Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί η φαινοτυπική αναλογία στην F 1 γενιά. Από τη θεωρία είναι γνωστό ότι το κανονικό σχήμα του καρπού επικρατεί έναντι του περισφιγμένου. Έστω Κ=κανονικό σχήμα, κ=περιεσφιγμένο σχήμα, όπου Κ>κ Το άτομο με κανονικό σχήμα καρπού θα εμφανίζει 2 πιθανούς γονότυπους ΚΚ και Κκ. Κατά συνέπεια και με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα διακρίνουμε 2 περιπτώσεις: 1 η περίπτωση: P: ΚΚ Χ κκ Γαμέτες: Κ κ F 1 : Κκ 100% με κανονικό σχήμα καρπού 2 η περίπτωση: P: Κκ Χ κκ Γαμέτες: Κ, κ κ F 1 Κκ, κκ κανονικό περιεσφιγμένο 50% 50% 2. Από τη διασταύρωση δύο φυτών με κόκκινα άνθη παίρνουμε 282 φυτά με κόκκινα και 103 φυτά με λευκά άνθη. Ποιοι οι γονείς των αρχικών φυτών που διασταυρώθηκαν; Επειδή από τη διασταύρωση φυτών με κόκκινα άνθη προκύπτουν και φυτά με λευκά άνθη (νέο γνώρισμα) προκύπτει το συμπέρασμα ότι το κόκκινο χρώμα είναι το επικρατές και το λευκό το υπολειπόμενο. Από τη φαινοτυπική αναλογία 282 κόκκινα:103 λευκά 3 κόκκινα :1 λευκό, συμπεραίνεται ότι οι γονείς που έδωσαν απογόνους με τέτοια αναλογία θα ήταν ετερόζυγοι, ενώ οι δικοί τους γονείς θα ήταν αμιγή στελέχη, ο ένας ως προς το κόκκινο και ο άλλος ως προς το λευκό χρώμα. Κατά συνέπεια και με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα ισχύει: Κ=κόκκινο άνθος, κ=λευκό άνθος, όπου Κ>κ P: ΚΚ Χ κκ Γαμέτες: Κ κ F 1 : Κκ 100% με κόκκινο χρώμα F 1 Χ F 1 : Κκ Χ Κκ Γαμέτες: Κ, κ Κ, κ F 2 : ΚΚ, Κκ, Κκ, κκ κόκκινα (3) λευκά (1) 3. Στα ινδικά χοιρίδια από τη διασταύρωση ατόμων με μαύρο χρώμα τριχώματος γεννιούνται και άτομα με άσπρο χρώμα τριχώματος. α. Με ποιόν τρόπο είναι δυνατόν, από μαύρα άτομα, να γεννιούνται μόνο άτομα με μαύρο χρώμα τριχώματος; β. Αν διασταυρωθούν ετερόζυγα άτομα ποια είναι η πιθανότητα οι 3 πρώτοι απόγονοι που θα γεννηθούν να έχουν με τη σειρά μαύρο χρώμα τριχώματος- άσπρο χρώμα τριχώματος - μαύρο χρώμα τριχώματος; 1

2 Επειδή από τη διασταύρωση ατόμων με μαύρο χρώμα τριχώματος γεννιούνται και άτομα με άσπρο χρώμα τριχώματος (νέο γνώρισμα) προκύπτει το συμπέρασμα ότι το μαύρο χρώμα είναι το επικρατές και το λευκό το υπολειπόμενο. Έστω Μ=μαύρο τρίχωμα, μ=λευκό τρίχωμα, όπου Μ>μ α. Για να απομακρυνθούν τα ετερόζυγα μαύρα άτομα που είναι υπεύθυνα για την εμφάνιση του άσπρου χρώματος γίνεται διασταύρωση ελέγχου. Κατά συνέπεια και με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα διακρίνουμε 2 περιπτώσεις: 1 η περίπτωση: P: ΜΜ Χ μμ Γαμέτες: Μ μ F 1 : Μμ 100% με μαύρο χρώμα τριχώματος 2 η περίπτωση: P: Μμ Χ μμ Γαμέτες: Μ, μ μ F 1 Μμ, μμ μαύρο λευκό β. Μεταξύ ετερόζυγων ατόμων θα ισχύει η παρακάτω διασταύρωση: P: Μμ Χ Μμ Γαμέτες: Μ, μ Μ, μ F 1 : ΜΜ, Μμ, Μμ, μμ μαύρα (3) λευκά (1) Η πιθανότητα να γεννηθεί άτομο με μαύρο χρώμα (P μαύρο ) είναι 3/4, ενώ η πιθανότητα να γεννηθεί άτομο με άσπρο χρώμα (P λευκό ) είναι 1/4. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Κατά συνέπεια θα ισχύει: P= P μαύρο P λευκό P μαύρο = 3/4 1/4 3/4= 9/64 4. Μια θηλυκή Drosophila με κοντά φτερά διασταυρώνεται με αρσενική Drosophila που έχει μακριά φτερά. Όλα τα άτομα της F 1 γενιάς έχουν μακριά φτερά. Από τη διασταύρωση των ατόμων της F 1, προέκυψαν στην F 2 γενιά: 310 αρσενικά και 308 θηλυκά με μακριά φτερά, 101 αρσενικά και 105 θηλυκά με κοντά φτερά. α. Να βρεθούν οι γονοτυπικές και φαινοτυπικές αναλογίες της F 2 γενιάς. β. Να βρεθούν οι γονότυποι της πατρικής (P) γενιάς. Επειδή από τη διασταύρωση ατόμων με μακριά φτερά με άτομα με κοντά φτερά όλα τα άτομα της F 1 γενιάς έχουν μακριά φτερά αυτό σημαίνει ότι η μορφή (μακριά) του συγκεκριμένου χαρακτήρα (μήκος φτερών) ελέγχεται από το επικρατές αλληλόμορφο, ενώ τα κοντά φτερά ελέγχονται από το υπολειπόμενο. Από τα δεδομένα της άσκησης προκύπτει: Για τα αρσενικά: 310 με μακριά : 101 με κοντά 3 μακριά : 1 κοντά. Για τα θηλυκά: 308 με μακριά : 105 με κοντά 3 μακριά : 1 κοντά. Επειδή η φαινοτυπική αναλογία στα αρσενικά και στα θηλυκά άτομα είναι η ίδια αυτό φανερώνει ότι ο συγκεκριμένος χαρακτήρας ελέγχεται από ένα ζεύγος αυτοσωμικών γονιδίων. Επιπλέον η φαινοτυπική αναλογία 3 : 1 που εμφανίζεται στην F 2 γενιά δείχνει ότι τα άτομα της F 1 γενιάς είναι ετερόζυγα οι γονείς των οποίων είναι άτομα αμιγή. Κατά συνέπεια και με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα ισχύει: Έστω Μ=μακριά φτερά, μ=κοντά φτερά, όπου Μ>μ P: μμχχ Χ ΜΜΧΥ Γαμέτες: μχ ΜΧ, ΜΥ F 1 : ΜμΧΧ, ΜμΧΥ 100% άτομα (αρσενικά και θηλυκά) με μακριά φτερά F 1 Χ F 1 : ΜμΧΧ Χ ΜμΧΥ Γαμέτες: ΜΧ, μχ ΜΧ, ΜΥ, μχ, μυ 2

