O rnam en ta l Sunflower

Σχετικά έγγραφα
The D iversity of Flower Color of the O rnam en ta l Sunflower and the Rela tion to An thocyan in s

1987, 3 ; ; RNA, , 1988, van der Krol. (chalcone synthase,chs) ,,,, (antisense) 112 ( sense suppression cosuppression)

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Effects of Plan t Growth Regula tors on the Con ten t of Phenolics in Sweet Cherry D orman t Flower Buds and D ormancy

Progress in breeding techniques of ornamental plants

China B iotechnology, 2005, 25 (12) : pcamb IA21201 DH5 1. 2

C lon ing of 62phosphoglucona te D ehydrogena se Gene ( 6PGD H ) and M olecu2 lar Conf irma tion of A llotetraplo id in C ucum is

Science of Sericulture

Error ana lysis of P2wave non2hyperbolic m oveout veloc ity in layered media

Stud ies on Spore Propaga tion of P teris cretica A lbo2linea ta

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

(A ntifreeze p roteins, A FP s) (afp ),

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

WANG L i2na 1, YANG Feng2juan 1, WANG Xiu2feng 13, SH IQ ing2hua 1, W E IM in 1, and HU Xiang2yang 2

Identification of Fish Species using DNA Method

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Genetic Rela tion sh ip of Som e Cultivars of Petun ia Hybr ids Using SRAP M arker

Studies on Synthesis and Biological Activities of 2( 1 H21,2,42 Triazol212yl)2 2Arylthioethyl Substituted Phenyl Ketones

DNA2ITS, Iden tif ica tion of C o lle to trichum sp. from A n thu rium and raeanum and Its Sequenc ing of R ibosoma l D NA2ITS

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

D etection on the Sen sitiv ity of Pota to Phytoph thora infestans to M eta laxyl and Cym oxan il

The RNA interference efficiency of glutathione S-transferases from Locusta migratoria manilensis

X,60. Umiel,, Griesbach,, China Academic Journal Electronic Publishing House. All rights reserved ,Vol. 22,No.

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

(N , 22 ),

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Retrieval of Seismic Data Recorded on Open-reel-type Magnetic Tapes (MT) by Using Existing Devices

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Application of a novel immune network learn ing algorithm to fault diagnosis

Quick algorithm f or computing core attribute

ER-Tree (Extended R*-Tree)

Shiraia sp. Slf14 III

Congruence Classes of Invertible Matrices of Order 3 over F 2

Evaluation of Resistance to Scab in Pear Germplasms

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Arbitrage Analysis of Futures Market with Frictions

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

,,, (, ) , ;,,, ; -

GPS, 0. 5 kg ( In tegrated Fertility Index, IF I) 1. 1 SPSS 10. IF I =

Nguyen Hien Trang* **

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΜΗΧΑΝΙΚΩΝ ΦΥΣΙΚΩΝ ΠΟΡΩΝ& ΠΕΡΙΒΑΛΛΟΝΤΟΣ

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Supporting Information

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Approximation Expressions for the Temperature Integral

Analysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius

ΑΝΑΠΤΥΞΗ ΠΡΟΓΡΑΜΜΑΤΩΝ ΕΚΠΑΙΔΕΥΣΗΣ ΜΕ ΣΤΟΧΟ ΤΗΝ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΥΑΙΣΘΗΤΟΠΟΙΗΣΗ ΑΤΟΜΩΝ ΜΕ ΕΙΔΙΚΕΣ ΑΝΑΓΚΕΣ ΚΑΙ ΤΗΝ ΚΟΙΝΩΝΙΚΗ ΤΟΥΣ ΕΝΣΩΜΑΤΩΣΗ

Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog

TABLE OF CONTENTS Page

Μέτρηση της Ρυθµικής Ικανότητας σε Μαθητές Γυµνασίου που Ασχολούνται µε Αθλητικές ραστηριότητες Συνοδευµένες ή Όχι από Μουσική

OPN antisense oligodeoxynucleotide inhibits p roliferation and apop tosis of human breast carcinoma cell line

Journal of the CUN(Natural Sciences Edition) ...

(T rip tery g ium w ilf ord ii Hook) ,Beroza [6 ] 4 W ilfo rine W ilfo rdine W ilfo rgine W il2. Euon ine 1. 0% 1980, 1. 1 ; 1. 0%, ; 0.

China Academic Journal Electronic Publishing House. All rights reserved. O ct., 2005

MSM Men who have Sex with Men HIV -

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

High order interpolation function for surface contact problem

RcHSP1718, E1coli BL21, 2 S tate Key L aboratory of Genetic Engineering, School of L ife Science,

EE512: Error Control Coding

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Οι επιδόσεις Ελλήνων στο Mini Mental State Examination με βάση την ηλικία και τη νοητική κατάσταση από την παιδική στην τρίτη ηλικία.

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

D etection of S traw berry m ild yellow edge virus w ith RT2PCR and Ana lysis of the Sequences of 3π Term ina l Reg ion

ΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.

ΙΩΑΝΝΗ ΑΘ. ΠΑΠΑΪΩΑΝΝΟΥ

New Cytotoxic Constituents from the Red Sea Soft Coral Nephthea sp.

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

Stem Character istics of W heat w ith Stem L odging and Effects of L odging on Gra in Y ield and Qual ity

«Συντήρηση αχλαδιών σε νερό. υπό την παρουσία σπόρων σιναπιού (Sinapis arvensis).»

ΦΩΤΟΓΡΑΜΜΕΤΡΙΚΕΣ ΚΑΙ ΤΗΛΕΠΙΣΚΟΠΙΚΕΣ ΜΕΘΟΔΟΙ ΣΤΗ ΜΕΛΕΤΗ ΘΕΜΑΤΩΝ ΔΑΣΙΚΟΥ ΠΕΡΙΒΑΛΛΟΝΤΟΣ

Polyvinyl Chloride PVC, The effects of organotin thermal stabilizers on the dehydrochlorination of TPUΠPVC blends

Peng Futian, Peng Yong, Zhou Peng, and Zhang Shoushi

ACTA SCIEN TIAE CIRCUMSTAN TIAE

ΓΗΠΛΧΜΑΣΗΚΖ ΔΡΓΑΗΑ ΑΡΥΗΣΔΚΣΟΝΗΚΖ ΣΧΝ ΓΔΦΤΡΧΝ ΑΠΟ ΑΠΟΦΖ ΜΟΡΦΟΛΟΓΗΑ ΚΑΗ ΑΗΘΖΣΗΚΖ

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙO ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΞΙΟΠΟΙΗΣΗΣ ΦΥΣΙΚΩΝ ΠΟΡΩΝ & ΓΕΩΡΓΙΚΗΣ ΜΗΧΑΝΙΚΗΣ

6 cm, 1. 2 IAA, NAA, 2. 1

Supporting Information

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Supporting Information. Research Center for Marine Drugs, Department of Pharmacy, State Key Laboratory

Supplementary Information for

Rub isco. Rubisco. R ubisco R ubisco , R ubisco

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΑΓΩΓΗΣ

JOURNAL OF BEIJ ING FORESTRY UNIVERSITY

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

M in ing Recursive Function s Ba sed on Gene Expression Programm ing

Transcript:

