Effects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro

HTML
DOWNLOAD

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "Effects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro"

Ζηναις Διδασκάλου
8 χρόνια πριν
Προβολές:

1 32 2 Vol 32 No Journal of South-Central University for NationalitiesNat Sci Edition Jun * CGA MC3T3-E1 MTT μmol /L CGA ALP PCR ~ 88 19μmol /L CGA 2 d μmol /L CGA ALP μmol /L CGA ALP Runx2 Osterix c-jun c-fos 6 d μmol /L CGA c-fos I Col-I CGA Q813 1Q786 A Effects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro Wang Chaoyuan 1 Yi Jiling 1 Song Chao 1 Wei Tiantian 1 Tang Junlong 1 Yang Guangzhong 2* 1 College of Life ScienceSouth-central University for NationalitiesWuhan China 2 College of PharmacySouth-central University for NationalitiesWuhan China Abstract To investigate the effect of chlorogenic acid CGA one of the components of Sambucus chinensison the osteogenic activity of cultured osteoblastsosteoblasts were treated with μmol /L CGA respectively MTT assayalkaline phosphatealpkitreal-time PCR were used to measure the proliferation ratealp activity and expression of bone-related genes in osteoblasts The results showed that ~ μmol /L CGA could promote the proliferation rate remarkably The activity of ALP in osteoblasts was up-regulated when treated with 44 09μmol / L CGA for 2 d The expression of bone-related genes such as ALP Runx2 Osterix c-jun and c-fos could be enhanced when treated with μmol /L CGA for 2 d The expression of c-fos could be promoted when treated with μmol /L CGA for 6 days In the whole process the expression of Col-I was increased in a time-dependent and concentration-dependent manner ThereforeCGA showed osteogenic activity which demonstrated that it was one of the osteogenic active ingredients of Sambucus chinensis Keywords chlorogenic acidosteoblastsalp activitybone differentiation related genes Sambucus chinensis * com wangchaoyuan@ mail scuec edu cn 2009CDZ033 3 chlorogenic acid CGA 4 5 CGA 1 2

2 ~ 4d 1 MC3T3-E1 CGA 90% 0 25% ALP CGA CGASIGMA-ALDRICH α-mem CO 2 4 h Thermo 150 μl DMSO % Thermo 10 min Thermo DMSO Amresco 0231 MTT Amerro 1 5 CGA BCA MC3T3-E / Thermo SYBR Green % CO 2 TOYOBO Corning Corning CO d HF90 /240 ALP BCA Motic AE21 ALP MULTISKAN ASCENT 354 thermo PCR 1 6 CGA Biometra JS-380A PCR ABI 7500 fast 1 2 CGA 0 05g CGA 50 ml α-mem MC3T3-E1 MC3T3-E1 10% α-mem MC3T3-E / % CO 2 CGA d 20 μl MTT 37 5% 492nm OD μmol /L MC3T3-E / % CO 2 1 mg /ml 246 d Trizol 10% α-mem CGA RNA cdna real-time μmol /L PCR 95 15s60 15s72 45s40 Tab 1 1 GAPDH 3 2 ΔΔCt 9 PCR 1 PCR Primer sequences of real-time PCR 5'-3' 5'-3' 3- GAPDH AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA c-fos CCAGTCAAGAGCATCAGCAA AAGTAGTGCAGCCCGGAGTA c-jun TCCCCTATCGACATGGAGTC TGAGTTGGCACCCACTGTTA Runx2 TCACTACCAGCCACCGAGAC ACGCCATAGTCCCTCCTTTT Osterix ATGGCGTCCTCTCTGCTTGAG AGGACTGCCTGCAGGAGAGAG ALP GCTGATCATTCCCACGTTTT CTGGGCCTGGTAGTTGTTGT I Col-I ACGTCCTGGTGAAGTTGGTC CAGGGAAGCCTCTTTCTCCT 1 7 F = 2 Ct- Ct- Ct- Ct one-way ANOVA

