ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6"


1 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής του, έγιναν οι εξής διασταυρώσεις με τα ακόλουθα αποτελέσματα: Από φυτά με κίτρινα άνθη, με φυτά με λευκά προέκυψαν 00 κίτρινα φυτά. Από κίτρινα με λευκά προέκυψαν 200 κίτρινα και 200 λευκά. Από κίτρινα με κίτρινα προέκυψαν 00 κίτρινα και 00 λευκά. Να γραφούν και οι αντίστοιχες διασταυρώσεις. 2. Συχνά εμφανίζεται ένα μονογονιδιακό γνώρισμα σε απογόνους χωρίς οι γονείς τους να εμφανίζουν το γνώρισμα αυτό. Ποιος ή ποιοι από τους παρακάτω τρόπους κληρονομικότητας θεωρείτε ότι δεν ακολουθεί η μεταβίβαση του γνωρίσματος αυτού; Α. αυτοσωμικός υπολειπόμενος Β. αυτοσωμικός επικρατής Γ. φυλοσύνδετος υπολειπόμενος Δ. ατελώς επικρατής. Σε μια οικογένεια ο άνδρας έχει ομάδα αίματος ΑΒ και η γυναίκα ομάδα αίματος Β. Ποιο από τα παιδιά της οικογένειες προέρχεται από διαφορετικό πατέρα; Α. Το ο παιδί με ομάδα αίματος Ο Β. Το 2ο παιδί με ομάδα αίματος ΑΒ Γ. Το ο παιδί ομάδα αίματος Α Δ. Το ο παιδί με ομάδα αίματος Β.. Η μεταβίβαση των χαρακτηριστικών που κωδικοποιούνται από το μιτοχονδριακό DNA: Α. γίνεται μόνο από την μητέρα στις κόρες Β. δεν ακολουθεί τους νόμους της Μεντελικής κληρονομικότητας Γ. γίνεται μόνο από την μητέρα στους γιους Δ. ακλουθεί τους νόμους της Μεντελικής κληρονομικότητας 5. Κατά τη διασταύρωση μιας μητέρας που είναι φορέας για την ασθένεια της αιμορροφιλίας Α με ένα φυσιολογικό πατέρα, ποια είναι η πιθανότητα να γεννηθεί κορίτσι που πάσχει από αιμορροφιλία Α; Α.0% Β. 25% Γ. 50% Δ. 00% 6. Μια γυναίκα που ανήκει στην ομάδα αίματος Α και έχει κανονική όραση παντρεύτηκε σε διαφορετικά χρονικά διαστήματα δύο άνδρες. Ο ένας ανήκε στην ομάδα αίματος ΑΒ και είχε αχρωματοψία και ο άλλος στην ομάδα Α και είχε κανονική όραση. Από τους δύο γάμους απέκτησε συνολικά πέντε παιδιά με τους παρακάτω φαινοτύπους: i). αγόρι : ομάδας Α και αχρωματοψία ii). αγόρι : -"- Ο και αχρωματοψία iii). κορίτσι: -"- Α και αχρωματοψία iv). κορίτσι: -"- Β και κανονικό v). κορίτσι: -"- Α και κανονικό Ποιος από τους δυο άνδρες είναι σε κάθε περίπτωση ο πιθανότερος πατέρας; 7. Σε μια διασταύρωση δύο ατόμων που διαφέρουν ως προς ένα γνώρισμα όλοι οι θηλυκοί απόγονοι φέρουν το φαινότυπο του πατρικού ατόμου και οι αρσενικοί του μητρικού ατόμου. Πως μπορείτε να εξηγήσετε το γεγονός; Δίνοντας ένα χαρακτηρισμό για το γνώρισμα, να γίνει η διασταύρωση που θα δικαιολογεί την άποψή σας. 8. Άνδρας με φυλοσύνδετη υπολειπόμενη ανωμαλία παντρεύεται γυναίκα με φυσιολογικό φαινότυπο. Δεδομένου ότι έχουν ήδη ένα κορίτσι πάσχον από την ανωμαλία, σε τι ποσοστό αναμένετε να πάσχουν τα κορίτσια απόγονοί τους; Α. 0 % Β. 25 % Γ. 50 % Δ. 00 % 9. Από τη διασταύρωση δύο ατόμων Drosophila προέκυψαν 80 θηλυκά και 90 αρσενικά άτομα. Δώστε μια πιθανή εξήγηση για τη φαινοτυπική αναλογία των απογόνων. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα /6

