Transcript

1 Journal of Ningxia Medical University min d 35d PCNA d 25d RT - PCR GDNF SCF 12d 18d 22% 75% P < % 25d GDNF mrna 4h 15d P < SCF mrna 4h 10 P < GDNF SCF R A 2 ~ min PCNA RT - PCR 28d 2 GDNF SCF min 4d 15d 68d min ~ 32 4 Rockett h min 23 ~ 28d 5 12h TUNEL 1 ml kg - 1 4h 6 24h II min 7 glial cell derived neu- rotrophic factor GDNF stem cell factor 8 - SCF NZ E - mail tianjh@cau. edu. cn 1. 3 PCNA d 6 4% 4 48h 2% ZLI min

2 PCNA Santa Cruz 4h 2d 10d 15d 20d 25d Biotechnology FL RNA TRITC ZF DNA 2h PBS Hoechst GenBank β - actin GDNF SCF cdna Oligo cdna PCR 1. 4 RT - PCR GDNF SCF β - actin F TGAAGATTATCCTGACCAGTTTG R GTCAGATACATCCACACCGTTTAG F ATAGTGGATGACCTCGTGTTATG R ACCTAATGTTGAAGAGAGCACAC F TTGTAACCAACTTGGGACGATATGG - 3' R GATCTTGATCTTCATGGTGCTAGG - 3' RT - PCR /bps r / 241 AF AF NM_ GDNF SCF SPSS 4h 2d 10d GDNF mrna P one - way ANOVA P < < d GDNF mrna h 3 2 1d 2d 10d SCF mrna P < d 20d SCF mrna 12d P < d 18d SCF mrna GDNF 21. 6% 74. 8% % P SCF < P < d 25d GDNF mrna CON a b c d CON a b c d A B C D E GDNF SCF P < GDNF SCF mrna P < ~ GDNF SCFmRNA

3 Danno S Itoh K Matsuda T Fujita J. Decreased expression of mouse Rbm3 a cold - shock protein in Sertoli cells of cryptorchid testis J. Am J Pathol A B A 2 Jannes P Spiessens C Van der Auwera I et al. Male A simgle subfertility induced by acute scrotal heating affects embryo quality in normal female mice J. Hum Reprod A 12 s Setchell BP Ekpe G Zupp JL et al. Transient retardation in embryo growth in normal female mice made PCNA pregnant by males whose testes had been heated J. 65d Hum Reprod Setchell BP D'Occhio MJ Hall MJ et al. Is embryonic mortality increased in normal female rats mated to subfertile males J. J Reprod Fertil niche GDNF 5 Rockett JC Mapp FL Garges JB et al. Effects of hyperthermia on spermatogenesis apoptosis gene expres- SCF a 1 Glial cell line sion and fertility in adult male mice J. Biol Reprod derived neurotrophic factor family receptor alpha GFRa1 GDNF 6 Zhang Y Yang X Cao H et al. Heat stress induces SC- Cdc2 protein decrease prior to mouse spermatogenic cell FR or C - Kit SCF apoptosis J. Acta Histochem Schmidt JA Avarbock MR Tobias JW et al. Identification of glial cell line - derived neurotrophic factor - 38 GFRa1 C - Kit 22 regulated genes important for spermatogonial stem cell self - renewal in the rat J. Biol Reprod Unni SK Modi DN Pathak SG et al. Stage - specific 24 localization and expression of c - kit in the adult human GDNF SCF testis J. J Histochem Cytochem GDNF SCF 9 de Rooij DG. The spermatogonial stem cell niche J. Microsc Res Tech Weise JM Gunes C. Differential regulation of human and mouse telomerase reverse transcriptase TERT promoter activity during testis development J. Mol Reprod Dev Lue YH Hikim AP Swerdloff RS et al. Single exposure to heat induces stage - specific germ cell apoptosis in rats role of intratesticular testosterone on stage specificity J. Endocrinology GDNF SCF mrna de Rooij DG Stem cells in the testis J. Int J Exp Pathol