2009, 36 (1) : 73-80 Acta Horticulturae Sinica 1, 2, 1, 13, 1, 1, 1, 1 ( 1, 350002; 2, 510640) :, ( Helianthus annuus L. ) PAL CHS CH I F3 H D FR AN S 6, 6, 95% 97% 83% 99% 64% 80% 80% 82% 64% 85% 87% 89% 6 RT2PCR, CHS, 6 ;,, ;, : ; ; ; : S 681 : A : 05132353X (2009) 0120073208 C lon ing and Expression of Genes Involved O rnam en ta l Sunflower in An thocyan in s Syn thesis in ZHANG J ian2liang 1, 2, PAN Da2ren 1, ZHOU Yi2fei 13, WANG Zhan2cheng 1, HUA Shu2mei 1, HOU L i2li 1, and SU I Fen2fen 1 ( 1 College of C rop Science, Fujian A griculture and Forestry U niversity, Fuzhou 350002, China; 2 C rop R esearch Institute, Guang2 dong A cadem y of A gricultural Science, Guangzhou 510640, China) Abstract: Six structural genes ( PAL, CHS, CH I, F3 H, D FR, AN S ) involved in anthocyanins synthesis were cloned from the ray florets of ornamental sunflower ( Helian thus annuus L. ) by homology sequence clo2 ning. Sequence analysis showed that these genes shared high sim ilarity w ith genes from other p lants, ranging from 95% - 97%, 83% - 99%, 64% - 80%, 80% - 82%, 64% - 85% and 87% - 89%, respectively. results of phylogenetic analysis were in agreement w ith that described in p lant taxonom y. Sem i2quantitative RT2PCR indicated that the transcrip ts of all six genes were detected in ray florets, tubular florets, buds, leav2 es, and barks excep t that the transcrip t of CHS was not detected in tubular florets. structural genes were higher in first florescence and full bloom periods and then decreased. The Exp ression levels of most The transcrip ts of these genes were higher in purp le petals than in chocolate petals, and higher in petalwith deep color than with multi2color. Key words: ornam ental sunflower; anthocyanin; cloning; gene exp ression (Helianthus annuus L. ),, ( anthocyanins), : 2008-07 - 18; : 2008-10 - 13 : (2007J0055) ; (JB04307) 3 Author for correspondence ( E2mail: fjyifei@yahoo1com1cn)

74 36 (Holton & Cornish, 1995;, 2008), ( Farzad et al., 2003) ( PAL ) (CHS ) (CH I) 3 - ( F3 H) 4 - (D FR ) (ANS ) 6, RT2PCR, 1 111 R ing of Fire (,, ) Mouling Rouge (, ) Autumn Beauty (, ) Joker (,, ) Ikarus (, ) ( 1) 5 2007 7, F ig. 1 1 The ornam en ta l sunflower w ith d ifferen t ray flora l colors

1 : 75 112,, 1 Target gene Primer code Sequence of p rimer 1 Table 1 Prim ers used in am plif ica tion Target gene Primer code Sequence of p rimer PAL PAL2F 5 2ACGTGGATCCCAYGGIGGIAAYTTYCARGG23 CHS CHS2F 5 2TCCCAACATGTGTGC23 PAL2R 5 2ACGTGGATCCACRTCYTGRTTRTGYTGYTC23 CHS2R 5 2GCCTTGTTGGTACAT23 D FR DFR2F 5 2CAAAGGATCCGAGAATGAAGTRATHAARCC23 CH I CH I2F 5 2GGTGTGAGAGGTATGGAAAT23 DFR2R 5 2AGAAGGATCCAAAATACATCCATCCNGTCAT23 CH I2R 5 2AGTCTTGATGCCAAACTTTG23 ANS Ans2F 5 2TSCAAAW GAAGATMAACTACTACCCMA23 Ans2R 5 2CARAARACAGCCCAW GAAAYCCTIACC23 F3 H F3 H2F F3 H2R : Y = T + C; R =A + G; W =A + T; N =A + T + G + C; H =A + T + C; D =A + G + T; I = Note: Y = T + C; R =A + G; W =A + T; N =A + T + G + C; H =A + T + C; D =A + G + T; I = Inosine. 5 2TATTCGCCAGGAGGAGGTT23 5 2TCGGCAAGGATAGTGGTGT23 113 RNA cd NA R ing of Fire 5 ; 4 ; R ing of Fire Mouling Rouge Autumn Beauty Joker Ikarus 5, TR Izol Reagent ( Invitrigen ) RNA DNase 37 DNA 500 g RNA, PrimeScrip t TM 1 st Strand cdna Synthesis Kit ( TaKaRa ) cdna 114 m in; cdna, PAL CH I F3 H D FR AN S PCR 94 5 94 50 s, 55 45 s, 72 1 m in, 35, CHS 48 DNAMAN NCB I 115 RT2PCR PAL CHS CH I F3 H D FR AN S ( 2), 2actin ( GenBank : AF282624), PCR 94 5 m in; 94 50 s, 60 50 s, 72 1 m in, 28 Target gene Primer code Sequence of p rimer PAL PAL2F 5 2GGAGTTTCTATGGACAACACACG23 PAL2R 2 RT2PCR Table 2 Prim ers used in sem i2quan tita tive RT2PCR 5 2CCACATCTTGGTTATGCTGCT23 Target gene F3 H Primer code Sequence of p rimer F3 H2F F3 H2R 5 2GATTCGCCAGGAGGAGGTT23 5 2CGGCAAGGATAGTGGTGTTG23 CHS CHS2F 5 2AATGCCACGTCCTTAGACGATA23 D FR DFR2F 5 2CAAAGGATCCGAGAATGAAGTG23 CHS2R 5 2CATCATAAACCGCTTGACCG23 DFR2R 5 2AGAAGGATCCAAAATACATCCATCC23 CH I CH I2F 5 2GGTGTGAGAGGTATGGAAAT23 ANS Ans2F 5 2TGCAAAAGAAGATCAACTACTACCC23 CH I2R 5 2AGTCTTGATGCCAAACTTTG23 Ans2R 5 2GAAGACAGCCCAAGAAACCC23 2actin Actin2F 5 2CCTATTGAACACGGTATTGTCAGC23 Action2R 5 2CTCTCTGCTCCGATTGTGATAACT23

76 36 2 211 RNA RNA P IPES 3 ( 2), RNA, RNA A260 /A280 118 210, RNA, RNA F ig. 2 RNA 2 Electrophoresis of tota l RNA of peta l of ornam en ta l sunflower 212, R ing of Fire cdna PCR, PAL CHS CH I F3 H D FR AN S 6, 303 232 527 686 227 286 bp, 100 76 175 228 75 94, 6 PAL /, CHS, F3 H P450, ANS N PAL 1 5 (HNQDV ) ; CHS, T132 M137 1 S133 ; ANS ANS 1 [L (V) GVEAHTDVS], 1 ; CH I F3 H DFR DNAMAN 610 (Chrysanthem um ) (Gerbera hybrid) (Glycine m ax) (V itis vinifera) (A rabidopsis thaliana) (A ntirrhinum m ajus) (M alus) ( Ipom oea purpurea) (O ryza sativa) ( Zea m ays) ( Triti2 cum aestivum ) 6 3,, ;, PAL 90% CHS 90%, CHS CH I F3 H D FR AN S

1 : 77

78 36 213 21311 4, 6,, CHS 21312 5, PAL CHS F3 H, ; CHS CH I D FR, AN S,, 214 6, PAL 5 CHS Joker R ing of Fire, Ikarus CH I Mouling Rouge Autumn Beauty, 3 F3 H Mouling Rouge, R ing of Fire Autumn Beauty, Joker Ikarus D FR R ing of Fire Mouling Rouge Autumn Beauty, Joker Ikarus AN S Mouling Rouge Autumn Beauty, R ing of Fire Joker, Ikarus

1 : 79 3 6 PAL CHS CH I F3 H D FR ANS F ig. 6 Expression of PAL, CHS, CH I, F3 H, D FR and ANS in ray floret w ith d ifferen t color from ornam en ta l sunflower 1: R ing of Fire ; 2: Mouling Rouge ; 3: Autumn Beauty ; 4: Joker ; 5: Ikarus. 311 :, PAL CHS CH I;, D FR AN S U F3GT R ing of Fire PAL ( GenBank : EF566469) CHS CH I ( Gen2 Bank : EF492066) AN S EU366166 ) F3 H ( GenBank : EU366167 ) D FR ( GenBank : ( GenBank : DQ884194) 6 6, 6, CH I 2 ( PAL CHS ) 3 ( F3 H D FR AN S ), Rausher (1999),, ( Sakuda, 2000; Lu & Rausher, 2003) 312 D FR ( Inagaki et al., 1999) CHS (Martin & Gerats, 1993) 6, ;, ( Katz & W eiss, 1998; W eiss, 2000), PAL, PAL, ( Given et al., 1998) PAL CH I,,, CH I

80 36, ( Forkmann & Dangelmayr, 1980) CH I F3 H ( naringenin) F3H F3 H D FR, ( / ), F3 H ( ) ( Zufall & Rausher, 2003) D FR AN S D FR AN S, D FR AN S, F3 H D FR ANS (2008), F3 H D FR AN S 6,, References Farzad M, Griesbach R, Hammond J, W eissm R, Elmendorf H G. 2003. D ifferential expression of three anthocyanin biosynthetic genes in a col2 or2changing flower, V iola cornuta cv. Yesterday, Today and Tomorrow. Plant Sci, 165: 1333-1342. Forkmann G, Dangelmayr B. 1980. Genetic control of isomerase activity in flowers of D ianthus caryophyllus. B iochem Genetics, 18: 5-6. Given N K, VenisM A, Grierson D. 1998. Phenylalanine ammonia2lyase activity and anthocyanin synthesis in ripening strawberry fruit. J Plant Physiol, 133: 25-30. Holton T A, Cornish E C. 1995. Genetics and biochem istry of anthocyanin biosynthesis. Plant Cell, 7: 1071-1083. Inagaki Y, Johzuka2H isatom i Y, Mori T, Takahashi S, Hayakawa Y, Peyacholnagul S, Ozeki Y, Iida S. 1999. Genom ic organization of the genes encoding dihydroflavonol 42reductase for flower pigmentation in the Japanese and common morning glories. Gene, 226: 181-188. Katz A, W eiss D. 1998. Photocontrol of chs gene exp ression in petunia flowers. Plant Physiol, 102: 210-216. Lu Y, RausherM D. 2003. Evolutionary rate variation in anthocyanin pathway genes. Mol B iol Evol, 20: 1844-1853. Martin C, Gerats T. 1993. Control of pigment biosynthesis genes during petal development. Plant Cell, 5: 1253-1264. RausherM D, M iller R E, Tiffin P. 1999. Patterns of evolutionary rate variation among genes of the anthocyanin biosynthetic pathway. Mol B iol Evol, 16: 266-274. Sakuda M. 2000. Transcriptional control of chalcone synthase by environmental stimuli. J Plant Res, 113: 327-333. W eiss D. 2000. Regulation of flower pigmentation and growth: Multiple signaling pathways control anthocyanin synthesis in expanding petals. Plant Physiol, 110: 152-157. Zhang Jian2liang, Pan Da2ren, Zhou Yi2fei, W u M ing2wei, Ke Xiang2de, L in D ian. 2008. PCR2mediated modification of D FR gene from orna2 mental sunflower and construction of the geneπs p lant expression vector. J Fujian Agriculture and Forestry University: National Science Edition, 37: 166-169. ( in Chinese),,,,,. 2008. PCR D FR. :, 37: 166-169. Zhang Yuan2yuan, Q i Dong2mei, L iu Hui, Zhang Ji2chong, L i Chong2hui, Zhang Jie, W ang L iang2sheng, L iu Gong2she. 2008. The diversity of flower color of the ornamental sunflower and the relation to anthocyanins. Acta Horticulturae Sinica, 35 (6) : 863-868. ( in Chinese),,,,,,,. 2008.., 35 (6) : 863-868. Zufall R A, RausherM D. 2003. The genetic basis of a flower color polymorphism in the common morning glory ( Ipom oea purpurea). J Heredity, 94: 442-448.