2 0. Δίνεται το παρακάτω γενεαλογικό δένδρο που παριστάνει την κληρονόμηση της ασθένειας της κυστικής ίνωσης: Ι 2 ΙΙ 2 5 ΙΙΙ 2 5 ΙV α). Να γραφούν οι γονότυποι όλων των ατόμων (όπου αυτό δεν είναι βέβαιο, οι πιο πιθανοί) β). Τι πιθανότητες υπάρχουν να γεννηθεί ένα δεύτερο παιδί από τα άτομα ΙΙΙx ΙΙΙ2 άρρωστο; γ). Το άτομο (ΙΙΙ 5) παντρεύεται κανονική γυναίκα. Τι πιθανότητες έχουν να κάνουν παιδί άρρωστο;. Στο γενεαλογικό δένδρο που ακολουθεί φαίνεται η κληρονόμηση του γονιδίου της PKU (φαινυλκετονουρίας) στον άνθρωπο. α). ποιοι είναι οι πιθανοί γονότυποι των ατόμων I και I2; β). ποια πιθανότητα υπάρχει το άτομο II να είναι φορέας; γ). ποια πιθανότητα υπάρχει ένα παιδί που θα γεννηθεί από τα άτομα III και III να πάσχει από φαινυλκετονουρία; Ι ΙΙ ΙΙΙ 2. Στο παρακάτω γενεαλογικό δένδρο παρουσιάζεται η κληρονόμηση ενός χαρακτηριστικού. Να ερευνήσετε και να αιτιολογήσετε: α). αν κληρονομείται ως αυτοσωμικό ή φυλοσύνδετο, β). αν κληρονομείται ως επικρατές ή υπολειπόμενο. γ). Αν το άτομο ΙΙΙ διασταυρωθεί με γυναίκα που φέρει επίσης το γνώρισμα τι πιθανότητες έχουν να κάνουν παιδί με το γνώρισμα; Ι 2 ΙΙ ΙΙΙ 2. Ένας άνδρας και μία γυναίκα έχουν ομάδα αίματος Α και Β αντίστοιχα. Το πρώτο τους παιδί έχει ομάδα αίματος ΑΒ και το δεύτερο παιδί τους έχει ομάδα αίματος Ο. Ποια είναι η σωστή πρόβλεψη για την ομάδα των επόμενων παιδιών; Α. Τα μισά παιδιά θα έχουν ομάδα αίματος ΑΒ και τα άλλα μισά ομάδα αίματος Ο. Β. Κάποια θα έχουν ομάδα αίματος Α και κάποια ομάδα αίματος Β Γ. Κάθε παιδί έχει ίσες πιθανότητες να έχει ομάδα αίματος Α, Β, ΑΒ ή Ο. Δ. Κάθε ομάδα είναι δυνατό να παρουσιαστεί, άλλα οι ομάδες Α και Β είναι πιθανότερες. Ένας πατέρας με ομάδα αίματος ΑΒ αμφισβητεί την πατρότητα της κόρης του που έχει ομάδα αίματος Β, όταν η μητέρα της έχει Α. Έχει δίκαιο ο πατέρας; Θα πρόσθετε κάποια επιπλέον ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 2/

3 πληροφορία το γεγονός ότι η κόρη έπασχε από κολόβωμα της ίριδας του ματιού (υπολειπόμενο φυλοσύνδετο γνώρισμα), όταν οι γονείς της ήταν φυσιολογικοί; 5. Στη φρουτόμυγα Drosophila melanogaster, το αλληλόμορφο για τα λευκά μάτια είναι φυλοσύνδετο και υπολειπόμενο γονίδιο. Ποιο θα είναι το αποτέλεσμα διασταύρωσης μεταξύ ενός θηλυκού με λευκά μάτια και ενός αρσενικού με κόκκινα μάτια; Α. Όλα τα θηλυκά θα έχουν κόκκινα μάτια και όλα τα αρσενικά θα έχουν λευκά μάτια. Β. Όλα τα αρσενικά θα έχουν λευκά μάτια και τα θηλυκά θα έχουν κόκκινα και λευκά μάτια σε αναλογία :. Γ. Κάθε συνδυασμός φύλου και χρώματος ματιών είναι δυνατός. Δ. Η αναλογία των θηλυκών προς τα αρσενικά και των κόκκινων προς τα λευκά μάτια θα είναι : ανεξάρτητα της μιας ιδιότητας από την άλλη. Να δικαιολογήσετε την απάντησή σας γράφοντας τους κατάλληλους γονοτύπους όλων των ατόμων, καθώς και την διασταύρωση που την υποστηρίζει. 6. Η αφυδρογονάση της 6-φωσφορικής γλυκόζης (G6PDH) είναι ένα σημαντικό ένζυμο που διαδραματίζει καθοριστικό ρόλο στην προστασία του κυττάρου από την οξειδωτική καταστροφή. Η έλλειψή της αποτελεί την πιο συχνή ενζυμική διαταραχή στον άνθρωπο. Έλλειψή του προκαλεί αιμολυτική αναιμία όταν καταναλώνονται ορισμένες τροφές (π.χ. κουκιά) ή φαρμακευτικές ουσίες (π.χ. ασπιρίνη). Εμφανίζεται συχνότερα στα αγόρια από ότι στα κορίτσια. Στο παρακάτω γενεαλογικό δένδρο απεικονίζεται η κληρονόμηση του γονιδίου G6PDH. Να εξετάσετε τον τρόπο που κληρονομείται το γονίδιο, (αυτοσωμικό ή φυλοσύνδετο, επικρατές ή υπολειπόμενο). Να εξετασθεί η πιθανότητα το κορίτσι III να γεννήσει αργότερα παιδί με την ασθένεια. I 2 II III 2 7. Σε κάποιο είδος εντόμων για να μελετηθεί η κληρονόμηση του χρώματος σώματος έγιναν πειραματικές διασταυρώσεις και προέκυψαν τα ακόλουθα αποτελέσματα στους απογόνους: Άτομα που έχουν: καφέ χρώμα σώματος κίτρινο χρώμα σώματος έδωσαν όλους με καφέ χρώμα με κίτρινες ζώνες. καφέ καφέ χρώμα σώματος με κίτρινες ζώνες έδωσαν ½ καφέ χρώμα σώματος : ½ καφέ χρώμα με κίτρινες ζώνες. καφέ χρώμα σώματος με κίτρινες ζώνες καφέ χρώμα σώματος με κίτρινες ζώνες έδωσαν 2 / καφέ χρώμα σώματος : ¼ καφέ χρώμα με κίτρινες ζώνες : ¼ κίτρινο χρώμα σώματος καφέ χρώμα σώματος κίτρινο χρώμα σώματος έδωσαν ¼ καφέ χρώμα σώματος: ¼ κίτρινο χρώμα σώματος : ¼ καφέ χρώμα σώματος με κίτρινες ζώνες : ¼ μαύρο χρώμα σώματος μαύρο χρώμα σώματος μαύρο χρώμα σώματος έδωσαν όλα μαύρο χρώμα σώματος. Να εξετάσετε σε τι είδους γονίδιο οφείλεται το χρώμα του σώματος αυτών των εντόμων. Να εξετάσετε τον τρόπο κληρονόμησης των γονιδίων αυτών (επικρατές, υπολειπόμενο, ). 8. Αν η σύζυγος είναι φορέας της δρεπανοκυτταρικής αναιμίας και της μερικής αχρωματοψίας και ο σύζυγος είναι φορέας της δρεπανοκυτταρικής αναιμίας και φυσιολογικός στην όραση, η πιθανότητα να γεννηθεί αγόρι που πάσχει από τις δύο ασθένειες είναι: Α. /8 Β. ½ Γ. /2 Δ. /6 ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα /6

4 9. Το γενεαλογικό δέντρο ανθρώπου της παρακάτω εικόνας δείχνει την κατανομή μιας ιδιότητας, που χαρακτηρίζεται με μαύρο σύμβολο, στα συγγενικά άτομα. Να εξετασθεί πως κληρονομείται το αλληλόμορφο για την ιδιότητα αυτή; Αυτοσωμικό ή φυλοσύνδετο, επικρατές ή υπολειπόμενο; Να δικαιολογήσετε την απάντησή σας Δίνεται το γενεαλογικό δένδρο. Η πιθανότητα το φυσιολογικό παιδί II- να είναι κορίτσι και φορέας της ασθένειας είναι: Α. / Β. 2/ Γ. / Δ. / 2. Σε ένα είδος εντόμου το χρώμα των ματιών μπορεί να είναι είτε κόκκινο είτε άσπρο, ενώ το μέγεθος των φτερών είτε φυσιολογικό είτε ατροφικό. Τα παραπάνω χαρακτηριστικά οφείλονται σε γονίδια που εδράζονται σε διαφορετικά χρωμοσώματα. Στο έντομο αυτό, το φύλο καθορίζεται όπως και στον άνθρωπο. Τα γονίδια για το κόκκινο χρώμα ματιών και το φυσιολογικό μέγεθος φτερών είναι επικρατή και το γονίδιο του μεγέθους των φτερών είναι αυτοσωμικό. Από τη διασταύρωση δύο εντόμων προέκυψαν 800 απόγονοι με τις παρακάτω αναλογίες: 50 θηλυκά με φυσιολογικά φτερά και κόκκινα μάτια 50 αρσενικά με φυσιολογικά φτερά και κόκκινα μάτια 50 θηλυκά με φυσιολογικά φτερά και άσπρα μάτια 50 αρσενικά με φυσιολογικά φτερά και άσπρα μάτια 50 θηλυκά με ατροφικά φτερά και κόκκινα μάτια 50 αρσενικά με ατροφικά φτερά και κόκκινα μάτια 50 θηλυκά με ατροφικά φτερά και άσπρα μάτια 50 αρσενικά με ατροφικά φτερά και άσπρα μάτια Α. Να γράψετε τους γονοτύπους των γονέων όσον αφορά το μέγεθος των φτερών. Να αιτιολογήσετε την απάντησή σας. Β. Με βάση τις αναλογίες των απογόνων της συγκεκριμένης διασταύρωσης να διερευνήσετε τους πιθανούς τρόπους κληρονόμησης του χαρακτήρα για το χρώμα των ματιών και να γράψετε τους πιθανούς γονοτύπους των γονέων. Να αιτιολογήσετε την απάντησή σας. 22. Στα κουνέλια το γονίδιο Β ελέγχει το κοντό τρίχωμα και το γονίδιο β το μακρύ. Από τη διασταύρωση θηλυκού κουνελιού με μακρύ τρίχωμα με αρσενικό κουνέλι που φέρει κοντό τρίχωμα παράχθηκαν 8 κουνελάκια, εκ των οποίων 5 κοντότριχα και μακρότριχα. Η διασταύρωση του ίδιου ζευγαριού πολλές φορές έδωσε 00 κουνελάκια. Να εξετάσετε ποια φαινοτυπική αναλογία δικαιολογεί τον τρόπο κληρονόμησης των γονιδίων Β και β. Α. 200 κοντότριχα : 200 μακρότριχα Β. 50 κοντότριχα : 250 μακρότριχα Γ. 00 κοντότριχα : 00 μακρότριχα Δ. 00 κοντότριχα : 00 μακρότριχα 2. Από τη διασταύρωση δύο ατόμων ενός είδους εντόμων γεννήθηκαν 000 αρσενικά και 00 θηλυκά άτομα. Οι μισοί θηλυκοί απόγονοι είχαν μαύρο χρώμα σώματος, ενώ οι άλλοι μισοί ασπρόμαυρο χρώμα. Οι μισοί αρσενικοί απόγονοι είχαν μαύρο χρώμα σώματος, ενώ οι άλλοι μισοί είχαν άσπρο χρώμα. Να εξηγήσετε τον τρόπο κληρονόμησης του χαρακτηριστικού αυτού. Να γράψετε τους γονότυπους των γονέων και να κάνετε τη διασταύρωση. Στα έντομα αυτά θεωρείστε ότι το φύλο καθορίζεται όπως και στον άνθρωπο. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα /6

5 2. Ποιο από τα παρακάτω γενεαλογικά δέντρα απεικονίζει την κληρονόμηση ενός επικρατούς φυλοσύνδετου γνωρίσματος; Αιτιολογείστε την απάντησή σας. 25. Στο γενεαλογικό δέντρο που παρατίθεται μελετάται ο τρόπος κληρονόμησης μιας μονογονιδιακής ασθένειας. Να διερευνήσετε τον τρόπο κληρονόμησης της ασθένειας. Να γράψετε όλες τις πιθανές διασταυρώσεις μεταξύ των ατόμων Ι και Ι2 που οδηγούν στο αποτέλεσμα αυτό. 26. Η μερική αχρωματοψία στο πράσινο και στο κόκκινο ακολουθεί φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας. Είναι λογικό να ισχυριστούμε ότι: Α. Γυναίκα με αχρωματοψία πρέπει να έχει πατέρα με αχρωματοψία. Β. Άντρας με αχρωματοψία πρέπει να έχει μητέρα με αχρωματοψία. Γ. Άντρας με αχρωματοψία πρέπει να έχει παππού με αχρωματοψία. Δ. Γυναίκα με αχρωματοψία πρέπει να έχει γιαγιά με αχρωματοψία. Να αιτιολογήσετε την απάντησή σας. 27. Από δύο γονείς που πάσχουν μόνο από την κληρονομική ασθένεια Ι γεννιέται κορίτσι που δεν πάσχει από την κληρονομική ασθένεια Ι, αλλά πάσχει από την κληρονομική ασθένεια ΙΙ. Να εξηγήσετε τον τρόπο κληρονομικότητας της ασθένειας Ι και τον τρόπο κληρονομικότητας της ασθένειας ΙΙ. Να γράψετε τους γονότυπους των γονέων. Δίνεται ότι τα γονίδια που καθορίζουν τις ασθένειες Ι και ΙΙ βρίσκονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. 28. Ο μη φυσιολογικός γαμέτης για τη δημιουργία του ανευπλοειδικού ατόμου ΧΥΥ προκύπτει από μη διαχωρισμό: Α. των ομόλογων χρωμοσωμάτων στην η μείωση κατά το σχηματισμό του ωαρίου Β. των ομόλογων χρωμοσωμάτων στην η μείωση κατά το σχηματισμό του σπερματοζωαρίου Γ. των αδελφών χρωματίδων στη 2η μείωση κατά το σχηματισμό του ωαρίου Δ. των αδελφών χρωματίδων στη 2η μείωση κατά το σχηματισμό του σπερματοζωαρίου. 29. Μια σιωπηλή μετάλλαξη στο γονίδιο που κωδικοποιεί την β πολυπεπτιδική αλυσίδα της αιμοσφαιρίνης Α: Α. είναι αιτία της εμφάνισης της ασθένειας της δρεπανοκυτταρικής αναιμίας Β. είναι αιτία της εμφάνισης της ασθένειας της αιμορροφιλίας Γ. είναι αιτία της εμφάνισης της ασθένειας της θαλασσαιμίας Δ. δεν μπορεί να προκαλέσει κάποια ασθένεια 0. Το σχήμα παρακάτω απεικονίζει τμήμα DNA προκαρυωτικού κυττάρου στο οποίο υπάρχουν δύο γονίδια το Α και το Β (συμβολίζονται με έντονη γραμμή) και οι θέσεις των υποκινητών τους (συμβολίζονται με διακεκομμένη γραμμή). Κάθε ένα από τα γονίδια αυτά είναι υπεύθυνο για τη σύνθεση πεπτιδικής αλυσίδας. Oι αλληλουχίες των γονιδίων που βρίσκονται στις θέσεις αυτές δίνονται παρακάτω. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 5/6

6 i). Να τοποθετήσετε τα και 5 άκρα στις πολυνουκλεοτιδικές αλυσίδες. ii). Ποιος είναι ο μη κωδικός κλώνος για το γονίδιο Α και το γονίδιο Β; iii). Σε ένα από τα δύο γονίδια γίνεται μετάλλαξη και συγκεκριμένα αντικατάσταση βάσης, αποτέλεσμα της οποίας είναι η αδυναμία σχηματισμού συμπλόκου έναρξης μετάφρασης και τελικά σύνθεση πεπτιδικής αλυσίδας. Η μετάλλαξη έγινε στην: Α. 7 η βάση του γονιδίου Α Β. 2 η βάση του γονιδίου Α Γ. 7 η βάση του γονιδίου Β Δ. 5 η βάση του γονιδίου Β. Δίνεται το παρακάτω τμήμα μορίου DNA που κωδικοποιεί ένα ολιγοπεπτίδιο. Να γράψετε τα κωδικόνια του DNA που κωδικοποιούν το πεπτίδιο αυτό. Α. Μετά την επίδραση ακτινοβολίας το παραπάνω τμήμα DNA σπάει στα σημεία που υποδεικνύονται από τα βέλη. Να γράψετε το τμήμα του DNA που αποκόπηκε και να σημειώσετε τον προσανατολισμό του. Β. Το τμήμα του DNA που αποκόπηκε, επανασυνδέεται στα ίδια σημεία κοπής μετά από αναστροφή. Να γράψετε ολόκληρο το μόριο του DNA που προκύπτει μετά την αναστροφή. Να αιτιολογήσετε την απάντησή σας. Να γράψετε τα κωδικόνια του μορίου DNA που κωδικοποιούν το νέο πεπτίδιο. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 6/6

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 5 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Ο Mendel καλλιέργησε 28.000 φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας Λόγοι επιτυχίας των πειραμάτων του Mendel 1. Μελέτησε μία ή δύο

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ Λ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ : 09/09/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από δύο

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 2001 ΗΜΕΡΗΣΙΟ 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα


ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 5.1. Σε ποια στοιχεία οφείλεται η επιτυχία των πειραμάτων του Mendel; 5.2. Τι είναι ο γονότυπος ; Πως μπορούμε να βρούμε το γονότυπο

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α. Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση.

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α. Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση. ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση. 1. Έχοντας στη διάθεσή μας στο εργαστήριο αμιγή στελέχη για ένα συγκεκριμένο χαρακτηριστικό

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα


Κεφάλαιο 5: ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Κεφάλαιο 5: ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ -ΘΕΩΡΙΑ- Κληρονομικότητα: Η ιδιότητα των ατόμων να μοιάζουν με τους προγόνους τους. Κληρονομικοί χαρακτήρες: Οι ιδιότητες που κληρονομούνται στους απογόνους. Γενετική:

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ. Βιολογία Κατεύθυνσης Γ Λυκείου Ασκήσεις 5 ου Κεφαλαίου

ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ. Βιολογία Κατεύθυνσης Γ Λυκείου Ασκήσεις 5 ου Κεφαλαίου ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ 1) Από την διασταύρωση ταύρου χωρίς κέρατα α) με αγελάδα που έχει κέρατα, γεννήθηκε μοσχάρι χωρίς κέρατα, β) επίσης με αγελάδα που έχει κέρατα, γεννήθηκε μοσχάρι με κέρατα γ) με αγελάδα

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα Κεφάλαιο 5: Μενδελική Κληρονομικότητα ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Ο Mendel. α. εξέταζε σε κάθε πείραμά του το σύνολο των ιδιοτήτων του μοσχομπίζελου β. χρησιμοποιούσε αμιγή στελέχη στις ιδιότητες που μελετούσε

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α : Α1. δ, Α2. γ, Α3. β, Α4. β, Α5. β Θέμα Β : Β1. Σελ.123 η παράγραφος με τίτλο «Ανοσοδιαγνωστικά» Β2. α-8, β-1, γ-6, δ-5, ε-7, στ-3 Β3. Σελ. 84

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Παραδόσεις του μαθήματος

Βιολογία Θετικής Κατεύθυνσης. Παραδόσεις του μαθήματος Βιολογία Θετικής Κατεύθυνσης Παραδόσεις του μαθήματος Κεφάλαιο 5ο ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Επιλογή του πειραματικού του υλικού Χρήση του μοσχομπίζελου το οποίο αναπτύσσεται γρήγορα, εμφανίζει ποικιλότητα

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού Γ Λυκείου

Βιολογία Προσανατολισμού Γ Λυκείου Μάθημα/Τάξη: Κεφάλαιο: Βιολογία Προσανατολισμού Γ Λυκείου Το γενετικό υλικό (Κεφ.1), Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας (Κεφ.2), Τεχνολογία του Ανασυνδυασμένου DNA (Κεφ.4), Μενδελική

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο.

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. Μια γυναίκα της οποίας ο πατέρας έπασχε από γαλακτοζαιμία θέλει να

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 29/12/2016 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 29/12/2016 ΘΕΜΑ 1 ο 1. α 2. β 3. γ 4. γ 5. δ ΘΕΜΑ 2ο Β1. Σημειώστε κάθε πρόταση με Σωστό ή Λάθος παραθέτοντας μια σύντομη δικαιολόγηση

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες

5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες 5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες Ποιος είναι ο σκοπός της αναπαραγωγής ; Η δημιουργία απογόνων

Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 5/2/2012 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. (10 µόρια)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 5/2/2012 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. (10 µόρια) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 5/2/2012 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΧΟΛΙΟ: Τα θέματα είναι πολύ εύκολα και αναμένονται ιδιαίτερα υψηλές βαθμολογίες από τους σωστά προετοιμασμένους υποψηφίους. ΘΕΜΑ Α Α1. δ Α2. β Α3. α Α4.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 09/09/07 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τ φράσ που συμπλρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:. Από δύο φορείς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2010 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2010 ΘΕΜΑ Α 1. δ 2. β 3. α 4. β 5. γ ΘΕΜΑ Β 1. Σελ. 17 σχολ. Βιβλίου: Το γενετικό υλικό ενός κυττάρου αποτελεί το γονιδίωμά του όπως είναι τα

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ.

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. Απαντήσεις: βιολογια κατευθυνσης 24/02/2013 ΘΕΜΑ 1 ο Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. ΘΕΜΑ 2 ο Α. Σελ 69 σχολικού βιβλίου: «Το μοσχομπίζελο έχει πολλά πλεονεκτήματα... έως και σελ 70 σχολικού..των αποτελεσμάτων».

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα