2009, 36 (1) : 73-80 Acta Horticulturae Sinica 1, 2, 1, 13, 1, 1, 1, 1 ( 1, 350002; 2, 510640) :, ( Helianthus annuus L. ) PAL CHS CH I F3 H D FR AN S 6, 6, 95% 97% 83% 99% 64% 80% 80% 82% 64% 85% 87% 89% 6 RT2PCR, CHS, 6 ;,, ;, : ; ; ; : S 681 : A : 05132353X (2009) 0120073208 C lon ing and Expression of Genes Involved O rnam en ta l Sunflower in An thocyan in s Syn thesis in ZHANG J ian2liang 1, 2, PAN Da2ren 1, ZHOU Yi2fei 13, WANG Zhan2cheng 1, HUA Shu2mei 1, HOU L i2li 1, and SU I Fen2fen 1 ( 1 College of C rop Science, Fujian A griculture and Forestry U niversity, Fuzhou 350002, China; 2 C rop R esearch Institute, Guang2 dong A cadem y of A gricultural Science, Guangzhou 510640, China) Abstract: Six structural genes ( PAL, CHS, CH I, F3 H, D FR, AN S ) involved in anthocyanins synthesis were cloned from the ray florets of ornamental sunflower ( Helian thus annuus L. ) by homology sequence clo2 ning. Sequence analysis showed that these genes shared high sim ilarity w ith genes from other p lants, ranging from 95% - 97%, 83% - 99%, 64% - 80%, 80% - 82%, 64% - 85% and 87% - 89%, respectively. results of phylogenetic analysis were in agreement w ith that described in p lant taxonom y. Sem i2quantitative RT2PCR indicated that the transcrip ts of all six genes were detected in ray florets, tubular florets, buds, leav2 es, and barks excep t that the transcrip t of CHS was not detected in tubular florets. structural genes were higher in first florescence and full bloom periods and then decreased. The Exp ression levels of most The transcrip ts of these genes were higher in purp le petals than in chocolate petals, and higher in petalwith deep color than with multi2color. Key words: ornam ental sunflower; anthocyanin; cloning; gene exp ression (Helianthus annuus L. ),, ( anthocyanins), : 2008-07 - 18; : 2008-10 - 13 : (2007J0055) ; (JB04307) 3 Author for correspondence ( E2mail: fjyifei@yahoo1com1cn)
74 36 (Holton & Cornish, 1995;, 2008), ( Farzad et al., 2003) ( PAL ) (CHS ) (CH I) 3 - ( F3 H) 4 - (D FR ) (ANS ) 6, RT2PCR, 1 111 R ing of Fire (,, ) Mouling Rouge (, ) Autumn Beauty (, ) Joker (,, ) Ikarus (, ) ( 1) 5 2007 7, F ig. 1 1 The ornam en ta l sunflower w ith d ifferen t ray flora l colors
1 : 75 112,, 1 Target gene Primer code Sequence of p rimer 1 Table 1 Prim ers used in am plif ica tion Target gene Primer code Sequence of p rimer PAL PAL2F 5 2ACGTGGATCCCAYGGIGGIAAYTTYCARGG23 CHS CHS2F 5 2TCCCAACATGTGTGC23 PAL2R 5 2ACGTGGATCCACRTCYTGRTTRTGYTGYTC23 CHS2R 5 2GCCTTGTTGGTACAT23 D FR DFR2F 5 2CAAAGGATCCGAGAATGAAGTRATHAARCC23 CH I CH I2F 5 2GGTGTGAGAGGTATGGAAAT23 DFR2R 5 2AGAAGGATCCAAAATACATCCATCCNGTCAT23 CH I2R 5 2AGTCTTGATGCCAAACTTTG23 ANS Ans2F 5 2TSCAAAW GAAGATMAACTACTACCCMA23 Ans2R 5 2CARAARACAGCCCAW GAAAYCCTIACC23 F3 H F3 H2F F3 H2R : Y = T + C; R =A + G; W =A + T; N =A + T + G + C; H =A + T + C; D =A + G + T; I = Note: Y = T + C; R =A + G; W =A + T; N =A + T + G + C; H =A + T + C; D =A + G + T; I = Inosine. 5 2TATTCGCCAGGAGGAGGTT23 5 2TCGGCAAGGATAGTGGTGT23 113 RNA cd NA R ing of Fire 5 ; 4 ; R ing of Fire Mouling Rouge Autumn Beauty Joker Ikarus 5, TR Izol Reagent ( Invitrigen ) RNA DNase 37 DNA 500 g RNA, PrimeScrip t TM 1 st Strand cdna Synthesis Kit ( TaKaRa ) cdna 114 m in; cdna, PAL CH I F3 H D FR AN S PCR 94 5 94 50 s, 55 45 s, 72 1 m in, 35, CHS 48 DNAMAN NCB I 115 RT2PCR PAL CHS CH I F3 H D FR AN S ( 2), 2actin ( GenBank : AF282624), PCR 94 5 m in; 94 50 s, 60 50 s, 72 1 m in, 28 Target gene Primer code Sequence of p rimer PAL PAL2F 5 2GGAGTTTCTATGGACAACACACG23 PAL2R 2 RT2PCR Table 2 Prim ers used in sem i2quan tita tive RT2PCR 5 2CCACATCTTGGTTATGCTGCT23 Target gene F3 H Primer code Sequence of p rimer F3 H2F F3 H2R 5 2GATTCGCCAGGAGGAGGTT23 5 2CGGCAAGGATAGTGGTGTTG23 CHS CHS2F 5 2AATGCCACGTCCTTAGACGATA23 D FR DFR2F 5 2CAAAGGATCCGAGAATGAAGTG23 CHS2R 5 2CATCATAAACCGCTTGACCG23 DFR2R 5 2AGAAGGATCCAAAATACATCCATCC23 CH I CH I2F 5 2GGTGTGAGAGGTATGGAAAT23 ANS Ans2F 5 2TGCAAAAGAAGATCAACTACTACCC23 CH I2R 5 2AGTCTTGATGCCAAACTTTG23 Ans2R 5 2GAAGACAGCCCAAGAAACCC23 2actin Actin2F 5 2CCTATTGAACACGGTATTGTCAGC23 Action2R 5 2CTCTCTGCTCCGATTGTGATAACT23
76 36 2 211 RNA RNA P IPES 3 ( 2), RNA, RNA A260 /A280 118 210, RNA, RNA F ig. 2 RNA 2 Electrophoresis of tota l RNA of peta l of ornam en ta l sunflower 212, R ing of Fire cdna PCR, PAL CHS CH I F3 H D FR AN S 6, 303 232 527 686 227 286 bp, 100 76 175 228 75 94, 6 PAL /, CHS, F3 H P450, ANS N PAL 1 5 (HNQDV ) ; CHS, T132 M137 1 S133 ; ANS ANS 1 [L (V) GVEAHTDVS], 1 ; CH I F3 H DFR DNAMAN 610 (Chrysanthem um ) (Gerbera hybrid) (Glycine m ax) (V itis vinifera) (A rabidopsis thaliana) (A ntirrhinum m ajus) (M alus) ( Ipom oea purpurea) (O ryza sativa) ( Zea m ays) ( Triti2 cum aestivum ) 6 3,, ;, PAL 90% CHS 90%, CHS CH I F3 H D FR AN S
1 : 77
78 36 213 21311 4, 6,, CHS 21312 5, PAL CHS F3 H, ; CHS CH I D FR, AN S,, 214 6, PAL 5 CHS Joker R ing of Fire, Ikarus CH I Mouling Rouge Autumn Beauty, 3 F3 H Mouling Rouge, R ing of Fire Autumn Beauty, Joker Ikarus D FR R ing of Fire Mouling Rouge Autumn Beauty, Joker Ikarus AN S Mouling Rouge Autumn Beauty, R ing of Fire Joker, Ikarus
1 : 79 3 6 PAL CHS CH I F3 H D FR ANS F ig. 6 Expression of PAL, CHS, CH I, F3 H, D FR and ANS in ray floret w ith d ifferen t color from ornam en ta l sunflower 1: R ing of Fire ; 2: Mouling Rouge ; 3: Autumn Beauty ; 4: Joker ; 5: Ikarus. 311 :, PAL CHS CH I;, D FR AN S U F3GT R ing of Fire PAL ( GenBank : EF566469) CHS CH I ( Gen2 Bank : EF492066) AN S EU366166 ) F3 H ( GenBank : EU366167 ) D FR ( GenBank : ( GenBank : DQ884194) 6 6, 6, CH I 2 ( PAL CHS ) 3 ( F3 H D FR AN S ), Rausher (1999),, ( Sakuda, 2000; Lu & Rausher, 2003) 312 D FR ( Inagaki et al., 1999) CHS (Martin & Gerats, 1993) 6, ;, ( Katz & W eiss, 1998; W eiss, 2000), PAL, PAL, ( Given et al., 1998) PAL CH I,,, CH I
80 36, ( Forkmann & Dangelmayr, 1980) CH I F3 H ( naringenin) F3H F3 H D FR, ( / ), F3 H ( ) ( Zufall & Rausher, 2003) D FR AN S D FR AN S, D FR AN S, F3 H D FR ANS (2008), F3 H D FR AN S 6,, References Farzad M, Griesbach R, Hammond J, W eissm R, Elmendorf H G. 2003. D ifferential expression of three anthocyanin biosynthetic genes in a col2 or2changing flower, V iola cornuta cv. Yesterday, Today and Tomorrow. Plant Sci, 165: 1333-1342. Forkmann G, Dangelmayr B. 1980. Genetic control of isomerase activity in flowers of D ianthus caryophyllus. B iochem Genetics, 18: 5-6. Given N K, VenisM A, Grierson D. 1998. Phenylalanine ammonia2lyase activity and anthocyanin synthesis in ripening strawberry fruit. J Plant Physiol, 133: 25-30. Holton T A, Cornish E C. 1995. Genetics and biochem istry of anthocyanin biosynthesis. Plant Cell, 7: 1071-1083. Inagaki Y, Johzuka2H isatom i Y, Mori T, Takahashi S, Hayakawa Y, Peyacholnagul S, Ozeki Y, Iida S. 1999. Genom ic organization of the genes encoding dihydroflavonol 42reductase for flower pigmentation in the Japanese and common morning glories. Gene, 226: 181-188. Katz A, W eiss D. 1998. Photocontrol of chs gene exp ression in petunia flowers. Plant Physiol, 102: 210-216. Lu Y, RausherM D. 2003. Evolutionary rate variation in anthocyanin pathway genes. Mol B iol Evol, 20: 1844-1853. Martin C, Gerats T. 1993. Control of pigment biosynthesis genes during petal development. Plant Cell, 5: 1253-1264. RausherM D, M iller R E, Tiffin P. 1999. Patterns of evolutionary rate variation among genes of the anthocyanin biosynthetic pathway. Mol B iol Evol, 16: 266-274. Sakuda M. 2000. Transcriptional control of chalcone synthase by environmental stimuli. J Plant Res, 113: 327-333. W eiss D. 2000. Regulation of flower pigmentation and growth: Multiple signaling pathways control anthocyanin synthesis in expanding petals. Plant Physiol, 110: 152-157. Zhang Jian2liang, Pan Da2ren, Zhou Yi2fei, W u M ing2wei, Ke Xiang2de, L in D ian. 2008. PCR2mediated modification of D FR gene from orna2 mental sunflower and construction of the geneπs p lant expression vector. J Fujian Agriculture and Forestry University: National Science Edition, 37: 166-169. ( in Chinese),,,,,. 2008. PCR D FR. :, 37: 166-169. Zhang Yuan2yuan, Q i Dong2mei, L iu Hui, Zhang Ji2chong, L i Chong2hui, Zhang Jie, W ang L iang2sheng, L iu Gong2she. 2008. The diversity of flower color of the ornamental sunflower and the relation to anthocyanins. Acta Horticulturae Sinica, 35 (6) : 863-868. ( in Chinese),,,,,,,. 2008.., 35 (6) : 863-868. Zufall R A, RausherM D. 2003. The genetic basis of a flower color polymorphism in the common morning glory ( Ipom oea purpurea). J Heredity, 94: 442-448.