3 CGA P < d μmol /L CGA CGA c-fos P < CGA ~ 88 19μmol /L μmol /L 3 2d 2 CGA c-fos P < d μmol /L CGA c-fos 1control2 ~ μmol /L CGA 1 Fig 1 ** P < 0 01 n = 3 CGA Effect of different concentrations of CGA on the proliferation of osteolasts 2 2 CGA ALP CGA ALP 2 c-jun P < d μmol /L CGA ~ 6 d P < 0 01 CGA MC3T3-E1ALP P < 0 01 c-jun 4 d CGA MC3T3-E1ALP P > d μmol /L CGA ALP P < control μmol /L CGA μmol /L CGA Fig 3 * P < 0 05 ** P < 0 01 n = 3 3 CGA c-fos Effect of CGA on c-fos expression of osteoblasts CGA c-jun μmol /L CGA 2 ~ 4 d c-jun P > d P < μmol /L CGA 2 d 1control μmol /L CGA μmol /L CGA Fig 2 * P < 0 05 ** P < 0 01 n = 3 2 Effect of chlorogenic acid on ALP activity of osteoblasts 1control μmol /L CGA μmol /L CGA * P < 0 05 ** P < 0 01 n = 3 Runx2 P < CGA mrna P < 0 01 P > 0 01 CGA c-fos mrna 3 Fig 4 4 CGA c-jun Effect of CGA on c-jun expression of osteoblasts CGA Runx μmol /L CGA 2 ~ 4d Runx2 P < d P < μmol /L CGA 2d

4 2 49 1control μmol /L CGA μmol /L CGA Fig 5 * P < 0 05 ** P < 0 01 n = 3 5 CGA Runx2 Effect of CGA on Runx2 expression of osteoblasts 6 CGA osterix CGA 2 d Osterix P < ~ 6 d CGA osterix P < control μmol /L CGA μmol /L CGA Fig 7 * P < 0 05**P < 0 01 n = 3 7 CGA ALP Effect of CGA on the ALP expression of osteoblasts 1control μmol /L CGA μmol /L CGA Fig 6 * P < 0 05 ** P < 0 01 n = 3 6 CGA Osterix Effect of CGA on Osterix expression of osteoblasts CGA 7 CGA ALP ~ μmol /L CGA osterix 2 d 2 CGA ALP P < μmol /L CGA ~ 6 d 2 CGA ALP CGA P < 0 05 ALP 8 CGA Col-I CGA Osterix ALP 11 CGA ALP CGA Col-I 2 ~ 6 d μmol /L μmol /L CGA ALP CGA Col-I P < μmol /L CGA ALP μmol /L CGA Col-I CGA ALP P < 0 05 P < control μmol /L CGA μmol /L CGA Fig 8 * P < 0 05 ** P < 0 01 n = CGA Col-I Effect of CGA on Col-I expression of osteoblasts MC3T3-E1 C57BL /6 I 10 MC3T3-E1 2 ~ 6 d CGA ALP mrna

5 50 32 Runx2 J Runx J Osterix 5 Osterix J Runx2 6Hai-Tao Lu Application of preparative high-speed countercounter chromatography for separation of chlorogenic acid Osterix from Flos Loncease J J Chromatogr A / I 13 CGA Runx2 Osterix Runx2 Osterix mrna J CGA 8 J Livak K JSchmittgen T D Analysis of relative gene expression data using real-time quantitative PCR and the CGA Col-I 2 -ΔΔT method J Methods I 10 Sudo HKodama HAmagai Yet al In vitro 14 differentiation and calcification in a new clone 2 d 22 05μmol /LCGA osteogenic cell line derived from newborn mouse Col-I P < calvaria J J Cell Biol ~ 6 d CGA Col-I 11Effenberger K E Johnsen S A Monroe D Get al CGA Regulation of osteoblastic phenotype and gene expression by hop-derived phytoestrogensj J Steroid Biochem Mol Biol c-fos c-jun 12 Ducy PStarbuck MPriemel Met a1 A Cbfaldependent genetic pathway controls bone formation -1AP-1 beyond embryonic development J Genes Dev 15 c-jun I 13Ohyama YNifuji AMaeda Yet al Spacioternporal 16 c-jun association and bone morphogenetic protein regulation of CGA c-fos c-jun sclerostin and osterix expression during embryonic osteogenesis J Endocrinology CGA CGA 14Raisz L G Fall P M Gabbitas B Y et al Effects of prostaglandine2 on bone formation in cultured fetal rat ALP CGA calvariae roleofinsulin-like growth factor-i J I Endocrinology CGA 15 c-fos J J Palcy SBolivar IGoltzman D Role of activator protein 1 transcriptional activity in the regulation of 2 J osteoblast-like cells J J Bone Miner Res gene expression by transforming growth factor beta1 and bone morphogenetic protein 2 in ROS17 /2 8

Σχετικά έγγραφα

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology 2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing