό ζλεγχο τθσ ζκφραςισ τουσ ςτα K562 κφτταρα Θ επιλογι των mirs των οποίων θ ζκφραςθ ελζγχκθκε ςτθν παροφςα εργαςία ςτθρίηεται ςε προθγοφμενθ ζρευνα του εργαςτθρίου Φαρμακολογίασ και τθσ ερευνθτικισ ομάδασ του κυρίου Λωάννθ Βιηιριανάκθ, αναπλθρωτι κακθγθτι Μοριακισ Φαρμακολογίασ και Φαρμακογονιδιωματικισ. Σα γονίδια που επιλζχκθκαν κατζχουν γνωςτό κομβικό ρόλο ςτον κυτταρικό κφκλο και τθ διαφοροποίθςθ. Επιπλζον, τα γονίδια των ριβοςωμικϊν πρωτεϊνϊν αποτελοφν κφριο πυρινα τθσ παροφςασ εργαςίασ. τον Πίνακα 3 που ακολουκεί παρατίκενται τα τρία(3) mirs και τα δεκαεννζα(19) γονίδια που ελζγχκθκαν μοριακά μζςω τθσ qpcr, θ κωδικι ονομαςία τουσ, το μζγεκοσ του προϊόντοσ που προκφπτει και θ αλλθλουχία των εκκινθτϊν (νοθματικϊν και μθ νοθματικϊν). Οριςμζνοι εκκινθτζσ ςχεδιάςτθκαν για τθν παροφςα εργαςία, ενϊ άλλοι είχαν ιδθ ςχεδιαςτεί ςε προθγοφμενθ διπλωματικι και προχπιρχαν ςτο εργαςτιριο. Να ςθμειωκεί ότι για τα mirnas χρθςιμοποιείται ζνα κοινόσ εκκινθτισ (Universal Primer) ωσ reverse και διαφζρουν μόνο οι forward εκκινθτισ. Αυτό ςυμβαίνει διότι, κατά τθ διάρκεια τθσ qpcr το ζνηυμο τθσ 67

68 αντίςτροφθσ μεταγραφάςθσ προςκζτει ςτο τζλοσ κάκε mirna μια περιοχι περίπου 60 νουκλεοτιδίων, πανομοιότυπθ για όλα τα mirs, προκειμζνου να υπάρχει επαρκισ γονιδιακόσ χϊροσ ϊςτε να προςδεκοφν δφο primers. Λόγω κοινισ λοιπόν «ετικζτασ» που προςτίκεται ςε όλα τα mirs χρθςιμοποιείται κοινόσ εκκινθτισ (universal primer) ωσ reverse primer, ενϊ ο forward είναι ειδικόσ για κάκε mir προκειμζνου να υπάρχει εκλεκτικότθτα (miscript PCR System Handbook 10/2011). ΠΛΝΑΚΑ 3 Αλλθλουχίεσ εκκινθτϊν που χρθςιμοποιικθκαν για τισ αναλφςεισ με qpcr. ΚΩΔΛΚΟ ΕΡΓΑΣΘΡΛΟΤ mirna / Γονίδιο Αλλθλουχία Μζγεκοσ προϊόντοσ VIZM14 Universal GAATCGAGCACCAGTTACGC Primer (Qiagen) VIZM15 U6 CGCAAGGATGACACGCAATTC VIZM2 mir-129-5p CGGTCTGGGCTTGCAAA VIZM8 mir-663a CCGCGGGACCGCAAAAAA VIZM7 mir p GAGGCTGGGAGGGGAAAA VIZ039 b-actin hmf 5'-TTGCTGACAGGATGCAGAAG-3' 147 bp VIZ040 b-actin hmr 5'-TGATCCACATCTGCTGGAAG-3' VIZ001 hcmyc RT F 5'- AGGAGAATGTCAAGAGGCGA -3' 119 bp VIZ002 hcmyc RT R 5'- GGCCTTTTCATTGTTTTCCA -3' VIZ003 hcasp8 RT F 5'- GATGACATGAACCTGCTGGA-3' 111 bp VIZ004 hcasp8 RT R 5'- CAGGCTCTTGTTGATTTGGG -3' VIZ005 hcycld1 RT F 5'- CTGCGAAGTGGAAACCATC -3' VIZ006 hcycld1 RT R 5'- TTGAAGTAGGACACCGAGGG -3' VIZ007 hcdk6 RT F 5'- TGCACAGTGTCACGAACAGA -3' 150 bp VIZ008 hcdk6 RT R 5 -ACCTCGGAGAAGCTGAAACA-3 VIZ009 hcdk2 RT F 5'-TTGTCAAGCTGCTGGATGTC bp VIZ010 hcdk2 RT R 5'- TGATGAGGGGAAGAGGAATG -3' VIZ011 hcdk4 RT F 5-ACCAGATGGCACTTACACCC bp VIZ012 hcdk4 RT R 5'- CCACAGAAGAGAGGCTTTCG -3' VIZ013 hcasp3 RT F 5'-GGTTCATCCAGTCGCTTTGT -3' 100 bp VIZ014 hcasp3 RT R 5'- AATTCTGTTGCCACCTTTCG -3' VIZ017 hcasp9 RT F 5'-TCGAAGCCAACCCTAGAAAA-3' 110 bp VIZ018 hcasp9 RT R 5'- CCTCCAGAACCAATGTCCAC-3' VIZ029 p53 F 5'- CCTTCCCAGAAAACCTACCAG-3' 230 bp VIZ030 p53 R 5'- CCTCACAACCTCCGTCATG-3' VIZ019 hp21 RT F 5'- GAGCGATGGAACTTCGACTT -3' 101 bp VIZ020 hp21 RT R 5'-GTGGGAAGGTAGAGCTTGGG -3' VIZ023 hbax RT F 5'-TCTGACGGCAACTTCAACTG -3' 132 bp VIZ024 hbax RT R 5'-GAGGAAGTCCAATGTCCAGC -3' VIZ021 hbcl2 RT F 5'-ACTTCGCCGAGATGTCCA -3' 123 bp VIZ022 hbcl2 RT R 5'-CAAAGAAGGCCACAATCCTC -3' 68

69 ΠΛΝΑΚΑ 3 (ςυνζχεια) VIZ89 F RPS19 F GCCTGGAGTTACTGTAAAAGACG 238 bp VIZ89 R RPS19 R CCCATAGATCTTGGTCATGGAGC VIZ90 F RPS14 F CCATGTCACTGATCTTTCTGG 195 bp VIZ90 R RPS14 R GTCTTGGTCCTATTTCCTCCTG VIZ93 F RPL10 F CGCCAGAAGATCCACATCTC 233 bp VIZ93 R RPL10 R CAAAGACATAGGTGGACAGGA VIZ94 F RPL35a CTATGTCTGGAAGGCTGTGG 178 bp VIZ94 R RPL35a GTGACTGTGTTGTTCTTTGCT VIZ95 F RPL5 F GGTGTGAAGGTTGGCCTGAC 165 bp VIZ05 R RPL5 R GGCACCTGGCTGACCATCAA VIZ80 F GADPH F ACGGATTTGGTCGTATTGGGCG 212 bp VIZ80 R GADPH R CTCCTGGAAGATGGTGATGG HBG1 F CGCCATGGGTCATTTCACAG 231 bp HBG1 R GTGGCATCTCCCAAGGAAGT HBA1 F GTCAACTTCAAGCTCCTAAGCC 141 bp HBA1 R GCTTAACGGTATTTGGAGGTCAG Θ παρουςίαςθ των αποτελεςμάτων επιλζχκθκε να αποτυπωκεί ανά επαγωγζα ζτςι ϊςτε να υπάρχει ςυνολικι εκτίμθςθ τθσ φαρμακολογικισ δράςθσ τουσ ςτα K462 για τα υπό μελζτθ γονίδια και mirs. 69

70 Δ.3. Επαγωγι τθσ διαφοροποίθςθσ των Κ562 κυττάρων με HMBA. Δ.3.1. Φαινοτυπικι αξιολόγθςθ των κυττάρων K562 μετά τθν επώαςι τουσ με HMBA. Σα κφτταρα, με αρχικζσ ςυγκεντρϊςεισ 10⁵ κφτταρα/ml, επωάςτθκαν με 5mM HMBA. τθ ςυνζχεια, ακολοφκθςε μικροςκοπικι παρατιρθςθ των κυττάρων 24 και 72 ϊρεσ αργότερα, προκειμζνου να αξιολογθκοφν οι φαινοτυπικζσ αλλαγζσ που παρατθροφνται ςε αυτά. Ακολουκεί θ παρουςίαςθ των εικόνων που λιφκθςαν κατά τθν πειραματικι διαδικαςία κακϊσ και τα αποτελζςματα αξιολόγθςθσ του φαινοτφπου και τθσ κυτταρικισ μορφολογίασ. Όπωσ προαναφζρκθκε, παρουςία HMBA τα κφτταρα K562 διαφοροποιοφνται ακολουκϊντασ είτε το μονοπάτι τθσ μεγακαρυοποίθςθσ είτε τθσ ερυκροποίθςθσ. Ενδεικτικά, θ μικροςκοπικι παρατιρθςθ κατά τθ μζτρθςθ με τθ μζκοδο βενηιδίνθσ παρουςιάηεται ςτθν παρακάτω εικόνα. Εικόνα 15. Μικροςκοπικι παρατιρθςθ κυττάρων Κ562 μετά από τθ χρώςθ με τθ μζκοδο βενηιδίνθσ. *Λιψεισ παροφςασ πειραματικισ εργαςίασ+ Αρχικά, όςον αφορά τον πλθκυςμό των κυττάρων, είναι εμφανισ θ μείωςθ του ρυκμοφ ανάπτυξισ τουσ ςτισ αρχικζσ ϊρεσ τθσ επϊαςθσ, που όμωσ μετά τισ 72 ϊρεσ ο αρικμόσ τουσ πλθςιάηει αυτόν τθσ καλλιζργειασ αναφοράσ (Εικόνα 17). Από μορφολογικι άποψθ (Εικόνα 16) θ μεμβράνθ των κυττάρων που επωάςτθκαν με HMBA είναι εμφανϊσ παραμορφωμζνθ και αρκετά πιο τραχιά ςυγκριτικά με τα κφτταρα ελζγχου (control). Άλλθ μια βαςικι παρατιρθςθ είναι πωσ ο πυρινασ των Κ562 που επωάςτθκαν με HMBA είναι πλζον πιο ςυμπαγισ. 70

71 Εικόνα 16. Φαινοτυπική απεικόνιςη Κ562 κυττάρων απουςία (A. 24h, Γ. 72h) και παρουςία (Β. 24h, Δ. 72h) επαγωγζα διαφοροποίηςησ HMBA 5mM. Παρουςία HMBA τα κφτταρα είναι λιγότερα ςε αρικμό, εμφανϊσ παραμορφωμζνα, με τραχιά κυτταρικι μεμβράνθ και με πιο πυκνό πυρινα. Δ.3.2. Πειραματικά δεδομζνα ανάπτυξθσ και διαφοροποίθςθσ των Κ562 κυττάρων παρουςία HMBA Σθν επϊαςθ των κυττάρων K562 με HMBA ακολοφκθςαν μετριςεισ κυτταρικισ ανάπτυξθσ και κανάτου ςτισ 24 και 72 ϊρεσ κάκε δείγματοσ. Με επεξεργαςία των τιμϊν που ελιφκθςαν και μετά από υπολογιςμό του μζςου όρου των τριπλϊν μετριςεων που ζγιναν προζκυψαν τα διαγράμματα που παρουςιάηονται ςτθ ςυνζχεια. Όπωσ είναι γνωςτό, θ προςκικθ του χθμικοφ επαγωγζα τθσ διαφοροποίθςθσ ςτισ καλλιζργειεσ ςυμβάλλει ςτθ μείωςθ του αναπαραγωγικοφ δυναμικοφ των κυττάρων, κακϊσ προκαλεί τθ δζςμευςι τουσ για διαφοροποίθςθ. Θ ανάπτυξθ των κυττάρων (Εικόνα 17) φαίνεται να κακυςτερεί παρουςία του επαγωγζα HMBA, χωρίσ ωςτόςο μεγάλθ αναςτολι. Όςον αφορά το ποςοςτό κανάτου ςτθν καλλιζργεια των κυττάρων, είναι επίςθσ ελαφρά αυξθμζνο ςτο επίπεδο του 6%. τθν εικόνα 17 παρουςιάηεται το ποςοςτό των κυττάρων που 71

72 ζδωςαν κετικό αποτζλεςμα κατά τθ δοκιμαςία χρϊςθσ με trypan blue (νεκρά κφτταρα), όπωσ αυτι περιγράφθκε ςτθν παράγραφο Γ.2.3. Θ διαφοροποίθςθ που προκαλεί το HMBA, όπωσ είναι γνωςτό από τθ βιβλιογραφία, ξεκινά από το πρϊτο 24ϊρο. Σο ποςοςτό των κυττάρων που βάφτθκαν με βενηιδίνθ-h 2 O 2 κατά τθν αντίςτοιχθ δοκιμαςία ζφταςε κοντά ςτο 12% μετά από 72 ϊρεσ επϊαςθσ(εικόνα 18). Παράλλθλα, θ ζκφραςθ των γονιδίων των ςφαιρινϊν α και γ αυξάνεται ςθμαντικά μετά το πρϊτο 24 ϊρεσ επϊαςθσ με HMBA. υγκριτικά το επίπεδο mrna τθσ γ-ςφαιρίνθσ αυξάνεται περιςςότερο (Εικόνα18Β). Όμωσ τα επίπεδα αυτά φαίνεται να μειϊνονται δραματικά ςτισ 72 ϊρεσ, παρά τθν αρχικι τουσ άνοδο, ςφμφωνα με τα αποτελζςματα τθσ qpcr που διενεργικθκε (Εικόνα 18). Εικόνα 17. Αξιολόγηςη επίδραςησ HMBA ςτα κφτταρα K562. Παρουςιάηονται γραφικά θ ανάπτυξθ των κυττάρων K562 παρουςία του επαγωγζα HMBA ςτα αριςτερά (A) και το ποςοςτό κανάτου των κυττάρων, όπωσ προζκυψε από τθ δοκιμαςία χρϊςθσ με trypan blue, ςτα δεξιά τθσ εικόνασ (B). 72

73 Εικόνα 18. Αξιολόγηςη επίδραςησ HMBA ωσ διαφοροποιητήσ ςτα κφτταρα K562. Το ποςοςτό των κυττάρων που βάφονται με βενηιδίνθ-h 2 O 2, όπωσ καταμετρικθκε, παρουςιάηεται γραφικά ςτο αριςτερό μζροσ τθσ εικόνασ(α), ενϊ ςτο δεξί(β) αποτυπϊνονται τα αποτελζςματα τθσ ανάλυςθσ qpcr για τα γονίδια ςφαιρινϊν α και γ κυττάρων K562 που επωάςτθκαν με 5mM HMBA. Δ.3.3. Απομόνωςθ RNA και ζλεγχοσ ζκφραςθσ των υπό μελζτθ mirs ςτα Κ562 που επωάςτθκαν με HMBA τθ ςυνζχεια ζγινε ςυγκριτικόσ ζλεγχοσ των επιπζδων ζκφραςθσ των mirnas ςε ςχζςθ με το μοριακό προφίλ των αλλαγϊν που παρατθρικθκαν μετά από χρονοεξαρτϊμενθ επϊαςθ με τον επαγωγζα, όπωσ ταυτοποιικθκε μζςω τθσ μεκόδου qpcr. Σα αποτελζςματα που παρουςιάηονται ςτθ ςυνζχεια προζκυψαν μετά από δφο βιολογικά διπλά ανεξάρτθτα πειράματα όπου πραγματοποιικθκαν τριπλζσ ανεξάρτθτεσ μετριςεισ ανά mirna ανά πείραμα (+/-SD) και ερμθνεφτθκαν βάςθ τθσ ςυγκριτικισ ανάλυςθσ με βάςθ τθν ζκφραςθ του U6 («μεκόδου ςφγκριςθσ του Ct- ΔΔCt Comparative Ct method»). τισ qpcr που πραγματοποιικθκαν το U6 επιλζχκθκε ωσ mirna αναφοράσ (house-keeping), κακϊσ θ ζκφραςι του παραμζνει ςχετικά ςτακερι για αρκετό χρόνο κατά τθ διάρκεια τθσ διαφοροποίθςθσ των κυττάρων και επιτρζπει και τθν περαιτζρω εκτίμθςθ τθσ ποςοτικοποίθςθσ των δειγμάτων mirna ςτα πειράματα RT-PCR. 73

74 Δ Δ C t 1.5 C O N T R O L K H M B A 2 4 h K H M B A 7 2 h m ir p m ir a m ir p Εικόνα 19. Ανάλυςη qpcr mirs κυττάρων K562 που επωάςτηκαν με HMBA 5Mm. Παρουςία του διαφοροποιθτι HMBA (5mM) όλα τα mirs που εξετάςτθκαν παρουςιάηουν εμφανι μείωςθ από το πρϊτο 24ϊρο (Εικόνα 19). Μποροφν να κατθγοριοποιθκοφν ςε δφο ομάδεσ: θ πρϊτθ με τα mir-129-5p και mir-663a, τα οποία μειϊνονται εξ αρχισ ςτο 50% τθσ ζκφραςισ τουσ και θ δεφτερθ με το mir p, το οποίο εμφανίηει μεν μειωμζνθ ζκφραςθ, που κινείται όμωσ ςε υψθλότερα επίπεδα. Δ.3.4. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων του κυτταρικοφ κφκλου ςτα Κ562 που επωάςτθκαν με HMBA Όπωσ προαναφζρκθκε, εκτόσ από τον ζλεγχο ζκφραςθσ των mirnas ελζχκθςαν και ςυγκεκριμζνα γονίδια του κυτταρικοφ κφκλου αλλά και των ριβοςωμικϊν πρωτεϊνϊν. Πραγματοποιικθκε ςυγκριτικόσ ζλεγχοσ των επιπζδων ζκφραςθσ γονιδίων, τα οποία, ςχετίηονται με τθν ικανότθτα των κυττάρων να παίρνουν αποφάςεισ για κυτταρικι ανάπτυξθ και διαφοροποίθςθ και το μοριακό προφίλ των αλλαγϊν που παρατθρικθκε μετά από χρονοεξαρτϊμενθ επϊαςθ με τισ ενϊςεισ επαγωγείσ ταυτοποιικθκε μζςω τθσ qpcr μεκόδου. Σα αποτελζςματα που παρουςιάηονται ςτθ ςυνζχεια προζκυψαν μετά από δφο βιολογικά διπλά ανεξάρτθτα πειράματα όπου πραγματοποιικθκαν τριπλζσ ανεξάρτθτεσ μετριςεισ ανά γονίδιο ανά πείραμα (+/-SD) και ερμθνεφτθκαν βάςθ τθσ «μεκόδου ςφγκριςθσ του Ct- AACt Comparative Ct method» ωσ προσ το ιδιοςτατικό γονίδιο (housekeeping gene) τθσ β-ακτίνθσ. Να ςθμειωκεί ότι ςτο δεφτερο βιολογικό 74

75 Δ Δ C t πείραμα (επαναλθπτικό) ελζχκθςαν εκείνα τα γονίδια που ζδειχναν μεγαλφτερθ μεταβολι, αλλά και με επιλεκτικότθτα ωσ προσ τθ ςθμαντικότθτά τουσ. τισ qpcr που πραγματοποιικθκαν το γονίδιο τθσ β-ακτίνθσ επιλζχκθκε ωσ γονίδιο αναφοράσ (house-keeping gene), κακϊσ θ ζκφραςθ του γονιδίου αυτοφ παραμζνει ςχετικά ςτακερι για αρκετό χρόνο κατά τθ διάρκεια τθσ διαφοροποίθςθσ των κυττάρων και επιτρζπει και τθν περαιτζρω εκτίμθςθ τθσ ποςοτικοποίθςθσ των δειγμάτων RNA ςτα πειράματα RT-PCR C O N T R O L 6 K H M B A 2 4 h K H M B A 7 2 h p 5 3 p 2 1 C M Y C C D K 2 C D K 4 C D K 6 C A S P 3 C A S P 8 C A S P 9 C C N D 1 B A X B C L 2 Εικόνα 20. Ανάλυςη qpcr γονιδίων κυτταρικοφ κφκλου και απόπτωςησ κυττάρων K562 που επωάςτηκαν με 5mM HMBA. Σα γονίδια των πρωτεϊνϊν p53, CASP9, CCND1 και CMYC εμφανίηουν χρονοεξαρτϊμενθ μείωςθ ζκφραςθσ, μετά από επϊαςθ με HMBA 5mM. Σα γονίδια των p21, CASP3 και CASP8 υπερεκφράηονται (με το p21 να εμφανίηει τθ μεγαλφτερθ αφξθςθ, ανεξάρτθτθ του p53) εξ αρχισ, όπωσ και ςτισ 72h. Οι CDK2 και CDK4 δεν επθρεάηονται ςτο πρϊτο 24ϊρο, μειϊνονται όμωσ ζντονα ςτθ ςυνζχεια. Θ ζκφραςθ τθσ CDK6 εμφανίηει εξ αρχισ μείωςθ, θ οποία διατθρείται ςχετικά ςτακερι. Σα γονίδια BAX και BCL2 διατθροφνται ςε ςχετικά ςτακερά επίπεδα. 75

76 Δ Δ C t Δ.3.5. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων των ριβοςωμικών πρωτεϊνών ςτα Κ562 που επωάςτθκαν με HMBA. Όςον αφορά τα γονίδια των ριβοςωμικϊν πρωτεϊνϊν, ζχουμε μια διφαςικι ιδιαίτερθ αλλαγι ςτθν ζκφραςι τουσ, ςυγκριτικά με τα MEL κφτταρα, όπου εξ αρχισ παρατθρείται μείωςθ των RPs (Amanatiadou et al., 2015). τα Κ562 παρατθρείται αρχικι αφξθςθ των ριβοςωμικϊν γονιδίων που ελζχκθςαν, με εξαίρεςθ το RPS19, παρουςία διαφοροποιθτι HMBA 5mM. Αυτό πικανϊσ οφείλεται ςτο γεγονόσ πωσ τα κφτταρα χρειάηονται χρόνο μζχρι να αποφαςίςουν εάν κα δεςμευκοφν για να διαφοροποιθκοφν. Επίςθσ, πρζπει να λθφκεί υπόψθ πωσ το HMBA προκαλεί και μεγακαρυοκυτταρικι διαφοροποίθςθ, επομζνωσ θ διττοφ τφπου επαγωγι ςχετίηεται με διαφορετικζσ κυτταρικζσ αποφάςεισ που πρζπει να λθφκοφν. τθ ςυνζχεια (72h) είναι εμφανισ θ μείωςθ όλων των ριβοςωμικϊν πρωτεϊνϊν, όπωσ και αναμζνεται λόγω επαγωγισ τθσ διαφοροποίθςθσ. Θ RPS19, θ οποία ςυνδζεται άμεςα με το ςφνδρομο Blackfan Diamond Anemia, εμφανίηει μείωςθ εξ αρχισ, με το μεγαλφτερο μάλιςτα ποςοςτό μειωμζνθσ ζκφραςθσ (~75%). 2.5 C O N T R O L K H M B A 2 4 h K H M B A 7 2 h R P S 1 9 R P S 1 4 R P L 3 5 a R P L 5 R P L 1 0 Εικόνα 21. Ανάλυςη qpcr ζκφραςησ ριβοςωμικϊν πρωτεϊνϊν κυττάρων K562 που επωάςτηκαν με 5mM HMBA. Δ.4. Επαγωγι τθσ διαφοροποίθςθσ των Κ562 κυττάρων με αιμίνθ Σα κφτταρα επωάςτθκαν με 30μΜ αιμίνθσ με αρχικζσ ςυγκεντρϊςεισ 2 * 10⁵ κφτταρα/ml. Θ αιμίνθ είναι ζνασ φυςικόσ ρυκμιςτισ τθσ ερυκροποίθςθσ και παρουςία τθσ, όπωσ προαναφζρκθκε, τα K562 κφτταρα παράγουν εμβρυϊκι 76

77 αιμοςφαιρίνθ ακολουκϊντασ το μονοπάτι τθσ ερυκροποίθςθσ (Rutherford et al., 1979), ενϊ αναμζνονται οι αντίςτοιχεσ μορφολογικζσ αλλαγζσ των κυττάρων. Δ.4.1. Φαινοτυπικι αξιολόγθςθ των κυττάρων K562 μετά τθν επώαςι τουσ με αιμίνθ το πρϊτο 24ϊρο θ κφρια διαφορά με τα κφτταρα τθσ καλλιζργειασ αναφοράσ είναι ο μειωμζνοσ αρικμόσ κυττάρων. τθν πορεία παρατθρείται αφξθςθ του μεγζκουσ των κυττάρων, εν αντικζςει με τθν παρουςία HMBA (πικανόν λόγω τοξικότθτασ), αλλά ο πυρινασ και πάλι είναι πιο ςυμπυκνωμζνοσ, προφανϊσ λόγω διαδικαςίασ ερυκροποίθςθσ. Εικόνα 22. Φαινοτυπική απεικόνιςη Κ562 κυττάρων απουςία (A. 24h, Γ. 72h) και παρουςία (Β. 24h, Δ. 72h) επαγωγζα διαφοροποίηςησ αιμίνη 30μM. Παρουςία αιμίνθσ 30μM τα κφτταρα μειϊνονται εμφανϊσ ςε αρικμό, ο πυρινασ τουσ εμφανίηεται και πάλι πιο ςυμπυκνωμζνοσ, όπωσ και με το HMBA, το μζγεκόσ τουσ αντικζτωσ αυξάνεται. 77

78 Δ.4.2. Πειραματικά δεδομζνα ανάπτυξθσ και διαφοροποίθςθσ των Κ562 κυττάρων παρουςία αιμίνθσ Θ ανάπτυξθ των κυττάρων παρουςία αιμίνθσ 30μM (Εικόνα 22) φαίνεται να αναςτζλλεται ςε μεγάλο βακμό, εν αντικζςει με τον επαγωγζα HMBA. Αυτό ιταν μάλιςτα εμφανζσ και ςτο μειωμζνο αρικμό κυττάρων ςτισ καλλιζργειεσ που επωάςτθκαν με επαγωγζα. Όςον αφορά το κάνατο των κυττάρων παρατθρείται απόπτωςθ εξαρτϊμενθ από τθ διαφοροποίθςθ, όπωσ είναι γνωςτό ότι ςυμβαίνει κατά τθ διάρκεια τθσ ερυκροποίθςθσ (Εικόνα 22). Μάλιςτα θ τοξικότθτα τθσ αιμίνθσ ςτα κφτταρα αυξάνεται ςθμαντικά όςο αυξάνονται και οι ϊρεσ επϊαςθσ. Όπωσ είναι γνωςτό από τθ βιβλιογραφία, θ αιμίνθ προκαλεί διαφοροποίθςθ, θ οποία δεν είναι τόςο εμφανισ από το πρϊτο 24ϊρο. Ωςτόςο θ χρϊςθ με βενηιδίνθ-h 2 O 2 δίνει αποτελζςματα (Εικόνα 23) με το ποςοςτό των κυττάρων που βάφονται να πλθςιάηει ςτο 40% ςτισ 72 ϊρεσ, το οποίο είναι και το μζγιςτο δυνατό. H ζκφραςθ των γονιδίων των ςφαιρινϊν α και γ φαίνεται αρκετά μειωμζνθ κατά το πρϊτο 24ωρο τθσ επϊαςθσ, ενϊ ςτισ 72 ϊρεσ εμφανϊσ αυξθμζνθ παρατθρείται θ αιμιςφαιρίνθ γ, ςφμφωνα με τα αποτελζςματα τθσ qpcr που διενεργικθκε (Εικόνα 24). Εικόνα 23. Αξιολόγηςη επίδραςησ Αιμίνησ ςτα κφτταρα K562. Παρουςιάηονται γραφικά θ ανάπτυξθ των κυττάρων K562 παρουςία του επαγωγζα αιμίνθ ςτα (Α) και το ποςοςτό κανάτωςθσ των κυττάρων, όπωσ προζκυψε από τθ δοκιμαςία χρϊςθσ με trypan blue, ςτα δεξιά τθσ εικόνασ (Β). 78

79 Εικόνα 24. Αξιολόγηςη τησ επίδραςησ τησ αιμίνησ ωσ επαγωγζα τησ διαφοροποίηςησ ςτα κφτταρα K562. Το ποςοςτό των κυττάρων που βάφονται κετικά με βενηιδίνθ, όπωσ μετρικθκε μικροςκοπικά με χρϊςθ, παρουςιάηεται γραφικά ςτο αριςτερό μζροσ τθσ εικόνασ(α), ενϊ ςτο δεξί(β) αποτυπϊνονται τα αποτελζςματα τθσ ανάλυςθσ qpcr για τα γονίδια ςφαιρινϊν α και γ, κυττάρων K562 που επωάςτθκαν με 30μM αιμίνθ. 79

80 Δ Δ C t Δ.4.3 Απομόνωςθ RNA και ζλεγχοσ ζκφραςθσ των υπό μελζτθ mirs ςτα Κ562 που επωάςτθκαν με αιμίνθ Με τον επαγωγζα αιμίνθ ςε ςυγκζντρωςθ 30μM, όλα τα mirs εμφανίηουν μειοφμενθ ζκφραςθ (Εικόνα 25). τα κφτταρα δθλαδι ιδθ μζςα ςτο πρϊτο 24ωρο επϊαςθσ θ ζκφραςθ όλων των mirnas που ελζχκθςαν μειϊνεται, δίχωσ να μποροφμε να διακρίνουμε τισ δφο ίδιεσ ομάδεσ που παρουςιάηονται κατά τθν επϊαςθ με τον προθγοφμενο επαγωγζα (HMBA). Περαιτζρω μείωςθ τθσ ζκφραςθσ καταγράφεται για το mir-129-5p και mir p. 1.5 C o n tro l H e m in 2 4 h H e m in 7 2 h m ir p m ir a m ir p Εικόνα 25. Ανάλυςη qpcr mirs κυττάρων K562 που επωάςτηκαν με αιμίνη 30μM. 80

81 Δ Δ C t Δ.4.4. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων του κυτταρικοφ κφκλου ςτα Κ562 που επωάςτθκαν με αιμίνθ Αντικζτωσ με το HMBA, θ αιμίνθ ωσ επαγωγζα τθσ διαφοροποίθςθσ επθρεάηει διαφορετικά οριςμζνα γονίδια του κυτταρικοφ κφκλου και τθσ απόπτωςθσ, όπωσ παρατθροφμε ςτο παρακάτω διάγραμμα. Σα γονίδια των πρωτεϊνϊν CDK2 και CMYC εμφανίηουν χρονοεξαρτϊμενθ μείωςθ ζκφραςθσ, με το πρϊτο να επθρεάηεται ελάχιςτα ςτο πρϊτο 24ωρο. Σα γονίδια των p53 και CASP3 υπερεκφράηονται εξ αρχισ, όπωσ και ςτισ 72h, ςε μικρότερο όμωσ ποςοςτό. Σα γονίδια των p21, CASP8 και CCND1 εμφανίηουν χρονοεξαρτϊμενθ αφξθςθ. Οι CDK4 και CDK6, κακϊσ και το BCL2 ςτο πρϊτο 24ϊρο αυξάνονται, ςτθ ςυνζχεια όμωσ μειϊνονται αιςκθτά. Σο γονίδιο τθσ CASP9 και BAX διατθροφνται ςε ςχετικά ςτακερά επίπεδα. 2 0 C o n tro l 1 5 H e m in 2 4 h H e m in 7 2 h p 5 3 p 2 1 C M Y C C D K 2 C D K 4 C D K 6 C A S P 3 C A S P 8 C A S P 9 C C N D 1 B A X B C L 2 Εικόνα 26. Ανάλυςη qpcr γονιδίων κυτταρικοφ κφκλου και απόπτωςησ κυττάρων K562 που επωάςτηκαν με 30μM αιμίνη. 81

82 Δ Δ C t Δ.4.5. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων των ριβοςωμικών πρωτεϊνών ςτα Κ562 που επωάςτθκαν με αιμίνθ Όςον αφορά το προφίλ ζκφραςθσ των ριβοςωμικϊν mrnas, παρατθρείται αρχικά αφξθςθ όλων παρουςία του διαφοροποιθτι αιμίνθ *30μΜ+, παρομοίωσ με τθν επίδραςθ του HMBA, αλλά ςτθ ςυνζχεια (72h) εμφανισ μείωςθ, με εξαίρεςθ τισ RPL5 και RPL10 (ριβοςωμικζσ που ςχετίηονται με τθ λευχαιμία), οι οποίεσ μειϊνονται μεν από τισ 24 ζωσ τισ 72 ϊρεσ, αλλά παραμζνουν ςε υψθλότερα επίπεδα ζκφραςθσ από το δείγμα αναφοράσ. Ωςτόςο, ςε αντίκεςθ με τθν παρουςία HMBA, θ ζκφραςθ κανενόσ γονιδίου δεν μειϊνεται ςε μεγάλο ποςοςτό. Επίςθσ, αξιοςθμείωτο είναι πωσ οι μεγαλφτερεσ μεταβολζσ απαντϊνται ςτισ RPL, δθλαδι ςτισ πρωτεΐνεσ τθσ μεγάλθσ υπομονάδασ, ενϊ θ μεγαλφτερθ μείωςθ ςτισ RPS (μικρι υπομονάδα) εμφανίηεται ςτισ 72h. 3 C o n tro l H e m in 2 4 h H e m in 7 2 h R P S 1 9 R P S 1 4 R P L 3 5 a R P L 5 R P L 1 0 Εικόνα 27. qpcr ανάλυςη τησ ζκφραςησ γονιδίων των ριβοςωμικϊν πρωτεϊνϊν ςε κφτταρα K562 που επωάςτηκαν με 30μM αιμίνη. 82

83 Δ.5. Επαγωγι τθσ διαφοροποίθςθσ των Κ562 κυττάρων με NaBut Δ.5.1. Φαινοτυπικι αξιολόγθςθ των κυττάρων K562 μετά τθν επώαςι τουσ με NaBut Όπωσ είναι εμφανζσ ςτισ εικόνεσ που ακολουκοφν (Εικόνα 28), παρατθρείται ςθμαντικι μείωςθ του αρικμοφ των κυττάρων μετά από επϊαςι τουσ με NaBut 1mM, κακϊσ επίςθσ είναι και πιο μεγάλα ςε μζγεκοσ- όπωσ ςυμβαίνει και παρουςία αιμίνθσ. Ο πυρινασ τουσ μπορεί να ειπωκεί πωσ παρομοιάηει με πυρινα πολυμορφοπφρθνων κυττάρων ςτισ 72 ϊρεσ. Εικόνα 28. Φαινοτυπική απεικόνιςη των Κ562 κυττάρων απουςία (A. 24h, Γ. 72h) και παρουςία (Β. 24h, Δ. 72h) επαγωγζα διαφοροποίηςησ 1mM NaBut. Παρουςία NaBut 1mM τα κφτταρα είναι λιγότερα ςε αρικμό, μεγαλφτερα ςε μζγεκοσ - όπωσ παρουςία 30μM αιμίνθσ, θ κυτταρικι τουσ μεμβράνθ δε δείχνει ιδιαίτερα παραμορφωμζνθ και ο πυρινασ ομοιάηει με τον αντίςτοιχο των πολυμορφοπφρθνων κυττάρων. 83

84 Δ.5.2. Πειραματικά δεδομζνα ανάπτυξθσ και διαφοροποίθςθσ των Κ562 κυττάρων παρουςία NaBut Θ ανάπτυξθ των κυττάρων (Εικόνα 29) φαίνεται να αναςτζλλεται ςε μεγάλο βακμό παρουςία του επαγωγζα NaBut με χρονοεξαρτϊμενο τρόπο. Όςον αφορά τον κυτταρικό κάνατο παρατθρείται μια πολφ μικρι αφξθςθ που όμωσ δεν ξεπερνά το ποςοςτό του 5% μετά από 72 ϊρεσ επϊαςθσ. Σο NaBut προκαλεί όπωσ ζχει προαναφερκεί διαφοροποίθςθ, με μζγιςτο ποςοςτό κυττάρων που χρωματίηονται με τθ μζκοδο βενηιδίνθσ-h 2 O 2 να βρίςκεται κοντά ςτο 30% όπωσ φαίνεται ςτθν εικόνα 30. Είναι ενδιαφζρον ότι ςτισ 72h επϊαςθσ τα επίπεδα τόςο τθσ αιμοςφαιρίνθσ γ όςο και α είναι πολφ υψθλότερα από εκείνα που παρατθρικθκαν μεταξφ των τριϊν επαγωγζων, όπωσ ζδειξε θ qpcr που διενεργικθκε (Εικόνα 30). Εικόνα 29. Αξιολόγηςη επίδραςησ NaBut ςτα κφτταρα K562. Η ανάπτυξθ των κυττάρων K562 παρουςία του επαγωγζα βουτυρικό νάτριο παρουςιάηεται ςτο αριςτερό μζροσ τθσ εικόνασ(α) και το ποςοςτό κανάτου των κυττάρων, όπωσ προζκυψε από τθ δοκιμαςία χρϊςθσ με trypan blue, ςτο δεξί διάγραμμα (Β). 84

85 Εικόνα 30. Αξιολόγηςη τησ επίδραςησ του NaBut (1mM) ωσ διαφοροποιητήσ ςτα κφτταρα K562. Το ποςοςτό των κυττάρων που βάφονται με βενηιδίνθ, όπωσ καταμετρικθκε και μικροςκοπικι απεικόνιςθ τθσ χρϊςθσ κατά τθ μζτρθςθ, παρουςιάηεται γραφικά ςτο αριςτερό μζροσ τθσ εικόνασ, ενϊ ςτο δεξί αποτυπϊνονται τα αποτελζςματα τθσ ανάλυςθσ qpcr για τα γονίδια ςφαιρινϊν α και γ κυττάρων K562 που επωάςτθκαν με 1mM βουτυρικό νάτριο. 85

86 Δ Δ C t Δ.5.3 Απομόνωςθ RNA και ζλεγχοσ ζκφραςθσ των υπό μελζτθ mirs ςτα Κ562 που επωάςτθκαν με NaBut Κατά τθν επϊαςθ με βουτυρικό νάτριο ςε ςυγκζντρωςθ 1mM το προφίλ ζκφραςθσ των υπό μελζτθ mirs, όπωσ παρατθροφμε ςτθν Εικόνα 31, δεν ομοιάηει με τα αντίςτοιχα κατά τθν επϊαςθ με τουσ προθγοφμενουσ διαφοροποιθτζσ (HMBA, αιμίνθ), εξαιρϊντασ μόνο τθν ζντονθ μείωςθ των mir-129-5p και mir p ςτο 50% ςτο πρϊτο 24ωρο. Αντικζτωσ λοιπόν με τθν παρουςία HMBA και αιμίνθσ, τα mirs που εξετάςτθκαν ςτθν παροφςα εργαςία φαίνονται να υπερεκφράηονται ςτισ 72 ϊρεσ επϊαςθσ με NaBut, παρά τθν αρχικι τουσ μείωςθ. Ακόμθ πιο διαφορετικι είναι θ ζκφραςθ του mir663 το οποίο είναι το μόνο που εμφανίηει αυξθμζνθ ζκφραςθ εξαρχισ. 2 5 C O N T R O L 2 0 N a B u t 2 4 h N a B u t 7 2 h m ir p m ir a m ir p Εικόνα 31. Ανάλυςη qpcr mirs κυττάρων K562 που επωάςτηκαν με NaBut 1mM. 86

87 Δ Δ C t Δ.5.4. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων του κυτταρικοφ κφκλου ςτα Κ562 που επωάςτθκαν με NaBut Κατά τθν επϊαςθ με βουτυρικό νάτριο, παρατθρείται μείωςθ κάτω του 0,5 ςτισ CDK2, CDK4, CDK6 και το BCL2 ςτισ 72 ϊρεσ, όπωσ και παρουςία αιμίνθσ. Σο ίδιο ίςχφει και για όλεσ τισ καςπάςεσ (CASP3, CAPS8, ιδίωσ CAPS9), εν αντικζςει με αυτό που βρζκθκε για τθν αιμίνθ και το HMBA, παρουςία των οποίων αυξάνονται. Ωςτόςο ςτο πρϊτο 24ωρο ζχουν τθν τάςθ να αυξθκοφν. Σο γονίδιο p21 υπερεκφράηεται ςε μεγάλο βακμό μετά τθν επϊαςθ με NaBut. Σα γονίδια p53 και CMYC ακολουκοφν παρόμοιο μοτίβο, αρχικισ αφξθςθσ ςτο πρϊτο 24ωρο και εναντίωσ μείωςθσ ςτισ 72 ϊρεσ, με το P53 να βρίςκεται κοντά ςτο control, ενϊ το CMYC να μειϊνεται περιςςότερο από 50%. Θ ζκφραςθ του p53 παρουςία βουτυρικοφ ομοιάηει με τθν ζκφραςι του παρουςία αιμίνθσ, ενϊ το CMYC ςυμπεριφζρεται όπωσ παρουςία HMBA. Θ κυκλίνθ D1 (CCND1) αυξάνεται κατά πολφ, ακόμθ περιςςότερο απϋότι παρουςία αιμίνθσ. τακερι παραμζνει θ ζκφραςθ τθσ BAX, όπωσ και παρουςία των άλλων δφο επαγωγζων τθσ διαφοροποίθςθσ. 1 5 C O N T R O L N a B u t 2 4 h N a B u t 7 2 h p 5 3 p 2 1 C M Y C C D K 2 C D K 4 C D K 6 C A S P 3 C A S P 8 C A S P 9 C C N D 1 B A X B C L 2 Εικόνα 32. Ανάλυςη qpcr γονιδίων κυτταρικοφ κφκλου και απόπτωςησ κυττάρων K562 που επωάςτηκαν με 1mM NaBut. 87

88 Δ Δ C t Δ.5.5. Ζλεγχοσ τθσ ζκφραςθσ γονιδίων των ριβοςωμικών πρωτεϊνών ςτα Κ562 που επωάςτθκαν με NaBut ε αντίκεςθ με τισ δυο προθγοφμενουσ ενϊςεισ, HMBA, αιμίνθ, τα K562 εμφανίηουν αυξθμζνα επίπεδα RPL35a και RPS14 ςτισ 72h, παρουςία NaBut 1mM. Σα επίπεδα RPS19 δε φαίνεται να επθρεάηονται από το ςυγκεκριμζνο επαγωγζα. Οι RPL5 και RPL10 αυξάνονται με το NaBut, περιςςότερο απ ότι με τθν αιμίνθ 30μM, ενϊ με το ΘΜΒΑ ςτισ 72ϊρεσ παρατθρικθκε μείωςθ τθσ ζκφραςισ τουσ. 3 C O N T R O L N a b u t 7 2 h R P S 1 9 R P S 1 4 R P L 3 5 a R P L 5 R P L 1 0 Εικόνα 33. Ανάλυςη qpcr ζκφραςησ γονιδίων ριβοςωμικϊν πρωτεϊνϊν κυττάρων K562 που επωάςτηκαν με 1mM NaBut για 72 ϊρεσ. 88

89 Ε. ΤΗΘΣΘΘ ΑΠΟΣΕΛΕΜΑΣΩΝ Θ γενετικι από μόνθ τθσ αδυνατεί να εξθγιςει το πϊσ αναπαράγονται κάποια κλθρονομοφμενα χαρακτθριςτικά των κυττάρων. Θ επιγενετικι ωσ επιςτιμθ μελετά τθν κλθρονομικι μεταβίβαςθ αυτϊν των αλλαγϊν ςτθ λειτουργία των γονιδίων που εμφανίηονται χωρίσ αλλαγι ςτθν αλλθλουχία του πυρθνικοφ DNA και τθ γονιδιακι ζκφραςθ εν ςυνόλω (R. Jaenisch and A. Bird, 2003). Θ επιγενετικι ρφκμιςθ τθσ μεταγραφισ των γονιδίων διαμεςολαβείται από εκλεκτικζσ, ενηυμικά καταλυόμενεσ, ομοιοπολικζσ τροποποιιςεισ ςυγκεκριμζνων νουκλεοτιδίων εντόσ των γονιδίων και από μετα-μεταφραςτικζσ τροποποιιςεισ των ιςτονϊν. Οι τροποποιιςεισ αυτζσ ευνοοφν τθ λιψθ διαμορφϊςεων χρωματίνθσ που επιτρζπουν ι αναςτζλλουν τθ μεταγραφι γονιδίων (Jenuwein and Allis, 2001) και είναι υπεφκυνεσ για τθν πακοφυςιολογικι ενεργοποίθςθ ι παρεμπόδιςθ λειτουργίασ ςθματοδοτικϊν μονοπατιϊν, ςυμβάλλοντασ ζτςι ςτθν ανάπτυξθ ι όχι του καρκίνου. Οι επιγενετικοί μθχανιςμοί διαδραματίηουν εμφανϊσ κακοριςτικό ρόλο ςτθ ρφκμιςθ τθσ γονιδιακισ ζκφραςθσ και αποτελοφν ενδιαφζροντεσ φαρμακευτικοφσ ςτόχουσ ανακάλυψθσ και ανάπτυξθσ φαρμάκων. Επιγενετικά φάρμακα εγκεκριμζνα από τον FDA αλλά και τον EMA κυκλοφοροφν τόςο ςτθν Αμερικι όςο και τθν Ευρϊπθ και υπογραμμίηουν το ρόλο των επιγενετικϊν ενηφμων ςε ανκρϊπινεσ αςκζνειεσ. Θ επιτυχισ δράςθ τουσ ωσ εκλεκτικά μικρά μόρια-αναςτολείσ ζναντι των αποακετυλαςϊν των ιςτονϊν (HDACs) και των μεκυλοτρανςφεραςϊν των ιςτονϊν κακϊσ και του DNA (DNMTs) ςτθ κεραπεία ςυγκεκριμζνων ανκρϊπινων καρκίνων ενκαρρφνει τθν επιςτθμονικι κοινότθτα για βακφτερθ κατανόθςθ και εκτενζςτερθ χριςθ τθσ επιγενετικισ ρφκμιςθσ και απορρφκμιςθσ ςε κεραπευτικζσ προςεγγίςεισ. Όπωσ προαναφζρκθκε ςτο ειςαγωγικό μζροσ, κφρια επιγενετικά ςτοιχεία, πζρα από τισ ακετυλιϊςεισ και τισ μεκυλιϊςεισ ιςτονϊν αλλά και DNA, αποτελοφν τα micrornas, θ ζκφραςθ των οποίων διαφζρει ανά διεργαςία ι / και ανά ιςτό. Ζτςι κατά τθ διαφοροποίθςθ ερυκρολευχαιμικϊν κυττάρων παρατθροφνται διαφορζσ, πζραν τθσ ζκφραςθσ γονιδίων, και των micrornas, οι οποίεσ ςχετίηονται με τισ αποφάςεισ που παίρνουν τα κφτταρα. Οι αποφάςεισ των κυττάρων μποροφν να ταξινομθκοφν και να αξιολογθκοφν ωσ ςχετιηόμενεσ με τθ διεργαςία τθσ διαφοροποίθςθσ (process specific) ι ωσ ςχετιηόμενεσ με τον επαγωγζα (inducer specific). ε αυτά τα πλαίςια, ςτθν παροφςα διπλωματικι εργαςία, αξιολογικθκαν micrornas εμπλεκόμενα ςε μοριακζσ διαδικαςίεσ τθσ διαφοροποίθςθσ ερυκρολευχαιμικϊν κυττάρων και ζγινε ςυςχζτιςθ των πλθροφοριϊν με ιδθ υπάρχουςεσ γνϊςεισ ςτθν εμπλοκι ριβοςωμικϊν πρωτεϊνϊν ς αυτι τθ διαδικαςία, κακϊσ απαιτείται άκρωσ ιςορροπθμζνθ παραγωγι και ζκφραςι τουσ για τθν τελικι διαφοροποίθςθ(amanatiadou et al., 2015). Σα αποτελζςματα πράγματι παρουςίαςαν ενδιαφζροντα ςτοιχεία που αναδεικνφουν μελλοντικζσ προοπτικζσ αξιοποίθςθσ mirnas ςτθν ζρευνα νζων αντικαρκινικϊν ςτόχων. Για τον κάκε επαγωγζα διαφοροποίθςθσ που χρθςιμοποιικθκε ζχουν ιδθ αναφερκεί τα χαρακτθριςτικά του και θ επίδραςθ που ζχει ςτα K562 κφτταρα. Οι τρεισ επαγωγείσ που χρθςιμοποιικθκαν ανικουν ςε διαφορετικι κατθγορία και ο τρόποσ που προκαλοφν επαγωγι επίςθσ διαφζρει (Tsiftsoglou et al., 2003b). Βαςικι διαφορά μεταξφ τουσ αποτελεί το γεγονόσ πωσ το ΘΜΒΑ, εκτόσ από ερυκροποίθςθ, δφναται να προκαλεί και μεγακαρυοποίθςθ(green et al., 1992). Επιπρόςκετα, κάκε 89

90 επαγωγζασ ωκεί τθν καλλιζργεια των K562 κυττάρων να διαφοροποιθκεί ςε διαφορετικά ποςοςτά, όπωσ προζκυψε από τθ διαφορετικι ζκφραςθ των γονιδίων των αιμοςφαιρινϊν α και γ, και προκαλεί αναςτολι τθσ ανάπτυξθσ τθσ καλλιζργειασ και κανάτωςθ των κυττάρων ςε εξίςου διαφορετικά ποςοςτά. Επίςθσ, καταγράφονται ςθμαντικζσ μορφολογικζσ διαφορζσ των κυττάρων που αφοροφν τισ αποφάςεισ τουσ για διαφοροποίθςθ, αναλόγωσ του επαγωγζα που χρθςιμοποιείται. Οι ςυγκεκριμζνεσ μεταβολζσ ςυνοδεφονται από τροποποιιςεισ γονιδιακισ ζκφραςθσ, όπωσ παρατθρικθκε. Αξίηει να αναφερκεί πωσ, βάςει των αποτελεςμάτων τθσ ερευνθτικισ δουλειάσ του εργαςτθρίου Φαρμακολογίασ του τμιματοσ Φαρμακευτικισ, μζςω βιοπλθροφορικισ ανάλυςθσ δεδομζνων Κ562 κυττάρων διά τθσ οδοφ RNA-Seq προζκυψε ουςιαςτικι διακφμανςθ ςτα προφίλ ζκφραςθσ των γονιδίων που εμπλζκονται ςτθ ρφκμιςθ του κυτταρικοφ κφκλου (Akrivou et al., 2018). Αξιοςθμείωτο ςτοιχείο αποτζλεςε θ διαφορετικι μορφολογία των κυττάρων ςτισ 72 ϊρεσ παρουςία ΘΜΒΑ ςε ςχζςθ με τθ μορφολογία των κυττάρων που επωάςτθκαν με άλλουσ επαγωγείσ, θ οποία φαίνεται να δικαιολογείται από το γεγονόσ ότι θ πλειοψθφία των κυττάρων ςτράφθκε προσ μεγακαρυοποίθςθ, όπωσ προκφπτει από τισ χαμθλζσ τιμζσ των γονιδίων των αιμοςφαιρινϊν (Εικόνα 18) (Hong Y. et al., 1996). Ωςτόςο, εντόσ του πρϊτου 24ϊρου τα κφτταρα χρειάηονται κάποιο χρόνο προςαρμογισ και λιψθσ αποφάςεων, οπότε και παρατθρείται αφξθςθ των α και γ αιμοςφαιρινϊν, όπωσ ςυμβαίνει και ςτα MEL που επωάηονται με HMBA (Campbell et al., 1990). Θ διαφοροποίθςθ των λευχαιμικϊν κυττάρων Κ562 που ακολουκεί το μονοπάτι τθσ μεγακαρυοποίθςθσ ςυνοδεφεται από χαρακτθριςτικζσ μεταβολζσ ςτθν κυτταρικι μορφολογία, τθν κυτταρικι προςκόλλθςθ, τθ διακοπι του κυτταρικοφ κφκλου και τθν ζκφραςθ των ειδικϊν βιοδεικτϊν των μεγακαρυοκυττάρων, όπωσ ο αυξθτικόσ παράγοντασ που προζρχεται από αιμοπετάλια(pdgf) και τισ ιντεγκρίνεσ αλλβ3 (CD41 / CD61) και α2β1 (CD49b) (Alitalo R., 1990). Θ εμφάνιςθ διαφορετικϊν προφίλ ζκφραςθσ γονιδίων παρουςία αυτοφ του επαγωγζα ςυγκριτικά με τουσ άλλουσ δφο, πικανότατα οφείλεται ςτο ότι τα κφτταρα ακολουκοφν ζνα διαφορετικό μονοπάτι διαφοροποίθςθσ. υγκεκριμζνα, βρζκθκε πωσ ογκοκαταςταλτικά γονίδια όπωσ το p53 και το CMYC αναςτζλλονται κατά τθ διαδικαςία ςτθν οποία παραπζμπει τα κφτταρα το HMBA, ενϊ αντικζτωσ οδθγεί ςε ςθμαντικι αφξθςθ, ανεξάρτθτθ του p53, τθν ζκφραςθ του γονιδίου p21, βαςικό ρυκμιςτι του κυτταρικοφ κφκλου και αναςτολζα CDKs. Θ λειτουργία του γονιδίου p21 εντοπίηεται ςτθν αναςτολι των CDK2 και CDK4 μζςα από τθν αναςτολι τθσ απόπτωςθσ (Abbas et al., 2009, He et al., 2005, Macleod et al., 1995), γεγονόσ που υποςτθρίηουν τα παρόντα ευρφματα μειωμζνθσ ζκφραςθσ των κυκλινϊν 2 και 4. Επίςθσ, από τθν παροφςα ανάλυςθ qpcr προζκυψε προσ τα κάτω ρφκμιςθ και τθσ CDK6, ςυμφωνϊντασ με δεδομζνα που λαμβάνουν χϊρα κατά τθ μεγακαρυοποίθςθ(navarro et al., 2009). Σα παραπάνω ευριματα υποδθλϊνουν ςυντονιςμζνθ λειτουργία προσ διακοπι του κυτταρικοφ κφκλου. Θ αυξθτικι ρφκμιςθ τθσ ζκφραςθσ του p21 επάγεται ςε πολυάρικμα κφτταρα με παράγοντεσ διαφοροποίθςθσ, ςυμπεριλαμβανομζνου του ρετινοϊκοφ οξζοσ (Liu et al., 1996), ςτεροειδϊν ορμονϊν (Rogatsky et al., 1997, Cha et al., 1998) και του επιδερμικοφ αυξθτικοφ παράγοντα(egf) (Chin et al., 1996) και IL-6 (Morse et al., 1997). 90

91 Σαυτόχρονα, θ επϊαςθ των Κ562 με ΘΜΒΑ δεν ζδειξε να επθρεάηει τα επίπεδα ζκφραςθσ των γονιδίων τθσ καςπάςθσ 9, που πικανόν υποδεικνφει τθ μθ ενεργοποίθςθ του ενδογενοφσ μονοπατιοφ του προγραμματιςμζνου κυτταρικοφ κανάτου (απόπτωςθσ), παρά τθ μικρι τάςθ τθσ ζκφραςθσ του προαποπτωτικοφ BAX για αφξθςθ. Παρατθρικθκε επίςθσ πωσ οφτε θ ζκφραςθ του αντιαποπτωτικοφ Bcl-2 επθρεάηεται. Σα παραπάνω ςυμφωνοφν με το μικρό ποςοςτό κανάτου των κυττάρων ςτθν καλλιζργεια παρουςία HMBA. Όςον αφορά τθν προςπάκεια ςυγκριτικισ ςυςχζτιςθσ των micrornas με τθν ζκφραςθ γονιδίων των ριβοςωμικϊν πρωτεϊνϊν, παρατθρείται μείωςθ τθσ ζκφραςθσ των micrornas και των γονιδίων των ριβοςωμικϊν πρωτεϊνϊν, εντονότερθ για τισ πρωτεΐνεσ τθσ μικρισ υπομονάδασ, παρά τθν αρχικι αφξθςθ τθσ ζκφραςθσ των γονιδίων των ριβοςωμικϊν πρωτεϊνϊν ςτο πρϊτο 24ωρο επϊαςθσ. Σο γεγονόσ αυτό, υποδθλϊνει ότι υπάρχει πικανι ςφνδεςθ τθσ ζκφραςθσ των γονιδίων των ριβοςωμικϊν πρωτεϊνϊν ανάλογθ με τα επίπεδα των mir-129-5p, mir-663-a και mir1207-5p ςτα K562 κφτταρα αφότου πάρουν τθν απόφαςθ και ςτραφοφν προσ τθ μεγακαρυοποίθςθ. Αντικζτωσ, ςε καλλιζργειεσ MEL κυττάρων, όπου το HMBA προκαλεί ερυκροποίθςθ, οι ριβοςωμικζσ πρωτεΐνεσ μειϊνονται από το πρϊτο 24ωρο, κακϊσ ιδθ από τισ 12 ϊρεσ ζκκεςθσ τα MEL δεςμεφονται προσ ερυκροποίθςθ (Amanatiadou et al., 2015). Πειραματικζσ μελζτεσ που ζχουν πραγματοποιθκεί ζωσ τϊρα περιλάμβαναν ωσ επί το πλείςτον τθν αιμίνθ ωσ επαγωγζα τθσ ερυκροποίθςθσ ςτα κφτταρα K562. Πρόκειται για ζνα εξαιρετικά ευπροςάρμοςτο μόριο που μπορεί να ζχει κυτταροτοξικά ι κυτταροπροςτατευτικά αποτελζςματα(diaconu et al., 2003). Επϊαςθ των κυττάρων Κ562 ςε υποτοξικζσ ςυγκεντρϊςεισ αιμίνθσ μπορεί να προκαλζςει ερυκροειδι διαφοροποίθςθ και να μειϊςει ελαφρϊσ τον ρυκμό κυτταρικισ ανάπτυξθσ, όπωσ πιςτοποιικθκε και ςτθν παροφςα εργαςία (Εικόνα 23, 24). Χρθςιμοποιϊντασ ποςοτικι RT-PCR διαπιςτϊκθκε ότι θ ζκφραςθ του p21 και τθσ κυκλίνθσ D1 αυξάνεται. Όπωσ μπορεί να υποτεκεί, θ ενεργοποίθςθ τθσ ζκφραςθσ του γονιδίου p21 ςυμβαίνει λόγω τθσ ενεργοποίθςθσ μθχανιςμϊν ελζγχου του κυτταρικοφ κφκλου (checkpoint mechanisms) των κυττάρων που προκαλείται από τθν ζκκεςθ τθσ καλλιζργειασ ςτθν αιμίνθ και είναι κοινό χαρακτθριςτικό μεταξφ επαγωγζων διαφοροποίθςθσ. φμφωνα όμωσ με τουσ Zhu et al. (2002) θ ζκφραςθ κυκλίνθσ D1 φαίνεται να ρυκμίηεται προσ τα κάτω από τθν επαγωγι με αιμίνθ, εν αντικζςει με τα παρόντα αποτελζςματα. ε αυτό το ςθμείο, πρζπει να αναφερκεί πωσ ο ποιοτικόσ ζλεγχοσ με θλεκτροφόρθςθ ςε πθκτι αγαρόηθσ του δείγματοσ τθσ κυκλίνθσ (δεν παρουςιάηεται) μετά τθν qpcr δεν ιταν ικανοποιθτικόσ, γεγονόσ που απαιτεί πλθρζςτερο ζλεγχο ςχετικά με τθν αυξθμζνθ ζκφραςθ του CNDD1. Επίςθσ αυξθμζνα παρουςιάςτθκαν τα επίπεδα ζκφραςθσ για τα γονίδια του p53, και των καςπαςϊν 8 και 3, υποδεικνφοντασ πικανι εμπλοκι για ζναρξθ και εκτζλεςθ απόπτωςθσ. τθν Κίνα μια εκτεταμζνθ μελζτθ μεταβολϊν των γονιδίων των K562 που επωάηονται με αιμίνθ προσ ερυκροποίθςθ(huo et al., 2006) ζδειξε επίςθσ ότι το ογκοκαταςταλτικό γονίδιο p53 αυξάνεται εν αντικζςει με τα κφτταρα MEL ςτα οποία θ ζκφραςθ του p53 φαίνεται μειωμζνθ μετά τθ δζςμευςθ για διαφοροποίθςθ και κατά τθν ερυκροποίθςθ(tsiftsoglou S.A. et al., 2009). Σα αποτελζςματα όμωσ των Huo et al.(2006) ωσ προσ το CMYC και τισ καςπάςεσ ζρχονται ςε αντίκεςθ με αυτά που λάβαμε ςτθν παροφςα εργαςία(μειωμζνα 91

92 επίπεδα CMYC και αυξθμζνα αυτά των καςπαςϊν 3,8,9). Σζλοσ, θ ζκφραςθ των γονιδίων των CDKs εμφανίηονται και πάλι μειωμζνα ςτισ 72 ϊρεσ παρά τθν αρχικά παρατθροφμενθ άνοδό τουσ, επθρεαηόμενα προφανϊσ από το p21. Σα ανωτζρω ςυμφωνοφν με τισ μετριςεισ του αρικμοφ των κυττάρων ςτθν καλλιζργεια, ο οποίοσ μειωνόταν αιςκθτά ςτθ διάρκεια επϊαςθσ με αιμίνθ. Όςον αφορά τθν ζκφραςθ των ριβοςωμικϊν πρωτεϊνϊν παρατθρικθκαν δφο ομάδεσ. Οι πρωτεΐνεσ τθσ μικρισ υπομονάδασ παρουςιάηουν μια μικρι τάςθ υπερζκφραςθσ ςτο πρϊτο 24ωρο επϊαςθσ με αιμίνθ, ενϊ ςτισ 72 ϊρεσ θ ζκφραςι τουσ είναι ςαφϊσ μικρότερθ ςε ςχζςθ με αυτι των κυττάρων τθσ καλλιζργειασ αναφοράσ που δε διαφοροποιοφνται αποτελζςματα αντιςτρόφωσ ανάλογα με τθν ζκφραςθ των γονιδίων των ςφαιρινϊν α και γ. ε αυτι τθν ομάδα μπορεί να ςυμπεριλθφκεί και θ RPL35a, ενϊ οι RPL5 και RPL10 εμφανίηουν αξιοςθμείωτθ υπερζκφραςθ εξ αρχισ. Λαμβάνοντασ υπόψθν πωσ ζλλειψθ τθσ RPL35a οδθγεί ςε μειωμζνο πολλαπλαςιαςμό των κυττάρων και αυξθμζνθ απόπτωςι τουσ (Farrar et al., 2008), είναι αναμενόμενθ θ μειωμζνθ ζκφραςι τθσ ςτθν καλλιζργεια των K562 που επωάςτθκαν με αιμίνθ και παρουςίαςαν αντίςτοιχα φαινόμενα. Όςον αφορά τισ πρωτεΐνεσ τθσ μικρισ υπομονάδασ (RPS14 και RPS19), πρζπει να λθφκεί υπόψθ θ καίρια εμπλοκι τουσ ςε αιμοποιθτικά ςφνδρομα και θ μθ ευνοϊκι τουσ ςυμπεριφορά προσ τθ διαφοροποίθςθ. Θ αυξθμζνθ ζκφραςθ των RPL5 και RPL10 πικανϊσ δικαιολογείται από τθν εμπλοκι τουσ ςτθ λευχαιμία, κακϊσ τα K562 είναι λευχαιμικά κφτταρα. Σζλοσ, θ επϊαςθ με αιμίνθ είχε ωσ αποτζλεςμα μία αξιοςθμείωτθ χρονοεξαρτϊμενθ μείωςθ τθσ ζκφραςθσ των mirnas που αναλφκθκαν. Μία υπόκεςθ που είναι ικανι να επεξθγιςει τθ μείωςθ αυτι είναι πωσ mirnas των οποίων θ ζκφραςθ αναςτζλλεται μπορεί να ενεργοποιοφν γονίδια-ςτόχουσ που προάγουν τθν ερυκροειδι διαφοροποίθςθ, μεταξφ των οποίων κα μπορεί να ςυγκαταλζγονται και γονίδια των ριβοςωμικϊν πρωτεϊνϊν. Όςον αφορά τθν κυτταρικι ανάπτυξθ και το επίπεδο τθσ διαφοροποίθςθσ ςτα κφτταρα που επωάςτθκαν με βουτυρικό νάτριο, παρατθρικθκε ιςχυρι αναςτολι(εικόνα 28, 29) και μεγάλθ ζκφραςθ των γονιδίων HbG1 και HbA1 ςτισ 72 ϊρεσ-μεγαλφτερθ απ ότι παρουςία αιμίνθσ. Σα ανωτζρω ςυμφωνοφν με όςα είχαν δείξει οι L. Cioe et al.(1981). H κακυςτζρθςθ τθσ ανίχνευςθσ τθσ παραγόμενθσ αιμοςφαιρίνθσ (Εικόνα 30) μπορεί να υποδθλϊνει ότι, όπωσ και ςτα κφτταρα MEL, πρζπει να ενεργοποιθκεί θ οδόσ βιοςφνκεςθσ τθσ αιμοςφαιρίνθσ (Sassa S. 1976, Rutherford and Weatherall, 1979). Επιπρόςκετα, οι ςθμαντικζσ φαινοτυπικζσ αλλαγζσ που ςυνόδευςαν τθν επϊαςθ των καρκινικϊν κυττάρων, οι οποίεσ ομοιάηουν με το φαινότυπο των K562 που επωάςτθκαν με αιμίνθ και όχι με αυτϊν που επωάςτθκαν με HMBA, αποτυπϊνονται ςτθν ζκφραςθ γονιδίων. Πιο ςυγκεκριμζνα, τα γονίδια p21, CNDD1 και CDKs ζχουν τθν ίδια ζκφραςθ (αφξθςθ και μείωςθ αντιςτοίχωσ) όπωσ και παρουςία αιμίνθσ. Αξίηει να αναφερκεί ότι παρατθρείται μείωςθ ςτα επίπεδα ζκφραςθσ των καςπαςϊν (CASP3, 8, 9) και του ογκοκαταςταλτικοφ p53, παρά τθν αρχικι του αφξθςθ, αντίκετα απ ότι παρουςία αιμίνθσ, γεγονόσ με ιδιαίτερο ενδιαφζρον κακϊσ αφορά άμεςα τθ διαδικαςία τθσ απόπτωςθσ. Ωςτόςο πρζπει να υπογραμμίςουμε πωσ παρότι θ επαγωγι τθσ απόπτωςθσ μπορεί να ςυςχετίηεται με τθν οδό διαφοροποίθςθσ, οι δφο αυτζσ διαδικαςίεσ υπόκεινται ςε διακριτό και ξεχωριςτό ρυκμιςτικό ζλεγχο. 92

93 Μθ αναμενόμενα και διαφορετικά ςυγκριτικά με τουσ άλλουσ δφο διαφοροποιθτζσ αποδείχκθκαν τα αποτελζςματα τθσ ανάλυςθσ qpcr τόςο για τα γονίδια των ριβοςωμικϊν πρωτεϊνϊν όςο και για τα mirs, αφοφ και ςτισ δφο περιπτϊςεισ προκφπτει υπερζκφραςθ ςτισ 72 ϊρεσ επϊαςθσ με βουτυρικό νάτριο. Πιο ςυγκεκριμζνα τα γονίδια τθσ μικρισ υπομονάδασ δεν επθρεάηονται πολφ, ενϊ οι RPL5 και RPL10 παρουςιάηουν αξιοςθμείωτθ αυξθμζνθ ζκφραςθ. Από τα mirs, εκείνο που ξεχωρίηει είναι το mir663a το οποίο παρουςιάηει αφξθςθ από το πρϊτο 24ωρο, ενϊ τα mir129-5p και mir1207-5p αρχικά μειϊνονται αρκετά για να υπερεκφραςτοφν ςτθ ςυνζχεια ςτισ 72 ϊρεσ. Λαμβάνοντασ υπόψθ τα επίπεδα ζκφραςθσ των αιμοςφαιρινϊν κατά τθ διαδικαςία, παρατθροφμε ότι ςτθν πλειοψθφία των γονιδίων απαιτείται χρόνοσ προςαρμογισ και τελικισ αφξθςθσ ι μείωςθσ τθσ ζκφραςισ τουσ. Σο όμοιο μοτίβο ζκφραςθσ μεταξφ γονιδίων ριβοςωμικϊν πρωτεϊνϊν και mirnas παρουςιάηει ιδιαίτερο ενδιαφζρον, κακϊσ θ ερυκροποίθςθ αποτελεί μια πολυεπίπεδα ρυκμιηόμενθ διαδικαςία ςτθν οποία εμπλζκονται αμφότερα οι ομάδεσ γονιδίων. Εικόνα 34. Ομαδοποίηςη γονιδίων και micrornas που μελετήθηκαν αναλόγωσ τη ςυμπεριφορά τησ ζκφραςήσ τουσ ςτισ 72 ϊρεσ επϊαςησ με κάθε επαγωγζα. Στον πίνακα Α.(αριςτερά) παρουςιάηονται τα γονίδια και τα micrornas που παρουςίαςαν τθ ςθμαντικότερθ μείωςθ ζκφραςθσ ςτισ 72 ϊρεσ παρουςία του κάκε επαγωγζα, ενϊ ςτον πίνακα Β. (δεξιά) τα αντίςτοιχα με τθ ςθμαντικότερθ αφξθςθ. Όλα τα ανωτζρω υποδθλϊνουν ότι οι ςχετικζσ οδοί ςθματοδότθςθσ επθρεάηονται διαφορικά από τουσ ομοιοςτατικοφσ γενωμικοφσ μθχανιςμοφσ που διζπουν τθν κυτταρικι ςυμπεριφορά μετά τθν ζκκεςθ ςε διαφορετικζσ ενϊςεισεπαγωγείσ τθσ διαφοροποίθςθσ, με οριςμζνεσ ομοιότθτεσ ωσ προσ τθν ζκφραςθ γονιδίων και micrornas. Σα αποτελζςματα που προζκυψαν πειραματικά, πζρα από το διαχωριςμό τουσ αναλόγωσ τον επαγωγζα που χρθςιμοποιικθκε, αξιολογοφμενα ωσ ςχετιηόμενα με τθ διεργαςία τθσ διαφοροποίθςθσ (process specific) των κυττάρων K562 μποροφν να ομαδοποιθκοφν ςε δφο κατθγορίεσ: α) τροποποιιςεισ ςτο μονοπάτι τθσ μεγακαρυωτικισ διαφοροποίθςθσ (παρουςία HMBA) και β) τροποποιιςεισ ςτο μονοπάτι τθσ ερυκροποίθςθσ (παρουςία αιμίνθσ ι βουτυρικοφ νατρίου). Και ςτισ δφο περιπτϊςεισ είναι εμφανζσ και λογικό να διακόπτεται ο κυτταρικόσ κφκλοσ προκειμζνου τα κφτταρα να βγουν από αυτόν για να διαφοροποιθκοφν. Παρατθρϊντασ τα αποτελζςματα μπορεί να κεωρθκεί πωσ 93

Division of Pediatric-Adolescent Gynecology. Chairman: Prof. G. Creatsas

Division of Pediatric-Adolescent Gynecology. Chairman: Prof. G. Creatsas Division of Pediatric-Adolescent Gynecology 2 & nd Reconstructive Department of Surgery Obstetrics & Gynecology University 2 nd Department of Athens, of Obstetrics Medical School, & Gynecology, Aretaieion

Διαβάστε περισσότερα

cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1

cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1 cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1 Λόγοι για τουσ οποίουσ αναγκαςτικαμε να δθμιουργιςουμε τθ cdna βιβλιοκικθ Σα γονίδια των ευκαρυωτικών είναι αςυνεχι. Οι περιοριςτικζσ ενδονουκλεάςεισ δεν κόβουν ςτθν

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Όνομα. Ημερομηνία. Ζήτημα Α : Να βάλετε ςε κφκλο τθ ςωςτι απάντθςθ 1. Κυτταρικόσ κφκλοσ είναι το χρονικό διάςτθμα που μεςολαβεί: α. μεταξφ δφο μιτωτικϊν

Διαβάστε περισσότερα

Κατανομι των HPV-υπότυπων ςε Χανιά και Ρζκυμνο Κριτθσ

Κατανομι των HPV-υπότυπων ςε Χανιά και Ρζκυμνο Κριτθσ Κατανομι των HPV-υπότυπων ςε Χανιά και Ρζκυμνο Κριτθσ Μπατάκθσ Εμμανουιλ Χθμικόσ, MSc Κλινικισ Χθμείασ του Καποδιςτριακοφ Πανεπιςτθμίου Ακθνών. Tμιματοσ Χθμείασ του Εκνικοφ και Μπαλαντίνου Ειρινθ Βιολόγοσ,

Διαβάστε περισσότερα

Πειραματικι Ψυχολογία (ΨΧ66)

Πειραματικι Ψυχολογία (ΨΧ66) Πειραματικι Ψυχολογία (ΨΧ66) Διάλεξη 7 Σεχνικζσ για τθν επίτευξθ ςτακερότθτασ Πζτροσ Ροφςςοσ Μζθοδοι για την επίτευξη του ελζγχου Μζςω του κατάλλθλου ςχεδιαςμοφ του πειράματοσ (ςτόχοσ είναι θ εξάλειψθ

Διαβάστε περισσότερα

Clinical trials have gone global: Is this a good thing? Επιλεγόμενο μάκθμα «Λευχαιμίεσ» Σταυροφλα Μπεροποφλθ Κωνςταντίνοσ Φωτιάδθσ

Clinical trials have gone global: Is this a good thing? Επιλεγόμενο μάκθμα «Λευχαιμίεσ» Σταυροφλα Μπεροποφλθ Κωνςταντίνοσ Φωτιάδθσ Clinical trials have gone global: Is this a good thing? Επιλεγόμενο μάκθμα «Λευχαιμίεσ» Σταυροφλα Μπεροποφλθ Κωνςταντίνοσ Φωτιάδθσ Τι είναι θ κλινικι δοκιμι; Σφμφωνα με το WHO Κάκε ερευνθτικι μελζτθ, θ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΟΙ ΓΙΑ ΦΥΣΙΚΟΥΣ

ΒΙΟΛΟΓΟΙ ΓΙΑ ΦΥΣΙΚΟΥΣ ΦΥΣΙΚΗ vs ΒΙΟΛΟΓΙΑ ΒΙΟΛΟΓΟΙ ΓΙΑ ΦΥΣΙΚΟΥΣ «Προτείνω να αναπτφξουμε πρώτα αυτό που κα μποροφςε να ζχει τον τίτλο: «ιδζεσ ενόσ απλοϊκοφ φυςικοφ για τουσ οργανιςμοφσ». Κοντολογίσ, τισ ιδζεσ που κα μποροφςαν

Διαβάστε περισσότερα

Επίδραςθ επιγενετικών μθχανιςμών κατά τθ διάρκεια τθσ ηωισ. Εμμ. Μ. Καραβιτάκθσ Παιδίατροσ Επιμ. Α ΜΕΝΝ Γ.Ν.Χανίων

Επίδραςθ επιγενετικών μθχανιςμών κατά τθ διάρκεια τθσ ηωισ. Εμμ. Μ. Καραβιτάκθσ Παιδίατροσ Επιμ. Α ΜΕΝΝ Γ.Ν.Χανίων Επίδραςθ επιγενετικών μθχανιςμών κατά τθ διάρκεια τθσ ηωισ Εμμ. Μ. Καραβιτάκθσ Παιδίατροσ Επιμ. Α ΜΕΝΝ Γ.Ν.Χανίων ΣΟΧΟΙ ΣΗ ΠΑΡΟΤΙΑΗ οριςμόσ τθσ επιγενετικισ και των μθχανιςμϊν τθσ επίδραςθ επιγενετικϊν

Διαβάστε περισσότερα

ΚΤΣΣΑΡΟ ΙΙ. Κυτταρόπλαςμα. Οργανίδια. Πυρήνασ. Κυτταρικό τοίχωμα. = Ημίρρευςτθ και οριοκετθμζνθ ομογενισ μάηα.

ΚΤΣΣΑΡΟ ΙΙ. Κυτταρόπλαςμα. Οργανίδια. Πυρήνασ. Κυτταρικό τοίχωμα. = Ημίρρευςτθ και οριοκετθμζνθ ομογενισ μάηα. ΚΤΣΣΑΡΟ ΙΙ Πρωτόπλαςμα Κυτταρόπλαςμα Κυτταρόπλαςμα = Ημίρρευςτθ και οριοκετθμζνθ ομογενισ μάηα. Οργανίδια = Δομζσ που επιτελοφν ςυγκεκριμζνθ λειτουργία Πυρήνασ Κυτταρικό τοίχωμα = Σο κζντρο ελζγχου του

Διαβάστε περισσότερα

Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ

Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ Λόγοι για τουσ οποίουσ κάνουμε γονιδιωματικι βιβλιοκικθ Για οργανιςμοφσ που κινδυνεφουν να εξαφανιςτοφν. Για εκπαιδευτικοφσ λόγουσ. Για να κάνουμε μελζτθ ςτθν εξελικτικι

Διαβάστε περισσότερα

ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ

ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ Ονομάςτθκε ΚΕΝΣΡΙΚΟ ΔΟΓΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ή ά DN RN ή ί ή ί 1 Κάκε κφτταρο και κάκε

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010

ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010 ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010 ΘΕΜΑ Α Α1 δ Α2 β Α3 α Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ.17 Τα κφτταρα διπλοειδι Β2. Σελ.14 Το DNA φωςφοδιεςτερικόσ δεςμόσ Β3. Σελ.37,38 Σθμειϊνεται.αντίγραφα ενόσ γονιδίου

Διαβάστε περισσότερα

ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ

ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ ΠΑΝΕΛΛΑΔΙΚΕ ΕΞΕΣΑΕΙ Γ ΣΑΞΗ ΗΜΕΡΗΙΟΤ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ ΘΕΜΑ Α ΑΠΑΝΣΗΕΙ Α.1. δ Α.2. δ Α.3. β Α.4. γ Α.5. α ΘΕΜΑ Β Β.1. Ι ΙΙ ΙΙΙ ΙV V VI VII Α Ε Σ Β Z Γ Δ Β.2.

Διαβάστε περισσότερα

Ζρευνα ικανοποίθςθσ τουριςτϊν

Ζρευνα ικανοποίθςθσ τουριςτϊν Ζρευνα ικανοποίθςθσ τουριςτϊν Ammon Ovis_Ζρευνα ικανοποίθςθσ τουριςτϊν_ Ραδιοςτακμόσ Flash 96 1 ΣΤΟΙΧΕΙΑ ΔΕΙΓΜΑΤΟΣ Σο δείγμα περιλαμβάνει 332 τουρίςτεσ από 5 διαφορετικζσ θπείρουσ. Οι περιςςότεροι εξ αυτϊν

Διαβάστε περισσότερα

ΥΡΟΝΣΙΣΗΡΙΟ ΜΕΗ ΕΚΠΑΙΔΕΤΗ Ο Μ Η Ρ Ο Σ

ΥΡΟΝΣΙΣΗΡΙΟ ΜΕΗ ΕΚΠΑΙΔΕΤΗ Ο Μ Η Ρ Ο Σ ΠΑΝΕΛΛΗΝΕ ΕΞΕΣΑΕ Γϋ ΣΑΞΗ ΗΜΕΡΗΟΤ ΓΕΝΚΟΤ ΛΤΚΕΟΤ ΣΕΣΑΡΣΗ 4 ΟΤΝΟΤ 2 0 1 4 ΒΟΛΟΓΑ ΘΕΣΚΗ ΚΑΣΕΤΘΤΝΗ ΑΠΑΝΤΗΣΕΣ ΘΕΜΑ Α: Α 1 - δ Α 2 -γ Α 3 -β Α 4 -γ Α 5 -β ΘΕΜΑ Β : Β1: 4 2 1 6 3 5 Β2: Α)DNA Πολυμεράςθ Β) Πριμόςωμα

Διαβάστε περισσότερα

Ενθμζρωςθ και προςταςία των καταναλωτών από τουσ κινδφνουσ που απορρζουν από τα χθμικά προϊόντα

Ενθμζρωςθ και προςταςία των καταναλωτών από τουσ κινδφνουσ που απορρζουν από τα χθμικά προϊόντα Ενθμζρωςθ και προςταςία των καταναλωτών από τουσ κινδφνουσ που απορρζουν από τα χθμικά προϊόντα Γενικό Χθμείο του Κράτουσ Διεφκυνςθ Περιβάλλοντοσ Δρ. Διμθτρα Δανιιλ Χθμικά προϊόντα Οι χθμικζσ ουςίεσ υπάρχουν

Διαβάστε περισσότερα

ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013

ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013 ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. ελ. 123-124 «Η γονιδιακι κεραπεία εφαρμόςτθκε και ειςάγονται πάλι ς αυτόν.» Β2. ελ. 133 «Διαγονιδιακά ονομάηονται

Διαβάστε περισσότερα

ΕΠΙΔΗΜΙΟΛΟΓIΑ. Επιμέλεια : Δρ. Ι. Δετοράκης

ΕΠΙΔΗΜΙΟΛΟΓIΑ. Επιμέλεια : Δρ. Ι. Δετοράκης ΕΠΙΔΗΜΙΟΛΟΓIΑ Επιμέλεια : Δρ. Ι. Δετοράκης ΣΙ ΕIΝΑΙ ΕΠΙΔΗΜΙΟΛΟΓIΑ Επιδθμιολογία είναι θ μελζτθ τθσ κατανομισ μιασ νόςου ςτον πλθκυςμό και οι παράγοντεσ που επθρεάηουν ι προςδιορίηουν αυτι τθν κατανομι.

Διαβάστε περισσότερα

Σ ΤΑΤ Ι Σ Τ Ι Κ Η. Statisticum collegium V

Σ ΤΑΤ Ι Σ Τ Ι Κ Η. Statisticum collegium V Σ ΤΑΤ Ι Σ Τ Ι Κ Η i Statisticum collegium V Στατιςτική Συμπεραςματολογία Ι Σημειακζσ Εκτιμήςεισ Διαςτήματα Εμπιςτοςφνησ Στατιςτική Συμπεραςματολογία (Statistical Inference) Το πεδίο τθσ Στατιςτικισ Συμπεραςματολογία,

Διαβάστε περισσότερα

3 ο ΓΥΜΝΑΣΙΟ ΤΡΙΚΑΛΩΝ ΕΡΓΑΣΙΑ ΤΕΧΝΟΛΟΓΙΑΣ Γ ΓΥΜΝΑΣΙΟΥ

3 ο ΓΥΜΝΑΣΙΟ ΤΡΙΚΑΛΩΝ ΕΡΓΑΣΙΑ ΤΕΧΝΟΛΟΓΙΑΣ Γ ΓΥΜΝΑΣΙΟΥ 3 ο ΓΥΜΝΑΣΙΟ ΤΡΙΚΑΛΩΝ ΕΡΓΑΣΙΑ ΤΕΧΝΟΛΟΓΙΑΣ Γ ΓΥΜΝΑΣΙΟΥ 1) Τίτλοσ τθσ ζρευνασ: «Ποια είναι θ επίδραςθ τθσ κερμοκραςίασ ςτθ διαλυτότθτα των ςτερεϊν ςτο νερό;» 2) Περιγραφι του ςκοποφ τθσ ζρευνασ: Η ζρευνα

Διαβάστε περισσότερα

Δομι και λειτουργία των πρωτεϊνϊν

Δομι και λειτουργία των πρωτεϊνϊν Δομι και λειτουργία των πρωτεϊνϊν Τισ πρωτεΐνεσ κατατάςςουμε ςε: Δομικέσ: αποτελοφν βαςικό υλικό για τθν δόμθςθ του κυτταρικοφ τοιχϊματοσ, των μεμβρανϊν, κ.λ.π. π.χ. το κoλλαγόνο, θ ελαςτίνθ και οι γλυκοπρωτείνεσ.

Διαβάστε περισσότερα

Δομι. Στρϊμα λιπιδικϊν μορίων πάχουσ 5 nm που λειτουργεί ωσ φραγμόσ Εξειδικευμζνεσ δίοδοι και αντλίεσ (πρωτεΐνεσ) ελζγχουν τι μπαίνει και τι βγαίνει

Δομι. Στρϊμα λιπιδικϊν μορίων πάχουσ 5 nm που λειτουργεί ωσ φραγμόσ Εξειδικευμζνεσ δίοδοι και αντλίεσ (πρωτεΐνεσ) ελζγχουν τι μπαίνει και τι βγαίνει Δομι των μεμβρανϊν Δομι Στρϊμα λιπιδικϊν μορίων πάχουσ 5 nm που λειτουργεί ωσ φραγμόσ Εξειδικευμζνεσ δίοδοι και αντλίεσ (πρωτεΐνεσ) ελζγχουν τι μπαίνει και τι βγαίνει Διπλοςτοιβάδα λιπιδίων Η λιπιδικι

Διαβάστε περισσότερα

ΛΕΙΣΟΤΡΓΙΚΆ ΤΣΉΜΑΣΑ. 7 θ Διάλεξθ Διαχείριςθ Μνιμθσ Μζροσ Γ

ΛΕΙΣΟΤΡΓΙΚΆ ΤΣΉΜΑΣΑ. 7 θ Διάλεξθ Διαχείριςθ Μνιμθσ Μζροσ Γ ΛΕΙΣΟΤΡΓΙΚΆ ΤΣΉΜΑΣΑ 7 θ Διάλεξθ Διαχείριςθ Μνιμθσ Μζροσ Γ ελιδοποίθςθ (1/10) Σόςο θ κατάτμθςθ διαμεριςμάτων ςτακεροφ μεγζκουσ όςο και θ κατάτμθςθ διαμεριςμάτων μεταβλθτοφ και άνιςου μεγζκουσ δεν κάνουν

Διαβάστε περισσότερα

ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ. Φιλιοποφλου Ειρινθ

ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ. Φιλιοποφλου Ειρινθ ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ Φιλιοποφλου Ειρινθ Προςθήκη νζων πεδίων Ασ υποκζςουμε ότι μετά τθ δθμιουργία του πίνακα αντιλαμβανόμαςτε ότι ζχουμε ξεχάςει κάποια πεδία. Είναι ζνα πρόβλθμα το οποίο

Διαβάστε περισσότερα

Μάρκετινγκ V Κοινωνικό Μάρκετινγκ. Πόπη Σουρμαΐδου. Σεμινάριο: Αναπτφςςοντασ μια κοινωνική επιχείρηςη

Μάρκετινγκ V Κοινωνικό Μάρκετινγκ. Πόπη Σουρμαΐδου. Σεμινάριο: Αναπτφςςοντασ μια κοινωνική επιχείρηςη Μάρκετινγκ V Κοινωνικό Μάρκετινγκ Πόπη Σουρμαΐδου Σεμινάριο: Αναπτφςςοντασ μια κοινωνική επιχείρηςη Σφνοψη Τι είναι το Marketing (βαςικι ειςαγωγι, swot ανάλυςθ, τα παλιά 4P) Τι είναι το Marketing Plan

Διαβάστε περισσότερα

ΚΥΤΤΑΟ Ι. Η θεμελιώδησ δομική και λειτουργική μονάδα όλων των οργανιςμών

ΚΥΤΤΑΟ Ι. Η θεμελιώδησ δομική και λειτουργική μονάδα όλων των οργανιςμών ΚΥΤΤΑΟ Ι Η θεμελιώδησ δομική και λειτουργική μονάδα όλων των οργανιςμών Είναι θ μικρότερθ δομι ςτθ φφςθ όπου εμφανίηεται το φαινόμενο τθσ ηωισ ΚΤΣΣΑΡΙΚΗ ΘΕΩΡΙΑ 1. Πλοι οι οργανιςμοί αποτελοφνται από κφτταρα

Διαβάστε περισσότερα

ΑΓΓΕΙΑΚΟ ΕΓΚΕΦΑΛΙΚΟ ΕΠΕΙΟΔΙΟ (ΑΕΕ)

ΑΓΓΕΙΑΚΟ ΕΓΚΕΦΑΛΙΚΟ ΕΠΕΙΟΔΙΟ (ΑΕΕ) ΑΓΓΕΙΑΚΟ ΕΓΚΕΦΑΛΙΚΟ ΕΠΕΙΟΔΙΟ (ΑΕΕ) Σα ΑΕΕ είναι θ ςυχνότερθ αιτία πρόκλθςθσ αναπθρίασ και θ τζταρτθ αιτία κανάτου 82-92% των ΑΕΕ είναι ιςχαιμικά και το 18-8% είναι αιμορραγικά. φμφωνα με τθν Παγκόςμια

Διαβάστε περισσότερα

1η Ενδιάμεση Τεχνική Έκθεση

1η Ενδιάμεση Τεχνική Έκθεση 1η Ενδιάμεση Τεχνική Έκθεση Εργαςτιριο Δαςικισ Διαχειριςτικισ και Τθλεπιςκόπθςθσ Αριςτοτζλειο Πανεπιςτιμιο Θεςςαλονίκθσ Διαβαλκανικό Κζντρο Περιβάλλοντοσ Ιοφνιοσ 2014 Επιςτθμονικι ερευνθτικι ομάδα Ζργου

Διαβάστε περισσότερα

1 Αρχιτεκτονική του κυττάρου-μεταβολισμός. Χ. Κ. Φ Ι Ρ Φ Ι Ρ Η - Φ Ρ Ο Ν Σ Ι Σ Η Ρ Ι Α Π Ρ Ο Ο Π Σ Ι Κ Η - Π Α Π Α Ν Α Σ Α Ι Ο Τ 1 0 1 ελίδα 1

1 Αρχιτεκτονική του κυττάρου-μεταβολισμός. Χ. Κ. Φ Ι Ρ Φ Ι Ρ Η - Φ Ρ Ο Ν Σ Ι Σ Η Ρ Ι Α Π Ρ Ο Ο Π Σ Ι Κ Η - Π Α Π Α Ν Α Σ Α Ι Ο Τ 1 0 1 ελίδα 1 1 Αρχιτεκτονική του κυττάρου-μεταβολισμός Γενικά : Οποιοδιποτε κφτταρο αποτελείται από χθμικζσ ενϊςεισ του άνκρακα που ονομάηονται οργανικζσ ενϊςεισ. Οι ενϊςεισ που αποτελοφν ςυςτατικά του κφτταρου χωρίηονται

Διαβάστε περισσότερα

ΘΕΡΜΟΔΤΝΑΜΙΚΗ Ι. Ενότθτα 1: Βαςικά χαρακτθριςτικά τθσ Θερμοδυναμικισ. ογομϊν Μπογοςιάν Πολυτεχνικι χολι Σμιμα Χθμικϊν Μθχανικϊν

ΘΕΡΜΟΔΤΝΑΜΙΚΗ Ι. Ενότθτα 1: Βαςικά χαρακτθριςτικά τθσ Θερμοδυναμικισ. ογομϊν Μπογοςιάν Πολυτεχνικι χολι Σμιμα Χθμικϊν Μθχανικϊν ΘΕΡΜΟΔΤΝΑΜΙΚΗ Ι Ενότθτα 1: Βαςικά χαρακτθριςτικά τθσ Θερμοδυναμικισ ογομϊν Μπογοςιάν Πολυτεχνικι χολι Σμιμα Χθμικϊν Μθχανικϊν κοποί ενότθτασ κοπόσ τθσ ενότθτασ αυτισ είναι θ περιγραφι των οριςμϊν και και

Διαβάστε περισσότερα

Παράςταςη ακεραίων ςτο ςυςτημα ςυμπλήρωμα ωσ προσ 2

Παράςταςη ακεραίων ςτο ςυςτημα ςυμπλήρωμα ωσ προσ 2 Παράςταςη ακεραίων ςτο ςυςτημα ςυμπλήρωμα ωσ προσ 2 Δρ. Χρήζηος Ηλιούδης Μθ Προςθμαςμζνοι Ακζραιοι Εφαρμογζσ (ςε οποιαδιποτε περίπτωςθ δεν χρειάηονται αρνθτικοί αρικμοί) Καταμζτρθςθ. Διευκυνςιοδότθςθ.

Διαβάστε περισσότερα

ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ ΣΕΣΑΡΣΗ 20 ΜΑΪΟΤ 2015

ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ ΣΕΣΑΡΣΗ 20 ΜΑΪΟΤ 2015 ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ ΘΕΜΑ Α ΣΕΣΑΡΣΗ 20 ΜΑΪΟΤ 2015 Α1. - γ. ςφφιλθ Α2. - α. ερυκρόσ μυελόσ των οςτών Α3. - β. εντομοκτόνο Α4. - β. καταναλωτζσ 1θσ τάξθσ Α5. - δ. μία οικογζνεια ΘΕΜΑ Β Β1. 1.

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ 2: ΤΟ ΛΟΓΙΣΜΙΚΟ ΤΟΥ ΥΠΟΛΟΓΙΣΤΗ. ΚΕΦΑΛΑΙΟ 5: Γνωριμία με το λογιςμικό του υπολογιςτι

ΕΝΟΤΗΤΑ 2: ΤΟ ΛΟΓΙΣΜΙΚΟ ΤΟΥ ΥΠΟΛΟΓΙΣΤΗ. ΚΕΦΑΛΑΙΟ 5: Γνωριμία με το λογιςμικό του υπολογιςτι ΕΝΟΤΗΤΑ 2: ΤΟ ΛΟΓΙΣΜΙΚΟ ΤΟΥ ΥΠΟΛΟΓΙΣΤΗ ΚΕΦΑΛΑΙΟ 5: Γνωριμία με το λογιςμικό του υπολογιςτι Λογιςμικό (Software), Πρόγραμμα (Programme ι Program), Προγραμματιςτισ (Programmer), Λειτουργικό Σφςτθμα (Operating

Διαβάστε περισσότερα

ΔΕΛΣΙΟ ΣΤΠΟΤ ΣΟΧΑΙ ΑΕ: «ΚΛΑΔΙΚΕ ΣΟΧΕΤΕΙ» ΜΕΛΕΣΗ ΑΓΟΡΑ ΑΛΤΙΔΩΝ ΛΙΑΝΙΚΟΤ ΕΜΠΟΡΙΟΤ

ΔΕΛΣΙΟ ΣΤΠΟΤ ΣΟΧΑΙ ΑΕ: «ΚΛΑΔΙΚΕ ΣΟΧΕΤΕΙ» ΜΕΛΕΣΗ ΑΓΟΡΑ ΑΛΤΙΔΩΝ ΛΙΑΝΙΚΟΤ ΕΜΠΟΡΙΟΤ ΔΕΛΣΙΟ ΣΤΠΟΤ ΣΟΧΑΙ ΑΕ: «ΚΛΑΔΙΚΕ ΣΟΧΕΤΕΙ» ΜΕΛΕΣΗ ΑΓΟΡΑ ΑΛΤΙΔΩΝ ΛΙΑΝΙΚΟΤ ΕΜΠΟΡΙΟΤ Μείωςθ 1,9% ςε ςχζςθ με το 2009, παρουςίαςε θ αγορά των αλυςίδων λιανικοφ εμπορίου των οκτϊ εξεταηόμενων κατθγοριϊν το 2010

Διαβάστε περισσότερα

Ο ΡΟΛΟ ΣΩΝ mirnas ΣΟΝ ΕΛΕΓΧΟ ΣΗ ΕΠΙΘΗΛΙΑΚΗ-ΠΡΟ-ΜΕΕΓΧΤΜΑΣΙΚΗ ΜΕΣΑΒΑΗ ΣΗΝ ΜΕΣΑΣΑΗ ΣΟΤ ΚΑΡΚΙΝΟ ΣΟΤ ΠΝΕΤΜΟΝΑ

Ο ΡΟΛΟ ΣΩΝ mirnas ΣΟΝ ΕΛΕΓΧΟ ΣΗ ΕΠΙΘΗΛΙΑΚΗ-ΠΡΟ-ΜΕΕΓΧΤΜΑΣΙΚΗ ΜΕΣΑΒΑΗ ΣΗΝ ΜΕΣΑΣΑΗ ΣΟΤ ΚΑΡΚΙΝΟ ΣΟΤ ΠΝΕΤΜΟΝΑ Ο ΡΟΛΟ ΣΩΝ mirnas ΣΟΝ ΕΛΕΓΧΟ ΣΗ ΕΠΙΘΗΛΙΑΚΗ-ΠΡΟ-ΜΕΕΓΧΤΜΑΣΙΚΗ ΜΕΣΑΒΑΗ ΣΗΝ ΜΕΣΑΣΑΗ ΣΟΤ ΚΑΡΚΙΝΟ ΣΟΤ ΠΝΕΤΜΟΝΑ Περλικόσ Φ. 1, Γεωργοποφλου Μ. 1, Καββαδίασ Α. 2, Ζϊθσ Π. 1, Πανταηόπουλοσ Ι. 1, Κουντηόγλου Δ.

Διαβάστε περισσότερα

ΠΡΟΦΟΡΑ ΖΗΣΗΗ ΚΡΑΣΘΚΗ ΠΑΡΕΜΒΑΗ

ΠΡΟΦΟΡΑ ΖΗΣΗΗ ΚΡΑΣΘΚΗ ΠΑΡΕΜΒΑΗ ΠΡΟΦΟΡΑ ΖΗΣΗΗ ΚΡΑΣΘΚΗ ΠΑΡΕΜΒΑΗ 1 Ειςαγωγι: Οι αγοραίεσ δυνάµεισ τθσ προςφοράσ και ηιτθςθσ Προσφορά και Ζήτηση είναι οι πιο γνωςτοί οικονοµικοί όροι. Η λειτουργία των αγορϊν προςδιορίηεται από δφο βαςικζσ

Διαβάστε περισσότερα

Ρομποτική. Η υγεία ςασ το αξίηει

Ρομποτική. Η υγεία ςασ το αξίηει Ρομποτική Μάκετε γριγορά και εφκολα ό τι χρειάηεται να ξζρετε για τισ λαπαροςκοπικζσ μεκόδουσ αντιμετϊπιςθσ γυναικολογικϊν πακιςεων Ενθμερωκείτε ςωςτά και υπεφκυνα Η υγεία ςασ το αξίηει Μζκοδοσ και πλεονεκτιματα

Διαβάστε περισσότερα

Παράςταςη ςυμπλήρωμα ωσ προσ 1

Παράςταςη ςυμπλήρωμα ωσ προσ 1 Δρ. Χρήστος Ηλιούδης Θζματα διάλεξησ ΣΤ1 Προςθεςη αφαίρεςη ςτο ΣΤ1 2 ή ΣΤ1 Ονομάηουμε ςυμπλιρωμα ωσ προσ μειωμζνθ βάςθ R ενόσ μθ προςθμαςμζνου αρικμοφ Χ = ( Χ θ-1 Χ θ-2... Χ 0 ) R ζναν άλλον αρικμό Χ'

Διαβάστε περισσότερα

Διδάςκων: Κακθγθτισ Αλζξανδροσ Ριγασ υνεπικουρία: πφρογλου Ιωάννθσ

Διδάςκων: Κακθγθτισ Αλζξανδροσ Ριγασ υνεπικουρία: πφρογλου Ιωάννθσ ΔΗΜΟΚΡΙΣΕΙΟ ΠΑΝΕΠΙΣΗΜΙΟ ΘΡΑΚΗ ΣΜΗΜΑ ΗΛΕΚΣΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΤΠΟΛΟΓΙΣΩΝ ΣΟΜΕΑ ΣΗΛΕΠΙΚΟΙΝΩΝΙΩΝ ΚΑΙ ΔΙΑΣΗΜΙΚΗ Βιοϊατρική Σεχνολογία 9 ο Εξάμηνο Διδάςκων: Κακθγθτισ Αλζξανδροσ Ριγασ υνεπικουρία:

Διαβάστε περισσότερα

Σόμοσ 3 Σεφχοσ 1 ΙΑΝ-ΑΠΡ 2015 ΜΑΛΑΞΗ & ΘΕΡΑΠΕΙΑ Σο μυαλό δεν χρηςιμοποιείται πραγματικά εάν δεν πράττει το καλό. A.T.Still Σόμοσ 3 Σεφχοσ 1

Σόμοσ 3 Σεφχοσ 1 ΙΑΝ-ΑΠΡ 2015 ΜΑΛΑΞΗ & ΘΕΡΑΠΕΙΑ Σο μυαλό δεν χρηςιμοποιείται πραγματικά εάν δεν πράττει το καλό. A.T.Still Σόμοσ 3 Σεφχοσ 1 Σόμοσ 3 Σεφχοσ 1 ΙΑΝ-ΑΠΡ 2015 ΜΑΛΑΞΗ & ΘΕΡΑΠΕΙΑ Επίςθμο Περιοδικό Όργανο του Ελ.Ι.Μ. Σο μυαλό δεν χρηςιμοποιείται πραγματικά εάν δεν πράττει το καλό. A.T.Still Σόμοσ 3 Σεφχοσ 1 ΠΕΡΙΕΧΟΜΕΝΑ 1 ΗΜΕΙΩΜΑ ΤΝΣΑΞΗ

Διαβάστε περισσότερα

Slide 1. Εισαγωγή στη ψυχρομετρία

Slide 1. Εισαγωγή στη ψυχρομετρία Slide 1 Εισαγωγή στη ψυχρομετρία 1 Slide 2 Σφντομη ειςαγωγή ςτη ψυχρομετρία. Διάγραμμα Mollier (πίεςησ-ενθαλπίασ P-H) Σο διάγραμμα Mollier είναι μία γραφικι παράςταςθ ςε ζναν άξονα ςυντεταγμζνων γραμμϊν

Διαβάστε περισσότερα

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες 1 Πρωτεΐνες Πρωτεΐνεσ : Οι πρωτεΐνεσ είναι ουςίεσ «πρώτθσ» γραμμισ για τουσ οργανιςμοφσ (άρα και για τον άνκρωπο). Σα κφτταρα και οι ιςτοί αποτελοφνται κατά κφριο λόγο από πρωτεΐνεσ. Ο ςθμαντικότεροσ όμωσ

Διαβάστε περισσότερα

Ακολουκιακά Λογικά Κυκλώματα

Ακολουκιακά Λογικά Κυκλώματα Ακολουκιακά Λογικά Κυκλώματα Τα ψθφιακά λογικά κυκλϊματα που μελετιςαμε μζχρι τϊρα ιταν ςυνδυαςτικά κυκλϊματα. Στα ςυνδυαςτικά κυκλϊματα οι ζξοδοι ςε κάκε χρονικι ςτιγμι εξαρτϊνται αποκλειςτικά και μόνο

Διαβάστε περισσότερα

ΤΝΔΡΟΜΟ RETT. Πθγζσ: Rett Syndrome Research Trust (reverserett.org) Rett Syndrome Association of Australia (RSAA) Army of Us (armyofus.

ΤΝΔΡΟΜΟ RETT. Πθγζσ: Rett Syndrome Research Trust (reverserett.org) Rett Syndrome Association of Australia (RSAA) Army of Us (armyofus. ΤΝΔΡΟΜΟ RETT Πθγζσ: Rett Syndrome Research Trust (reverserett.org) Rett Syndrome Association of Australia (RSAA) Army of Us (armyofus.org) Σι είναι το φνδρομο Rett; Σο φνδρομο Rett είναι μια βαριά και

Διαβάστε περισσότερα

Λειτουργική νευροανατομία Νευρικά κφτταρα. Αλεξάνδρα Οικονόμου

Λειτουργική νευροανατομία Νευρικά κφτταρα. Αλεξάνδρα Οικονόμου Λειτουργική νευροανατομία Νευρικά κφτταρα Αλεξάνδρα Οικονόμου Τα είδη κυττάρων Νευρϊνεσ 100 δις. μεταφζρουν πλθροφορίεσ θλεκτροχθμικι μετάδοςθ Νευρογλοία 10 φορζσ μικρότερα από τουσ νευρϊνεσ 10 φορζσ περιςςότερα

Διαβάστε περισσότερα

ΠΡΩΙΜΕ ΕΠΙΠΣΩΕΙ ΣΗ ΠΑΧΤΑΡΚΙΑ ΣΟ ΚΑΡΔΙΑΓΓΕΙΑΚΟ ΤΣΗΜΑ ΣΩΝ ΠΑΙΔΙΩΝ

ΠΡΩΙΜΕ ΕΠΙΠΣΩΕΙ ΣΗ ΠΑΧΤΑΡΚΙΑ ΣΟ ΚΑΡΔΙΑΓΓΕΙΑΚΟ ΤΣΗΜΑ ΣΩΝ ΠΑΙΔΙΩΝ ΠΡΩΙΜΕ ΕΠΙΠΣΩΕΙ ΣΗ ΠΑΧΤΑΡΚΙΑ ΣΟ ΚΑΡΔΙΑΓΓΕΙΑΚΟ ΤΣΗΜΑ ΣΩΝ ΠΑΙΔΙΩΝ Κυριακή Παπαδοποφλου-Λεγμπζλου Λζκτορας Παιδιατρικής-Παιδοκαρδιολογίας ΑΠΘ ΔϋΠαιδιατρικι Κλινικι Νοςοκομείο «Παπαγεωργίου» Θεςςαλονίκθ Η

Διαβάστε περισσότερα

Πανελλαδικε σ Εξετα ςεισ Γ Τα ξησ Ημερη ςιου και Δ Τα ξησ Εςπερινου Γενικου Λυκει ου

Πανελλαδικε σ Εξετα ςεισ Γ Τα ξησ Ημερη ςιου και Δ Τα ξησ Εςπερινου Γενικου Λυκει ου Ζνωςθ Ελλινων Χθμικϊν Πανελλαδικε σ Εξετα ςεισ Γ Τα ξησ Ημερη ςιου και Δ Τα ξησ Εςπερινου Γενικου Λυκει ου Χημεία 03/07/2017 Τμιμα Παιδείασ και Χθμικισ Εκπαίδευςθσ 0 Πανελλαδικε σ Εξετα ςεισ Γ Τα ξησ Ημερη

Διαβάστε περισσότερα

Εξαρτιςεισ -Ναρκωτικά

Εξαρτιςεισ -Ναρκωτικά Εξαρτιςεισ -Ναρκωτικά Η ομάδα μασ φζτοσ κα αςχολθκεί με το κζμα των εξαρτιςεων το οποίο είναι πολφ διευρυμζνο ςτισ μζρεσ μασ. Θα ςασ αναφζρουμε πολλζσ πλθροφορίεσ για τισ εξαρτιςεισ. Επίςθσ κα κζλαμε να

Διαβάστε περισσότερα

Πωσ δθμιουργώ φακζλουσ;

Πωσ δθμιουργώ φακζλουσ; Πωσ δθμιουργώ φακζλουσ; Για να μπορζςετε να δθμιουργιςετε φακζλουσ ςτο χαρτοφυλάκιό ςασ ςτο Mahara κα πρζπει να μπείτε ςτο ςφςτθμα αφοφ πατιςετε πάνω ςτο ςφνδεςμο Mahara profiles από οποιοδιποτε ςελίδα

Διαβάστε περισσότερα

ΕΝΟΣΗΣΑ 1: ΓΝΩΡIΖΩ ΣΟΝ ΤΠΟΛΟΓΙΣΗ. ΚΕΦΑΛΑΙΟ 2: Σο Τλικό του Τπολογιςτι

ΕΝΟΣΗΣΑ 1: ΓΝΩΡIΖΩ ΣΟΝ ΤΠΟΛΟΓΙΣΗ. ΚΕΦΑΛΑΙΟ 2: Σο Τλικό του Τπολογιςτι ΕΝΟΣΗΣΑ 1: ΓΝΩΡIΖΩ ΣΟΝ ΤΠΟΛΟΓΙΣΗ ΚΕΦΑΛΑΙΟ 2: Σο Τλικό του Τπολογιςτι Τλικό υπολογιςτι (Hardware), Προςωπικόσ Τπολογιςτισ (ΡC), υςκευι ειςόδου, υςκευι εξόδου, Οκόνθ (Screen), Εκτυπωτισ (Printer), αρωτισ

Διαβάστε περισσότερα

Εγχειρίδιο Χριςθσ τθσ διαδικτυακισ εφαρμογισ «Υποβολι και παρακολοφκθςθ τθσ ζγκριςθσ Εκπαιδευτικών Πακζτων»

Εγχειρίδιο Χριςθσ τθσ διαδικτυακισ εφαρμογισ «Υποβολι και παρακολοφκθςθ τθσ ζγκριςθσ Εκπαιδευτικών Πακζτων» Εγχειρίδιο Χριςθσ τθσ διαδικτυακισ εφαρμογισ «Υποβολι και παρακολοφκθςθ τθσ ζγκριςθσ Εκπαιδευτικών Πακζτων» Το Πλθροφοριακό Σφςτθμα τθσ δράςθσ «e-κπαιδευτείτε» ζχει ςτόχο να αυτοματοποιιςει τισ ακόλουκεσ

Διαβάστε περισσότερα

ANA, anti-dna, anti-ena

ANA, anti-dna, anti-ena ANA, anti-dna, anti-ena Κλινικι και Προγνωςτικι Αξιολόγθςθ ΣΑΜΑΣΗ-ΝΙΚΟ ΛΙΟΗ Αναπλθρωτισ Κακθγθτισ Δ/ντισ: Ρευματολογικό Σμιμα Πανεπιςτθμιακι Πακολογικι Κλινικι Ιατρικι χολι Παν/μίου Πατρών ΑΝΑ Πρόκειται

Διαβάστε περισσότερα

Ανϊτερεσ πνευματικζσ λειτουργίεσ Μνιμθ Μάκθςθ -Συμπεριφορά

Ανϊτερεσ πνευματικζσ λειτουργίεσ Μνιμθ Μάκθςθ -Συμπεριφορά Ανϊτερεσ πνευματικζσ λειτουργίεσ Μνιμθ Μάκθςθ -Συμπεριφορά Οδθγίεσ Προτείνεται να γίνει ςαφισ ο ρόλοσ κάκε τμιματοσ του ΚΝΣ και να αναδειχκεί θ ςχζςθ που ζχουν τα μζρθ αυτά με τισ ανϊτερεσ πνευματικζσ

Διαβάστε περισσότερα

ΑΣΛΑΝΣΙΚΗ ΕΝΩΗ ΠΑΝΕΤΡΩΠΑΪΚΟ STRESS TEST ΑΦΑΛΙΣΙΚΩΝ ΕΣΑΙΡΙΩΝ ΑΠΟΣΕΛΕΜΑΣΑ 2014

ΑΣΛΑΝΣΙΚΗ ΕΝΩΗ ΠΑΝΕΤΡΩΠΑΪΚΟ STRESS TEST ΑΦΑΛΙΣΙΚΩΝ ΕΣΑΙΡΙΩΝ ΑΠΟΣΕΛΕΜΑΣΑ 2014 ΑΣΛΑΝΣΙΚΗ ΕΝΩΗ ΠΑΝΕΤΡΩΠΑΪΚΟ STRESS TEST ΑΦΑΛΙΣΙΚΩΝ ΕΣΑΙΡΙΩΝ ΑΠΟΣΕΛΕΜΑΣΑ 2014 τθ διάρκεια του τρζχοντοσ ζτουσ εξελίχκθκε θ ευρωπαϊκι άςκθςθ προςομοίωςθσ ακραίων καταςτάςεων για τισ Αςφαλιςτικζσ Εταιρίεσ

Διαβάστε περισσότερα

Ασκήσεις βιολογίας. Καρυότυποσ-DNA. Φιρφιρισ Χριςτοσ ΦΡΟΝΣΙΣΗΡΙΑ ΠΡΟΟΠΣΙΚΗ 1

Ασκήσεις βιολογίας. Καρυότυποσ-DNA. Φιρφιρισ Χριςτοσ ΦΡΟΝΣΙΣΗΡΙΑ ΠΡΟΟΠΣΙΚΗ 1 Παράδειγμα 1. Ο ανκρώπινοσ καρυότυποσ διακζτει 46 χρωμοςώματα και το ανκρώπινο γονιδίωμα 3x10 9 ηεφγθ βάςεων. Από τα παραπάνω βιοχθμικά δεδομζνα,τι μποροφμε να γνωρίηουμε για το γενετικό υλικό των ανκρωπίνων

Διαβάστε περισσότερα

Οδηγίεσ προσ τουσ εκπαιδευτικοφσ για το μοντζλο του Άβακα

Οδηγίεσ προσ τουσ εκπαιδευτικοφσ για το μοντζλο του Άβακα Οδηγίεσ προσ τουσ εκπαιδευτικοφσ για το μοντζλο του Άβακα Αυτζσ οι οδθγίεσ ζχουν ςτόχο λοιπόν να βοθκιςουν τουσ εκπαιδευτικοφσ να καταςκευάςουν τισ δικζσ τουσ δραςτθριότθτεσ με το μοντζλο του Άβακα. Παρουςίαςη

Διαβάστε περισσότερα

ΗΛΕΚΣΡΟΝΙΚΗ ΤΠΗΡΕΙΑ ΑΠΟΚΣΗΗ ΑΚΑΔΗΜΑΪΚΗ ΣΑΤΣΟΣΗΣΑ

ΗΛΕΚΣΡΟΝΙΚΗ ΤΠΗΡΕΙΑ ΑΠΟΚΣΗΗ ΑΚΑΔΗΜΑΪΚΗ ΣΑΤΣΟΣΗΣΑ ΗΛΕΚΣΡΟΝΙΚΗ ΤΠΗΡΕΙΑ ΑΠΟΚΣΗΗ ΑΚΑΔΗΜΑΪΚΗ ΣΑΤΣΟΣΗΣΑ Οδηγός Χρήσης Εφαρμογής Ελέγχου Προσφορών Αφοφ πιςτοποιθκεί ο λογαριαςμόσ που δθμιουργιςατε ςτο πρόγραμμα ωσ Πάροχοσ Προςφορϊν, κα λάβετε ζνα e-mail με

Διαβάστε περισσότερα

NanoTech micro. Κερδίςτε τθ μάχθ απζναντι ςτα Βακτιρια!

NanoTech micro. Κερδίςτε τθ μάχθ απζναντι ςτα Βακτιρια! NanoTech micro Κερδίςτε τθ μάχθ απζναντι ςτα Βακτιρια! Κερδίςτε τθ μάχθ απζναντι ςτα Βακτιρια 2 Κερδίςτε τθ μάχθ απζναντι ςτα Βακτιρια Η καταπολζμθςθ των Βακτθρίων αποτελεί πρωταρχικό ςτόχο Οι χϊροι των

Διαβάστε περισσότερα

Rivensco Consulting Ltd 1B Georgiou Gemistou street Strovolos Nicosia Cyprus tel tel

Rivensco Consulting Ltd 1B Georgiou Gemistou street Strovolos Nicosia Cyprus tel tel Erasmus+ Programme Strategic Partnership Project Title: One Minute May Save A Life No. project: 2015-1-RO01-KA202-014982 Rivensco Consulting Ltd 1B Georgiou Gemistou street Strovolos Nicosia Cyprus tel

Διαβάστε περισσότερα

Προγραμματιςμόσ Διδακτζασ Ύλησ Βιολογίασ Γυμναςίου Γ (Πιλοτικά) 2015-2016 Α ΣΕΣΡΑΜΗΝΟ Ενότητα Δραςτηριότητεσ Βαςικζσ Ζννοιεσ Δ/κζσ

Προγραμματιςμόσ Διδακτζασ Ύλησ Βιολογίασ Γυμναςίου Γ (Πιλοτικά) 2015-2016 Α ΣΕΣΡΑΜΗΝΟ Ενότητα Δραςτηριότητεσ Βαςικζσ Ζννοιεσ Δ/κζσ Προγραμματιςμόσ Διδακτζασ Ύλησ Βιολογίασ Γυμναςίου Γ (Πιλοτικά) 2015-2016 Α ΣΕΣΡΑΜΗΝΟ Ενότητα Δραςτηριότητεσ Βαςικζσ Ζννοιεσ Δ/κζσ Γνωριμία Ενότητα 1: Αναζηηώνηαρ ηοςρ Αγνοούμενούρ μαρ... Π/δοι Ειςαγωγικζσ

Διαβάστε περισσότερα

Θεςιακά ςυςτιματα αρίκμθςθσ

Θεςιακά ςυςτιματα αρίκμθςθσ Θεςιακά ςυςτιματα αρίκμθςθσ Δρ. Χρήστος Ηλιούδης αρικμθτικό ςφςτθμα αρίκμθςθσ (Number System) Αξία (value) παράςταςθ Οι αξίεσ (π.χ. το βάροσ μιασ ποςότθτασ μιλων) μποροφν να παραςτακοφν με πολλοφσ τρόπουσ

Διαβάστε περισσότερα

ΠΤΡΟ ΤΓΓΕΛΑΚΗ ΒΙΟΛΟΓΙΑ. Γ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΚΕΥΑΛΑΙΟ 4 ο ΣΕΦΝΟΛΟΓΙΑ ΑΝΑΤΝΔΤΑΜΕΝΟΤ DNA (ΘΕΩΡΙΑ)

ΠΤΡΟ ΤΓΓΕΛΑΚΗ ΒΙΟΛΟΓΙΑ. Γ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΚΕΥΑΛΑΙΟ 4 ο ΣΕΦΝΟΛΟΓΙΑ ΑΝΑΤΝΔΤΑΜΕΝΟΤ DNA (ΘΕΩΡΙΑ) ΠΤΡΟ ΤΓΓΕΛΑΚΗ ΒΙΟΛΟΓΙΑ ΕΝΟΣΗΣΑ 1 Γ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΚΕΥΑΛΑΙΟ 4 ο ΣΕΦΝΟΛΟΓΙΑ ΑΝΑΤΝΔΤΑΜΕΝΟΤ DNA (ΘΕΩΡΙΑ) ΕΡΩΣΗΕΙ ΘΕΩΡΙΑ ΜΕ ΧΗΜΑΣΑ ΚΑΙ ΕΠΙΗΜΑΝΕΙ ΕΡΩΣΗΕΙ ΠΟΛΛΑΠΛΗ ΕΠΙΛΟΓΗ ΕΡΩΣΗΕΙ ΣΤΠΟΤ ΩΣΟ ΛΑΘΟ ΕΡΩΣΗΕΙ ΚΡΙΕΩ

Διαβάστε περισσότερα

Είναι μια μελζτθ αςκενι-μάρτυρα (case-control). Όςοι ςυμμετζχουν ςτθν μελζτθ ζχουν επιλεγεί με βάςθ τθν ζκβαςθ.

Είναι μια μελζτθ αςκενι-μάρτυρα (case-control). Όςοι ςυμμετζχουν ςτθν μελζτθ ζχουν επιλεγεί με βάςθ τθν ζκβαςθ. Ερϊτθςθ 1 Μια μελζτθ πραγματοποιείται για να εξετάςει αν θ μετεμμθνοπαυςιακι ορμονικι κεραπεία ζχει προςτατευτικό ρόλο για τθν πρόλθψθ εμφράγματοσ του μυοκαρδίου. 1013 γυναίκεσ με οξφ ζμφραγμα του μυοκαρδίου

Διαβάστε περισσότερα

Πειραματικι Ψυχολογία (ΨΧ66)

Πειραματικι Ψυχολογία (ΨΧ66) Πειραματικι Ψυχολογία (ΨΧ66) Διδάςκουςα: Αλεξάνδρα Οικονόμου Παρουςίαςη διαλζξεων: Πζτροσ Ροφςςοσ Διάλεξη 1 Ειςαγωγι Αντικείμενο και τρόποσ λειτουργίασ του μακιματοσ Τι είναι επιςτιμθ; Καλωςορίςατε ςτο

Διαβάστε περισσότερα

Νζεσ Τάςεισ ςτην εκπαιδευτική διαδικαςία: Gamification

Νζεσ Τάςεισ ςτην εκπαιδευτική διαδικαςία: Gamification Νζεσ Τάςεισ ςτην εκπαιδευτική διαδικαςία: Gamification Δρ. Παναγιϊτθσ Ζαχαριάσ Οικονομικό Πανεπιςτιμιο Ακθνϊν - 15/5/2014 Ημερίδα με κζμα: «Οικονομία τθσ Γνϊςθσ: Αξιοποίθςθ τθσ καινοτομίασ ςτθ Β Βάκμια

Διαβάστε περισσότερα

Ακράτεια οφρων είναι οποιαςδιποτε μορφισ ακοφςια απώλεια οφρων.

Ακράτεια οφρων είναι οποιαςδιποτε μορφισ ακοφςια απώλεια οφρων. Σί είναι η ακράτεια οφρων; Ακράτεια οφρων είναι οποιαςδιποτε μορφισ ακοφςια απώλεια οφρων. Ποιά είναι η επίπτωςή τησ ςτο γυναικείο πληθυςμό; Γενικά 27% των γυναικών κα παρουςιάςουν κάποιο τφπο ακράτειασ

Διαβάστε περισσότερα

Διαχείριςη Αριθμοδεικτών (v.1.0.7)

Διαχείριςη Αριθμοδεικτών (v.1.0.7) Διαχείριςη Αριθμοδεικτών (v.1.0.7) Περιεχόμενα 1. Μενοφ... 5 1.1 Αρικμοδείκτεσ.... 5 1.1.1 Δθμιουργία Αρικμοδείκτθ... 6 1.1.2 Αντιγραφι Αρικμοδείκτθ... 11 2. Παράμετροι... 12 2.1.1 Κατθγορίεσ Αρικμοδεικτϊν...

Διαβάστε περισσότερα

τατιςτικά ςτοιχεία ιςτότοπου Κ.Ε.Π.Α. Α.Ν.Ε.Μ, www.e-kepa.gr για τθν περίοδο 1/1/2011-31/12/2014

τατιςτικά ςτοιχεία ιςτότοπου Κ.Ε.Π.Α. Α.Ν.Ε.Μ, www.e-kepa.gr για τθν περίοδο 1/1/2011-31/12/2014 τατιςτικά ςτοιχεία ιςτότοπου Κ.Ε.Π.Α. Α.Ν.Ε.Μ, www.e-kepa.gr για τθν περίοδο 1/1/2011-31/12/2014 Ειςαγωγι Στο παρόν κείμενο παρουςιάηονται και αναλφονται τα ςτατιςτικά ςτοιχεία του ιςτοτόπου τθσ ΚΕΠΑ-ΑΝΕΜ,

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ Η ΤΑΞΗ ΤΗΣ ΤΕΛΙΚΗΣ ΕΠΙΛΟΓΗΣ. Στθ ΓϋΛυκείου οι Ομάδεσ Προςανατολιςμοφ είναι τρεισ:

Γ' ΛΥΚΕΙΟΥ Η ΤΑΞΗ ΤΗΣ ΤΕΛΙΚΗΣ ΕΠΙΛΟΓΗΣ. Στθ ΓϋΛυκείου οι Ομάδεσ Προςανατολιςμοφ είναι τρεισ: Γ' ΛΥΚΕΙΟΥ Η ΤΑΞΗ ΤΗΣ ΤΕΛΙΚΗΣ ΕΠΙΛΟΓΗΣ Στθ ΓϋΛυκείου οι Ομάδεσ Προςανατολιςμοφ είναι τρεισ: 1. Ομάδα Ανκρωπιςτικών Σπουδών 2. Ομάδα Οικονομικών, Πολιτικών, Κοινωνικών & Παιδαγωγικών Σπουδών 3. Ομάδα Θετικών

Διαβάστε περισσότερα

Βαριά μυαςθζνεια Myasthenia gravis. Αλεξάνδρα Οικονόμου

Βαριά μυαςθζνεια Myasthenia gravis. Αλεξάνδρα Οικονόμου Βαριά μυαςθζνεια Myasthenia gravis Αλεξάνδρα Οικονόμου Περιγραφή Νευρομυϊκι αναπθρία από ελάττωςθ του αρικμοφ των υποδοχζων ACh ςτθ νευρομυϊκι ςφναψθ Διαταραχι αυτοανοςίασ: Ο αςκενισ παράγει αντιςϊματα

Διαβάστε περισσότερα

Παράγοντεσ υμμετοχήσ Ενηλίκων ςτην Εκπαίδευςη: Ζητήματα Κινητοποίηςησ και Πρόςβαςησ ςε Οργανωμζνεσ Εκπαιδευτικζσ Δραςτηριότητεσ

Παράγοντεσ υμμετοχήσ Ενηλίκων ςτην Εκπαίδευςη: Ζητήματα Κινητοποίηςησ και Πρόςβαςησ ςε Οργανωμζνεσ Εκπαιδευτικζσ Δραςτηριότητεσ ΑΡΙΣΟΣΕΛΕΙΟ ΠΑΝΕΠΙΣΗΜΙΟ ΘΕΑΛΟΝΙΚΗ ΑΝΟΙΚΣΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΣΑ Παράγοντεσ υμμετοχήσ Ενηλίκων ςτην Εκπαίδευςη: Ζητήματα Κινητοποίηςησ κα