4 Naughton CK Jain S Strickland AM et al. Glial cell - line derived neurotrophic factor - mediated RET signaling regulates spermatogonial stem cell fate J. Biol Reprod Chowdhury AK Steinberger E. A Quantitative Study of the Effect of Heat on Germinal Epithelium of Rat Testes J. Am J Anat Zhang XS Zhang ZH Jin X et al. Dedifferentiation of adult monkey Sertoli cells through activation of extracellularly regulated kinase 1 /2 induced by heat treatment J. Endocrinology Kubota H Avarbock MR Brinster RL. Culture conditions and single growth factors affect fate determination of mouse spermatogonial stem cells J. Biol Reprod Kubota H Avarbock MR Brinster RL. Growth factors essential for self - renewal and expansion of mouse spermatogonial stem cells J. Proc Natl Acad Sci USA Tadokoro Y Yomogida K Ohta H et al. Homeostatic regulation of germinal stem cell proliferation by the GDNF /FSH pathway J. Mech Dev Yomogida K Yagura Y Tadokoro Y et al. Dramatic expansion of germinal stem cells by ectopically expressed human glial cell line - derived neurotrophic factor in mouse Sertoli cells J. Biol Reprod Creemers LB Meng X den Ouden K et al. Transplantation of germ cells from glial cell line - derived neurotrophic factor - overexpressing mice to host testes depleted of endogenous spermatogenesis by fractionated irradiation J. Biol Reprod Meng X Lindahl M Hyvonen ME et al. Regulation of cell fate decision of undifferentiated spermatogonia by GDNF J. Science Hofmann MC Braydich - Stolle L Dym M. Isolation of male germ - line stem cells influence of GDNF J. Dev Biol Viglietto G Dolci S Bruni P et al. Glial cell line - derived neutrotrophic factor and neurturin can act as paracrine growth factors stimulating DNA synthesis of Ret - expressing spermatogonia J. Int J Oncol Ohta H Yomogida K Dohmae K et al. Regulation of proliferation and differentiation in spermatogonial stem cells the role of c - kit and its ligand SCF J. Development Effect of Heat Shock Treatment on Proliferation of Spermatogonia MA Wen - zhi 1 2 WANG Yan - rong 1 TIAN Jian - hui 2 1. Key Laboratory of Fertility Preservation and Maintenance of Ministry of Education and Key Laboratory of Reproduction and Heredity of Ningxia Hui Autonomous Region School of Basic Medicine Scientific Ningxia Medical University Yinchuan Ningxia Hui Autonomous Region P. R. Yinchuan Key Laboratory of Animal Genetics and Breeding of the Ministry of Agriculture China Agricultural University Beijing Abstract Objective To understand the effect of heat shock on mouse spermatogonia proliferation and to explore the mechanism of male short - term infertility caused by high - temperature. Methods Eight - week - old male KM mice were treated with 43 heat shock for 15 minutes. Spermatogonia proliferation and GDNF and SCF gene expression was detected by PCNA immunofluorescence staining at the d and 35d after heat shock - treatment and by RT - PCR at the 4h 2d 10d 15d 20d and 25d after heat shock - treatment respectively. Results At the 12 th and 18 th day after heat - shock treatment spermatogonia proliferation index were 22% and 75% which were significantly lower P < than 93% in the control group. At the 25 th day after heat - shock treatment the proliferation levels returned to normal levels. The expression levels of stem cell proliferation promoting regulatory factor GDNF in spermatogonial stem - cell micro - environment significantly P < down - regulated during the 4 th h to 15 th day after shock treatment Stem cell differentiation regulatory factor SCF expression levels was significantly P < down - regulated at the 4 th h to 10 th days after heat shock treatment. Conclusion The expression of GDNF and SCF genes significantly reduced shortly after heat shock treatment and permatogonia proliferation was inhibited. Key words heat shock spermatogonia proliferation niche

5