3 F 2 : ΜΜΧΧ ΜΧ Μακριά φτερά ΜμΧΧ μχ Μακριά φτερά Φ.Α : 3 μακριά : 1 κοντά Φ.Α : 3 μακριά : 1 κοντά Γ.Α : 1 ΜΜΧΥ: 2ΜμΧΥ: 1μμΧΥ Γ.Α : 1 ΜΜΧΧ: 2ΜμΧΧ: μμχχ ΜΧ μχ ΜΥ μυ ΜμΧΧ Μακριά φτερά μμχχ Κοντά φτερά ΑΥΤΟΣΩΜΙΚΑ ΑΤΕΛΩΣ ΕΠΙΚΡΑΤΗ-ΣΥΝΕΠΙΚΡΑΤΗ ΜΜΧΥ Μακριά φτερά ΜμΧΥ Μακριά φτερά ΜμΧΥ Μακριά φτερά μμχυ Κοντά φτερά 5. Από την διασταύρωση κοτόπουλων προκύπτουν στην F 2 γενιά οι ακόλουθες φαινοτυπικές αναλογίες: 25 κοτόπουλα με άσπρα πιτσιλωτά φτερά, 23 κοτόπουλα με μαύρα πιτσιλωτά φτερά και 49 κοτόπουλα που έχουν ένα μωσαϊκό μπλε χρώμα φτερών. Πως κληρονομείται το συγκεκριμένο χαρακτηριστικό και ποιοι είναι οι γονότυποι της P και F 1 γενιάς; Η φαινοτυπική αναλογία που εμφανίζεται στην F 2 γενιάς είναι η εξής: 25 άσπρα πιτσιλωτά φτερά: 49 με μωσαϊκό μπλε χρώμα φτερών: 23 μαύρα πιτσιλωτά φτερά δηλαδή περίπου 1 άσπρο: 2 μπλε μωσαϊκό: 1 μαύρο. Επειδή προκύπτουν 3 φαινότυποι από τους οποίους οι 2 είναι ακραίοι (άσπρα και μαύρα πιτσιλωτά φτερά) η κληρονόμηση του συγκεκριμένου χαρακτήρα εξηγείται με την ενδιάμεση κληρονομικότητα (στην συγκεκριμένη περίπτωση τα γονίδια είναι ατελώς επικρατή). Τα άτομα της F 1 γενιάς που δίνουν τέτοια φαινοτυπική αναλογία θα πρέπει να έχουν μωσαϊκό μπλε χρώμα φτερών (ετερόζυγα) και οι γονείς τους να είναι αμιγή άτομα. Κατά συνέπεια και με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα ισχύει: Έστω Κ 1 =Μαύρα πιτσιλωτά φτερά, Κ 2 =Άσπρα πιτσιλωτά φτερά, όπου Κ 1 =Κ 2 P: Κ 1 Κ 1 Χ Κ 2 Κ 2 Γαμέτες: Κ 1 Κ 2 F 1 : Κ 1 Κ 2 100% με μωσαϊκό μπλε χρώμα φτερών F 1 Χ F 1 : Κ 1 Κ 2 Χ Κ 1 Κ 2 Γαμέτες: Κ 1, Κ 2 Κ 1, Κ 2 F 2 : Κ 1 Κ 1, Κ 1 Κ 2, Κ 1 Κ 2, Κ 2 Κ 2 μαύρα πιτσιλωτά μωσαϊκό μπλε άσπρα πιτσιλωτά φτερά (1) χρώμα (2) φτερά (1) 6. Γυναίκα με ομάδα αίματος Α, της οποίας ο ένας γονιός είχε ομάδα αίματος Β και άνδρας με ομάδα αίματος Β παντρεύονται και κάνουν παιδί με ομάδα αίματος Α. α. Ποιες άλλες ομάδες αίματος θα μπορούσαν να είχαν τα παιδιά τους; β. Ποια η πιθανότητα το επόμενο παιδί να είναι αγόρι και να έχει την ίδια ομάδα αίματος με την μητέρα του; Τα γονίδια που καθορίζουν τον τύπο των ομάδων αίματος του ανθρώπου είναι συνεπικρατή. Η γυναίκα (ομάδα αίματος Α) θα μπορούσε να είχε γονότυπο I A I A ή I A i. Επειδή όμως ο ένας της γονιός είναι ομάδας αίματος Β ο αποδεκτός γονότυπος για την γυναίκα είναι ο I A i. Ο άνδρας με ομάδα αίματος Β θα μπορούσε να είχε γονότυπο I Β I Β ή I Β i. Επειδή όμως από τον γάμο του με την γυναίκα γεννιέται παιδί με ομάδα αίματος Α ο αποδεκτός γονότυπος είναι ο I Β i. Ο γονότυπος του παιδιού θα είναι ίδιος με της μητέρας του δηλαδή I A i. α. Με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα ισχύει: P: I A i Χ I Β i Γαμέτες: I A, i I Β, i 3

4 F 1 : I A I Β, I A i, I Β i, ii ΑΒ Α Β Ο β. Από την παραπάνω διασταύρωση γίνεται φανερό ότι η πιθανότητα το ζευγάρι να αποκτήσει παιδί με ομάδα αίματος Α είναι 1/4, ενώ η πιθανότητα να γεννηθεί αγόρι είναι 1/2. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Κατά συνέπεια η πιθανότητα να γεννηθεί αγόρι με ομάδα αίματος Α είναι: 1/4 1/2=1/8. ΦΥΛΟΣΥΝΔΕΤΑ 7. Στη Drosophila διασταύρωση θηλυκού με κανονικό μάτι με αρσενικό με στενό μάτι έχει σαν αποτέλεσμα όλοι οι θηλυκοί απόγονοι να έχουν στενό μάτι και όλοι οι αρσενικοί απόγονοι να έχουν κανονικό μάτι. Πως κληρονομείται το συγκεκριμένο χαρακτηριστικό και ποιοι είναι οι γονότυποι των ατόμων; Λόγω των διαφορετικών φαινοτυπικών αναλογιών που εμφανίζονται στους αρσενικούς και θηλυκούς απογόνους συμπεραίνεται ότι ο χαρακτήρας (το σχήμα του ματιού) ελέγχεται από ζευγάρι γονιδίων που βρίσκεται στο Χ χρωμόσωμα. Όλοι οι θηλυκοί απόγονοι έχουν τον ίδιο φαινότυπο με τον αρσενικό γονέα τους (στενό μάτι) γεγονός που σημαίνει ότι το στενό μάτι ελέγχεται από το επικρατές αλληλόμορφο και το κανονικό μάτι από το υπολειπόμενο αλληλόμορφο. Έστω Χ Σ =στενό μάτι, Χ σ =κανονικό μάτι, όπου Χ Σ >Χ σ Κατά συνέπεια και με βάση τον 1 ο αλληλόμορφων γονιδίων θα ισχύει: P: Χ σ Χ σ Χ Χ Σ Υ Γαμέτες: Χ σ Χ Σ, Υ F 1 : Χ Σ Χ σ, Χ σ Υ 100% θηλυκά με 100% αρσενικά με στενό μάτι κανονικό μάτι νόμο του Mendel ή νόμο του διαχωρισμού των 8. Γυναίκα με κανονική όραση παντρεύεται άνδρα δαλτωνικό. α. Ποια η πιθανότητα το παιδί που θα γεννηθεί να είναι δαλτωνικό; β. Ποια η πιθανότητα τα επόμενα 2 παιδιά τους να είναι δαλτωνικά; γ. Ποια η πιθανότητα τα επόμενα 2 παιδιά τους να είναι αγόρια και δαλτωνικά; δ. Εάν στην πρώτη κύηση γεννηθούν δίδυμα ποια η πιθανότητα να είναι δαλτωνικά; Όπως είναι γνωστό από το βιβλίο ο δαλτωνισμός οφείλεται σε υπολειπόμενο φυλοσύνδετο γονίδιο. Έστω Χ Δ =κανονική όραση, Χ δ =δαλτωνισμός, όπου Χ Δ >Χ δ Η γυναίκα μπορεί να έχει γονότυπο Χ Δ Χ Δ (πιθανότητα 1/2) ή Χ Δ Χ δ (πιθανότητα 1/2), ενώ ο άνδρας θα είναι Χ δ Υ. Μόνο όμως εάν η γυναίκα είναι φορέας (Χ Δ Χ δ ) είναι δυνατόν να γεννηθούν απόγονοι με δαλτωνισμό. Με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα ισχύει: P: Χ Δ Χ δ (1/2) Χ Χ δ Υ Γαμέτες: Χ Δ, Χ δ Χ δ, Υ F 1 : Χ Δ Χ δ, Χ Δ Υ, Χ δ Χ δ, Χ δ Υ θηλυκό αρσενικό θηλυκό αρσενικό φυσιολογικό φυσιολογικό δαλτωνικό δαλτωνικό Η πιθανότητα να συμβούν 2 ανεξάρτητα γεγονότα ισούται με το γινόμενο των πιθανοτήτων να συμβεί το καθένα ξεχωριστά. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Άρα: α. P= 1/2 (γονότυπος Χ Δ Χ δ ) 1/2 (παιδί δαλτωνικό)=1/4 (παιδί δαλτωνικό) β. P= 1/2 (γονότυπος Χ Δ Χ δ ) 1/2 (1 ο παιδί δαλτωνικό) 1/2 (γονότυπος Χ Δ Χ δ ) 1/2 (2 ο παιδί δαλτωνικό)= 1/16 (2 παιδιά δαλτωνικά) γ. P= 1/2 (γονότυπος Χ Δ Χ δ ) 1/4 (1 ο αγόρι δαλτωνικό) 1/2 (γονότυπος Χ Δ Χ δ ) 1/4 (2 ο αγόρι δαλτωνικό) =1/64 (2 αγόρια δαλτωνικά) δ. Διακρίνουμε 2 περιπτώσεις: i. Τα δίδυμα να είναι μονοζυγωτικά (προέρχονται από το ίδιο ωάριο). P= 1/2 (γονότυπος Χ Δ Χ δ ) 1/2 (παιδιά δαλτωνικά)= 1/4.( Είναι σαν 1 κύηση) ii. Τα δίδυμα να είναι διζυγωτικά (προέρχονται από διαφορετικό ωάριο). P=1/2 (γονότυπος Χ Δ Χ δ ) 1/2 (1 ο παιδί δαλτωνικό) 1/2 (γονότυπος Χ Δ Χ δ ) 1/2 (2 ο παιδί δαλτωνικό)= 1/16 (Θεωρούνται σαν 2 διαφορετικές κυήσεις) 4

5 9. Από τη διασταύρωση πεταλούδων (εμφανίζουν αντίθετο φυλοκαθορισμό από αυτόν του ανθρώπου) προκύπτουν στην F 2 γενιά 208 αρσενικά με κόκκινο χρώμα ματιών, 102 θηλυκά με κόκκινα και 103 θηλυκά με λευκά μάτια. Ποιοι οι γονότυποι και φαινότυποι της P και F 1 γενιάς; Η διαφορετική φαινοτυπική αναλογία μεταξύ αρσενικών και θηλυκών δείχνει ότι ο χαρακτήρας (χρώμα ματιών) ελέγχεται από φυλοσύνδετο γονίδιο. Επειδή όλα τα αρσενικά (ΧΧ) της F 2 έχουν κόκκινο χρώμα, ενώ από τα θηλυκά (ΧΥ) τα μισά έχουν κόκκινο και τα μισά έχουν λευκό χρώμα, αυτό σημαίνει ότι το κόκκινο χρώμα ελέγχεται από το επικρατές και το λευκό από το υπολειπόμενο γονίδιο. Αυτή η φαινοτυπική αναλογία προκύπτει εάν ετερόζυγα αρσενικά άτομα της F 1 γενιάς με κόκκινα μάτια διασταυρωθούν με θηλυκά με κόκκινα μάτια. Στην πατρική γενιά διασταυρώνονται αρσενικά ομόζυγα με κόκκινα μάτια με θηλυκά με λευκά μάτια. Κατά συνέπεια και με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα ισχύει: Έστω Χ Κ =κόκκινο χρώμα, Χ κ =λευκό χρώμα, όπου Χ Κ >Χ κ P: Χ κ Υ Χ Χ Κ Χ Κ Γαμέτες: Χ κ, Υ Χ Κ F 1 : Χ Κ Χ κ, Χ Κ Υ αρσενικά με κόκκινα μάτια θηλυκά με κόκκινα μάτια F 1 Χ F 1 : Χ Κ Υ Χ Χ Κ Χ κ Γαμέτες: Χ Κ, Υ Χ Κ, Χ κ F 2 : Χ Κ Χ Κ, Χ Κ Χ κ, Χ Κ Υ, Χ κ Υ αρσενικά αρσενικά θηλυκά θηλυκά κόκκινα κόκκινα κόκκινα λευκά ΠΟΛΛΑΠΛΑ ΑΛΛΗΛΟΜΟΡΦΑ 10. Στο κινέζικο ηράνθεμο (είδος λουλουδιού) το εσωτερικό του άνθους (το λεγόμενο μάτι) μπορεί να είναι άσπρο κανονικού μεγέθους, κίτρινο κανονικό και κίτρινο μεγάλο μέγεθος. Όταν διασταυρώνονται φυτά με μάτι κίτρινο με μεγάλο μέγεθος δίνουν πάντα απογόνους με μάτι κίτρινο με μεγάλο μέγεθος. Διασταύρωση φυτών με κίτρινο κανονικό μπορεί να δώσει φυτά με κίτρινο κανονικό και φυτά με κίτρινο και μεγάλο μέγεθος. Τέλος φυτά με άσπρο κανονικό μέγεθος όταν διασταυρωθούν μεταξύ τους μπορούν να δώσουν απογόνους με άσπρο κανονικό και κίτρινο κανονικό ή απογόνους με άσπρο κανονικό και κίτρινο με μεγάλο μέγεθος. Τι μπορείτε να συμπεράνετε για το χρώμα του ματιού; Να δείξετε τις παραπάνω διασταυρώσεις. Η ύπαρξη 3 φαινοτύπων εξηγείται είτε με ενδιάμεση κληρονομικότητα είτε με την ύπαρξη πολλαπλών αλληλόμορφων. Για να ισχύει η ενδιάμεση κληρονομικότητα θα πρέπει οι 2 από τους 3 φαινότυπους να είναι ομόζυγοι και ακραίοι. Όταν άτομα ομόζυγα και φαινοτυπικά ίδια διασταυρώνονται μεταξύ τους θα πρέπει όλοι οι απόγονοι να μοιάζουν στους γονείς τους. Κάτι τέτοιο όμως ισχύει μόνο για την 1 η διασταύρωση γι αυτό και εξετάζεται η περίπτωση των πολλαπλών αλληλόμορφων. Φυτά με άσπρο κανονικού μεγέθους μάτι όταν διασταυρωθούν μεταξύ τους δίνουν άτομα και με τους 3 φαινοτύπους, άρα το άσπρο επικρατεί έναντι των άλλων δύο. Φυτά με κίτρινο κανονικό μέγεθος ματιού όταν διασταυρωθούν δίνουν άτομα και με κίτρινο και μεγάλο μέγεθος ματιού, άρα το κίτρινο κανονικό επικρατεί του κίτρινου μεγάλου μεγέθους. Τέλος φυτά με κίτρινο μεγάλο μέγεθος δίνουν μόνο όμοια με αυτά άτομα γεγονός που επιβεβαιώνει ότι το κίτρινο μεγάλο μέγεθος είναι υπολειπόμενο έναντι όλων. Κατά συνέπεια και με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα ισχύουν οι παρακάτω διασταυρώσεις: Έστω Α 1 =άσπρο κανονικό μάτι, Α 2 =κίτρινο κανονικό μάτι, Α 3 =κίτρινο μεγάλο μάτι, όπου Α 1 >Α 2 >Α 3 1 η διασταύρωση: P: Α 3 Α 3 Χ Α 3 Α 3 Γαμέτες: Α 3 Α 3 F 1 : Α 3 Α 3 100% με κίτρινο μεγάλο μάτι 5

6 2 η διασταύρωση: P: Α 2 Α 3 Χ Α 2 Α 3 Γαμέτες: Α 2, Α 3 Α 2, Α 3 F 1 Α 2 Α 2, Α 2 Α 3, Α 2 Α 3, Α 3 Α 3 κίτρινο με κίτρινο με κίτρινο με κίτρινο με κανονικό μάτι κανονικό μάτι κανονικό μάτι μεγάλο μάτι 3 η διασταύρωση (περίπτωση α): P: Α 1 Α 2 Χ Α 1 Α 2 Γαμέτες: Α 1, Α 2 Α 1, Α 2 F 1 Α 1 Α 1, Α 1 Α 2, Α 1 Α 2, Α 2 Α 2 άσπρο με άσπρο με άσπρο με κίτρινο με κανονικό μάτι κανονικό μάτι κανονικό μάτι κανονικό μάτι 3 η διασταύρωση (περίπτωση β): P: Α 1 Α 2 Χ Α 1 Α 3 Γαμέτες: Α 1, Α 2 Α 1, Α 3 F 1 Α 1 Α 1, Α 1 Α 3, Α 1 Α 2, Α 2 Α 3 άσπρο με άσπρο με άσπρο με κίτρινο με κανονικό μάτι κανονικό μάτι κανονικό μάτι κανονικό μάτι 3 η διασταύρωση (περίπτωση γ): P: Α 1 Α 3 Χ Α 1 Α 3 Γαμέτες: Α 1, Α 3 Α 1, Α 3 F 1 Α 1 Α 1, Α 1 Α 3, Α 1 Α 3, Α 3 Α 3 άσπρο με άσπρο με άσπρο με κίτρινο με κανονικό μάτι κανονικό μάτι κανονικό μάτι μεγάλο μάτι ΘΝΗΣΙΓΟΝΑ 11. Η διασταύρωση 2 ατόμων Drosophila που εμφανίζουν μικρές εγκοπές στις άκρες των φτερών τους, δίνει 150 απογόνους με εγκοπές στα φτερά και 73 με κανονικά φτερά. Δείξτε την διασταύρωση και εξηγήστε. Από τη διασταύρωση ατόμων με μικρές εγκοπές στα φτερά προκύπτουν και άτομα με κανονικό φτερά (νέο γνώρισμα) γεγονός που σημαίνει ότι τα άτομα με τις μικρές εγκοπές είναι ετερόζυγα. Από τη διασταύρωση ατόμων με μικρές εγκοπές εμφανίζεται φαινοτυπική αναλογία: 150 άτομα με εγκοπές: 73 άτομα κανονικά 2 άτομα με εγκοπές : 1 άτομο κανονικό η οποία όμως διαφέρει από τις αναμενόμενες φαινοτυπικές αναλογίες 3:1 ή 1:2:1. Αυτή η φαινοτυπική αναλογία δείχνει την ύπαρξη θνησιγόνου γονιδίου σε κάθε άτομο της πατρικής γενιάς. Κατά συνέπεια και με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα ισχύει: Έστω Κ=κανονικά φτερά, Κ =θνησιγόνο, ΚΚ =άτομο με εγκοπές P: ΚΚ Χ ΚΚ Γαμέτες: Κ, Κ Κ, Κ F 1 : ΚΚ, ΚΚ, ΚΚ, Κ Κ κανονικά φτερά (1) άτομα με εγκοπές (2) πεθαίνει (1) στα φτερά ΔΙΫΒΡΙΔΙΣΜΟΣ 2 ΕΠΙΚΡΑΤΗ 12. Διασταυρώνουμε δύο ομόζυγα φυτά από τα οποία το ένα έχει κόκκινα άνθη και σφαιρικούς καρπούς και το άλλο κίτρινα άνθη και επιμήκεις καρπούς. Αν το κόκκινο επικρατεί έναντι του κίτρινου και το επίμηκες του σφαιρικού, να βρεθεί: α. Η φαινοτυπική και γονοτυπική αναλογία της F 2 γενιάς. β. Αν προκύψουν στην F 2 γενιά 120 φυτά πόσα από αυτά έχουν άνθη κόκκινα και πόσα έχουν σφαιρικούς καρπούς; γ. Πως είναι δυνατή η απομόνωση αμιγών ατόμων με κόκκινο χρώμα και σφαιρικό καρπό; 6

7 Έστω Κ=Κόκκινα άνθη, κ=κίτρινα άνθη, όπου Κ>κ Ε=επίμηκες καρπός, ε=σφαιρικός καρπός, όπου Ε>ε Με βάση το 1 ο και 2 ο νόμο του Mendel ή νόμο της ανεξάρτητης μεταβίβασης των γονιδίων θα ισχύει: P: ΚΚεε Χ κκεε Γαμέτες: Κε κε F 1 : ΚκΕε 100% με κόκκινο άνθος και επίμηκες καρπό F 1 Χ F 1 : ΚκΕε Χ ΚκΕε Γαμέτες: ΚΕ, Κε, κε, κε ΚΕ, Κε, κε, κε F 2 : ΚΕ Κε κε κε ΚΕ ΚΚΕΕ ΚΚΕε ΚκΕΕ ΚκΕε Κε ΚΚΕε ΚΚεε ΚκΕε Κκεε κε ΚκΕΕ ΚκΕε κκεε κκεε κε ΚκΕε Κκεε κκεε κκεε Φ.Α.: 9 άτομα με κόκκινο άνθος και επίμηκες καρπό. 3 άτομα με κόκκινο άνθος και σφαιρικό καρπό. 3 άτομα με κίτρινο άνθος και επίμηκες καρπό. 1 άτομα με κίτρινο άνθος και σφαιρικό καρπό. Γ.Α.: 4: ΚκΕε, 2: ΚκΕΕ, 2:Κκεε, 2:ΚΚΕε, 2:κκΕε, 1:ΚΚΕΕ, 1:κκεε, 1:ΚΚεε, 1:κκΕΕ β. Άτομα με κόκκινα άνθη στην F 2 γενιά είναι 12 στα 16. Κατά συνέπεια σε 120 φυτά θα είναι: (12/16) 120=90 φυτά με κόκκινα άνθη. Άτομα με σφαιρικούς καρπούς στην F 2 γενιά είναι 4 στα 16. Κατά συνέπεια σε 120 φυτά θα είναι: (4/16) 120=30 φυτά με σφαιρικούς καρπούς. Τα άτομα με κόκκινα άνθη και σφαιρικό καρπό έχουν γονότυπο Κκεε ή ΚΚεε. Για να απομακρυνθούν τα ετερόζυγα κόκκινα άτομα που είναι υπεύθυνα για την εμφάνιση ατόμων με κίτρινο χρώμα άνθους γίνεται διασταύρωση ελέγχου με άτομο ομόζυγο και ως προς τα 2 υπολειπόμενα, δηλαδή έχει γονότυπο κκεε. 1 η περίπτωση: P: ΚΚεε Χ κκεε Γαμέτες: Κε κε F 1 : Κκεε 100% με κόκκινο άνθος και σφαιρικό καρπό 2 η περίπτωση: P: Κκεε Χ κκεε Γαμέτες: Κε, κε κε F 1 : Κκεε, κκεε 50% άτομα κόκκινα 50% άτομα κίτρινα με σφαιρικό καρπό με σφαιρικό καρπό ΕΠΙΚΡΑΤΕΣ- ΕΝΔΙΑΜΕΣΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 13. Στα ροδάκινα διασταύρωση ατόμων με χνουδωτή επιδερμίδα και έλλειψη αδένα στη βάση του φύλλου με άτομα με απαλή επιδερμίδα και ωοειδή αδένα στη βάση του φύλλου είχε σαν αποτέλεσμα να προκύψουν στην F 2 γενιά τα εξής άτομα: 120 άτομα χνουδωτά με στρογγυλό αδένα. 64 άτομα χνουδωτά με έλλειψη αδένα. 57 άτομα χνουδωτά με ωοειδή αδένα. 40 άτομα απαλά με στρογγυλό αδένα. 17 άτομα απαλά με έλλειψη αδένα. 24 άτομα απαλά με ωοειδή αδένα. Να βρεθούν οι γονότυποι των γονέων και να γίνει η διασταύρωση. Για την επιφάνεια της επιδερμίδας Από τα δεδομένα της άσκησης προκύπτει φαινοτυπική αναλογία 241 χνουδωτά : 81 απαλή 3 χνουδωτή : 1 απαλή. Το γονίδιο που ελέγχει τη χνουδωτή επιδερμίδα είναι επικρατές και αυτό που ελέγχει την απαλή επιδερμίδα είναι το υπολειπόμενο. Τα άτομα που διασταυρώνονται για να προκύψει αυτή η φαινοτυπική αναλογία είναι ετερόζυγα. 7

8 Έστω Χ=χνουδωτή επιδερμίδα, χ=λεία επιδερμίδα, όπου Χ>χ Για το σχήμα του αδένα Από τα δεδομένα της άσκησης προκύπτει φαινοτυπική αναλογία 81 με έλλειψη : 160 στρογγυλά : 81 ωοειδή 1 με έλλειψη : 2 στρογγυλά : 1 ωοειδή. Η ύπαρξη 2 ακραίων και σε ίση αναλογία φαινοτύπων ερμηνεύεται με βάση την ενδιάμεση κληρονομικότητα. Τα άτομα που διασταυρώνονται για να προκύψει αυτή η φαινοτυπική αναλογία είναι ετερόζυγα. Έστω Κ=έλλειψη αδένα, Λ=ωοειδής αδένας, όπου Κ=Λ, ΚΛ=στρογγυλός αδένας Με βάση το 1 ο και 2 ο νόμο του Mendel ή νόμο της ανεξάρτητης μεταβίβασης των γονιδίων θα ισχύει: P: ΚΚΧΧ Χ ΛΛχχ Γαμέτες: ΚΧ Λχ F 1 : ΚΛΧχ 100% άτομα με χνουδωτή επιδερμίδα και στρογγυλό αδένα F 1 Χ F 1 : ΚΛΧχ Χ ΚΛΧχ Γαμέτες: ΚΧ, Κχ, ΛΧ, Λχ ΚΧ, Κχ, ΛΧ, Λχ F 2 : ΚΧ Κχ ΛΧ Λχ ΚΧ ΚΚΧΧ ΚΚΧχ ΚΛΧΧ ΚΛΧχ Κχ ΚΚΧχ ΚΚχχ ΚΛΧχ ΚΛχχ ΛΧ ΚΛΧΧ ΚΛΧχ ΛΛΧΧ ΛΛΧχ Λχ ΚΛΧχ ΚΛχχ ΛΛΧχ ΛΛχχ ΕΠΙΚΡΑΤΕΣ-ΦΥΛΟΣΥΝΔΕΤΟ 14. Μια Drosophila με άσπρα μάτια και κανονικά φτερά διασταυρώνεται με άλλη που έχει κόκκινα μάτια και ατροφικά φτερά. Στην F 1 γενιά όλοι οι απόγονοι έχουν κανονικά φτερά, αλλά όλα τα θηλυκά έχουν κόκκινα και όλα τα αρσενικά άσπρα μάτια. Ποιος ο γονότυπος των γονιών και ποια η φαινοτυπική αναλογία στην F 2 γενιά; Για το σχήμα των φτερών: Από τη διασταύρωση ατόμων με κανονικά φτερά και ατόμων με ατροφικά φτερά όλα τα άτομα της F 1 γενιάς έχουν κανονικά φτερά. Αυτό σημαίνει ότι ο χαρακτήρας φτερά ελέγχεται από ζεύγος αυτοσωμικών γονιδίων με το επικρατές γονίδιο να ελέγχει τα κανονικά φτερά και το υπολειπόμενο γονίδιο να ελέγχει τα ατροφικά φτερά. Επίσης το άτομο της P γενιάς με κανονικά φτερά είναι αμιγές. Έστω Κ=κανονικά φτερά, κ=ατροφικά φτερά, όπου Κ>κ Για το χρώμα των ματιών: Η διαφορετική φαινοτυπική αναλογία μεταξύ αρσενικών και θηλυκών της F 1 γενιάς δείχνει ότι ο συγκεκριμένος χαρακτήρας ελέγχεται από ζεύγος φυλοσύνδετων γονιδίων. Τα θηλυκά άτομα (ΧΧ), τα οποία όλα έχουν κόκκινα μάτια, παίρνουν το ένα Χ από τον πατέρα τους (ΧΥ) που και κατά συνέπεια και αυτός θα έχει κόκκινα μάτια, Τα αρσενικά (ΧΥ), τα οποία όλα έχουν άσπρα μάτια, παίρνουν το Χ από τη μητέρα τους η οποία και αυτή, με βάση τα δεδομένα της άσκησης θα έχει άσπρα μάτια. Από τα προηγούμενα συμπεραίνεται ότι το κόκκινο επικρατεί έναντι του άσπρου. Έστω Χ Λ =κόκκινα μάτια, Χ λ =λευκά μάτια, όπου Χ Λ >Χ λ Οι γονότυποι των γονέων θα είναι: : ΚΚΧ λ Χ λ, κκχ Λ Υ Με βάση το 1 ο και 2 ο νόμο του Mendel ή νόμο της ανεξάρτητης μεταβίβασης των γονιδίων θα ισχύει: P: ΚΚΧ λ Χ λ Χ κκχ Λ Υ Γαμέτες: ΚΧ λ κχ Λ, κυ F 1 : ΚκΧ Λ Χ λ, ΚκΧ λ Υ 100% θηλυκά με κανονικά φτερά 100% αρσενικά με κανονικά φτερά και κόκκινα μάτια και λευκά μάτια F 1 Χ F 1 : ΚκΧ Λ Χ λ Χ ΚκΧ λ Υ Γαμέτες: ΚΧ Λ, ΚΧ λ, κχ Λ, κχ λ ΚΧ λ, ΚΥ, κχ λ, κυ 8

9 F 2 : ΚΧ λ ΚΥ κχ λ κυ ΚΧ Λ ΚΚΧ Λ Χ λ ΚΚΧ Λ Υ ΚκΧ Λ Χ λ ΚκΧ Λ Υ ΚΧ λ ΚΚΧ λ Χ λ ΚΚΧ λ Υ ΚκΧ λ Χ λ ΚκΧ λ Υ κχ Λ ΚκΧ Λ Χ λ ΚκΧ Λ Υ κκχ Λ Χ λ κκχ Λ Υ κχ λ ΚκΧ λ Χ λ ΚΚΧ λ Υ κκχ λ Χ λ κκχ λ Υ Φ.Α.: 3 άτομα με κόκκινα μάτια και κανονικά φτερά. 3 άτομα με άσπρα μάτια και κανονικά φτερά. 1 άτομα με κόκκινα μάτια και ατροφικά φτερά. 1 άτομα με άσπρα μάτια και ατροφικά φτερά. 3 άτομα με κόκκινα μάτια και κανονικά φτερά. 3 άτομα με άσπρα μάτια και κανονικά φτερά. 1 άτομα με κόκκινα μάτια και ατροφικά φτερά. 1 άτομα με άσπρα μάτια και ατροφικά φτερά. ΘΝΗΣΙΓΟΝΟ ΕΠΙΚΡΑΤΕΣ- ΘΝΗΣΙΓΟΝΟ ΦΥΛΟΣΥΝΔΕΤΟ 15. Από τη διασταύρωση ατόμων Drosophila με ανεστραμμένα φτερά και γκρι χρώμα σώματος γεννήθηκαν: 150 θηλυκά με ανεστραμμένα φτερά και γκρι χρώμα σώματος. 76 θηλυκά με κανονικά φτερά και γκρι χρώμα σώματος. 75 αρσενικά με ανεστραμμένα φτερά και γκρι χρώμα σώματος. 37 αρσενικά με κανονικά φτερά και γκρι χρώμα σώματος. α. Να βρεθούν οι γονότυποι των γονέων και να γίνει η διασταύρωση. β. Αν αρσενικά άτομα της F 1 γενιάς με κανονικά φτερά και γκρι χρώμα διασταυρωθούν με θηλυκά με ανεστραμμένα φτερά και γκρι χρώμα της ίδιας γενιάς, ποια είναι η πιθανότητα να γεννηθούν άτομα που θα πεθάνουν αμέσως; α. Για το σχήμα των φτερών Στα θηλυκά άτομα: 150 με ανεστραμμένα φτερά : 76 με κανονικά φτερά 2 με ανεστραμμένα φτερά : 1 με κανονικά φτερά. Στα αρσενικά άτομα: 75 με ανεστραμμένα φτερά : 37 με κανονικά φτερά 2 με ανεστραμμένα φτερά : 1 με κανονικά φτερά. Διαπιστώνεται ότι και στα 2 φύλα εμφανίζεται η μη αναμενόμενη φαινοτυπική αναλογία 2:1 η οποία μπορεί να ερμηνευτεί με την ύπαρξη θνησιγόνου αυτοσωμικού γονιδίου. Έστω Κ=κανονικό, Κ =θνησιγόνο γονίδιο, ΚΚ =ανεστραμμένα φτερά Για το χρώμα του σώματος 226 θηλυκά με γκρι χρώμα σώματος : 112 αρσενικά με γκρι χρώμα σώματος 2 θηλυκά με γκρι χρώμα σώματος : 1 αρσενικό με γκρι χρώμα σώματος Η διαφορετική αναλογία μεταξύ θηλυκών και αρσενικών ατόμων σημαίνει ότι υπάρχει και άλλο θνησιγόνο γονίδιο το οποίο είναι φυλοσύνδετο, μεταβιβάζεται από τα ετερόζυγα θηλυκά της πατρικής γενιάς και προκαλεί το θάνατο των μισών αρσενικών απογόνων. Έστω Χ Γ =γκρι χρώμα σώματος, Χ γ =θνησιγόνο, όπου Χ Γ >Χ γ Με βάση τον 1 ο και 2 ο νόμο του Mendel ή νόμο της ανεξάρτητης μεταβίβασης των γονιδίων θα ισχύει: P: ΚΚ Χ Γ Χ γ Χ ΚΚ Χ Γ Υ Γαμέτες: ΚΧ Γ, ΚΧ γ, Κ Χ Γ, Κ Χ γ ΚΧ Γ, ΚΥ, Κ Χ Γ, Κ Υ F 1 : ΚΧ Γ ΚΥ Κ Χ Γ Κ Υ ΚΧ Γ ΚΚΧ Γ Χ Γ ΚΚΧ Γ Υ ΚΚ Χ Γ Χ Γ ΚΚ Χ Γ Υ ΚΧ γ ΚΚΧ Γ Χ γ ΚΚΧ γ Υ νεκρό ΚΚ Χ Γ Χ γ ΚΚ Χ γ Υ νεκρό Κ Χ Γ ΚΚ Χ Γ Χ Γ ΚΚ Χ Γ Υ Κ Κ Χ Γ Χ Γ νεκρό Κ Κ Χ Γ Υ νεκρό Κ Χ γ ΚΚ Χ Γ Χ γ ΚΚ Χ γ Υ νεκρό Κ Κ Χ Γ Χ γ νεκρό Κ Κ Χ γ Υ νεκρό 9

10 Φ.Α.: 4 θηλυκά άτομα με ανεστραμμένα φτερά και γκρι χρώμα (2 ΚΚ Χ Γ Χ Γ και 2 ΚΚ Χ Γ Χ γ ). 2 θηλυκά άτομα με κανονικά φτερά και γκρι χρώμα (1 ΚΚΧ Γ Χ Γ και 1 ΚΚΧ Γ Χ γ ). 2 αρσενικά άτομα με ανεστραμμένα φτερά και γκρι χρώμα (ΚΚ Χ Γ Υ). 1 αρσενικό άτομα με κανονικά φτερά και γκρι χρώμα (ΚΚΧ Γ Υ). β. Το αρσενικό άτομο έχει γονότυπο ΚΚΧ Γ Υ, ενώ το θηλυκό μπορεί να είναι ΚΚ Χ Γ Χ Γ (πιθανότητα 1/2) ή ΚΚ Χ Γ Χ γ (πιθανότητα 1/2). Κατά συνέπεια θα ισχύουν 2 περιπτώσεις: 1η περίπτωση: ΚΚΧ Γ Υ X ΚΚ Χ Γ Χ Γ 2η περίπτωση: ΚΚΧ Γ Υ X ΚΚ Χ Γ Χ γ Όμως μόνο από τη 2 η διασταύρωση είναι δυνατόν να γεννηθούν άτομα που θα πεθάνουν αμέσως. Με βάση τον 1 ο και 2 ο νόμο του Mendel ή νόμο της ανεξάρτητης μεταβίβασης των γονιδίων θα ισχύει: P: ΚΚ Χ Γ Χ γ Χ ΚΚΧ Γ Υ Γαμέτες: ΚΧ Γ, ΚΧ γ, Κ Χ Γ, Κ Χ γ ΚΧ Γ, ΚΥ F 1 : ΚΧ Γ ΚΥ ΚΧ Γ ΚΚΧ Γ Χ Γ ΚΚΧ Γ Υ ΚΧ γ ΚΚΧ Γ Χ γ ΚΚΧ γ Υ νεκρό Κ Χ Γ ΚΚ Χ Γ Χ Γ ΚΚ Χ Γ Υ Κ Χ γ ΚΚ Χ Γ Χ γ ΚΚ Χ γ Υ νεκρό Η πιθανότητα να συμβούν 2 ανεξάρτητα γεγονότα ισούται με το γινόμενο των πιθανοτήτων να συμβεί το καθένα ξεχωριστά. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Κατά συνέπεια η πιθανότητα να γεννηθεί άτομο που θα πεθάνει αμέσως είναι: P=1/2 (γονότυπος ΚΚ Χ Γ Χ γ ) 2/8= 1/8. 2 ΦΥΛΟΣΥΝΔΕΤΑ 16. Ετερόζυγη ως προς την αιμορροφιλία και το δαλτωνισμό γυναίκα παντρεύεται με έναν άνδρα δαλτωνικό. α. Ποια η πιθανότητα να γεννηθεί δαλτωνικό παιδί; β. Ποια η πιθανότητα το 1 ο κορίτσι που θα γεννηθεί να είναι δαλτωνικό και αιμορροφιλικό; γ. Ποια η πιθανότητα το 1 ο αγόρι που θα γεννηθεί να είναι δαλτωνικό και αιμορροφιλικό; Έστω Χ Α =κανονική πήξη αίματος, Χ α =αιμορροφιλία, όπου Χ Α >Χ α Έστω Χ Δ =φυσιολογική όραση, Χ δ =δαλτωνισμός, όπου Χ Δ >Χ δ Ο άνδρας έχει γονότυπο Χ δα Υ και η γυναίκα Χ ΔΑ Χ δα (πιθανότητα 1/2) ή Χ Δα Χ δα (πιθανότητα 1/2). Κατά συνέπεια και με βάση το 1 ο και 2 ο νόμο του Mendel ή νόμο της ανεξάρτητης μεταβίβασης των γονιδίων θα ισχύουν 2 περιπτώσεις: 1 η περίπτωση: P: Χ ΔΑ Χ δα Χ Χ δα Υ Γαμέτες: Χ ΔΑ,, Χ δα Χ δα, Υ F 1 : Χ ΔΑ Χ δα, Χ ΔΑ Υ, Χ δα Χ δα, Χ δα Υ θηλυκό αρσενικό θηλυκό δαλτωνικό αρσενικό δαλτωνικό φυσιολογικό φυσιολογικό και αιμορροφιλικό Η πιθανότητα να συμβούν 2 ανεξάρτητα γεγονότα ισούται με το γινόμενο των πιθανοτήτων να συμβεί το καθένα ξεχωριστά. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Άρα: P α =1/2 (γονότυπος Χ ΔΑ Χ δα ) 1/2 (παιδί δαλτωνικό)= 1/4 P β =1/2 (γονότυπος Χ ΔΑ Χ δα ) 0 (κορίτσι δαλτωνικό και αιμορροφιλικό)= 0 P γ =1/2 (γονότυπος Χ ΔΑ Χ δα ) 1/2 (αγόρι δαλτωνικό και αιμορροφιλικό)= 1/4 2 η περίπτωση: 10

11 P: Χ Δα Χ δα Χ Χ δα Υ Γαμέτες: Χ Δα,, Χ δα Χ δα, Υ F 1 : Χ Δα Χ δα, Χ Δα Υ, Χ δα Χ δα, Χ δα Υ θηλυκό αρσενικό θηλυκό δαλτωνικό αρσενικό δαλτωνικό φυσιολογικό αιμορροφιλικό Η πιθανότητα να συμβούν 2 ανεξάρτητα γεγονότα ισούται με το γινόμενο των πιθανοτήτων να συμβεί το καθένα ξεχωριστά. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Άρα: P α =1/2 (γονότυπος Χ Δα Χ δα ) 1/2 (παιδί δαλτωνικό)= 1/4 P β =1/2 (γονότυπος Χ Δα Χ δα ) 0 (κορίτσι δαλτωνικό και αιμορροφιλικό)= 0 P γ =1/2 (γονότυπος Χ Δα Χ δα ) 0 (αγόρι δαλτωνικό και αιμορροφιλικό)= 0 Επειδή τα γεγονότα είναι ασυμβίβαστα (η γυναίκα θα έχει έναν από τους 2 γονότυπους) η πιθανότητα να συμβεί ή το ένα ή το άλλο ισούται με το άθροισμα των επιμέρους πιθανοτήτων. Άρα: P ολ α= P α + P α =1/4+1/4=1/2 να γεννηθεί παιδί δαλτωνικό. P ολ β= P β + P β =0+0=0 να γεννηθεί κορίτσι δαλτωνικό και αιμορροφιλικό. P ολ γ= P γ + P γ =1/4+0=1/4 να γεννηθεί αγόρι δαλτωνικό και αιμορροφιλικό. ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ 17. Το παρακάτω γενεαλογικό δένδρο δείχνει την κληρονόμηση της πολυκυστικής νόσου των νεφρών. Να βρείτε τον πιο πιθανό τύπο της κληρονομικότητας που ακολουθεί η ασθένεια και να αιτιολογήσετε την απάντησή σας. Δεν είναι φυλοσύνδετο υπολειπόμενο αφού από πατέρα που δεν πάσχει (I1) γεννιέται κόρη που πάσχει (II2). Δεν είναι φυλοσύνδετο επικρατές αφού από μητέρα που δεν πάσχει (III3) γεννιέται γιος που πάσχει (IV1). Θεωρητικά θα μπορούσε να είναι αυτοσωμικό υπολειπόμενο, ουσιαστικά όμως κάτι τέτοιο δεν ισχύει, γιατί το χαρακτηριστικό δεν θα εμφανιζόταν σε κάθε γενιά με τέτοια συχνότητα, ενώ τα φυσιολογικά άτομα, που παντρεύονται άτομα ασθενή, θα έπρεπε να είναι όλα ετερόζυγα, κάτι που είναι πρακτικά αδύνατο λόγω της σπανιότητας της ασθένειας. Είναι αυτοσωμικό επικρατές επειδή κάθε ασθενής έχει και ένα γονέα ασθενή, ενώ το χαρακτηριστικό εμφανίζεται σε κάθε γενιά, σε έναν σημαντικό αριθμό απογόνων και σε ίση περίπου αναλογία μεταξύ θηλυκών και αρσενικών ατόμων. 18. Άνδρας δαλτωνικός του οποίου ο πατέρας είχε κυστική ίνωση και η μητέρα ήταν φορέας και των 2 ασθενειών παντρεύτηκε γυναίκα δαλτωνική της οποίας η μητέρα είχε κυστική ίνωση και ο πατέρας ήταν φορέας της κυστικής ίνωσης. Το παιδί τους φέρει και τις 2 ασθένειες. α. Να γίνουν τα γενεαλογικά δένδρα. β. Ποιοι είναι οι πιθανοί γονότυποι των ατόμων; γ. Το ζευγάρι πρόκειται να αποκτήσει το 2 ο τους παιδί. Ποια η πιθανότητα και φέρει και τις 2 ασθένειες; 11

12 Η κυστική ίνωση οφείλεται σε αυτοσωμικό υπολειπόμενο γονίδιο. Έστω Κ=φυσιολογικό, κ=κυστική ίνωση, όπου Κ>κ Ο δαλτωνισμός οφείλεται σε υπολειπόμενο φυλοσύνδετο γονίδιο Έστω Χ Δ =φυσιολογική όραση, Χ δ =δαλτωνισμός, όπου Χ Δ >Χ δ Τα γενεαλογικά δένδρα της οικογένειας και οι γονότυποι των ατόμων για την κάθε ασθένεια είναι τα εξής: Για την κυστική ίνωση Για το δαλτωνισμό Συνολικά: Άνδρας: ΚκΧ δ Υ Πατέρας άνδρα: κκχ Δ Υ Μητέρα άνδρα: ΚκΧ Δ Χ δ Γυναίκα: ΚκΧ δ Χ δ Πατέρας γυναίκας: ΚκΧ δ Υ Μητέρα γυναίκας: κκχ Δ Χ δ Παιδί: κκχ δ Υ, κκχ δ Χ δ γ. Με βάση το 1 ο και 2 ο νόμο του Mendel ή νόμο της ανεξάρτητης μεταβίβασης των γονιδίων θα ισχύει: P: ΚκΧ δ Χ δ Χ ΚκΧ δ Υ Γαμέτες: ΚΧ δ, κχ δ ΚΧ δ, ΚΥ, κχ δ, κυ 12

13 F 1 : ΚΧ δ κχ δ ΚΧ δ ΚΚΧ δ Χ δ ΚκΧ δ Χ δ ΚΥ ΚΚΧ δ Υ ΚκΧ δ Υ κχ δ ΚκΧ δ Χ δ κκχ δ Χ δ κυ ΚκΧ δ Υ κκχ δ Υ Η πιθανότητα να φέρει το παιδί που θα γεννηθεί και τις 2 ιδιότητες είναι 1/ Το παρακάτω γενεαλογικό δένδρο απεικονίζει τον τρόπο κληρονόμησης της ασθένειας Tay-sachs. α. Να βρείτε τον τύπο κληρονομικότητας της ασθένειας και τους γονότυπους των ατόμων. β. Ποια η πιθανότητα το επόμενο παιδί των I1 και I2 να εμφανίσει την ασθένεια; γ. Ποια η πιθανότητα τα 2 επόμενα παιδιά των I1 και I2 να είναι αγόρια και το ένα να είναι φυσιολογικό, ενώ το άλλο να εμφανίζει την ασθένεια; δ. Ποια η πιθανότητα το άτομο II3 να είναι ετερόζυγο; ε. Ποια η πιθανότητα το άτομο II5 να είναι ετερόζυγο; στ. Εάν η γυναίκα II5 παντρευτεί άνδρα που φέρει την ασθένεια ποια η πιθανότητα να γεννηθεί παιδί φυσιολογικό και ετερόζυγο; α. Από άτομα που δεν πάσχουν (I1 και I2) γεννιέται παιδί (II6) που πάσχει. Κατά συνέπεια η ασθένεια οφείλεται σε υπολειπόμενο γονίδιο. Δεν είναι φυλοσύνδετο υπολειπόμενο γιατί άνδρας που δεν πάσχει (I2) αποκτάει κόρη που πάσχει (II6) Άρα πρόκειται για αυτοσωμικό υπολειπόμενο γονίδιο. Έστω Α=φυσιολογικό γονίδιο, α=γονίδιο για ασθένεια Tay-sachs, όπου Α>α. Οι γονότυποι των ατόμων είναι: I1, I2, II4, III8: Αα II3, II6, II7, III9, III10: αα II5: ΑΑ ή Αα β. Με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων ισχύει: P: Αα Χ Αα Γαμέτες: Α, α Α, α F 1 : ΑΑ, Αα, Αα, αα φυσιολογικά άτομα (3/4) ασθενή άτομα (1/4) Η πιθανότητα το επόμενο παιδί των I1 και I2 να είναι ασθενής είναι 1/4. 13

14 γ. Η πιθανότητα να συμβούν 2 ανεξάρτητα γεγονότα ισούται με το γινόμενο των πιθανοτήτων να συμβεί το καθένα ξεχωριστά. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Στην συγκεκριμένη περίπτωση εξετάζονται 2 διαφορετικοί συνδυασμοί: 1 ο αγόρι: φυσιολογικό 2 ο αγόρι ασθενής=3/4 (φυσιολογικό) 1/2 (αγόρι) 1/4 (ασθενής) 1/2 (αγόρι)=3/64 1 ο αγόρι: ασθενής 2 ο αγόρι φυσιολογικό=1/4 (ασθενής) 1/2 (αγόρι) 3/4 (φυσιολογικό) 1/2 (αγόρι)=3/64 Επειδή τα γεγονότα είναι ασυμβίβαστα (δεν μπορεί το 1 ο ή το 2 ο αγόρι να είναι ταυτόχρονα φυσιολογικό και ασθενής) η πιθανότητα να συμβεί ή το ένα ή το άλλο ισούται με το άθροισμα των επιμέρους πιθανοτήτων. Άρα:P=3/64+3/64=6/64=3/32 δ. P=0 ε. Από τους 3 φυσιολογικούς απογόνους των I1 και I2 ο ένας είναι ομόζυγος (πιθανότητα 1/3) και οι 2 είναι ετερόζυγοι (πιθανότητα 2/3) στ. Ο γονότυπος του άνδρα είναι αα ενώ της γυναίκας είναι ΑΑ (1/3) ή Αα (2/3). Με βάση τον 1 ο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων θα διακρίνουμε 2 περιπτώσεις: 1 η περίπτωση: P: ΑΑ Χ αα Γαμέτες: Α α F 1 : Αα 100% φυσιολογικό και ετερόζυγο Η πιθανότητα να συμβούν 2 ανεξάρτητα γεγονότα ισούται με το γινόμενο των πιθανοτήτων να συμβεί το καθένα ξεχωριστά. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Άρα: P 1 = 1/3 (γονότυπος ΑΑ) 1 (φυσιολογικό ετερόζυγο)=1/3 2 η περίπτωση: P: Αα Χ αα Γαμέτες: Α, α α F 1 Αα, αα 50% φυσιολογικό 50% ασθενής ετερόζυγο Η πιθανότητα να συμβούν 2 ανεξάρτητα γεγονότα ισούται με το γινόμενο των πιθανοτήτων να συμβεί το καθένα ξεχωριστά. Η κάθε κύηση είναι ανεξάρτητο γεγονός. Άρα: P 2 = 2/3 (γονότυπος Αα) 1/2 (φυσιολογικό ετερόζυγο)=2/6=1/3 Επειδή τα γεγονότα είναι ασυμβίβαστα (η γυναίκα θα έχει έναν από τους 2 γονότυπους) η πιθανότητα να συμβεί ή το ένα ή το άλλο ισούται με το άθροισμα των επιμέρους πιθανοτήτων. Άρα: P= P 1 + P 2 =1/3+1/3=2/3 14


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 5 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 2 ΕΠΙΚΡΑΤΗ 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους.

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα Κεφάλαιο 5: Μενδελική Κληρονομικότητα ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Ο Mendel. α. εξέταζε σε κάθε πείραμά του το σύνολο των ιδιοτήτων του μοσχομπίζελου β. χρησιμοποιούσε αμιγή στελέχη στις ιδιότητες που μελετούσε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 5.1. Σε ποια στοιχεία οφείλεται η επιτυχία των πειραμάτων του Mendel; 5.2. Τι είναι ο γονότυπος ; Πως μπορούμε να βρούμε το γονότυπο

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα


-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ 1 Στη δροσόφιλα το κόκκινο χρώμα των ματιών είναι επικρατές. Εάν οι απόγονοι σε δύο διαφορετικές διασταυρώσεις είναι οι ακόλουθοι: ιασταύρωση Α ιασταύρωση Β 24 αρσενικά

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο.

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. Μια γυναίκα της οποίας ο πατέρας έπασχε από γαλακτοζαιμία θέλει να

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.)

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) Μενδελική κληρονομικότητα κεφάλαιο 5 Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) 5. Μενδελική κληρονομικότητα Το ενδιαφέρον για την κληρονομικότητα είναι πολύ παλιό, σχεδόν όσο και η ύπαρξη του ανθρώπινου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΘΕΜΑ 1ο 1. Στην αυτοσωμική επικρατή κληρονομικότητα α. κάθε ασθενής γονέας γεννά έναν τουλάχιστον ασθενή απόγονο

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 2001 ΗΜΕΡΗΣΙΟ 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα


Κ Η Λ Ρ Η ΟΝ Ο Ο Ν Μ Ο ΙΚ Ι Ο Κ Τ Ο Η Τ Τ Η Α ΚΕΦΑΛΑΙΟ 5ο: Η πρώτη επιστηµονική µελέτη για την κληρονοµικότητα έγινε το 19ο αιώνα ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Από τον Αυστριακό µοναχός Gregor Mendel Θεωρείται ο πατέρας της Γενετικής 1 Ένα σηµαντικό στοιχείο

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΓΕ.Λ. Νέου Σκοπού Σερρών Ενδεικτικές απαντήσεις στη Βιολογία Θετικής Κατεύθυνσης

ΓΕ.Λ. Νέου Σκοπού Σερρών Ενδεικτικές απαντήσεις στη Βιολογία Θετικής Κατεύθυνσης 1 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ Παρασκευή, 22 Μαΐου 2015 ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ A5. γ ΘΕΜΑ Β Μονάδες 5 * 5 = 25 Β1. 1. Α 2. Β 3.

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 την κουκίδα «Για την επιλογή οργάνων συμβατών για μεταμόσχευση.» Β2. Σελ. 136 «Το πρόβατο Dolly» έως «γέννησε τη Dolly.»

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων. Αθήνα, 30/5/2012 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3 ΠΡΟΒΛΗΜΑ 5.1 Στα ποντίκια το σκούρο μάτι απαιτεί την ταυτόχρονη παρουσία των υπερεχόντων αλληλομόρφων γονιδίων R και Q. Ζώα ομοζυγωτικά για ένα από τα δύο ή και τα δύο υποτελή αλληλόμορφα έχουν ανοιχτόχρωμα

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. Α: 1, 4, 5, 6 Β: 2, 3, 7, 8 Β2. Βλέπε σχολικό εγχειρίδιο σελ. 41-42 «Κατά την έναρξη

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις Αλληλεπιδράσεις γονιδίων Ι ασκήσεις 1. Στους σκύλους Labrador ένα θηλυκό άτομο με καστανό χρωματισμό διασταυρώθηκε με αρσενικό που είχε χρυσαφί χρωματισμό. Όλοι οι F1 απόγονοι είχαν μαύρο χρωματισμό. Η

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ κεφ. 5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2 Γ ΛΥΚΕΙΟΥ κεφ. 5 ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2 O Mendel στο Brno (Τσεχία) Τον αναγνωρίζετε; Το μοναστήρι σήμερα Οι κήποι σήμερα Το μοσχομπίζελο Η επιτυχία των πειραμάτων του Μέντελ 1. χωριστά η

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 30 Μαΐου 2012 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό Απαντήσεις στο μάθημα της Βιολογίας Κατεύθυνσης ΘΕΜΑ 1 Ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 Ο 1.σχολικό βιβλίο σελ. 109 «Με τον όρο ζύμωση και αντιβιοτικά» 2.σχολικό βιβλίο σελ. 119-120 «Τα αντισώματα μπορούν

Διαβάστε περισσότερα